Method for type 3 streptococcus pneumoniae polysaccharide purification (versions)

FIELD: medicine.

SUBSTANCE: group of inventions refers to biotechnology and biochemistry. The serotype 3 Streptococcus pneumoniae polysaccharides are purified from protein impurities. According to the first version of the method, the Streptococcus pneumoniae cell lysate is heated to 60°C for 30 min for protein aggregation and deposition. The deposited substances are separated by filtration through membrane and depth filter of the pore diameter of 0.45 mcm and centrifuged to produce the purified lysate. According to the second version of the method, the pH value of the lysate or the centrifugate is increased to 8.0 to 8.4 and filtered. According to the third version of the method, the Streptococcus pneumoniae cell lysate is heated to 60°C - 70°C for 30 - 50 min. It is followed by lysate centrifugation and increase of the pH value to 8.0 - 8.4, and filtration. According to the fourth version of the method, the pH value is decreased to 3.0 - 5.0 and heated to 60°C - 70°C for 30 - 50 min. It is followed by centrifugation and increase of the pH value of the lysate and the centrifugation to 8.4, and filtration.

EFFECT: group of the inventions provides producing lysates and concentrates containing purified serotype 3 polysaccharide.

20 cl, 2 tbl, 2 ex, 8 dwg

 

The technical FIELD

The present invention relates to improved methods for the reduction or removal of protein impurities from multicomponent lysate or centrifugate cells of Streptococcus pneumoniae containing polysaccharides of serotypes 3, including the steps of heating or pH adjustment.

The LEVEL of TECHNOLOGY

In the preparation of multivalent pneumococcal conjugate vaccine intended for the prevention of infectious disease caused by the bacterium Streptococcus pneumoniae (also known as pneumococcus), selected serotypes of Streptococcus pneumoniae grown to obtain polysaccharides necessary for the production of vaccines. Cells are grown in large fermenters and at the end of fermentation are lysed by adding desoxycholate sodium (DOH) or other lytic agent. Then a liquid nutrient medium with the lysate is collected for further treatment and recovery of capsular polysaccharides surrounding the bacterial cell. After conjugation to a protein carrier polysaccharide include in the final vaccine product, and in this form it provides immunity to the selected serotypes of Streptococcus pneumoniae in the target population for the vaccine.

Although the cell lysate obtained in the course of this process, contains the target polysaccharide, it also contains a large number of cell components, including DNA, RNA, proteins and prom is mediate components. Traditional treatment includes a minimal decrease in the pH of the lysate to 6.6 by adding acetic acid, which promotes the deposition lytic agent and some impurities. This material is centrifuged, then filter that removes most of the solids with a nominal amount of up to 0.45 μm. However, it was shown that the traditional methods of processing minimally reduce the amount of impurities and create additional difficulties when removing soluble proteins to ensure compliance with the specifications of purified polysaccharides.

The high content of polluting soluble protein is especially difficult when working with certain serotypes. Some serotypes, in particular Streptococcus pneumoniae type 3 produce large and viscous chain polysaccharides (e.g., for type 3, chains of glucose/glucuronic acid by weight of 2-3 million daltons)that fall into the medium during lysis of the cells. Their viscosity makes it difficult to filter after centrifugation, and, in such cases, the cleaning process does not provide sufficient removal of the protein, leading to malfunction.

Accordingly, improved methods for removing impurities proteins from complex cell lysates Streptococcus pneumoniae, in particular lysates containing polysaccharides of Streptococcus pneumoniae 3 the IPA.

BRIEF description of the INVENTION

The proposed improved ways to reduce or remove impurities proteins from multicomponent lysate or centrifugate cells of Streptococcus pneumoniae, comprising the polysaccharide serotype 3. According to one method, the lysate of cells of Streptococcus pneumoniae containing polysaccharides of serotypes 3, is heated for a time and at a temperature sufficient to denature contained in the lysate proteins and to induce their aggregation and precipitation. Accordingly, according to one implementation variant of the present invention, the method includes the following steps: 1) heating the lysate to at least 60°C for at least 30 minutes, causing aggregation and precipitation of proteins; and 2) separating the precipitated solids from the lysate; thus receive essentially cleared lysate containing the polysaccharide serotype 3. According to one particular implementation variant, the lysate is heated to about 60-70°C for approximately 30-50 minutes. According to another particular implementation variant, the lysate was heated to approximately 65°C for approximately 40 minutes. According to another implementation variant, the phase selection (separation) includes filtering the lysate with the removal of precipitated substances using a membrane filter, in particular a membrane filter with a pore diameter of 45 McMahan another implementation variant, the step of allocating includes filtering the lysate to remove precipitated substances using the volume of the filter. According to another particular implementation variant, the step of allocating precipitated substances from the lysate comprises centrifugation of the lysate to remove precipitated solids.

According to another implementation variant of the present invention, a method is proposed to reduce or remove impurities from the lysate or centrifugate cells of Streptococcus pneumoniae containing polysaccharide serotype 3, which includes the step of adjusting the pH of the lysate or centrifugate. According to this implementation variant, the step of adjusting the pH improves filterability. According to one particular implementation variant, the pH of the lysate or centrifugate increase to at least 8,0 before filtering, in particular to values in the range from 8.0 to 8.4, and more particularly to approximately 8,2. According to another implementation variant, the step of filtering includes filtering the lysate or centrifugate using a membrane filter, in particular a membrane filter with a pore diameter of 0.45 µm. According to another implementation variant, the step of filtering includes filtering the lysate or centrifugate using volume filter.

According to another aspect of the present invention, a method is proposed to reduce or remove impurities from whether the ATA or centrifugate cells of Streptococcus pneumoniae, containing polysaccharide serotype 3, which includes heating the lysate in combination with the step of adjusting the pH of the lysate or centrifugate obtained by centrifugation of the lysate. According to this implementation variant, the step of adjusting the pH improves filterability. Accordingly, according to one implementation variant, the method comprises the following steps: 1) heating the lysate to at least 60°C for at least 30 minutes, causing aggregation and precipitation of proteins; 2) centrifugation of the lysate and separating the precipitated proteins from the lysate with getting centrifugate; 3) raising the pH of centrifugate to at least 8,0; and 4) filtering centrifugate; get purified centrifugal containing polysaccharide serotype 3. According to a particular implementation variant, the lysate is heated to about 60-70°C for about 30-50 minutes before centrifugation, and more particularly to approximately 60°C for 40 minutes. According to another implementation variant, prior to filtration, the pH of centrifugate increased to values in the range of about from 8.0 to 8.4, more specifically, to approximately 8,2. According to an additional variant of implementation, the step of filtering includes filtering the lysate with the removal of precipitated substances using a membrane filter, more specifically, membrane filter with a diameter the size of pores of 0.45 μm. According to another implementation variant, the step of filtering includes filtering the lysate with the removal of precipitated substances using volume filter.

According to another implementation variant of the present invention, a method for reduction or removal of protein impurities from the lysate or centrifugate cells of Streptococcus pneumoniae containing polysaccharide serotype 3, which includes the step of adjusting the pH of the lysate or centrifugate, causing aggregation and precipitation of proteins. According to this implementation variant, the method comprises the following steps: 1) reducing the pH of the specified lysate to approximately 3.0 to 5.0, causing aggregation and precipitation of proteins; 2) centrifugation of the lysate and separating the precipitated proteins from the lysate with getting centrifugate; 3) raising the pH of centrifugate to at least 8,0; and 4) filtering centrifugate; the result is essentially purified centrifugal containing polysaccharide serotype 3. According to a particular implementation variant, the pH of the lysate before centrifugation reduced to approximately 3.0. According to another implementation variant, the pH of centrifugate before filtering increases to values in the range of approximately 8.0 to approximately 8,4, more specifically, to approximately 8,2. According to an additional variant implementation, the phase adjustment of pH for aggregation and osuzhdeni the proteins additionally includes heating the lysate to at least 60°C for at least 30 minutes, more specifically up to about 60-70°C for 30-50 minutes, and even more specifically up to about 60°C for 40 minutes. According to one additional implementation variant, the step of filtering includes filtering the lysate with the removal of precipitated substances using a membrane filter, more specifically a membrane filter with a pore diameter of 0.45 µm. According to another implementation variant, the step of filtering includes filtering the lysate with the removal of precipitated substances using volume filter.

BRIEF DESCRIPTION of DRAWINGS

The Figure 1 shows the output of polysaccharides in vitro studies of different conditions of heating and holding time for lysates serotype 3. Data are shown as percentage of the values obtained for the samples in the experiment without heating, to demonstrate the relative percentage loss (i.e. reduce the amount of protein in the treated samples (100% equivalent to the absence of losses).

The Figure 2 shows the output of proteins in vitro studies of different conditions of heating and holding time for lysates serotype 3. Data are shown as percentage of the values obtained for the samples in the experiment without heating, to demonstrate the relative percentage of the loss of protein in the treated samples (100% equivalent to the absence of losses).

Fig is re 3 shows the adjusted graph response effect of time (left) and temperature (right) at the concentration of proteins (top) and polysaccharides (PS, below) in lysates of serotype 3. Value "% retracement of the SS" and "% correction protein" represents the percentage concentrations of polysaccharides and proteins, respectively, at different values of time and temperature compared to time = 0 minutes and at room temperature (up to 100% concentrations of proteins and polysaccharides).

The Figure 4 shows a contour graph of the cumulative percentage of protein from lysates, built in the form of conditions of temperature and time. The percentage of remaining soluble protein shown in curvilinear histograms. The range of 60-70°C for 30-50 minutes a frame.

The Figure 5 shows the DDS-Na-SDS page gels showing the removal of the soluble proteins from the lysate of cells subjected to heat. Tracks with lysates, are not subjected to heating, shown on the left (IPPPN3-007), and tracks from the lysates subjected to heat, as shown to the right (IPPPN3-011).

The Figure 6 shows a photograph comparing lysates serotype 3, subjected to heating (right) and not subjected to heating (left), after precipitation during the same time.

Figure 7 shows a plot of the concentration of polysaccharides (PS), protein concentrations and relative filterability of centrifugation serotype 3 from pH centrifugate. Shows five groups of histograms corresponding to the five and experimental cycles. Concentrations of polysaccharides (mg/10 l) and protein concentrations (g/mol) is shown on the left axis of ordinates. The value of the relative filterability shown on the right ordinate axis, which corresponds to a relative force needed to push approximately 3 ml of centrifugate serotype 3 through a syringe filter with a pore diameter of 0.45 μm on a scale from 1 to 5 (1=easy, 5=hard).

The Figure 8 shows a graph showing the change of the flow velocity of the sample centrifugate serotype 3 via volume filters with time depending on the pH of centrifugate. The flow velocity (y-axis) was measured by calculating the ratios for each minute filtration time in minutes divided by the total weight of centrifugate which has passed through the filter for this moment (the smaller this ratio, the higher the flow velocity), in grams. the pH of the sample centrifugate brought to different values (5,0-8,5), and punching the samples through the filters at different constant values of pressure (5-20 pounds per square inch (psi)).

DETAILED description of the INVENTION

According to the present invention proposed improved methods of reduction or removal of protein impurities from multicomponent lysate or centrifugate cells of Streptococcus pneumoniae containing polysaccharides of serotypes 3, including the steps of heating or pH adjustment. N what are the ways lysate is heated for a time and to a temperature sufficient to denaturirovannyj proteins present in the lysate, and cause aggregation and precipitation of proteins. According to other methods, bring the pH of the lysate or centrifugate obtained by centrifugation of the lysate, to improve the filterability or to cause aggregation and precipitation of proteins. According to other methods, stages of heating and pH adjustment are combined, causing aggregation and precipitation of proteins, improves the filterability of the lysate or centrifugate. Such methods allow to obtain essentially cleared lysates or centrifugate containing polysaccharide serotype 3.

In this application, the term "essentially purified lysates containing polysaccharide serotype 3" or "essentially purified centrifugate containing polysaccharide serotype 3" represents a lysate or centrifugal cells of Streptococcus pneumoniae serotype 3, from which proteins have been removed so that the relative concentration of protein in the lysate or centrifugate is less than about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 5% or about 1% protein compared to the protein concentration in the lysate or centrifugate to remove protein. Methods of quantitative determination of the protein concentration in the lysate or centrifugate cells choir is known in the art and include, for example, polyacrylamide gel electrophoresis in the presence of dodecyl sulfate sodium (DDS-Na PAG), chromatography and electrophoresis (see, for example, Deutscher, MR (ed.), Guide to Protein Purification, San Diego: Academic Press, Inc. (1990)).

According to one implementation variant of the present invention, a method including the step of heating, ensuring the reduction or removal of protein impurities from the lysate of cells of Streptococcus pneumoniae containing polysaccharide serotype 3. The high temperatures allows to destroy the native structure of proteins and denaturing them, with no impact on polysaccharides. The result is the aggregation and precipitation of proteins, which facilitates the separation of the lysate and allows you to easily remove the solids by centrifugation or filtration. This stage of heating is potentially effective in the selection or purification of any resistant to heat polysaccharide from biological mixtures containing significant amounts of impurities soluble proteins, and therefore, it can be used in any liquid phase, where the level of proteins is a problem (for example, biological mixtures containing DNA, RNA, polysaccharides, oligosaccharides, sugars, fatty acids and lipids).

Thus, according to one implementation variant of the present invention, a method for reducing the number or UD the population of protein impurities from the lysate of cells of Streptococcus pneumoniae, containing polysaccharide serotype 3, which includes the following steps: 1) heating the lysate to at least 50°C, up to at least 55°C, or up to at least 60°C for at least 15 minutes or at least 30 minutes with the aggregation and precipitation of proteins; and 2) separating the precipitate from the lysate with obtaining essentially cleared lysate containing the polysaccharide serotype 3. According to a particular implementation variant lysate is heated to about 50-80°C. for about 15-60 minutes. According to another particular implementation variant lysate is heated to about 60-70°C for approximately 30-50 minutes. According to another particular implementation variant lysate is heated to approximately 65°C for approximately 40 minutes. According to a more detailed description section below Experiments, when the heat stable polysaccharide serotype 3 at 65°C for 40 minutes was able to remove more than 80% protein with minimal loss of polysaccharide. According to another implementation variant, the step of separating comprises centrifuging or filtering to remove or reduce the amount of protein in the lysate. In particular, according to one implementation variant, the step of separating comprises filtering the lysate with the removal of precipitated substances using a membrane filter, in particular a membrane filter with a pore size of 0.45 m is m According to another implementation variant, the step of separating comprises filtering the lysate with the removal of precipitated substances using volume filter.

Filters are typically used when filtering large volumes, for example when cleaning the polysaccharide serotype 3, include membrane (surface) filters and bulk filters. Membrane filters are mainly due to the separation of particles by size, in which all impurities are filtered solution are larger than the pore size membrane filter, remain on the filter surface. Unlike the diaphragm, the surround filters contain fibrous or granular material with a random porous structure through which pass filtered solution; the action of this filter is based mostly on random absorption and mechanical trapping of impurities in the deep layer of the material. Within the methods according to the present invention the membrane and surround filters can be used in combination, thus surround the filter will select larger impurities and surface filter will capture smaller impurities.

According to another implementation variant of the present invention is also a method for reduction or removal of protein impurities from the lysate of cells of Streptococcus pneumoniae containing polysaccharides of serotypes 3, or CE is triturate, obtained by centrifugation of such a lysate comprising the step of adjusting the pH of the lysate or centrifugate. According to this implementation variant, the step of adjusting the pH improves filterability. In this application, the term "filterability" lysate or centrifugate cells of Streptococcus pneumoniae containing polysaccharides of serotypes 3, refers to the ability of the lysate or centrifugate to pass through the filter, for example through the membrane or surround the filter. Therefore, improving the filterability of lysate or centrifugate connected, for example, with increasing flow rate lysate or centrifugate through the filter, reducing clogging of the filter lysate or centrifugation or reduced pressure which must be applied for transmission of a given amount of lysate or centrifugate through the filter.

Traditional methods of removing impurities from lysates or centrifugation cells of Streptococcus pneumoniae containing polysaccharides of serotypes 3, included minimal lowering the pH of the lysate to 6.6 by adding acetic acid, after which spent a long centrifugation and filtering through a filter with pore diameter of 0.45 µm. This method of processing demonstrates a minimal decrease in the number of impurities and resulting difficulties in relation to removal of soluble proteins using membrane or volume is introw before sending the product for cleaning. However, the methods according to the present invention relate to detection of the fact that the filterability of this high molecular weight polysaccharide can be modified as a direct function of the pH and the increase of pH of the lysate or centrifugate improves filterability without significant loss of molecular weight or functionality polysaccharide serotype 3.

Thus, according to one implementation variant of the present invention, a method for reduction or removal of protein impurities from the lysate of cells of Streptococcus pneumoniae containing polysaccharides of serotypes 3, or centrifugate obtained by centrifugation of the lysate, which includes the step of increasing the pH of centrifugate or lysate to at least 8,0 before filtering. According to another implementation variant, the pH of centrifugate or lysate before filtering increase to approximately 8.0 to 8.4 and, more specifically, to approximately 8,2. Filtering is done after adjusting the pH of the lysate or centrifugate may include filtering the lysate or centrifugate using a membrane filter, in particular a membrane filter with a pore diameter of 0.45 µm. According to another implementation variant filtering lysate or centrifugate may include the use of bulk filter.

According to another implementation variant, a method for reduction or removal of proteins is o impurities from the lysate of cells of Streptococcus pneumoniae, containing polysaccharide serotype 3, which includes the step of heating the lysate in combination with the step of adjusting the pH of the lysate. According to one implementation variant of the present method includes the following steps: 1) heating the lysate to at least 50°C, up to at least 55°C, or up to at least 60°C for at least 15 or at least 30 minutes, causing aggregation and precipitation of proteins; 2) centrifugation of the lysate and separating the precipitated proteins from the lysate with getting centrifugate; 3) raising the pH of centrifugate to at least 8.0; and 4) filtering centrifugate obtaining essentially cleared lysate containing polysaccharides of serotypes 3. According to a particular implementation variant lysate before centrifugation heated to about 50-80°C. for about 15-60 minutes. According to another particular implementation variant lysate before centrifugation heated to about 60-70°C for approximately 30-50 minutes. According to another implementation variant lysate before centrifugation heated to approximately 65°C for approximately 40 minutes. According to another particular implementation variant before filtration, the pH of centrifugate increase to approximately 8.0 to 8.4 and, more specifically, to approximately 8,2. According to an additional variant of the implementation stage of the filter is before filtering centrifugate using a membrane filter, in particular membrane filter with a pore diameter of 0.45 µm. According to another implementation variant, the step of filtering includes filtering the lysate with the removal of precipitated substances using volume filter.

According to another implementation variant, a method for reduction or removal of protein impurities from the lysate or centrifugate cells of Streptococcus pneumoniae containing polysaccharides of serotypes 3, including the step of adjusting the pH, which causes the aggregation and precipitation of proteins. According to one implementation variant of the present method includes the following steps: 1) reducing the pH of the specified lysate to less than approximately 5,0, 4,5, 4,0, a 3.5 or 3.0, or up to approximately 3.0 to 5.0, causing aggregation and precipitation of proteins; 2) centrifugation of the lysate and separating the precipitated proteins from the lysate to obtain centrifugate; 3) raising the pH of centrifugate to at least 8,0; and 4) filtering centrifugate obtaining essentially purified centrifugate containing polysaccharide serotype 3. According to a particular implementation variant before centrifugation, the pH of the lysate is reduced to approximately 3.0. According to another implementation variant, the pH of centrifugate increase to approximately 8.0 to 8.4 and, more specifically, to approximately 8,2. According to a particular variant of the implementation stage of filtering includes filtering is SATA with the removal of precipitated substances using a membrane filter, more specifically, membrane filter with a pore diameter of 0.45 µm. According to another implementation variant, the step of filtering includes filtering the lysate with the removal of precipitated substances using volume filter.

According to another implementation variant, a method for reduction or removal of protein impurities from the lysate or centrifugate cells of Streptococcus pneumoniae containing polysaccharide serotype 3, which includes the step of adjusting the pH, causing aggregation and precipitation of proteins, and also includes heating the lysate to at least 50°C up to at least 55°C, or up to at least 60°C for at least 15 minutes or at least 30 minutes, causing aggregation and precipitation of proteins. According to a particular implementation variant lysate before centrifugation heated to approximately 50°C.-80°C. for about 15-60 minutes. According to another particular implementation variant lysate before centrifugation heated to approximately 60°C-70°C for approximately 30-50 minutes. According to an additional variant of implementation of the lysate before centrifugation heated to approximately 65°C for approximately 40 minutes.

The following examples are provided to illustrate and not to limit.

EXPERIMENTAL PART

Streptococcus pneumoniae type 3 produce very cu is Phnom and viscous polysaccharide, which falls into the nutrient medium during lysis of the cells. Currently at the end of fermentation induce lysis using desoxycholate (DOH) of sodium. It is believed that the polysaccharide type 3 is very stable in a wide range of temperatures and pH; however, its viscosity makes it difficult to filter after centrifugation, allowing only small amounts of cell-free culture fluid (CFB). The following examples describe studies on the heat after lysis with the aim of denaturirovannyj and deposition of proteins, as well as adjustment of pH to improve the filterability of the lysate.

Example 1. Stage heating

Application stage heating to obtain Streptococcus pneumoniae serotype 3 due to the need to reduce the protein content before cleaning steps. Party purified polysaccharide had a tendency to fracture due to the fact that the level of residual protein in them exceeded the regulatory level of 5%/protein/polysaccharide. Therefore, to study the effectiveness and range of application stage of heating when cleaning up and getting Streptococcus pneumoniae serotype 3 were conducted the following laboratory tests. The purpose of the implementation stage of heating was to reduce the level of protein while maintaining a high level of polysaccharide.

In the laboratory the material, obtained by fermentation lysate of cells in the experimental condition is the time, poured in equal quantity in tubes Falcon™ (BD Biosciences, Bedford, MA) and was heated on a water bath to different temperatures. Investigated temperature range from 50°C to 80°C and the exposure time ranged from 15 to 240 minutes. A control sample was kept at room temperature (about 21°C). All samples were then kept overnight in the external environment, then centrifuged and passed through a syringe filter with a pore size of 0.45 μm Membrane syringe filters 25 mm HT Tuffryn®, low protein binding, Pall Life Sciences, Ann Arbor, Mississippi, USA), which received the material for the analysis of polysaccharides and proteins. The experimental data were analyzed using software for statistical data processing (Cornerstone™, Applied Systems Technologies, Inc., Dunnellon, Florida, USA) to determine the effect of temperature and time of heating on the levels of polysaccharide and protein.

The analysis of the level of polysaccharide and proteins

The analysis of the level of polysaccharides was performed by the method of HPLC-SEC (high-performance liquid chromatography - gel filtration column) using standard methods well known in the art (see, for example, Aquilar, M. "HPLC of Peptides and Proteins: Methods and Protocols, Totowa, NJ: Humana Press (2004)). The Figure 1 shows the output of the polysaccharide in the experiments at different time of heating. Data are presented as the percentage level of the policy is arid in the control experiment and 100% means no loss. As shown in Figure 1, the yield of polysaccharide was stable versus time of heating and temperature.

Data also were collected in a pilot scale; they are shown in Figure 1 as point, designated by the abbreviation "IPP". Shows time values indicate periods of heating, maintain the specified temperature and cooling. These samples were selected after heating in the current fermenter unlike heating in the laboratory. Within the range of temperatures and time of heating, studied in pilot scale (30-50 minutes and 60-70°C), loss of polysaccharide was in the range of 0-18%, and most certain in the study of the values of the losses amounted to 10% or less. These values fall into the range of acceptable values for the subsequent processing of this material.

The analysis of the level of proteins was performed using standard methods DDS-Na-SDS page (polyacrylamide gel Electrophoresis in the presence of dodecyl-sulfate sodium), are well known in the art (see, for example. Walker, J.M. "The Protein Protocols Handbook" Totowa, NJ: Humana Press (2002)). Analysis of the gels was performed using the imaging gels (imaging device with UV-photometer with the program Labworks™ V.3, UVP Inc., Upland, CA, USA) for the interpretation of the total densities of the bands (lanes) compared to standard protein.

As shown in Figure 2, the temperature from 50°C to 80°C was investigated in the laboratory, and in pilot scale (point, designated by the abbreviation "IPP"). Data are shown as percentage of control values obtained for not subjected to heat samples to show the relative percent loss at a temperature of 60°C (See Figure 2). Although at 50°C and 55°C was a significant decrease in the protein quantity, temperature 60°C was defined as the minimum for the operation of the experimental setup, because at this temperature is more reliable destruction of proteins.

The Figure 3 shows a Graph of the corrected response for the concentration of proteins and polysaccharides, built in the form of a time-dependent and temperature. The presented data show the percentage concentration of protein and polysaccharide at different values of time and temperature compared to time=0 and at room temperature (which correspond to the 100% values for protein and polysaccharide). As shown in Figure 3, the exposure time had a significant impact on the removal of soluble proteins, whereas the shutter speed more than 15 minutes of influence is not exerted. As for the output of the polysaccharide (PS), time and temperature had a limited impact on the loss of a substation (<20% loss, which is acceptable for further processing of polysaccharide).

The Figure 4 shows a contour graph of the cumulative percentage of protein from lysates gray is IPA 3, built in the shape depending on temperature and time. The percentage of remaining soluble protein shown in curvilinear histograms. Range 60°C-70°C for 30-50 minutes is framed and is a preferred range selected for the implementation phase of the heating described in this application. However, as described above, was also the analysis of a wider range, which showed the effectiveness of this range.

The Figure 5 shows the DDS-Na-SDS page gels of soluble proteins after testing stage heat at the pilot scale. The gel on the left shows the results obtained for the batch fermentation pilot scale (IPPPN3-007) without stage heating, which indicate that the protein levels do not change during the whole process of selection (before pH adjustment, after adjustment of pH, after centrifugation and after adjusting the pH in the tank). "After adjusting the pH in the tank" means a sample taken from a compendium for aging centrifugate after adjusting the pH to the required level before filtering. The cleanup process through 100 KDa longitudinal ultrafiltration (UF) along the stream used to remove dissolved substances with a molecular weight less than 100 KDa by gradual replacement of the original suspension medium in a buffer solution using a continuous blood is and filtering, and further concentrating the solution. It was shown that after the above step, the UV content of proteins in the party IPPPN3-007 was 31% protein/polysaccharide, expressed in the form/(ratio by weight of components). The final protein level after a full cleanup process amounted to 9.9% (in relative polysaccharide), and accordingly the party is not satisfied with the standard of the Final Concentration in the Party (PAC)<5% protein. For party IPPPN3-011 after exposure lysate and before allocating the target product included stage heat aged at 60°C for 30 minutes. The protein level after 100 kDa filter was 6.7%, and the protein level of the PAC was 2.5%, and accordingly the party meet intermediate standard PAC for medicines. As shown in the gel image in Figure 5 to the right, the step of heating resulted in a significant reduction of the protein level during the allocation process.

Generalized data on a pilot scale associated with the stage of heating, also presented in Table 1. In cycles -001, -004, -005, -007, and -013 not used stage heating. Among these cycles only cycles -001 and -004 satisfy the target standard for the level of protein <5% V/V, which indicates the continuing difficulties of the cleaning process, aimed at the destruction of 20-35% protein after UV. During the introduction stage of aging at elevated temperature, as shown in the Table for cycles -011, -012, -014, -015, and -017, the protein content was decreased to 3.1% and 6.7% after stage UV, and the final level of protein in the purified polysaccharide was 0.6 to 2.5%.

Table 1
The percentage of protein after ultrafiltration and in the final concentrate party (CCP) under different conditions of heating and exposure times
ProcessParty% protein UV% protein PAC
Without heatingIPPPN3-001324,8
Without heatingIPPPN3-004353,5
Without heatingIPPPN3-005207,4
Without heatingIPPPN3-007319,9
Without heatingIPPPN3-013226,1
Heating To 60°C/30 mi the IPPPN3-0116,72,5
Heating to 70°C/50 minIPPPN3-0124,31,7
Heating to 65°C/40 minIPPPN3-0143,10,9
Heating to 65°C/40 minIPPPN3-0153,70,6
Heating to 65°C/40 minIPPPN3-0173,41,7

Introduction stage heating also increased the separation efficiency by increasing aggregation of the protein, which has resulted in a more efficient centrifugation. The impact of the introduction of this stage is shown in Figure 6, which presents a photograph comparing the lysate of cells not subjected to heating (left), and the lysate of the cells subjected to heating (right), after soaking over night in the external environment, without stirring. Environment has become much more transparent after heating, indicating a more intense aggregation and precipitation of protein.

According to the data described above, the introduction of stage n is grovania was important to remove protein impurities in the production of polysaccharide. The final polysaccharide meet the interim criteria for the production of drugs <5%/(protein/polysaccharide), which indicates the stability of the product in relation to thermal processing.

Example 2. The phase adjustment of pH and filter

Traditional filtering polysaccharides of Streptococcus pneumoniae, comprising the vaccine Prevnar®, included prolonged centrifugation of lysates of cells and further filtered through volume and membrane filters. As described above, Streptococcus pneumoniae type 3 is a large polysaccharide, which is viscous in solution, and it cannot be filtered out in the normal processing. In view of these problems, has been working to change the filtering characteristics of this polysaccharide. Accordingly, studies have been conducted, aimed at finding tools that could improve the filterability of solutions of polysaccharide serotype 3. Using pH as a variable parameter, the lab has conducted initial studies on the effect of pH on the removal of proteins and subsequent filterability solutions lysate serotype 3 through syringe filters 25 mm in diameter with a pore size of 0.45 μm HT Tuffryn® (Pall Life Sciences, Ann Arbor, Michigan, USA). Before centrifugation, the pH of the lysate samples serotype 3, subjected to fermentation, brought to 6.6 (two series of experiments), 5,0 (two series exp is Simantov) or 3.0 (one series of experiments) using acetic acid or sulfuric acid, to remove soluble proteins. Lysates were centrifuged and poured into test tubes Falcon™ (BD Biosciences, Bedford, mA, USA) under conditions corresponding to one of the four options, in which the pH is brought with 3n NaOH (sodium hydroxide solution): 1) control (without pH adjustment); 2) adjust pH to 7.0; and 3) adjust pH to 8.0; and 4) adjusting the pH to 9.0. Then centrifugate punching through syringe filters with a pore diameter of 0.45 μm with a relative force needed to filter approximately 3 ml of the material.

The results obtained in five series of experiments, described above, are presented in Figure 7, a graph of dependence of the concentration of polysaccharide (PS), protein concentrations and relative filterability of centrifugation serotype 3 from pH centrifugate.

Concentrations of polysaccharide (mg/ml) and protein concentrations (g/10 l) is indicated along the ordinate axis on the left. The value of the relative filterability is indicated along the ordinate axis on the right, and they correspond to the relative force that must be applied to penetrate approximately 3 ml of centrifugate serotype 3 through a syringe filter with a pore diameter of 0.45 μm on a five-point scale (1=easy, 5=hard). As shown in Figure 7, with a higher pH level in all experimental cycles, except for one, watched improving filterability. The results, given the data in Figure 7, it was also demonstrated that very low pH value of 3.0 provides successful removal of protein, but makes it difficult to filter.

On the basis of the identified effects of pH were conducted controlled laboratory studies to determine the effect of pH on the filtration ability. Material after centrifugation has been experienced in the installation and re-centrifuged in the laboratory. The lysate was separated, and the pH was brought to values in the range of 5.0 to 8.5. The lysate was placed in a pressure chamber in which is maintained a constant pressure. The lysate was poured into the tubes via volume filter CUNO 60SP (CUNO Inc., Meriden, Connecticut, USA), and analyzed the bandwidth of the filter. This procedure was performed for each test pH (5,0-8,5) and for dierent values of the constant pressure (5-20 pounds per square inch (psi)). The results are shown in Figure 8, which shows a comparison of the dependences of the flow velocity of the sample centrifugate via volume filters from time to time as a function of pH centrifugate. The flow velocity (y axis) was measured by calculating the ratios for each minute filtration time in minutes divided by the total weight of centrifugate in grams, passed through the filter at this moment (the smaller this ratio, the higher the flow velocity). As shown in Figure 8, the passage at high pH 7,0-8,5 characterized Bo is its high flow rate compared to the passage at lower pH 5.0-6.0 with the same value of constant pressure (10 psi). At pH 8.0, at a constant pressure of 10 psi or 20 psi flow rate was also higher than at a pressure of 5 psi.

Next carried out experimental runs, including the above-described phase adjustment of pH (experimental runs below in Table 2). Bottles for sowing, containing the inoculum of Streptococcus pneumonias 3 type were grown in fermentors. The cells were subjected to chemical lysis and lysate or centrifuged, or subjected to heat and then centrifuged. After centrifugation drove pH (except cycle IPPPN3-015), and the lysate was filtered through a surround filters and membrane filters with a pore diameter of 0.45 μm before the subsequent treatment stage. The number of filters required for the processing of lysate obtained from different experimental cycles were taken for measure point (the lower filterability result in more frequent clogging of filters and more filters need to handle lysate). The data in Table 2 indicate that processing of the lysate obtained in different cycles with pH adjustment to different levels of 7.5 and above, with heat treatment or without it, it took only one volume and one membrane filter. In the cycle -015 estimated the effect of pH 6.6 on filterability. As shown by the data for cycle -015 for processing only 37 l took three sets of filters. These results were obtained even if the cycle is -015 stage heating to remove proteins. After adjusting the pH of the remaining material of the lysate from the cycle -015 to a value of 8.2 processing the remaining 68 l demanded one set of filters.

Table 2
Filterability lysates after adjustment of pH in cycles laboratory scale
CyclepHVolumeSurround filtersMembrane filtersTemperature, °CThe time of heating/cooling (min)
IPPPN3-0018,082 l11N/aN/a
IPPPN3-0037,580 l11N/aN/a
IPPPN3-0049,090 l11N/aN/a
IPPPN3-0068,585 l11N/aN/a
IPPPN3-0078,596 l11N/aN/a
IPPPN3-0108,088 l11N/aN/a
IPPPN3-011*8,285 l116042/30/43
IPPPN3-012*8,286 l117055/50/45
IPPPN3-0138,190 l11N/aN/a
IPPN3-014* 8,2103 l116552/40/51
IPPPN3-015*8,237 l336552/40/52
IPPPN3-015*8,268 l116552/40/52
IPPPN3-016*8,287 l116553/40/43
*The lysate was subjected to heat treatment before centrifugation.

On the basis of laboratory data presented in Figure 7 and Figure 8, and adjustment of pH in the experimental environment for processing as the preferred range of pH, improves filterability lysates serotype 3, set pH 8,2±0,2.

In this application, the terms in the singular include one or more (i.e. at IU is e one) of the denoted objects. For example, "an element" means one or more elements.

All publications and patent applications mentioned in the detailed description indicate the level available to the expert in the field that applies the present invention. All publications and patent applications included in this application by reference to the same extent as if each individual publication or patent application was specifically and individually indicated by reference.

Although the above present invention is described in some detail by way of illustration and examples for purposes of better understanding, some changes and modifications within the scope the appended claims.

1. The method of purification of polysaccharides of Streptococcus pneumoniae serotype 3 protein impurities, comprising the following steps:
A. heating the lysate at least up to 60°C for at least 30 min in order to cause aggregation and precipitation of proteins; and
B. separating precipitated solids from the specified lysate with obtaining essentially cleared lysate containing the polysaccharide serotype 3.

2. The method according to claim 1, characterized in that step a) includes heating the specified lysate to 60-70°C.

3. The method according to claim 2, characterized in that step a) includes heating the specified lysate for 30-50 minutes

4. The method according to claim 3, characterized in that the step which includes heating the specified lysate to at least 65°C for 40 minutes

5. The method according to claim 1, characterized in that step b) includes filtering the specified lysate with the implementation of the removal of precipitated solids from the specified lysate.

6. The method according to claim 5, characterized in that the lysate is filtered using at least one filter selected from the group comprising a membrane filter and surround the filter.

7. The method according to claim 6, characterized in that the membrane filter is a membrane filter with a pore diameter of 0.45 µm.

8. The method according to claim 1, characterized in that step b) comprises centrifuging the specified lysate with removing precipitated solids from the specified lysate.

9. The method of purification of polysaccharides of Streptococcus pneumoniae serotype 3 protein impurities, comprising the steps:
A. increasing the pH of the specified lysate or centrifugate cells of Streptococcus pneumoniae to at least 8,0; and
B. filtering the lysate or centrifugate obtaining essentially cleared lysate containing the polysaccharide serotype 3.

10. The method according to claim 9, characterized in that the pH of the specified lysate or centrifugate before filtering increased to values ranging from 8.0 to 8.4.

11. The method according to claim 10, characterized in that the pH of the specified lysate or centrifugate before filtering to increase the value of 8.2.

12. The method according to claim 9, characterized in that the lysate is filtered using at least the aqueous filter, selected from the group comprising a membrane filter and surround the filter.

13. The method according to item 12, characterized in that the membrane filter is a membrane filter with a pore diameter of 0.45 µm.

14. The method of purification of polysaccharides of Streptococcus pneumoniae serotype 3 protein impurities, comprising the steps:
A. heating the lysate of cells of Streptococcus pneumoniae of at least 60°C for at least 30 min in order to cause aggregation and precipitation of proteins;
B. centrifugation specified lysate and separating the precipitated proteins from the lysate with getting centrifugate;
C. raising the pH of the specified lysate or centrifugate at least to 8.0; and
G. filtering the specified lysate with obtaining essentially cleared lysate containing the polysaccharide serotype 3.

15. The method according to 14, characterized in that step a) includes heating the specified lysate to a temperature of 60-70°C.

16. The method according to 14, characterized in that step a) includes heating the specified lysate for about 30-50 minutes

17. The method according to 14, characterized in that step a) includes heating the specified lysate to 60°C for 40 minutes

18. The method according to 14, characterized in that step C) comprises raising the pH of the specified centrifugate to values in the range from 8.0 to 8.4.

19. The method according to p, characterized in that step C) comprises raising the pH of the decree is sent to the steering centrifugate to 8.2.

20. The method according to 14, wherein step d) includes filtering the specified centrifugate using at least one filter selected from the group comprising a membrane filter and surround the filter.

21. The method according to claim 20, characterized in that the membrane filter is a membrane filter with a pore diameter of 0.45 µm.

22. The method of purification of polysaccharides of Streptococcus pneumoniae serotype 3 protein impurities, comprising the steps:
A. lowering the pH value of the specified cell lysate Streptococcus pneumoniae to values in the range from 3.0 to 5.0, with the implementation of the aggregation and precipitation of proteins;
B. centrifugation specified lysate and separating the precipitated proteins from the lysate with getting centrifugate;
C. raising the pH of the specified lysate or centrifugate at least to 8.0; and
G. filtering the specified lysate with obtaining essentially cleared lysate containing the polysaccharide serotype 3.

23. The method according to item 22, wherein step a) includes lowering the pH of the specified lysate to 3.0, with the implementation of the aggregation and precipitation of proteins.

24. The method according to item 22, wherein step C) comprises raising the pH of the specified centrifugate to values in the range from 8.0 to 8.4.

25. The method according to paragraph 24, wherein step C) comprises raising the pH of the specified centrifugate to 8.2.

26. The method according A.25 different is eat, that said centrifugal filtered using at least one filter selected from the group comprising a membrane filter and surround the filter.

27. The method according to p, characterized in that the membrane filter is a membrane filter with a pore diameter of 0.45 µm.

28. The method according to item 22, wherein step a) further includes heating the specified lysate to at least 60°C for at least 30 minutes

29. The method according to item 22, wherein step a) further includes heating the specified lysate to 60-70°C.

30. The method according to item 22, wherein step a) further includes heating the specified lysate for 30-50 minutes

31. The method according to item 22, wherein step a) further includes heating the specified lysate 60°C for 40 minutes



 

Same patents:

FIELD: medicine.

SUBSTANCE: set contains one base pair showing activity of upstream and downstream primers, and a probe having the following structure: 5' CAAGNACTTCTGTTNCCCCGGACYGA 3'; 5' ATNTNTC AATTGTCANCATAAGC AGCC A 3'; F AM -5' CCTYCGGCNCCTGAYTGCGGCTAATCC 3'-BHQ1.

EFFECT: invention enables high-accuracy identification of the genetic material of human enteroviruses A, B, C, D.

4 dwg, 1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry and a method of producing comenic acid. The method is characterised by that it involves fermentation of the Gluconobacter oxydans-03 strain in a medium containing glucose - 35.0 g/l, yeast extract - 1.17 g/l, disubstituted ammonium phosphate - 0.619·10-3 g/l, monosubstituted potassium phosphate - 0.12·10-3 g/l, at temperature 28°C with forced aeration by 1.5-2.0 volume of air per 1 volume of medium per minute for 66-78 hours until obtaining gluconic acids: gluconic, 2-keto-gluconic, 5-keto-gluconic, 2,5-diketo-gluconic; Gluconobacter oxydans-03 cells are deposited by heating the culture fluid to 80-85°C for 0.5 hours in the presence of bentonite until formation of a residue; the supernatant fluid is filtered; the obtained filtrate which contains comenic acid and gluconic acids is deposited on anionite AV-17-8 chS, while adding sodium bicarbonate to obtain sodium salts of comenic acid and gluconic acids; 17-19% hydrochloric acid solution is added to form a residue containing comenic and gluconic acids; comenic acid is separated from gluconic acids by washing the residue with iced water or iced water-alcohol solution with water to alcohol ratio of 3:1, wherein 10 ml of the solution per 1 g of residue is used.

EFFECT: invention enables to obtain high-purity comenic acid.

6 ex

FIELD: medicine.

SUBSTANCE: method provides grinding a pathological biomaterial to be homogenated to prepare a suspensions. The prepared suspension is added with 3-5% citric acid at the basis of its content in the suspension. It is kept for 20-30 minutes at 10-20°C and added with 3-4% succinic acid and kept for 20-30 minutes at 10-20°C that is followed by neutrilising the suspension with 5-10% ammonium and reducing to pH 7.5-7.6. The neutrilised suspention is settled for 20-30 minutes; a supernatant is rinsed, and the precipitation is inoculated with a nutrient medium containing in 1 l of distilled water citric acid 8.0 g, ammonium citrate 2.0 g, succinic acid 3.0 g, asparagine or glycine 2.0 g, di-basic potassium phosphate 5.0 g, magnesium sulphate 0.5 g, zinc sulphate 0.3 g, di-basic sodium phosphate 3.0 g, sodium chloride 5.0-6.0 g, ferrous sulphate 0.1 g and glycerin 40-50 ml at pH 7.5-7.6. To produce the solid agar medium, the fluid medium diluted in distilled water 1:1 is added with agar 2.5 g per the fluid medium 100 ml, and sodium chloride is reduced to 5-6%.

EFFECT: invention allows reducing staphylococcus recovery time.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: technique involves DNA recovery from the biomaterial and real-time polymerase chain reaction with using probes marked by fluorescent dyes and fluorescence extinguishers. It involves preparing two reaction mixtures one of which contains the primers atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc and the probe FAM-cgttcggctc ggcatctcga tattccc-BHQ1, while the other one contains the primers ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca and the probe Joe-gtatccggct atgcgccgag tttgg BHQ1. The polymerase chain reaction is real-time at primer annealing temperature 55-62C in 30-45 cycles with continuous fluorescence control, its increment observing in one or more reaction mixtures enables diagnosing the presence of agrobacteria in the samples.

EFFECT: invention enables extending the range of genotypes of the diagnosed agrobacteria.

5 cl, 7 dwg, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention discloses a method for preparing a major protective antigen of a cholera vibrio of cholera toxin B subunit. The method involves deposition of a protein fraction from filtered broth culture of the recombinant strain other than 01 serogroup Vibrio cholerae KM93 (State Collection 'Microbe'). The deposited protein fraction is used to recover the B subunit to be purified by three-step column TSK HW-60 gel penetration chromatography. The purified preparation of the B subunit is applicable for producing anti-toxin serums, high-specific immunoglobulin and diagnostic test systems, as well as an ingredient of vaccine preparations.

EFFECT: use of the invention enables higher yield of the high-purity native immunogenic preparation of the cholera toxin B subunit.

2 dwg, 1 tbl

FIELD: medicine.

SUBSTANCE: method involves the PCR-amplification of the 16S rRNA fragment with the use of specific original oligonucleotide primers SEQ ID No: 1 and SEQ ID NO: 2. It is followed by the PCR biotinylation of the primer SEQ ID No: 1 which enables detecting the nucleotide sequences of the 16S rRNA by simple one-chain solid-phase sequencing with the use of specific original sequencing primers SEQ ID No: 3, SEQ ID NO: 4 and SEQ ID NO: 5. The mycobacteria are precisely identified by comparing certain sequences with common sequences of various types of mycobacteria in the database.

EFFECT: invention enables identifying mycobacterioses in the samples of pathological material.

4 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains solid and liquid phases. The solid phase of the nutrient medium contains a pancreatic digest of fish meal, a hemophilic bacteria growth stimulator, sodium chloride, yeastrel, glucose, agar, 2% potassium tellurite and distilled water in the preset proportions. The liquid phase contains the pancreatic digest of fish meal, enzymatic peptone, sodium chloride, yeastrel, glucose, cattle blood serum and distilled water in the preset proportions.

EFFECT: invention allows higher sensitivity of the medium, germination value and growth rate of diphtheria bacteria.

3 ex

FIELD: medicine.

SUBSTANCE: SLURP-1 peptide is prepared by transformation of competent cells Escherichia coli BL21 (BE3) by recombinant plasmid DNA pET22b(+)/SLURP-1.

EFFECT: invention provides higher effectiveness of SLURP-1 protein synthesis in cells Escherichia coli.

2 cl, 3 dwg, 1 tbl, 6 ex

FIELD: agriculture.

SUBSTANCE: strain of bacteria Bacillus thuringiensis 846-Bt was isolated from a natural source and deposited in the collection of All-Russian Research Institute of agricultural microbiology numbered 00045.

EFFECT: strain of bacteria Bacillus thuringiensis RCAM 00045 provides deaths of all the greater wax moth larvae of 6-4 ages.

1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: method involves adding an additive containing biomass of microorganisms into waste water with initial pH 5.5. The microorganisms used are at least one of the following types: Rhodotorula glutiuius in amount of 14-6 mg/m3, Trihoderme viridae in amount of 23-1 mg/m3, Chaetomium globosum in amount of 25-15 mg/m3.

EFFECT: invention enables to increase treatment efficiency by accelerating the process.

3 tbl

FIELD: chemistry.

SUBSTANCE: method involves passing a solution of lipopolysaccharide Shigella flexneri 2a in a 0.05 M triethylammonium acetate buffer at pH 4.7, which contains 10% n-propanol, through a column with a hydrophobic carrier which is Octyl Sepharose CL-4B, and then washing the column with the same buffer solution.

EFFECT: method can be used to produce carriers which enable extraction and purification of specific antibodies to lipopolysaccharides using affinity chromatography.

1 ex

FIELD: chemistry.

SUBSTANCE: methods involve obtaining a bacterial cellulose product through fermentation, possible lysis of bacterial cells from the bacterial cellulose product, mixing it with at least one polymeric thickener or precipitating agent and coprecipitation of the obtained mixture with alcohol. The bacterial cell lysis step can be performed after mixing with the precipitating agent. The polymeric thickener used can be at least one charged cellulose ester, at least one precipitating agent or combination thereof. The composition obtained using said method, having improved rheological properties and containing bacterial cellulose, has viscosity of at least 300 cP (300 mPa·s) and tensile yield 1.0 dine/cm2 (0.1 N/m) when more than 0.36 wt % of it is put into a 500 ml water sample and after application of not more than two passages in an extensional homogeniser at pressure 1500 lb/in2 (10342.5 kPa).

EFFECT: improved rheological properties of the composition.

31 cl, 20 ex

FIELD: medicine.

SUBSTANCE: what is offered is a method of making a construct containing crystal cellulose. Cellulose-forming organisms are grown at least partially in a hollow template made by means of a three-dimensional printer. What is offered is a method of making the hollow template by means of the three-dimensional printer which grows portions of the hollow template in layers from a modelling material.

EFFECT: invention can be used for making the construct which can be successfully used as an implant or for cultivation of mammal or human living cells.

16 cl, 7 dwg

FIELD: chemistry.

SUBSTANCE: starting high-molecular chitosan is dissolved in acid solution. The chitosan dissolved in the acid is then precipitated by adding alkali solution. The re-precipitated high-molecular chitosan is washed from the formed salt and excess alkali using a coarse-porous filter. The re-precipitated chitosan is dissolved in acid solution until achieving pH 5.5. An enzyme preparation is then added and hydrolysis is carried out. The reaction is stopped after formation of low-molecular chitosan.

EFFECT: method is characterised by avoiding the need to remove salts from the enzymatic mixture and the end product, as well as low level of loss of material.

2 dwg, 7 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: polysaccharide contains galactose, glucose, ramnose as monosaccharide components and pyruvic acid bound with any of the monosaccaride components. Molar content of galactose, glucose and ramnose in polysaccharide is in ratio 4:2:1, quantity of pyruvic acid being from 4 to 7% in weight. Said polysaccharide has structure, represented by formula (I): Polysaccharide is obtained by cultivation in anaerobic conditions of strain Bifidobacterium longum JBL05 (NITE BP-82) - polysaccharide producent. Also claimed are immunostimulator and moisturising means representing said polypeptide.

EFFECT: increase of moisturising and immunostimulating activity.

5 cl, 6 dwg, 6 ex

FIELD: chemistry.

SUBSTANCE: according to the method, wood raw material undergoes coarse grinding first and resinous substances are then extracted, after which the obtained product undergoes fine grinding and mechanical activation. The installation has for coarse grinding wood raw material, apparatus for extracting resinous substances and apparatus for fine grinding and mechanical activation arranged in series.

EFFECT: invention simplifies the method of preparing wood raw material and increases output of sugars from said material at the fermentolysis step.

8 cl, 1 dwg, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: there is offered a method for preparing low-molecular heparins by enzymatic degradation. For enzymatic depolymerisation, immobilised lysozyme is used.

EFFECT: prepared low-molecular heparin shows higher inhibitor activity with respect to blood coagulation factor Xa and lower inhibitor activity with respect to thrombin in comparison with initial heparin.

2 tbl, 3 ex

FIELD: food industry.

SUBSTANCE: method provides for depth cultivation of basidium fungi Pleurotus ostreatus on nutrient medium of the following composition (g/l): soya flour - 21, KH2PO4 - 3.5, MgSO4 - 0.4, milk whey - 200 ml, water - up to 1 litre. Mycelium is exposed to deep freezing with further defrosting. Then its disintegration is carried out. Food fibres are cleaned by alternating treatment with cold and hot water, mix of 1 M sodium carbonate or sodium hydroxide with ethanol in the ratio of 1:2 and 0.5 M solution of citric acid. Yield of food fibres makes 16-18% of dry biomass, content of chitin - 16-19%, glucan - 40-50% of dry mass of food fibres.

EFFECT: food fibres with high content of chitin.

4 ex

FIELD: medicine.

SUBSTANCE: invention refers to immunology and biotechnology. There is offered method of cleaning bacterial capsular polysaccharide Neisseria meningitidis or Haemophilus influenzae. Polysaccharide is precipitated with using a cationic detergent, gathered, solubilised with pure ethanol or mixed ethanol:water with final concentration of ethanol 50% to 95%, filtered and then precipitated with calcium or sodium salts. There are described versions of the method of preparing the vaccines with using cleaning capsular polysaccharide. There is disclosed the method for solubilisation of capsular polysaccharide.

EFFECT: application of the invention ensures simple and fast method of cleaning capsular polysaccharide that can find application in medicine for preparing the vaccine.

26 cl, 10 dwg, 24 tbl

FIELD: agriculture.

SUBSTANCE: method for production of agarose includes preparation of dry sea algae Gracilaria spp., preferably, Gracilaria dura from natural sources or cultivated in polyethylene bags or on rafts, treatment of dry algae with alkali. Treated algae are washed with water till pH of washing waters makes from 7 to 8, water is added. Autoclaving and further homogenisation are carried out with production of extract. Extract is treated with activated carbon and celite at the temperature of 85-95°C to prepare hot extract. Vacuum filtration of extract is carried out through a layer of celite. Filtrate is frozen with preparation of mass, and produced mass is thawed. In order to remove thawed liquid, product produced at the stage of freezing and thawing is compressed and further squeezed. Agarose produced as a result of this process is dissolved in water by means of heating in autoclave. Stage of freezing and thawing, as well as product compressing and squeezing are repeated. Produced product is dissolved in water and dried by means of spraying to produce finely dispersed powder. Agarose is also suggested, which is produced by specified method.

EFFECT: invention makes it possible to produce agarose with high strength of gel and low temperature of gel formation Strength of 1% gel makes ≥1900g/cm2, and gel formation temperature makes 35-35,5°C.

6 cl, 6 tbl, 8 ex

FIELD: food industry.

SUBSTANCE: invention is related to biotechnology. The method is as follows: The microbial preparation represented by a suspension of equal combination of Bacillus subtilis TNP-3 and Bacillus subtilis TNP-5 bacteria strains (at a concentration of 1·109 CFU/ml) suspended in 1%-glucose solution is non-recurrently introduced 10 days after planting by way of spraying and irrigation with consumption rate equal to 100 ml per bush.

EFFECT: invention allows to enhance the efficiency of control over strawberry affection by the fungous disease (grey rot).

4 tbl

Up!