Method of protecting winter cereals from root rot and dwarf leaf rust

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly to protection of plants from disease causative agents. The method involves treating seeds with a mixture consisting of a fungicidal strain of Pseudomonas fluorescens 17-1, which is deposited at the Scientific Research Institute Of Mechanisation Of Agriculture Of The Russian Academy Of Agricultural Sciences of agricultural microbiology under No.622D and a growth-stimulating strain of Sphingobacterium spiritivorum 38-22, which is deposited at the Scientific Research Institute Of Mechanisation Of Agriculture Of The Russian Academy Of Agricultural Sciences of agricultural microbiology under No.620D and a fungicide Vintsit in ratio 1:1:0.5, wherein the fungicide Vintsit is used in amount of 150 ml per hectare standard of seeds.

EFFECT: invention increases efficiency of protecting plants from root rot and dwarf leaf rust.

1 tbl, 3 ex

 

The invention relates to agriculture, in particular to the protection of plants from pathogens.

There is a method in which microorganisms used fungicide mixed with humic fertilizers (patent No. 2130264 published 20.95.1999. IPC 01N 63/00).

The known method is not effective enough, because using a composition of numerous cells of microorganisms.

The closest technical solution is the way in which they prepare the strains on the particular environment and the resulting biomass is mixed with humic fertilizer "Darina" (patent 2291620 published 20.01.2007).

The disadvantage of the prototype method is that the preparation of strains spent 12-16 hours, which reduces the efficiency of the method.

Technical result - increase the efficiency of the method and the expansion of the range of fungicidal and plant growth strains.

The technical solution of the stated object is achieved by the fact that the seeds before sowing is treated with a mixture of two strains 17-1 and 38-22 with title 3...6×109CFU/ml each and fungicide Vincit in the ratio of 1:1:0,5.

The method is as follows.

Strain 38-22 Sphingobacterium spiritivorum deposited in the collection of epiphytic microorganisms GNU VNII C. agricultural Microbiology under the number "ARRIAM D". He is characterized as a growth-stimulating, AK is actively producing IAA. Highly effective when seeds inoculation and treatment of vegetating plants grain and forage crops.

Strain 17-1 Pseudomonas fluorescens deposited in the collection of epiphytic microorganisms GNU VNII C. agricultural Microbiology under the number "VNIIM D". He is characterized as a growth stimulating possessing antifungal activity against phytopathogenic fungi. Highly effective when seeds inoculation and treatment of vegetating plants crops.

Vincit - suspension concentrate fungicide used on crops for seed with moisture before sowing or in advance.

Drug Vincit is made to enhance the effects of strains 17-1 38-22 against diseases. Given that the strain 17-1 also fungicidal action, Vincit make half dose of the preparation used. This takes into account that when you make a full dose of a mixture of drugs to be toxic to soil microorganisms. In addition, the high (full) dose of Vincita toxic for insertion strains.

Example 1. For sowing winter wheat varieties Victory-60 1-hectare cooked seeds that were treated with a mixture of strains fungicide 17-1 and growth stimulating 38-22 at a rate of 300 ml of concentrated suspensions each. Suspension of strains was dissolved in water in the amount of 2.5 HP To the resulting solution was added 150 ml Fung is CIDA Vincit. The mixture was treated hectare seed rate (200 kg).

Example 2. For sowing of winter barley varieties Michael, with an area of 1 ha was prepared seeds that were treated with a mixture of strains fungicide 17-1 and growth stimulating 38-22 based on 200 ml of cell suspension each. Suspension of strains was dissolved in water in the amount of 2.5 HP To the resulting solution were added 100 ml of fungicide Vincit. The mixture was treated hectare seed rate.

Example 3. For sowing of winter barley varieties Michael, with an area of 1 ha was prepared seeds that were treated with a mixture of strains fungicide 17-1 and growth stimulating 38-22 at the rate of 400 ml of cell suspension each. Suspension of strains was dissolved in water in the amount of 2.5 HP To the resulting solution were added 200 ml of fungicide Vincit. The mixture was treated hectare seed rate.

The results of the experiments are summarized in table.

The influence of the method of pre-sowing seed treatment on diseases of winter grain crops (% of plants)
No.Options experienceRoot rotDwarf rust
about the ima wheat winter barleywinter wheatwinter barley
1.Control (without treatment)60,257,374,268,1
2.Strain 17-112,611,243,842,7
3.Strain 38-2214,5a 12.745,9to 45.4
4.Vincit (300 ml/ha)6,15,935,032,0
5.A mixture of strains (17-1+38-22) in 300 ml10,69.540,139,4
6.A mixture of strains (17-1+3 8-22) in 200 ml+Vincit (100 ml)5,0the 4.724,3 23,0
7.A mixture of strains (17-1+38-22) in 300 ml+Vincit (150 ml) the proposed method3,73,518,0the 17.3
8.A mixture of strains (17-1+38-22) in 400 ml+Vincit (200 ml)5,8of 5.428,127,5

The proposed method reduces the incidence of root rot in winter wheat and winter barley to 3.7%and 3.5%, which is 2.4% less than in the application Vincita and 6-6,9% less than when using a mixture of strains. The incidence of dwarf rust fell on winter wheat and winter barley to 18.0 and 17.3%, respectively, 17 and 14.7% less than when using a fungicide Vincit and 22.1% less than when using a mixture of strains.

Thus, the proposed method improves the efficiency of the method and the disease resistance of winter crops, expands the range of fungicidal and plant growth of microorganisms.

The way to protect winter crops from root rot and dwarf rust comprising applying strain fungicide seed treatment before sowing, characterized in that the seed is treated with a mixture of status is the present of fungicidal strain Pseudomonas fluorescens 17-1 ARRIAM D, growth stimulating strain Sphingobacterium spiritivorum 38-22 ARRIAM D and fungicide Vincit in the ratio of 1:1:0,5, and the fungicide Vincit used in the amount of 150 ml per hectare seed rate.



 

Same patents:

FIELD: medicine.

SUBSTANCE: what is produced is the yeast strain Saccharomyces cerevisiae able to produce secreted human somatotropin. Said strain contains a promoter contolled DNA sequence coding mature human somatotropin fused with a leader peptide in the same reading frame. The leader peptide includes a double pro-site of α-factor of yeast Saccharomyces cerevisiae. It also can contain a triple pro-site of α-factor of yeast Saccharomyces cerevisiae, or a double pro-site of HSP150 protein of yeast Saccharomyces cerevisiae, or a combination of said pro-sites. A method for producing human somatotropin provides cultivation of the human somatotropin producer strain.

EFFECT: use of the invention provides higher end product yield.

2 cl, 1 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains enzyme cattle erythromass hydrolyzate containing 0.10-0.14% of amine nitrogen, potassium monophosphate, 3-aqueous disubstituted potassium phosphate, activated carbon, 7-aqueous ferrous sulphate, L-cysteine hydrochloride, microbiological agar and distilled water in the preset proportions.

EFFECT: invention allows reducing time for legionella cultivation.

3 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains enzyme sprat hydrolyzate containing 0.10-0.14% of amine nitrogen, potassium monophosphate, 3-aqueous disubstituted potassium phosphate, 7-aqueous ferrous sulphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water in the preset proportions.

EFFECT: invention provides higher biomass yield and reduced time of legionella cultivation.

3 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains enzyme yolk hydrolyzate containing 0.10-0.14% of amine nitrogen, potassium monophosphate, 3-aqueous disubstituted potassium phosphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water in the preset proportions.

EFFECT: invention allows reducing time for legionella cultivation.

3 ex

FIELD: medicine.

SUBSTANCE: group of inventions refers to biotechnology and biochemistry. The serotype 3 Streptococcus pneumoniae polysaccharides are purified from protein impurities. According to the first version of the method, the Streptococcus pneumoniae cell lysate is heated to 60°C for 30 min for protein aggregation and deposition. The deposited substances are separated by filtration through membrane and depth filter of the pore diameter of 0.45 mcm and centrifuged to produce the purified lysate. According to the second version of the method, the pH value of the lysate or the centrifugate is increased to 8.0 to 8.4 and filtered. According to the third version of the method, the Streptococcus pneumoniae cell lysate is heated to 60°C - 70°C for 30 - 50 min. It is followed by lysate centrifugation and increase of the pH value to 8.0 - 8.4, and filtration. According to the fourth version of the method, the pH value is decreased to 3.0 - 5.0 and heated to 60°C - 70°C for 30 - 50 min. It is followed by centrifugation and increase of the pH value of the lysate and the centrifugation to 8.4, and filtration.

EFFECT: group of the inventions provides producing lysates and concentrates containing purified serotype 3 polysaccharide.

20 cl, 2 tbl, 2 ex, 8 dwg

FIELD: medicine.

SUBSTANCE: set contains one base pair showing activity of upstream and downstream primers, and a probe having the following structure: 5' CAAGNACTTCTGTTNCCCCGGACYGA 3'; 5' ATNTNTC AATTGTCANCATAAGC AGCC A 3'; F AM -5' CCTYCGGCNCCTGAYTGCGGCTAATCC 3'-BHQ1.

EFFECT: invention enables high-accuracy identification of the genetic material of human enteroviruses A, B, C, D.

4 dwg, 1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry and a method of producing comenic acid. The method is characterised by that it involves fermentation of the Gluconobacter oxydans-03 strain in a medium containing glucose - 35.0 g/l, yeast extract - 1.17 g/l, disubstituted ammonium phosphate - 0.619·10-3 g/l, monosubstituted potassium phosphate - 0.12·10-3 g/l, at temperature 28°C with forced aeration by 1.5-2.0 volume of air per 1 volume of medium per minute for 66-78 hours until obtaining gluconic acids: gluconic, 2-keto-gluconic, 5-keto-gluconic, 2,5-diketo-gluconic; Gluconobacter oxydans-03 cells are deposited by heating the culture fluid to 80-85°C for 0.5 hours in the presence of bentonite until formation of a residue; the supernatant fluid is filtered; the obtained filtrate which contains comenic acid and gluconic acids is deposited on anionite AV-17-8 chS, while adding sodium bicarbonate to obtain sodium salts of comenic acid and gluconic acids; 17-19% hydrochloric acid solution is added to form a residue containing comenic and gluconic acids; comenic acid is separated from gluconic acids by washing the residue with iced water or iced water-alcohol solution with water to alcohol ratio of 3:1, wherein 10 ml of the solution per 1 g of residue is used.

EFFECT: invention enables to obtain high-purity comenic acid.

6 ex

FIELD: medicine.

SUBSTANCE: method provides grinding a pathological biomaterial to be homogenated to prepare a suspensions. The prepared suspension is added with 3-5% citric acid at the basis of its content in the suspension. It is kept for 20-30 minutes at 10-20°C and added with 3-4% succinic acid and kept for 20-30 minutes at 10-20°C that is followed by neutrilising the suspension with 5-10% ammonium and reducing to pH 7.5-7.6. The neutrilised suspention is settled for 20-30 minutes; a supernatant is rinsed, and the precipitation is inoculated with a nutrient medium containing in 1 l of distilled water citric acid 8.0 g, ammonium citrate 2.0 g, succinic acid 3.0 g, asparagine or glycine 2.0 g, di-basic potassium phosphate 5.0 g, magnesium sulphate 0.5 g, zinc sulphate 0.3 g, di-basic sodium phosphate 3.0 g, sodium chloride 5.0-6.0 g, ferrous sulphate 0.1 g and glycerin 40-50 ml at pH 7.5-7.6. To produce the solid agar medium, the fluid medium diluted in distilled water 1:1 is added with agar 2.5 g per the fluid medium 100 ml, and sodium chloride is reduced to 5-6%.

EFFECT: invention allows reducing staphylococcus recovery time.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: technique involves DNA recovery from the biomaterial and real-time polymerase chain reaction with using probes marked by fluorescent dyes and fluorescence extinguishers. It involves preparing two reaction mixtures one of which contains the primers atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc and the probe FAM-cgttcggctc ggcatctcga tattccc-BHQ1, while the other one contains the primers ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca and the probe Joe-gtatccggct atgcgccgag tttgg BHQ1. The polymerase chain reaction is real-time at primer annealing temperature 55-62C in 30-45 cycles with continuous fluorescence control, its increment observing in one or more reaction mixtures enables diagnosing the presence of agrobacteria in the samples.

EFFECT: invention enables extending the range of genotypes of the diagnosed agrobacteria.

5 cl, 7 dwg, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention discloses a method for preparing a major protective antigen of a cholera vibrio of cholera toxin B subunit. The method involves deposition of a protein fraction from filtered broth culture of the recombinant strain other than 01 serogroup Vibrio cholerae KM93 (State Collection 'Microbe'). The deposited protein fraction is used to recover the B subunit to be purified by three-step column TSK HW-60 gel penetration chromatography. The purified preparation of the B subunit is applicable for producing anti-toxin serums, high-specific immunoglobulin and diagnostic test systems, as well as an ingredient of vaccine preparations.

EFFECT: use of the invention enables higher yield of the high-purity native immunogenic preparation of the cholera toxin B subunit.

2 dwg, 1 tbl

FIELD: medicine.

SUBSTANCE: what is produced is the yeast strain Saccharomyces cerevisiae able to produce secreted human somatotropin. Said strain contains a promoter contolled DNA sequence coding mature human somatotropin fused with a leader peptide in the same reading frame. The leader peptide includes a double pro-site of α-factor of yeast Saccharomyces cerevisiae. It also can contain a triple pro-site of α-factor of yeast Saccharomyces cerevisiae, or a double pro-site of HSP150 protein of yeast Saccharomyces cerevisiae, or a combination of said pro-sites. A method for producing human somatotropin provides cultivation of the human somatotropin producer strain.

EFFECT: use of the invention provides higher end product yield.

2 cl, 1 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains enzyme cattle erythromass hydrolyzate containing 0.10-0.14% of amine nitrogen, potassium monophosphate, 3-aqueous disubstituted potassium phosphate, activated carbon, 7-aqueous ferrous sulphate, L-cysteine hydrochloride, microbiological agar and distilled water in the preset proportions.

EFFECT: invention allows reducing time for legionella cultivation.

3 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains enzyme sprat hydrolyzate containing 0.10-0.14% of amine nitrogen, potassium monophosphate, 3-aqueous disubstituted potassium phosphate, 7-aqueous ferrous sulphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water in the preset proportions.

EFFECT: invention provides higher biomass yield and reduced time of legionella cultivation.

3 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains enzyme yolk hydrolyzate containing 0.10-0.14% of amine nitrogen, potassium monophosphate, 3-aqueous disubstituted potassium phosphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water in the preset proportions.

EFFECT: invention allows reducing time for legionella cultivation.

3 ex

FIELD: medicine.

SUBSTANCE: group of inventions refers to biotechnology and biochemistry. The serotype 3 Streptococcus pneumoniae polysaccharides are purified from protein impurities. According to the first version of the method, the Streptococcus pneumoniae cell lysate is heated to 60°C for 30 min for protein aggregation and deposition. The deposited substances are separated by filtration through membrane and depth filter of the pore diameter of 0.45 mcm and centrifuged to produce the purified lysate. According to the second version of the method, the pH value of the lysate or the centrifugate is increased to 8.0 to 8.4 and filtered. According to the third version of the method, the Streptococcus pneumoniae cell lysate is heated to 60°C - 70°C for 30 - 50 min. It is followed by lysate centrifugation and increase of the pH value to 8.0 - 8.4, and filtration. According to the fourth version of the method, the pH value is decreased to 3.0 - 5.0 and heated to 60°C - 70°C for 30 - 50 min. It is followed by centrifugation and increase of the pH value of the lysate and the centrifugation to 8.4, and filtration.

EFFECT: group of the inventions provides producing lysates and concentrates containing purified serotype 3 polysaccharide.

20 cl, 2 tbl, 2 ex, 8 dwg

FIELD: medicine.

SUBSTANCE: set contains one base pair showing activity of upstream and downstream primers, and a probe having the following structure: 5' CAAGNACTTCTGTTNCCCCGGACYGA 3'; 5' ATNTNTC AATTGTCANCATAAGC AGCC A 3'; F AM -5' CCTYCGGCNCCTGAYTGCGGCTAATCC 3'-BHQ1.

EFFECT: invention enables high-accuracy identification of the genetic material of human enteroviruses A, B, C, D.

4 dwg, 1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry and a method of producing comenic acid. The method is characterised by that it involves fermentation of the Gluconobacter oxydans-03 strain in a medium containing glucose - 35.0 g/l, yeast extract - 1.17 g/l, disubstituted ammonium phosphate - 0.619·10-3 g/l, monosubstituted potassium phosphate - 0.12·10-3 g/l, at temperature 28°C with forced aeration by 1.5-2.0 volume of air per 1 volume of medium per minute for 66-78 hours until obtaining gluconic acids: gluconic, 2-keto-gluconic, 5-keto-gluconic, 2,5-diketo-gluconic; Gluconobacter oxydans-03 cells are deposited by heating the culture fluid to 80-85°C for 0.5 hours in the presence of bentonite until formation of a residue; the supernatant fluid is filtered; the obtained filtrate which contains comenic acid and gluconic acids is deposited on anionite AV-17-8 chS, while adding sodium bicarbonate to obtain sodium salts of comenic acid and gluconic acids; 17-19% hydrochloric acid solution is added to form a residue containing comenic and gluconic acids; comenic acid is separated from gluconic acids by washing the residue with iced water or iced water-alcohol solution with water to alcohol ratio of 3:1, wherein 10 ml of the solution per 1 g of residue is used.

EFFECT: invention enables to obtain high-purity comenic acid.

6 ex

FIELD: medicine.

SUBSTANCE: method provides grinding a pathological biomaterial to be homogenated to prepare a suspensions. The prepared suspension is added with 3-5% citric acid at the basis of its content in the suspension. It is kept for 20-30 minutes at 10-20°C and added with 3-4% succinic acid and kept for 20-30 minutes at 10-20°C that is followed by neutrilising the suspension with 5-10% ammonium and reducing to pH 7.5-7.6. The neutrilised suspention is settled for 20-30 minutes; a supernatant is rinsed, and the precipitation is inoculated with a nutrient medium containing in 1 l of distilled water citric acid 8.0 g, ammonium citrate 2.0 g, succinic acid 3.0 g, asparagine or glycine 2.0 g, di-basic potassium phosphate 5.0 g, magnesium sulphate 0.5 g, zinc sulphate 0.3 g, di-basic sodium phosphate 3.0 g, sodium chloride 5.0-6.0 g, ferrous sulphate 0.1 g and glycerin 40-50 ml at pH 7.5-7.6. To produce the solid agar medium, the fluid medium diluted in distilled water 1:1 is added with agar 2.5 g per the fluid medium 100 ml, and sodium chloride is reduced to 5-6%.

EFFECT: invention allows reducing staphylococcus recovery time.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: technique involves DNA recovery from the biomaterial and real-time polymerase chain reaction with using probes marked by fluorescent dyes and fluorescence extinguishers. It involves preparing two reaction mixtures one of which contains the primers atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc and the probe FAM-cgttcggctc ggcatctcga tattccc-BHQ1, while the other one contains the primers ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca and the probe Joe-gtatccggct atgcgccgag tttgg BHQ1. The polymerase chain reaction is real-time at primer annealing temperature 55-62C in 30-45 cycles with continuous fluorescence control, its increment observing in one or more reaction mixtures enables diagnosing the presence of agrobacteria in the samples.

EFFECT: invention enables extending the range of genotypes of the diagnosed agrobacteria.

5 cl, 7 dwg, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention discloses a method for preparing a major protective antigen of a cholera vibrio of cholera toxin B subunit. The method involves deposition of a protein fraction from filtered broth culture of the recombinant strain other than 01 serogroup Vibrio cholerae KM93 (State Collection 'Microbe'). The deposited protein fraction is used to recover the B subunit to be purified by three-step column TSK HW-60 gel penetration chromatography. The purified preparation of the B subunit is applicable for producing anti-toxin serums, high-specific immunoglobulin and diagnostic test systems, as well as an ingredient of vaccine preparations.

EFFECT: use of the invention enables higher yield of the high-purity native immunogenic preparation of the cholera toxin B subunit.

2 dwg, 1 tbl

FIELD: medicine.

SUBSTANCE: method for preparing a composition containing colloidal nanosilver or nanogold involves incubation of probiotic bacteria specified in Lactobacillus fermentum species with an aqueous solution containing at least 4 mM of silver nitrate or auric chloride. The composition containing colloidal nanosilver is prepared by contact of said bacteria at 5-45°C and the aqueous solution containing mixed silver nitrate, ammonium and/or ammonia salt, as well as alkali metal hydroxide. The composition containing colloidal nanogold is prepared by contact of said bacteria at 5-45°C and the aqueous solution containing mixed auric chloride and alkali metal hydroxide.

EFFECT: prepared compositions are used as an antimicrobial agent or an algicidal agent.

17 cl, 4 dwg, 5 tbl, 16 ex

Up!