Method for microbiological synthesis of secreted human somatotropin and yeast strain saccharomyces cerevisiae - secreted human somatotropin producer

FIELD: medicine.

SUBSTANCE: what is produced is the yeast strain Saccharomyces cerevisiae able to produce secreted human somatotropin. Said strain contains a promoter contolled DNA sequence coding mature human somatotropin fused with a leader peptide in the same reading frame. The leader peptide includes a double pro-site of α-factor of yeast Saccharomyces cerevisiae. It also can contain a triple pro-site of α-factor of yeast Saccharomyces cerevisiae, or a double pro-site of HSP150 protein of yeast Saccharomyces cerevisiae, or a combination of said pro-sites. A method for producing human somatotropin provides cultivation of the human somatotropin producer strain.

EFFECT: use of the invention provides higher end product yield.

2 cl, 1 dwg, 8 ex

 

The invention relates to the field of biotechnology and relates to a method of synthesis of secreted growth hormone human cells of the yeast Saccharomyces cerevisiae.

Increased production of proteins of medical and technical purposes by increasing the efficiency of their secretion in the cells of microorganisms is one of the priority directions of researches in the field of biotechnology. Among the microorganisms used for this purpose include the yeast Saccharomyces cerevisiae.

Under sekretiruemyi proteins we understand such targeted soluble proteins, biosynthesis which in yeast S.cerevisiae accompanied by their secretion into the extracellular environment.

It is known that the efficiency of secretion in yeast S.cerevisiae depends on the choice of leader polypeptide (leader regions), directing the secretion of proteins [Romanos et al., 1992, Yeast 8:423-488]. A necessary part of the leader polypeptide is a signal peptide (pre-region), additional Pro - region. Each part of the leader polypeptide, members of the secreted protein during its biosynthesis, in the process of secretion is removed from its composition as to perform their function.

The main function of the signal peptide is in the process of translocation of the protein, i.e. the intersection secretively protein membrane layer that separates the cells in the cat who Roy is protein synthesis, from the field reticulum, in which the curtailment secreted protein and its post-translational modification. The signal peptide is removed from the composition of the secreted protein during translocation. Pro-region can perform a dual function: on the one hand, the Pro-region provides the elongation of proteins, especially of short proteins, affecting their translocation. A second feature of the Pro-region is realized at the stage of transport proteins from the er and is in the interaction sequence of the Pro-region with transport receptors, which mediate the inclusion of secreted proteins in secretory granules, in which secreted proteins move within the cell. One of the final steps in the intracellular transport in the Golgi complex is the enzymatic cleavage processing of the Pro-region from the Mature part of the secreted protein, which is then routed to the plasma membrane and exit the cell.

In the yeast S. cerevisiae as a leader regions usually use leader region of yeast secreted proteins. One of the most widely used leader regions yeast origin used for the secretion of heterologous proteins in S.cerevisiae cells, is a leader pre-Pro region of the precursor α-factor (MFα-1) of the sexual factor, secreted yeast cells α-mating type. The effectiveness of this leader region demonstrated repeatedly, including in relation to the secretion of proteins such as insulin-like growth factor I [Bayne et al., 1988, Gene, 66:235-244], granulocyte colony-stimulating factor [Ernst, 1988, DNA, 7:355 to 360 above], lysozyme human and chicken [Oka et al., 1999, Biosci.Biotechnol.Biochem., 63:1977-1983; Hashimoto et al., 1998, Protein Engineering, 11:75-77].

Other known secretory leader yeast origin is a pre-Pro-region of the glycoprotein HSP150 S. cerevisiae, a positive influence on the secretion of heterologous proteins in yeast cells installed, for example, β-lactamase [Simonen et al., 1994, J Biol Chem, 269:13887-92] and the extracellular domain of the receptor for nerve growth factor in rats [Simonen et al., 1996, Yeast, 12:457-66].

An example of a sequence of artificial origin, effectively performing in yeast cells the function of leader polypeptide is a fragment belointeractive-1-beta [Lee et al., 1999, Biotechnol Prog, 15:884-890].

We have found several modifications of the Pro-regions leader of polypeptides that provide improved processing [Kjeldsen et al., 1996, Gene, 170:107-112] and secretory activity [Kjeldsen, 2000, Appl Environ Biotechnol, 54:277-286]. In particular, known artificially constructed Pro-peptide, providing a 4-fold increase in insulin secretion compared with standard what arianta Pro-α-factor in yeast [Kjeldsen, 2000, Appl Environ Biotechnol, 54:277-286].

Somatotropin human growth hormone) belongs to the group of anabolic hormones. The lack of it in the body leads to serious consequences - dwarf, accompanied in most cases, degenerative changes of the skeleton and muscles, infertility, and sometimes mental retardation. The physiological effect of somatotropin includes the growth and strength of the muscles, stimulates the formation of bone and cartilage tissues, increasing the breakdown of fat, improvement of cardiac activity [Hedge et al., 1987, Clinical endocrine discrimination. W.B.Saunders company, 1987]. Somatotropin also has a pronounced anti-atherogenic effect (increases levels of high density lipoprotein and decreases the levels of low-density lipoprotein. It is shown that people with growth hormone deficiency have an increased risk of cardiovascular mortality (proceedings of the III all-Russian scientific-practical conference "Actual neuroendocrinology problems", Moscow, October 6-7, 2003).

The described method of constructing strains of S.cerevisiae SCR-H1 and SCR-H2 - stable producers of secreted recombinant somatotropin human. Cells of these strains contain multiple copies of the expression cassette containing the gene of somatotropin, integrated in different chromosomal loci that provides the stable inheritance. In the structure of the expression cassettes somatotropin gene is under control of the GAL1 promoter S.cerevisiae. Secretion of the protein is either solely leader pre-Pro-region of α-factor in yeast (in cells of strain SCR-H1), or use simultaneously the two leaders, which is the alternative in relation to each other: constructions secretion of somatotropin is directed leader pre-Pro-region of α-factor in yeast, as in other hybrid leader region containing the modified signal peptide of α-factor in yeast and Pro-region of the protein HSP150 S.cerevisiae (in cells of strain SCR-H2). The level of secretion of somatotropin is 100 mg/l and 150 mg/l, respectively [EN 2009145487].

The task of the claimed group of inventions - expanding Arsenal of methods microbiological synthesis of secreted growth hormone human cells of the yeast Saccharomyces cerevisiae.

The problem is solved by

- development of a microbiological method for the synthesis of secreted growth hormone human cells of the yeast Saccharomyces cerevisiae, providing for the cultivation of the producer strain secreted somatotropin rights containing a DNA sequence encoding a Mature somatotropin human, fused in the same reading frame with the leader polypeptide comprising the signal peptide, and a combination of two to three consecutive Pro is Blasta, each of which stimulates the secretion of somatotropin person in the yeast Saccharomyces cerevisiae, in particular, the double Pro-α-factor of the yeast S.cerevisiae, triple Pro-α-factor of the yeast S.cerevisiae, double the Pro-region of the protein HSP150 yeast S.cerevisiae or Pro-region of the protein HSP150 yeast S.cerevisiae and Pro-α-factor of the yeast S.cerevisiae;

- design strain of the yeast Saccharomyces cerevisiae VKPM Y-3580 - producer of secreted growth hormone human.

The method in General

Sowing culture of one of the strains of the yeast Saccharomyces cerevisiae producer secreted somatotropin rights containing a DNA sequence encoding a Mature somatotropin human, fused in the same reading frame with the leader polypeptide comprising the signal peptide, and a combination of two to three consecutive Pro-regions, each of which stimulates the secretion of somatotropin in the yeast Saccharomyces cerevisiae, obtained by cultivation of a strain for 16-40 hours at a temperature of between 22 and 32°C on an orbital shaker 100-350 rpm in the medium of the following composition, in wt.%: peptone 1-3; yeast extract 0.5 to 3; glucose 1-3, water - the rest, pH - natural.

Seed culture inoculated fermenter (0.5 to 1000 l), containing the fermentation medium of the following composition, in wt.%: peptone 1-3; yeast extract 0.5 to 3, glucose or sucrose 1-4, water - octalin is e, the pH of the environment - natural. The number of seed culture introduced into the fermenter, is 3-15% by volume of a fermentation medium.

The fermentation is carried out at a temperature between 22 and 32°C, aeration 0,2-1,5 rpm rpm and speed stirring culture 200-1500 rpm/min. Through 16-30 h after inoculation of the fermenter begin feeding an aqueous solution of the following composition (in grams per liter): peptone 20-100; yeast extract 20-100, glucose or sucrose 100-500, with a speed of 1-10 ml/l/h and set pH staterevenue culture in the range of pH 5.5 to pH of 7.2. The total duration of the fermentation is lasts for 48-96 hours.

The method allows to synthesize secretory somatotropin human rights in the amount of 1-2 g/l of culture fluid, to determine the number of which use the method of polyacrylamide gel electrophoresis and enzyme immunoassay Protocol [EN 2009145487].

Construction of Saccharomyces cerevisiae strain - producer of secreted growth hormone human.

Stage 1 - construct new gene variants leader polypeptides, containing in its composition protein sequence encoding an effective signal peptide and a combination of consecutive Pro-regions, each of which stimulates the secretion of somatotropin person in the yeast Saccharomyces cerevisiae, in particular, the double Pro-α-factor of the yeast S.cerevisiae, or utrain the th Pro-α-factor of the yeast S.cerevisiae, or double the Pro-region of the protein HSP150 yeast S.cerevisiae, or Pro-region of the protein HSP150 yeast S.cerevisiae and Pro-α-factor of the yeast S.cerevisiae.

Under the combination of understand the unique animation Pro-region, or a combination of various Pro-regions. New leader polypeptides to-end contain a unique website recognition proteases KEH.

Stage 2 - design variants of yeast expression vectors, each of which contains the gene encoding the Mature growth hormone human, merged with one of the variants of the leader polypeptide, containing in its composition a combination of consecutive Pro-regions, is able to stimulate the secretion of somatotropin human cells of the yeast S.cerevisiae. The presence in the field of fusion of the target protein and leader of the polypeptide of website recognition proteases KEH allows secretion in the enzymatic processing of fused protein with intracellular proteases KEH release from Mature somatotropin human (containing the corresponding native N-terminal amino acid residue). Expression vectors also contain the region of initiation of replication of endogenous 2-micron plasmid of yeast, which ensures their ability to be maintained in yeast cells S. cerevisiae in episomes mnogoseriynom condition. To stabilize plasma is IDA vectors introduce functional gene PGK1 yeast S. cerevisiae.

Stage 3 - derived variants, expression vectors transform the recipient strain of the yeast S.cerevisiae. Preferably as a recipient strain of yeast is used strain S.cerevisiae D721W, which is diploid, that provides improved stability of its expression characteristics. Strain S.cerevisiae D721W contains a homozygous mutation in the chromosomal alleles of the structural gene PGK1 encoding phosphoglycerides that ensures stable maintenance of the vector, containing the functional gene PGK1, on media containing any single carbon source assimilable by yeast Saccharomyces cerevisiae, and GAL80 gene encoding the protein is a repressor of the GAL1 promoter, which provides galactosaemia gene expression under the control of the GAL1 promoter.

Step 4 - on the basis of the results of the comparative analysis of the obtained transformants select strain of yeast carrying out the most effective secretion of somatotropin human.

Step 5 - using a selected strain of yeast and fermentation equipment, carry out the biosynthesis of somatotropin human.

The design of the proposed strain - producer of secreted growth hormone human conduct as described above using, as a combination of Pro-areas - double-Pro-α-factor is ora yeast S.cerevisiae. The result is a strain of the yeast Saccharomyces cerevisiae SCR-GH-FF - producer Mature somatotropin person who deposited in Russian national collection of industrial microorganisms (VKPM) as Saccharomyces cerevisiae VKPM Y-3580.

Description of the proposed strain

Genotype:

SCR-GH-FF (a/α leu2/leu2 ura3/ura3 trp1/trp1::TRP1 pgk1::URA3/pgk1::gal80 URA3::LEU2/gal80::LEU2 lys7/LYS7 his3/HIS3 his4/HIS4 STA2/STA2 suc°/SUC2) /pPDX3-FF-GH

Morphological features:

Under cultivation at 28°C for 48 hours on agar YPD medium of the following composition (in wt.%): peptone 2, yeast extract 1, glucose 2, agar 2, water the rest, the cells of the inventive strain have an oval shape, 3-7 µm in diameter. Cells packouts. Budding true, multilateral. True mycelium form.

Colonies are the following:

1) on agar medium YPD colonies are white with a smooth edge and a matte surface, a lenticular profile and creamy consistency;

2) on agar medium with starch (composition in wt.%: peptone 2, yeast extract 1, starch 1, agar 2, water the rest of the colony is white with a patterned edge, matte surface, lenticular profile and krupchato consistency.

Growth in liquid medium with starch: at 28°C during the first 24 h of cultivation - liquid cloudy, white precipitate, not crumpled, parietal film does not form.

Physico-chemically the signs: optional gone anaerobic. Temperature growth 20-33°C (optimum 28°C). the pH of the cultivation of 3.8 to 7.4 (optimum - 5,0).

Assimilation of carbon sources: Sprayway glucose, fructose, maltose, sucrose, dextrin, starch. Not sprayway lactose, galactose, inulin, xylose, arabinose.

Assimilation of nitrogen sources: Absorbs amino acids, ammonium sulphate, ammonium nitrate.

Pathogenicity: the Claimed Saccharomyces cerevisiae strain VKPM Y-3580 leptogenesis.

Storage: the Strain stored at -70°C in 20% aqueous solution of glycerol. Can be stored on a rich agar medium with glucose for 3 months at +4°C.

Stability: Stable for 20 consecutive subcultures on agar YPD medium at a temperature of 28°C.

Production of somatotropin: Secretes Mature somatotropin human rights in the amount of 1-2 g/L.

The claimed group of inventions is illustrated in the following figure, where electrophoregram samples of the culture liquid obtained by culturing strains-producers of somatotropin person (example 9): SCR-GH-F (Dor), SCR-GH-150 (Dor), SCR-GH-150F (Dor), SCR-GH-FF (Dor), SCR-GH-150x2 (Dor) and SCR-GH-FFF (Dor and 6). On the track caused the total protein samples obtained from 10 ál of the culture fluid. On electrophoregram presents sample pharmacy drug growth hormone human ("Rastan", 2.5 μg, dark), and is also the molecular weight markers (Dorm, the left shows the values of molecular weight protein markers (in kDa). At the bottom of electrophoregram the data of measurements of the concentrations of somatotropin human (mg/l) in the respective samples of the culture fluid obtained by enzyme-linked immunosorbent assay (ELISA).

Example 1. The design DNA that encodes a leader polypeptide containing the sequence of the double Pro-α-factor of the yeast S.cerevisiae

Constructing a DNA sequence that encodes a leader polypeptide comprising the protein sequence of the double Pro-α-factor of the yeast S.cerevisiae, performed using plasmids R-1, containing the expression cassette comprising the promoter GAL1 gene and the Mature growth hormone human, fused in the same reading frame with a DNA sequence that encodes a leader of pre-Pro-region of α-factor S.cerevisiae [RU2009145487]. Plasmid R-1 split on sites NcoI and XhoI. The larger of the resultant DNA fragments containing the vector portion of the plasmid and the DNA sequence encoding the Pro-region of α-factor in yeast, merged with the sequence of the promoter region of the gene GAL1 yeast elute from the gel and called fragment-1. Then, using PCR primers N449 (5'-atatagatctccagtcaacactacaa) and standard pUC reverse primer, called N169 (5'-gagcggataacaatttcacacagg), amplified fragment of DNA plasma the s R-1, the closing sequence of the Pro-α-factor yeast and merged with her Mature gene growth hormone human. Amplificatory DNA fragment cleaved by a unique terminal sites BglII and XhoI and called fragment-2. Then, as a result of annealing to each other of two synthetic oligonucleotides N573 (5'-catgttggaattcg) and N574 (5'-gatccgaattccaa) are synthetic adapter, called fragment-3. As a result of joint ligating three of the obtained DNA fragments receive plasmid pUC18x-GAL1pFF-GH.

The obtained plasmid pUC18x-GAL1pFF-GH gene contains Mature growth hormone human, fused in the same reading frame with a DNA fragment coding for a leader polypeptide comprising the signal peptide and the sequence of the double Pro-α-factor yeast.

Example 2. The design DNA that encodes a leader polypeptide containing the sequence three times Pro-α-factor of the yeast S.cerevisiae

Constructing a DNA sequence that encodes a leader polypeptide comprising the protein sequence three times Pro-α-factor of the yeast S.cerevisiae, performed using plasmids pUC18x-GAL1pFF-GH (example 1). This plasmid pUC18x-GAL1pFF-GH split across sites NcoI and XhoI. The larger of the resultant DNA fragments containing the vector portion of the plasmid and sequence of the promoter region of the gene GAL1 yeast merged with the leader polypeptide, containing twice the Pro-region of α-factor of yeast, called fragment-4. As a result of joint ligation of three DNA fragments, fragments 2 and 3 (example 1) and fragment-4 receive plasmid pUC18x-GAL1pFFF-GH.

The obtained plasmid pUC18x-GAL1pFFF-GH gene contains Mature growth hormone human, fused in the same reading frame with a DNA fragment coding for a leader polypeptide comprising the signal peptide and the sequence three times Pro-α-factor yeast.

Example 3. The design DNA that encodes a leader polypeptide containing the sequence twice the Pro-region of the protein HSP150 yeast S.cerevisiae

Constructing gene leader polypeptide containing twice the Pro-region of the protein HSP150 yeast S.cerevisiae, performed using plasmids R-15, containing the expression cassette comprising the promoter GAL1 gene and the Mature growth hormone human, fused in the same reading frame with a DNA sequence that encodes a leader polypeptide containing the sequence Pro-region (N) protein HSP150 yeast S.cerevisiae [EN 2009145487]. Plasmid R-15 split across sites NcoI and XhoI. The larger of the resultant DNA fragments containing the vector portion of the plasmid and the DNA sequence encoding the Pro-region of the protein HSP150, merged with the sequence of the promoter region of the gene GAL1 yeast elute from the gel and call f is agumentom-5. Next, using PCR primers N616 (5'-aatagatctgcctatgctccatctga) and standard pUC reverse primer, called N169 (5'-gagcggataacaatttcacacagg), amplified fragment of DNA plasmids R-15, containing the sequence encoding the Pro-region of the protein HSP150 yeast S. cerevisiae and merged with her Mature gene growth hormone human. Amplificatory DNA fragment cleaved by a unique terminal sites BglII and XhoI and called fragment 6. As a result of joint ligation of three DNA fragments, fragment 3 (example 1) and fragments 5 and 6 receive the plasmid pUC18x-GAL1matHH-GH.

The obtained plasmid pUC18x-GAL1matHH-GH gene contains Mature growth hormone human, merged with the DNA fragment coding for a leader polypeptide comprising the sequence twice the Pro-region of the protein HSP150 yeast S.cerevisiae.

Example 4. The design DNA that encodes a leader polypeptide containing the sequence of the Pro-region of the protein HSP150 yeast S.cerevisiae and Pro-α-factor of the yeast S.cerevisiae

Using PCR primers N449 (5'-atatagatctccagtcaacactacaa) and standard pUC reverse primer, called N169 (5'-gagcggataacaatttcacacagg), amplified fragment of DNA plasmids R-1 [EN 2009145487]containing the DNA sequence encoding the Pro-region of α-factor in yeast S.cerevisiae and merged with her Mature gene growth hormone human. Amplificatory DNA fragment cleaved by a unique terminal sites BglII and Xho called fragment 7.

As a result of joint ligation of three DNA fragments, fragment 5 (example 3), fragment 3 (example 1) and fragment 7 obtain plasmid pUC18x-GALlmatHF-GH.

The obtained plasmid pUC18x-GAL1matHF-GH gene contains Mature growth hormone human, merged with the DNA fragment coding for a leader polypeptide comprising the sequence of the Pro-region of the protein HSP150 yeast S.cerevisiae and Pro-α-factor of the yeast S.cerevisiae.

Example 5. Design variants of yeast expression vectors comprising different combinations of Pro-areas

The design is conducted using laboratory byreplacing vector pPDX3. Vector pPDX3 contains an area of replication initiation endogenous 2-micron plasmid of yeast, which ensures its ability to be maintained in the cells of the yeast Saccharomyces cerevisiae in episomes mnogoseriynom state vector also carries a functional allele of the gene PGK1 yeast, which provides its selective maintenance in yeast cells by chromosomal mutant allele of this gene. Vector pPDX3 contains a single substitution in the sequence of the NcoI site (ccatgg changed to ccatga), localized in the region of the structural gene URA3, which does not lead to inactivation of this gene.

Construction carried out as follows. DNA vector pPDX3 cleaved by HindIII/XhoI and are ligated with HindIII/XhoI fragment of DNA plasmids R-1, or pUC8x-GAL1pFF-GH, or pUC18x-GAL1pFFF-GH, or R-15, or pUC18x-GAL1matHH-GH, or pUC18x-GAL1matHF-GH, comprising the sequence of GAL1 promoter and the gene of Mature growth hormone human, merged with the DNA sequence that encodes the corresponding variant of the leader polypeptide. The result expression vector pPDX3-F-GH, or pPDX3-FF-GH, or pPDX3-FFF-GH, or pPDX3-H-GH, or pPDX3-HH-GH, or pPDX3-HF-GH, respectively.

Received perepilichny expression vector contains a gene of Mature growth hormone human, merged with the DNA sequences encoding the variants leader polypeptides, containing in its composition single (F), double (FF) or three times (FFF) Pro-α-factor of yeast, single (N), double (NN) Pro-region of the protein HSP150 yeast S.cerevisiae, or a combination of the Pro-region of the protein HSP150 yeast S.cerevisiae and Pro-α-factor of the yeast S.cerevisiae (HF), respectively.

Example 6. The design of a recipient strain of the yeast S.cerevisiae D721W

The recipient strain S.cerevisiae D721W is derived laboratory strains of S.cerevisiae D721/pPDX3. Cells of strain D721/pPDX3 carry a homozygous mutation in the chromosomal alleles of the structural genes PGK1 and GAL80.

Strain D721W design in two stages. In the first phase cells laboratory strain D721/pPDX3 transform obtained by any method, the DNA fragment containing the native gene TRP1 yeast S.cerevisiae. Transformation implementation is Aut method [Ito H, Fukuda Y, Murata K, Kimura A; J Bacteriol. 1983; 153:163-168]. Transformants are selected on standard mineral medium for growing yeast that does not contain tryptophan.

Select one of the obtained transformants and call it a strain S.cerevisiae D721W/pPDX3.

In the second phase cells of strain D721W/pPDX3 exempt from being in them episunago vector pPDX3. They are cultivated on agar YPGE medium of the following composition in wt.%: bactopeptone 2, yeast extract 1, baktagir 2, ethanol, 2 glycerol 3, water the rest. In this environment effectively grow cells carrying plasmid pPDX3, which is PGK1 gene, and cells, their lost. Besplatnye clones selectrow on the grounds of lack of growth on YPD medium with glucose. The resulting Besplatniy strain called strain S.cerevisiae D721W.

Strain D721W used as the recipient for transformation of yeast ireplychannel expression vectors.

Example 7. Obtaining the claimed strain and other strains of yeast S.cerevisiae-producers of secreted growth hormone human

The strain of yeast SCR-GH-F, or SCR-GH-FF, or SCR-GH-FFF, or SCR-GH-H, or SCR-GH-HH, or SCR-GH-HF receive as a result of transformation of the cells of the recipient strain D721W expression vectors pPDX3-F-GH, or pPDX3-FF-GH, or pPDX3-FFF-GH, pPDX3-H-GH, or pPDX3-HH-GH, or pPDX3-HF-GH, respectively. To implement the transformation of cells PCs is MMA D721W cultured for 18-24 hours at the temperature of 28°C on agar medium YPGE. Transformation of cultured cells is carried out according to the method of Ito [Ito et al., J Bacteriol. 1983; 153: 163-168]. Transformants are selected based on their ability to grow on YPD medium.

To analyze the level of secretion of growth hormone cells of the obtained transformants were cultured on YPD medium for 44 hours at 28°C on a rotary shaker at 250 rpm Next, analyze the level of secreted growth hormone in the environment of the cultivation of yeast. As a negative control using strain D721W/pPDX2.

The results of the analysis (Figure 1) show that the strains SCR-GH-FF, SCR-GH-FFF, SCR-GH-HH and SCR-GH-HF, secretion of somatotropin in which the leader polypeptide, comprising in its structure a combination of Pro-regions, far superior in productivity strains SCR-GH-F and SCR-GH-H secretion of somatotropin in which pre-Pro-region of α-factor in yeast or pre-Pro-region of the HSP150 protein, respectively. The level of secretion of somatotropin strains SCR-GH-FF, SCR-GH-FFF, SCR-GH-HH and SCR-GH-HF is not less than 200 mg/l, higher than that of strains SCR-H1 and SCR-H2 [EN 2009145487].

Strain SCR-GH-FF deposited in Russian national collection of industrial microorganisms (VKPM) as Saccharomyces cerevisiae strain VKPM Y-3580.

Example 8. Microbiological synthesis of somatotropin person using strain VKPM Y-3580

To obtain the inoculum strain VKPM Y-3580 grown in YPD medium is and the rocking chair (250 rpm) at 28°C for 24 hours

50 ml of seed used for planting 3 l fermentor Anglicon containing 950 ml of YPD medium. The fermentation is carried out at a temperature of 28°C, aeration 1 l/1 l/min and the stirring speed 1000 rpm After 24 hours after inoculation of the fermenter begin feeding an aqueous solution of the following composition (in grams per liter): peptone 50, yeast extract, 50, sucrose 200; at a rate of 8 ml/h and set pH staterevenue culture at pH 6.8 using Podarok solution 10% sulfuric acid and 10% NaOH. The total fermentation time of 72 hours.

The amount of secreted growth hormone human strain VKPM Y-3580 under these conditions is 2 g/L.

1. The way microbiological synthesis of secreted growth hormone human cells of the yeast Saccharomyces cerevisiae, providing for the cultivation of the producer strain containing the DNA sequence encoding the Mature somatotropin person under the control of a promoter that ensures the expression of the growth hormone human in Saccharomyces cerevisiae cells, while Mature somatotropin human fused in the same reading frame with the leader polypeptide comprising the signal peptide and the sequence of performing in yeast cells the function of the Pro-region, characterized in that as a Pro-region of the leader polypeptide use a combination or two or three after avatele located Pro-regions of the α-factor of Saccharomyces cerevisiae, or double the Pro-region of the protein HSP150 yeast Saccharomyces cerevisiae, or a combination of the Pro-region of the protein HSP150 yeast Saccharomyces cerevisiae and Pro-α-factor of Saccharomyces cerevisiae.

2. The strain of the yeast Saccharomyces cerevisiae VKPM Y-3580 - producer of secreted growth hormone human, intended for realization variant of the method according to claim 1, involving the use of two consecutive Pro-regions of the α-factor of Saccharomyces cerevisiae as a Pro-region of the leader polypeptide derived from the recipient diploid strain of Saccharomyces cerevisiae containing a homozygous mutation of the gene PGK1 and gene GAL80, by transformation of the recipient strain expression vector containing the gene PGK1, and under the control of the GAL1 promoter DNA sequence encoding a Mature somatotropin human signal peptide of the α-factor of Saccharomyces cerevisiae and the combination of two consecutive Pro-regions of the α-factor of Saccharomyces cerevisiae.



 

Same patents:

FIELD: medicine.

SUBSTANCE: nutrient medium contains enzyme cattle erythromass hydrolyzate containing 0.10-0.14% of amine nitrogen, potassium monophosphate, 3-aqueous disubstituted potassium phosphate, activated carbon, 7-aqueous ferrous sulphate, L-cysteine hydrochloride, microbiological agar and distilled water in the preset proportions.

EFFECT: invention allows reducing time for legionella cultivation.

3 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains enzyme sprat hydrolyzate containing 0.10-0.14% of amine nitrogen, potassium monophosphate, 3-aqueous disubstituted potassium phosphate, 7-aqueous ferrous sulphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water in the preset proportions.

EFFECT: invention provides higher biomass yield and reduced time of legionella cultivation.

3 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains enzyme yolk hydrolyzate containing 0.10-0.14% of amine nitrogen, potassium monophosphate, 3-aqueous disubstituted potassium phosphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water in the preset proportions.

EFFECT: invention allows reducing time for legionella cultivation.

3 ex

FIELD: medicine.

SUBSTANCE: group of inventions refers to biotechnology and biochemistry. The serotype 3 Streptococcus pneumoniae polysaccharides are purified from protein impurities. According to the first version of the method, the Streptococcus pneumoniae cell lysate is heated to 60°C for 30 min for protein aggregation and deposition. The deposited substances are separated by filtration through membrane and depth filter of the pore diameter of 0.45 mcm and centrifuged to produce the purified lysate. According to the second version of the method, the pH value of the lysate or the centrifugate is increased to 8.0 to 8.4 and filtered. According to the third version of the method, the Streptococcus pneumoniae cell lysate is heated to 60°C - 70°C for 30 - 50 min. It is followed by lysate centrifugation and increase of the pH value to 8.0 - 8.4, and filtration. According to the fourth version of the method, the pH value is decreased to 3.0 - 5.0 and heated to 60°C - 70°C for 30 - 50 min. It is followed by centrifugation and increase of the pH value of the lysate and the centrifugation to 8.4, and filtration.

EFFECT: group of the inventions provides producing lysates and concentrates containing purified serotype 3 polysaccharide.

20 cl, 2 tbl, 2 ex, 8 dwg

FIELD: medicine.

SUBSTANCE: set contains one base pair showing activity of upstream and downstream primers, and a probe having the following structure: 5' CAAGNACTTCTGTTNCCCCGGACYGA 3'; 5' ATNTNTC AATTGTCANCATAAGC AGCC A 3'; F AM -5' CCTYCGGCNCCTGAYTGCGGCTAATCC 3'-BHQ1.

EFFECT: invention enables high-accuracy identification of the genetic material of human enteroviruses A, B, C, D.

4 dwg, 1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry and a method of producing comenic acid. The method is characterised by that it involves fermentation of the Gluconobacter oxydans-03 strain in a medium containing glucose - 35.0 g/l, yeast extract - 1.17 g/l, disubstituted ammonium phosphate - 0.619·10-3 g/l, monosubstituted potassium phosphate - 0.12·10-3 g/l, at temperature 28°C with forced aeration by 1.5-2.0 volume of air per 1 volume of medium per minute for 66-78 hours until obtaining gluconic acids: gluconic, 2-keto-gluconic, 5-keto-gluconic, 2,5-diketo-gluconic; Gluconobacter oxydans-03 cells are deposited by heating the culture fluid to 80-85°C for 0.5 hours in the presence of bentonite until formation of a residue; the supernatant fluid is filtered; the obtained filtrate which contains comenic acid and gluconic acids is deposited on anionite AV-17-8 chS, while adding sodium bicarbonate to obtain sodium salts of comenic acid and gluconic acids; 17-19% hydrochloric acid solution is added to form a residue containing comenic and gluconic acids; comenic acid is separated from gluconic acids by washing the residue with iced water or iced water-alcohol solution with water to alcohol ratio of 3:1, wherein 10 ml of the solution per 1 g of residue is used.

EFFECT: invention enables to obtain high-purity comenic acid.

6 ex

FIELD: medicine.

SUBSTANCE: method provides grinding a pathological biomaterial to be homogenated to prepare a suspensions. The prepared suspension is added with 3-5% citric acid at the basis of its content in the suspension. It is kept for 20-30 minutes at 10-20°C and added with 3-4% succinic acid and kept for 20-30 minutes at 10-20°C that is followed by neutrilising the suspension with 5-10% ammonium and reducing to pH 7.5-7.6. The neutrilised suspention is settled for 20-30 minutes; a supernatant is rinsed, and the precipitation is inoculated with a nutrient medium containing in 1 l of distilled water citric acid 8.0 g, ammonium citrate 2.0 g, succinic acid 3.0 g, asparagine or glycine 2.0 g, di-basic potassium phosphate 5.0 g, magnesium sulphate 0.5 g, zinc sulphate 0.3 g, di-basic sodium phosphate 3.0 g, sodium chloride 5.0-6.0 g, ferrous sulphate 0.1 g and glycerin 40-50 ml at pH 7.5-7.6. To produce the solid agar medium, the fluid medium diluted in distilled water 1:1 is added with agar 2.5 g per the fluid medium 100 ml, and sodium chloride is reduced to 5-6%.

EFFECT: invention allows reducing staphylococcus recovery time.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: technique involves DNA recovery from the biomaterial and real-time polymerase chain reaction with using probes marked by fluorescent dyes and fluorescence extinguishers. It involves preparing two reaction mixtures one of which contains the primers atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc and the probe FAM-cgttcggctc ggcatctcga tattccc-BHQ1, while the other one contains the primers ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca and the probe Joe-gtatccggct atgcgccgag tttgg BHQ1. The polymerase chain reaction is real-time at primer annealing temperature 55-62C in 30-45 cycles with continuous fluorescence control, its increment observing in one or more reaction mixtures enables diagnosing the presence of agrobacteria in the samples.

EFFECT: invention enables extending the range of genotypes of the diagnosed agrobacteria.

5 cl, 7 dwg, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention discloses a method for preparing a major protective antigen of a cholera vibrio of cholera toxin B subunit. The method involves deposition of a protein fraction from filtered broth culture of the recombinant strain other than 01 serogroup Vibrio cholerae KM93 (State Collection 'Microbe'). The deposited protein fraction is used to recover the B subunit to be purified by three-step column TSK HW-60 gel penetration chromatography. The purified preparation of the B subunit is applicable for producing anti-toxin serums, high-specific immunoglobulin and diagnostic test systems, as well as an ingredient of vaccine preparations.

EFFECT: use of the invention enables higher yield of the high-purity native immunogenic preparation of the cholera toxin B subunit.

2 dwg, 1 tbl

FIELD: medicine.

SUBSTANCE: method involves the PCR-amplification of the 16S rRNA fragment with the use of specific original oligonucleotide primers SEQ ID No: 1 and SEQ ID NO: 2. It is followed by the PCR biotinylation of the primer SEQ ID No: 1 which enables detecting the nucleotide sequences of the 16S rRNA by simple one-chain solid-phase sequencing with the use of specific original sequencing primers SEQ ID No: 3, SEQ ID NO: 4 and SEQ ID NO: 5. The mycobacteria are precisely identified by comparing certain sequences with common sequences of various types of mycobacteria in the database.

EFFECT: invention enables identifying mycobacterioses in the samples of pathological material.

4 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method involves providing a cell culture containing mammal cells which contain a gene coding rTNF-lg expression of which occurs in the cell culture medium. The medium containing glutamine and possessing the essential properties is used. Said culture is maintained in an initial growth phase at a first set of cultivation conditions during a first period of time. At least one of the cultivation conditions are modified to produce a second set of cultivation conditions with said cultivation condition at the specified stage of modification of at least one of cultivation conditions specified from the group consisting of: (i) temperature; (ii) pH; (iii) osmolality; (iv) a level of the chemical activator and their combinations. Said culture is maintained at the specified second set of conditions during a second period of time so that rTNF-lg is accumulated in the specified culture.

EFFECT: invention enables the scale rTNF-lg production in the cell culture.

48 cl, 76 dwg, 27 tbl, 17 ex

FIELD: medicine.

SUBSTANCE: method for producing an immortalised human cell involves transfection of an immortalised human host cell in a serum-free medium with using a transfection vector containing a gene coding a target human protein, a promoter and a bovine growth hormone polyadenilation (polyA) signal wherein said promoter and the polyA signal are binded with 5'- and 3'-terminus of the gene coding a target human protein respectively, and an origin of replication. Said transfection vector additionally bears at least one genetic selection marker. Stable transfected cells are selected.

EFFECT: invention allows producing the stable immortalised transfected human cells for preparing recombinant human proteins.

16 cl, 16 dwg, 1 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology, particularly genetic and protein engineering, as well as a method of producing recombinant human C-peptide. The disclosed method involves culturing an Escherichia coli producing strain, breaking down bacterial cells by disintegration, separating "inclusion bodies" containing a hybrid protein, dissolution thereof in a buffer containing urea and dithiothreitol, renaturating and purifying the renatured hybrid protein, disintegration thereof with trypsin and carboxypeptidase B, separation via chromatography on SP-sepharose, followed by purification and obtaining the end product.

EFFECT: method enables to obtain C-peptide with high output and purity of not less than 95% from wastes formed when producing recombinant human insulin.

4 tbl, 6 ex

FIELD: chemistry.

SUBSTANCE: method involves preparing a cell culture containing mammal cells which contain a gene which encodes a polypeptide whose expression takes place in cell culture conditions. A medium containing glutamine and having the required properties is used. Said culture is kept at the initial growth phase under a first set of culturing conditions for a first period of time. At least one of the culturing conditions is changed to obtain a second set of culturing conditions, wherein said culturing condition at said step for changing at least one culturing condition is selected from a group consisting of: (i) temperature; (ii) pH; (iii) osmolality; (iv) level of chemical activator and combinations thereof. Said culture is kept at said second set of conditions for a second period of time so that polypeptide accumulates in said culture.

EFFECT: invention enables large-scale production of polypeptides in a cell culture.

46 cl, 76 dwg, 27 tbl, 17 ex

FIELD: medicine.

SUBSTANCE: what is offered is a compound of structure (I) presented in the patent claim, referred to labyrinthopeptines. There are also offered a method for preparing the compound of formula (I) and the pharmaceutical composition containing the compound of formula (I).

EFFECT: compound can be applied for preparing the drug for bacterial infections caused by gram-positive bacteria or for neuropathic pain or pain initiated by inflammations.

19 cl, 7 tbl, 18 ex

FIELD: medicine.

SUBSTANCE: described is method of purification of recombinant granulocyte colony-stimulating factor (filgrastim) of human. Method characteristics: at the stage of purification from coarse pollutions applied is sorbent SP-Sepharose Fast Flow, elution is carried out by gradient 0.5 M NaCl in acetate buffer pH 5-5.5, stage of fine purification is carried out by ion-changeable chromatography on sorbent YMC BioPro S30, at the stage of purified product concentration applied is sorbent CM-Sepharose Fast Flow, and elution is carried out by gradient 0.5 M NaCl in acetate buffer pH 5-5.5, additionally carried out is stage of gel-filtration by sorbent Sephadex G25, elution is carried out by 13.3 mM sodium-acetate buffer, pH 3.9.

EFFECT: invention makes it possible to considerably reduce waste of protein during purification.

2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method involves cultivation of an obligate methanol-assimilating bacterium Methylophilus methylotrophus or Methylobacillus glycogens in a fluid medium with the bacterium secreting an end protein from a bacterial cell where said bacterium has a DNA structure containing a promoter sequence functioning in the methanol-assimilating bacterium, a nucleotide sequence coding a polypeptide containing a signal sequence which functions in the methanol-assimilating bacterium, and a sequence of the end protein functionally connected with the promoter sequence.

EFFECT: method allows producing the protein effectively by means of extracellular secretion, difficult-to-produce by means of secretory production with application of Escherichia coli bacteria.

5 cl, 7 ex

FIELD: medicine.

SUBSTANCE: by recombinant method obtained is fused protein, which contains natural molecule of human erythropoetine with cysteine residue near its C-end and Fc fragment of humal IgG, containing hinge region, N-end of said Fc fragment is connected to said C-end of said erythropoetine molecule, and said Fc fragment is natural, excluding mutation, consisting in substitution of cysteine residue in said hinge region, located the nearest of all to said erythropoetine molecule, with non-cysteine residue, which resulted in the fact that first cysteine residue of said hinge region, located the nearest of all to said N-end, is separated, by, at least, 12 or 17 amino acids from said cysteine residue of said erythropoetine molecule. Obtained peptide is used for stimulation of erythropoesis in mammal.

EFFECT: invention makes it possible to obtain fused protein, which possesses erythropoetine activity, has prolonged time of half-life in vivo in comparison with native human erythropoetine.

43 cl, 20 dwg, 10 ex

FIELD: medicine.

SUBSTANCE: in order to obtain protein PS-CFP2/TurboYFP_MBP7, constructed is recombinant plasmid DNA PS-CFP2/TurboYFP_MBP7 with size 4916 bp, coding hybrid protein, containing sequence of proteins PS-CFP2 and Turbo YFP, bound with fragment of myelin basic protein 80-104. Composition of plasmid DNA also includes promoter of T5 PHK-polymerase transcription, site of ribosome binding; fragment of DNA plasmid gen of β-lactamase, determining stability of Escherichia coli cells to ampicillin, as genetic marker. Obtained plasmid DNA is used to transform cells of Escherichia coli strain BL21(DE3) to obtain strain-producent of hybrid protein PS-CFP2/TurboYFP_MBP7. In order to obtain protein PS-CFP2/TurboYFP_MBP7 cultivation of strain-producent of Escherichia coli BL21 (DE3)/pQe30_PS-CFP2/TurboYFP_MBP7 is performed, cells are destroyed and target protein is purified by method of affine and gel-filtration chromatography.

EFFECT: invention makes it possible to increase biosensor sensitivity and stability and extend its specificity in respect to pool of catalytic antibodies.

3 cl, 7 dwg, 1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: method of microbiological synthesis of mature human interferon alpha-2 is implemented by cultivation of Saccharomyces cerevisiae yeast containing inactivating mutation in a structural gene of proteinase YPS1 and/or additional genes of proteinase KEX2. A recombinant method is used to produce Saccharomyces cerevisiae yeast strains capable to secrete mature human interferon alpha-2 in a culture medium.

EFFECT: invention allows increasing production of mature human interferon alpha-2 ensured by reduced degradation of secreted interferon by yeast proteinase YPS1 gene inactivation, and by improved effectiveness of processing of secreted interferon precursor by increasing native or secreted proteinase KEX2 expression.

9 cl, 1 tbl, 33 ex

FIELD: chemistry.

SUBSTANCE: invention relates to genetic engineering and microbiological industry, as well as a genetic structure for exposing protein on the Yarrowia lipolytica yeast cell wall surface. The disclosed structure has a promoter, a terminator, a signal sequence, a selective marker, a nucleotide sequence which encodes an immobilised protein, and a nucleotide sequence which encodes an amino acid sequence containing an amino acid sequence selected from a group of sequences given in the list of sequences under number SEQ ID NO:1 or SEQ ID NO:2, or SEQ ID NO:3, or SEQ ID NO:4, or SEQ ID NO:5, or SEQ ID NO:6.

EFFECT: invention simplifies the process of purifying the protein produced by the cell and can be used in microbiological synthesis of proteins.

7 dwg, 11 ex, 1 tbl

Up!