Set of oligodeoxyribonucleotide primers and fluorescent-marked probes for enterovirus rna identification by reverse transcription - polymerase chain reaction with hybridisation fluorescent detection

FIELD: medicine.

SUBSTANCE: set contains one base pair showing activity of upstream and downstream primers, and a probe having the following structure: 5' CAAGNACTTCTGTTNCCCCGGACYGA 3'; 5' ATNTNTC AATTGTCANCATAAGC AGCC A 3'; F AM -5' CCTYCGGCNCCTGAYTGCGGCTAATCC 3'-BHQ1.

EFFECT: invention enables high-accuracy identification of the genetic material of human enteroviruses A, B, C, D.

4 dwg, 1 tbl, 1 ex

 

The invention relates to kits for the detection of genetic material (RNA) of enteroviruses in clinical or autopsy samples, samples of the external environment with the aim of diagnosis, epidemiological investigation, and to solve research tasks for studying properties of enteroviruses biotechnology and can be used in medicine and epidemiology. Using diagnostic primers it is possible to identify the genetic material (RNA) of human enteroviruses a, b, C, D.

Enteroviruses are United in the genus Enterovirus, which belongs to the family Picornaviridae. According to the latest version of virus classification adopted by the International Committee on taxonomy (http://www.ncbi.nlm.nih.gov/ICTVdb/lctv/index.htm based on molecular-biological characteristics of the virus, enteroviruses human grouped into four types (human enteroviruses a, b, C, D), polioviruses included in the human enteroviruses C.

Detection of enteroviruses is an important task for health care, because at the moment, even during outbreaks of enteroviral infection laboratory is able to confirm only 45-70% of the samples [Kuznetsova V.G., Mechetina A.A., Denisov A.A., A.V. Demin and other Clinico-epidemiological characteristics of enteroviral meningitis according to the flash 2004 // proceedings of the XV Scientific-great the political conference of physicians. Novosibirsk, 2005. 415-416]. While the etiology of most infectious absentem, viral intestinal infections, acute respiratory infections and serous meningitis remains unspecified. An important task is to control the circulation of poliovirus in the environment and the timely identification of patients and carriers, as evidenced by recent cases of introduction of the infection from Tajikistan in our country [http://www.interfax.ru/news.asp?id=141999, http://rospotrebnadzor.ru/documents/proto/27880/].

Enteroviruses belong to the RNA-containing viruses, and their titer in the samples, usually quite low, so in some cases in the samples enteroviruses not detected or the data are mixed. Selection of high-quality primers is a complex procedure because the human enteroviruses are more than 100 serotypes and genetically variable even within the same genotype.

Currently in Russia for PCR diagnosis of enteroviruses used PCR system with detection results by the method of electrophoresis production of the following companies: JSC "Biohimik" (http://www.biochemmack.ru/product/moleculardiagnostics/infectious/), CJSC "Licej" (reagent kits for PCR production "Isogen") (http://www.lytech.ru/catalog_69.htm). Set with hybridization-fluorescence detection produced by the company "Interlabservice (znii, Russia), (http://www.interlabservice.ru/catalog/reagents/index.php?sid=678).

It is known IP is the use of a set of oligonucleotide primers, manufactured by LLC "Licej" (Moscow) for the detection of enterovirus RT-PCR (RF patent No. 2313792, IPC G01N 33/50, C12Q 1/68, publ. 27.12.2007,

The well-known set of oligonucleotide primers for RT-PCR used in the detection and differentiation of RNA enterovirus (RF patent No. 2189396, IPC C12Q 1/68, publ. 20.09.2002,).

However, the above analogues, including the well-known commercial test systems, allow us to determine the genus enterovirus, but do not allow to determine the serotype. For example, in the set of Real-Time PCR (with hybridization-fluorescence detection) of the company "Interlabservice can be obtained fragment length only 190 i.e. that does not allow for determination of the nucleotide sequence with subsequent genotyping.

Existing test systems do not allow to determine the amount of viral RNA in the sample. In the proposed set can be used control samples with known concentration for the detection of viral load in the sample under investigation.

The closest analogue (prototype) is an application for U.S. patent No. 20110045458, IPC C12Q 1/70, publ. 24.02.2011, "Detection of enteroviruses", which shows the primers and probes for conserved region of the 5'UTR of the RNA genome of enteroviruses.

However, the above-mentioned primers and probes differ in structure from the primers and probe proposed in Appl the reception technical solution. Developed by the authors set oligodeoxyribonucleotide primers and fluorescently-labeled probe provides the ability to get a fragment of up to 450 n, which allows genotyping of enteroviruses based on the nucleotide sequence of the amplicon with greater accuracy.

The technical result of the claimed invention to provide such a set oligodeoxyribonucleotide primers and fluorescently-labeled probe that would define not only kind, but serotypes of enterovirus with greater accuracy.

This technical result is achieved by obtaining a set oligodeoxyribonucleotide primers and fluorescently labeled probes for identification of enterovirus RNA by the method of reverse transcription polymerase chain reaction (RT-PCR) with hybridization-fluorescence detection in clinical specimens and the environment, containing 1 pair of oligonucleotides having the activity of forward and reverse primers, and a probe having the following structure:

5'→3' 5' CAAGNACTTCTGTTNCCCCGGACYGA 3'

3'←5' 5' ATNTNTCAATTGTCANCATAAGCAGCCA 3'

FAM -5' CCTYCGGCNCCTGAYTGCGGCTAATCC 3'- BHQ1

Declare the set obtained by:

- design of diagnostic primers and fluorescently-labeled probe on a conserved region of the 5'UTR of the gene enteroviruses;

- constructing recombinant plasmids the th DNA pCR 2.1 (TORO), carrier specific for enterovirus DNA-matrix.

Conditions for amplification were optimized according to the following parameters: concentration of magnesium ions, the concentration of primers and probes in the reaction mixture; the temperature of annealing of primers and probe.

At the initial stage for all kinds of human enteroviruses a, b, C, D were selected and synthesized specific oligonucleotide primers and a probe for hybridization-fluorescence detection of PCR products. To do this in the database of GenBank using the software BLAST (http://www.ncbi.nlm.nih.gov/) were selected as the most conservative parts of the genome (5'UTR) of all types of human enteroviruses (a, b, C, D). Analysis of the properties of oligonucleotide primers and probes were conducted using the software Vector NTI 9.0.0 (InforMax). The results are shown in table and figure 1.

Table
The structure of the set of inventive primers for detection of enterovirus RNA in clinical specimens and the environment FROM RT-PCR with hybridization-fluorescence detection
The structure of the primer (5'->3')NameT annealing (°C)Localizar the I genome
CAAGNACTTCTGTTNCCCCGGACYGAF903-306072-98 (5'UTR)
ATNTNTCAATTGTCANCATAAGCAGCCAR41-3260493-521 (5'UTR)
FAM-CCTYCGGCNCCTGAYTGCGGCTAATCC-BHQ1Z95173354-381 (5'UTR)

It is important to note that the development of conditions for RT-PCR carried out by us exclusively using commercially available enzymes and device for amplification, designed for mass use in diagnostic laboratories in Russia. This fact allows simple, quick and reliable to apply this invention in laboratory practice.

Inactivation of samples and isolation of RNA was performed under the conditions regulated by the guidelines MU 1.3. 2569-09 "Organization of work of the laboratories using methods of nucleic acid amplification when working with material containing microorganisms of I-IV groups of pathogenicity".

The procedure of extracting RNA from the investigated material was performed using a set of reagents "RIBO-Sorb" (znii, Russia) in accordance with instructions for use.

The reverse transcription reaction was performed using the receiving of a set of reagents "Reverta-L" (znii, Russia) in accordance with instructions for use.

For PCR in real time was preparing a mixture of the components of the following composition (based on one sample in a 30 μl mixture): 0.2 mm of each deoxynucleotide, 1.5 mm MgCl2, 30 mm Tris-HCl (pH 8.5 at +25°C), 16 mm (NH4)2SO4, 0.1% of Nonidet P40 (Sigma), 15 μm, specific oligonucleotide primers, probe (concentration of 5-10 μm) and 1,5U/30µl of Taq DNA polymerase (SibEnzyme", Russia).

As a negative control sample in the reaction mixture was added to THE buffer.

RT-PCR in real time and check the results was performed in the device "Rotor Gene 6000" (Corbett) Green (470 nm /510 nm).

The programming of the amplifier / experimental parameters:

1. Hold/Hold temperature95°C - 5 min
2. Cycling/Cycling (10 cycles)95°C - 10 sec
60°C 60 sec
3. Cycling 2/Cycling 2 (35 cycles)95°C - 10 sec
60°S - 60 s - detection

4. The fluorescence is measured at the temperature of annealing of the primers on the channel FAM/Green.

The results were evaluated by cash is Chiyo fluorescence to 30-th cycle, which are shown in the graph, figure 2. Figure 2 shows curves 1-5 - positive for enterovirus samples; curve 6 - positive control; curve 7 is the negative control and other negative samples.

Additionally, the results were evaluated for the presence of DNA fragments strip which was located at the same level in the gel, and the band marker of molecular weight corresponding to the sizes of the DNA fragments 450 BP (Fig 3) for enteroviruses. Electrophoresis was conducted in a 2.5%agarose gel for detection of DNA isolated from vaccinated material. Tracks: 1-5 - positive for enterovirus samples; 6 - molecular weight marker.

Positive control samples were obtained by molecular transformation of competent bacterial cells of Escherichia coli TOP 10 recombinant plasmid pCR 2.1, including synthetic insert DNA corresponding to a selected part of the genomic RNA of the enterovirus.

Analysis of the effectiveness of molecular transformation was carried out by PCR in real time in accordance with the Protocol described above, where in the reaction mixture instead of cDNA was added to 3 μl of the concentrate plasmids pCR, bearing the cDNA insert corresponding to the parts of the genome of enteroviruses.

To test the created diagnostic system as an exemplary analysis is used in clinical material (cerebral spinal fluid and faeces) from patients with serous meningitis, as well as plasmid DNA obtained by the selection of competent bacterial cells of Escherichia coli, transformed bacterial plasmids pCR, involves inserting a cDNA corresponding to detektivami parts of the genome of enteroviruses.

The study was performed in compliance with the principles of voluntariness and confidentiality in accordance with the basic laws of the Russian Federation on health protection of citizens" (as amended Decree of the President of the Russian Federation from 24.12.1993 T, Federal laws No. 30-FZ dated 02.03.1998 No. 214-FZ, dated 20.12.1999). The Respondent and specimen collection was performed after obtaining written informed consent. The procedure of study approved by the ethics Committee of the fsri SRC VB "Vector" may 20, 2008.

To determine the sensitivity of the set of concentrated solution of plasmid DNA were prepared with serial 10-fold dilution. The concentration of DNA dilutions in the study of the sensitivity of the primers was carried out with the help of fluorimetry QUBIT (Invitrogen, USA) and a reagent kit manufacturer.

The invention is illustrated in the following example, the identification of specific samples.

Example

To diagnose and clarify the etiology of serous meningitis in the laboratory of molecular Virology RNA-containing viruses fsri GMCVB Vector received 15 samples spin the brain fluid from patients, hospitalized in MBUS Novosibirsk City infectious hospital №1 in the period from July to September 2008

After a study RT-PCR in real time identified 12 positive samples (80%) enterovirus infection. The DNA fragments were studied using sequencing. Phylogenetic analysis of nucleotide sequences of fragments of the 5'UTR revealed the identity of the samples L20, L22, L25, L26, L29, L28, L31, L33, L34, L61, L96, L108 to the enterovirus genome ESNO. The closest sequence isolates of these genotypes were previously identified in Australia-2006(GU236299), Australia-2006(GU236300)), France (France-1997(AM237015), France-1997(AM), France-1997(AM237013). The results of the study are presented in the phylogenetic tree in figure 4.

Phylogenetic tree of enteroviruses ESNO built on the nucleotide sequence of the 5'UTR of the genome of enteroviruses (72 - 521 BP). The topology of the tree recovered using a method combining nearest neighbors. The matrix of genetic distances calculated using the method of Kimura with two-parameter metric.

From the foregoing it is clear that achieved the claimed technical result, namely: developed a set oligodeoxyribonucleotide primers and fluorescently labeled probes for identification of enterovirus RNA by the method of reverse transcription - polymerase is aznoe chain reaction (RT-PCR) with hybridization-fluorescence detection in clinical specimens and the environment, allows you to determine not only the race but the enterovirus serotype. There was also the analytical sensitivity of the kit for detection of enteroviruses, which amounted to 2×104M.K. (genome equivalents)/ml of This system can be used for quantitative analysis, and genotyping.

Set oligodeoxyribonucleotide primers and fluorescently labeled probes for identification of enterovirus RNA by the method of reverse transcription - polymerase chain reaction (RT-PCR) with hybridization-fluorescence detection in clinical specimens and the environment, containing 1 pair of oligonucleotides having the activity of forward and reverse primers, and a probe having the following structure:
5'→3' 5' CAAGNACTTCTGTTNCCCCGGACYGA 3'
3'←5' 5' ATNTNTCAATTGTCANCATAAGCAGCCA 3'
FAM -5' CCTYCGGCNCCTGAYTGCGGCTAATCC 3'- BHQ1.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry and a method of producing comenic acid. The method is characterised by that it involves fermentation of the Gluconobacter oxydans-03 strain in a medium containing glucose - 35.0 g/l, yeast extract - 1.17 g/l, disubstituted ammonium phosphate - 0.619·10-3 g/l, monosubstituted potassium phosphate - 0.12·10-3 g/l, at temperature 28°C with forced aeration by 1.5-2.0 volume of air per 1 volume of medium per minute for 66-78 hours until obtaining gluconic acids: gluconic, 2-keto-gluconic, 5-keto-gluconic, 2,5-diketo-gluconic; Gluconobacter oxydans-03 cells are deposited by heating the culture fluid to 80-85°C for 0.5 hours in the presence of bentonite until formation of a residue; the supernatant fluid is filtered; the obtained filtrate which contains comenic acid and gluconic acids is deposited on anionite AV-17-8 chS, while adding sodium bicarbonate to obtain sodium salts of comenic acid and gluconic acids; 17-19% hydrochloric acid solution is added to form a residue containing comenic and gluconic acids; comenic acid is separated from gluconic acids by washing the residue with iced water or iced water-alcohol solution with water to alcohol ratio of 3:1, wherein 10 ml of the solution per 1 g of residue is used.

EFFECT: invention enables to obtain high-purity comenic acid.

6 ex

FIELD: medicine.

SUBSTANCE: method provides grinding a pathological biomaterial to be homogenated to prepare a suspensions. The prepared suspension is added with 3-5% citric acid at the basis of its content in the suspension. It is kept for 20-30 minutes at 10-20°C and added with 3-4% succinic acid and kept for 20-30 minutes at 10-20°C that is followed by neutrilising the suspension with 5-10% ammonium and reducing to pH 7.5-7.6. The neutrilised suspention is settled for 20-30 minutes; a supernatant is rinsed, and the precipitation is inoculated with a nutrient medium containing in 1 l of distilled water citric acid 8.0 g, ammonium citrate 2.0 g, succinic acid 3.0 g, asparagine or glycine 2.0 g, di-basic potassium phosphate 5.0 g, magnesium sulphate 0.5 g, zinc sulphate 0.3 g, di-basic sodium phosphate 3.0 g, sodium chloride 5.0-6.0 g, ferrous sulphate 0.1 g and glycerin 40-50 ml at pH 7.5-7.6. To produce the solid agar medium, the fluid medium diluted in distilled water 1:1 is added with agar 2.5 g per the fluid medium 100 ml, and sodium chloride is reduced to 5-6%.

EFFECT: invention allows reducing staphylococcus recovery time.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: technique involves DNA recovery from the biomaterial and real-time polymerase chain reaction with using probes marked by fluorescent dyes and fluorescence extinguishers. It involves preparing two reaction mixtures one of which contains the primers atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc and the probe FAM-cgttcggctc ggcatctcga tattccc-BHQ1, while the other one contains the primers ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca and the probe Joe-gtatccggct atgcgccgag tttgg BHQ1. The polymerase chain reaction is real-time at primer annealing temperature 55-62C in 30-45 cycles with continuous fluorescence control, its increment observing in one or more reaction mixtures enables diagnosing the presence of agrobacteria in the samples.

EFFECT: invention enables extending the range of genotypes of the diagnosed agrobacteria.

5 cl, 7 dwg, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention discloses a method for preparing a major protective antigen of a cholera vibrio of cholera toxin B subunit. The method involves deposition of a protein fraction from filtered broth culture of the recombinant strain other than 01 serogroup Vibrio cholerae KM93 (State Collection 'Microbe'). The deposited protein fraction is used to recover the B subunit to be purified by three-step column TSK HW-60 gel penetration chromatography. The purified preparation of the B subunit is applicable for producing anti-toxin serums, high-specific immunoglobulin and diagnostic test systems, as well as an ingredient of vaccine preparations.

EFFECT: use of the invention enables higher yield of the high-purity native immunogenic preparation of the cholera toxin B subunit.

2 dwg, 1 tbl

FIELD: medicine.

SUBSTANCE: method involves the PCR-amplification of the 16S rRNA fragment with the use of specific original oligonucleotide primers SEQ ID No: 1 and SEQ ID NO: 2. It is followed by the PCR biotinylation of the primer SEQ ID No: 1 which enables detecting the nucleotide sequences of the 16S rRNA by simple one-chain solid-phase sequencing with the use of specific original sequencing primers SEQ ID No: 3, SEQ ID NO: 4 and SEQ ID NO: 5. The mycobacteria are precisely identified by comparing certain sequences with common sequences of various types of mycobacteria in the database.

EFFECT: invention enables identifying mycobacterioses in the samples of pathological material.

4 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains solid and liquid phases. The solid phase of the nutrient medium contains a pancreatic digest of fish meal, a hemophilic bacteria growth stimulator, sodium chloride, yeastrel, glucose, agar, 2% potassium tellurite and distilled water in the preset proportions. The liquid phase contains the pancreatic digest of fish meal, enzymatic peptone, sodium chloride, yeastrel, glucose, cattle blood serum and distilled water in the preset proportions.

EFFECT: invention allows higher sensitivity of the medium, germination value and growth rate of diphtheria bacteria.

3 ex

FIELD: medicine.

SUBSTANCE: SLURP-1 peptide is prepared by transformation of competent cells Escherichia coli BL21 (BE3) by recombinant plasmid DNA pET22b(+)/SLURP-1.

EFFECT: invention provides higher effectiveness of SLURP-1 protein synthesis in cells Escherichia coli.

2 cl, 3 dwg, 1 tbl, 6 ex

FIELD: agriculture.

SUBSTANCE: strain of bacteria Bacillus thuringiensis 846-Bt was isolated from a natural source and deposited in the collection of All-Russian Research Institute of agricultural microbiology numbered 00045.

EFFECT: strain of bacteria Bacillus thuringiensis RCAM 00045 provides deaths of all the greater wax moth larvae of 6-4 ages.

1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: method involves adding an additive containing biomass of microorganisms into waste water with initial pH 5.5. The microorganisms used are at least one of the following types: Rhodotorula glutiuius in amount of 14-6 mg/m3, Trihoderme viridae in amount of 23-1 mg/m3, Chaetomium globosum in amount of 25-15 mg/m3.

EFFECT: invention enables to increase treatment efficiency by accelerating the process.

3 tbl

FIELD: chemistry.

SUBSTANCE: method involves adding an additive containing biomass of microorganisms into waste water with initial pH 5.5. The microorganisms used are at least one of the following types: Rhodotorula glutiuius in amount of 14-6 mg/m3, Trihoderme viridae in amount of 23-1 mg/m3, Chaetomium globosum in amount of 25-15 mg/m3.

EFFECT: invention enables to increase treatment efficiency by accelerating the process.

3 tbl

FIELD: medicine.

SUBSTANCE: leukocyte count is determined. The real-time PCR is used to determine a total number of genomes of microorganisms, a number of normobiot and opportunistic biot genomes. The derived total number of genomes of microorganisms is compared to the normal value -104.5-5.0. The number of normobiot and opportunistic biot genomes is compared with the total number of genomes of microorganisms and with each other. The total number of genomes of microorganisms more than 104.5-5.0, the number of normobiot genomes more than 10 times lesser than that, the number of opportunistic biot genomes equal to the total number of genomes or less than in 10 times lesser, and the number of genomes of opportunistic microorganisms exceeding the number of normobiot genomes more than 10 times greater, urethritis caused by opportunistic microorganisms is diagnosed. If observing manifested clinical symptoms and PML count more than 5 as shown by microscopy results, its manifest form is diagnosed, while the absence or the insufficient degree of manifestation of clinical symptoms and PML count more than 5, an asymptomatic form is diagnosed.

EFFECT: use of the technique allows early prescription of the adequate etiotropic therapy and avoided developing complications.

3 ex

FIELD: medicine.

SUBSTANCE: what is presented is a method for genotyping TXNRD1 rs 1128446 gene polymorphism providing conducting PCR with using specially specified pair of primers (F: 5'-GGCTTCTCGTAGCCATTAGG-3' and R: 5'-TATCTTCCCTTCCCCGAGAC-3') that is followed by the analysis of the PCR product by RFLP which involves Taq1 endonuclease processing and fractionation of the produced fragments in 2% agarose gel. The DNA fragments sized 179 and 83 base pairs are verified as a wild type CC homozygous genotype, the fragment sized 262 base pairs - as a homozygous mutant genotype GG, while the fragments 262 sized 179 and 83 base pairs - as a heterozygous genotype CG.

EFFECT: method is characterised by diagnostic simplicity and accuracy.

1 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: what is presented is a method for genotyping PRDX1 rs 17522918 gene polymorphism providing conducting PCR with using specially specified pair of primers (F: 5'-ACACTCACCAGTCCCAACACAAG-3' and R; 5 '-CCACATCCCCCTCCTCTCTCTC-3') that is followed by the analysis of the PCR product by RFLP which involves BstH2I endonuclease processing and fractionation of the produced fragments in 2% agarose gel. The DNA fragments sized 81 and 84 base pairs are verified as a wild type CC homozygous genotype, the fragment sized 165 base pairs - as a homozygous mutant genotype AA, while the fragments 165 sized 81 and 84 base pairs - as a heterozygous genotype CA.

EFFECT: method under the invention is characterised by diagnostic simplicity and accuracy.

1 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: what is offered is a method for prediction of a risk of developing essential hypertension with using a prognostic regression model based on the use of genotyping P-450 1B1 cytochrome rs1056836 gene polymorphism, nitrogen oxide endothelial synthase rs2070744 gene polymorphism combined with assessing an alcohol consumption pattern and occupational psychoemotional state. The derived data of genetic and environmental risk factors are used to calculate a precise probability of grouping a patient with a low, moderate or high risk of developing essential hypertension. The developed method enables predicting the probability of essential hypertension with accuracy 85-99%.

EFFECT: method is applicable in practice by medical geneticists of medical genetic consultation services and cardiologists of healthcare facilities for the purpose of prediction of an individual risk of the onset of essential hypertension in women.

1 ex

FIELD: medicine.

SUBSTANCE: set of oligonucleotide primers and fluorescent-marked probes for species-specific instant identification of Marburg virus by real-time polymerase chain reaction involves sequences species-specific for Marburg virus. The invention may be used in medicine for detection of a genetic material (RNA) of Marburg virus.

EFFECT: creation of the more specific set of the oligonucleotide primers and probes.

1 dwg, 3 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: technique involves DNA recovery from the biomaterial and real-time polymerase chain reaction with using probes marked by fluorescent dyes and fluorescence extinguishers. It involves preparing two reaction mixtures one of which contains the primers atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc and the probe FAM-cgttcggctc ggcatctcga tattccc-BHQ1, while the other one contains the primers ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca and the probe Joe-gtatccggct atgcgccgag tttgg BHQ1. The polymerase chain reaction is real-time at primer annealing temperature 55-62C in 30-45 cycles with continuous fluorescence control, its increment observing in one or more reaction mixtures enables diagnosing the presence of agrobacteria in the samples.

EFFECT: invention enables extending the range of genotypes of the diagnosed agrobacteria.

5 cl, 7 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: invention concerns identifying toxigenic Vibrio cholerae O1 strains, determining their biovars and differentiating V.cholerae eltor biovars by typical isolates and changed versions. According to the invention, the multiplex polymerase chain reaction (PCR) is conducted in a single step in two reaction mixtures wherein each mixture contains a specially selected combination of primers: one - to the genes rfbO1, cas3 and ctxBclass another - to the genes rfbO1, rtxC and ctxBEltor. A test system for implementing the method comprises DNA recovery components, PCR components and result analysis components. The PCR components contain: the 10-fold buffer solution, pH 8.4, mineral oil, deionised sterile water, two positive controls, enzyme Taq-polymerase, mixed dNTP, mixed primers No.1 - rfbO1-F - rjbO1-R, cas3-F - cas3-R, ctxBclass-F- ctxBclass and mixed primers No.2 - rfbO1-F - rfbO1-R, rtxC-F - rtxC-R, ctxBEltor-F - ctxBEltor-R.

EFFECT: invention enables fast and reliable detection of serogroup cholera vibrios O1 biovar, detecting their toxigenicity and differentiating the detected toxigenic Vcholerae eltor biovar strains by typical isolates and changed versions.

3 cl, 2 dwg, 3 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention discloses a method for detecting the expressing genetic determinants of the pathogenic microorganisms Burkholderia with using reverse transcription and conjugated amplification (RT-PCR) for the following structure functional analysis. The method involves the stages of bacterial culture growing to an early logarithmic growth phase, RNA recovery and purification by nucleosorption from the sodium merthiolate processed broth culture, removal of DNA impurities by DNA-ase processing, cDNA synthesis in the presence of a ribonuclease and primer inhibitor specific to sequences of procaryote mRNA ribosome determinants, cDNA reamplification with the same primer for collection and use thereof as a matrix in gene-specific PCR, recovery and detection of the nucleotide sequence of amplicons.

EFFECT: method provides assessing the action of cell adaptation variations in response to the varying environmental conditions on the manifestations of the most important biological characteristics of microorganisms - virulence and antimicrobial resistance - with a high degree of sensitivity at various environmental conditions.

3 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: what is offered is a test system presented by a oligonucleotide kit enabling detecting point mutations in FAH and SERPINA1 genes which induce type 1 tyrosinemia and alpha-1-antitrypsin deficiency respectively. What us described is a method for detection of said point mutations involving two-round multiplex PCR with using the respective kit of specific primers and hybridisation of the prepared PCR products with a biochip containing the test system under the invention.

EFFECT: method enables the short-term accurate genetic analysis.

3 cl, 13 tbl, 19 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: there are offered a method and a kit for assessment of functional bypass activity of human complement component C9. The pharmaceutical preparation derinate is sorbed in microplate wells. Then the analysed sample containing the component C9 of unknown activity and porpoise complement is introduced in the analysed sample. It is followed with incubation, and after washing and drying of the dish, a conjugate of enzyme with component C9 antibodies and a substratum of this enzyme are added into the wells. The component C9 activity is evaluated by the amount of the prepared product of enzymatic reaction. The kit comprises the flat-bottomed microplate with sorbed derinate, conjugated enzyme and human complement component C9 antibodies, porpoise complement, substrate buffer and standard with known activity C9.

EFFECT: invention enables assessing the component C9 with using the preparation derinate as an classical activator of the complement.

2 cl, 1 dwg, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to medicine and concerns a pharmaceutical composition for inducing an immune response on tumour-associated macrophagues containing a mini-gene DNA construct which codes a polypeptide in a pharmaceutically acceptable carrier wherein the polypeptide contains three immunogenic legumain fragments bonded together with linker peptides, and wherein each linker peptide consists of the AAA or AAY sequence.

EFFECT: invention provides effective control of breast carcinoma, non-small-cell lung cancer and colorectal carcinoma.

8 cl, 2 ex, 26 dwg

Up!