Recombinant plasmid dna ptb323 coding hybrid polypeptide cst-deltampt64 with properties of species-specific mycobacterial antigen mpt64 (mpb64), recombinant escherichia coli bacterial strain - producer of hybrid polypeptide cst-deltampt64 and recombinant polypeptide cst-deltampt64

FIELD: medicine.

SUBSTANCE: recombinant plasmid DNA pTB323 under the invention coding the hybrid polypeptide glutathione-8-transferase (GST) and a shorter version of the protein MPT64 (rΔMPT64), has an average molecular weight 3.6 MDa, size 5574 base pairs, consists of: a) EcoRI-BamHI-fragment of the vector plasmid pGEX-2T of size 4938 base pairs containing the β-lactamase gene inducing tac-promotor, the internal gene Iaclg coding the lactose operone repressor protein, a glutathione-5-transferase gene fragment from S. japonicum with a multiple sites of gene cloning (MSC) in 3'-terminal part of this gene and a nucleotide sequence coding a thrombine proteolysis site and found in front of the MSC; b) EcoRI-BamHI-fragment of 636 base pairs containing a truncated gene MPT64 flanked by EcoRI and BamHI restriction endonuclease sites and prepared by amplification of the gene-related fragment with genome DNA M. tuberculosis; c) a genetic marker - β-lactamase gene determining resistance of pTB323 plasmid transformed cells E. coli to the antibiotic ampicillin; d) unique restriction sites: BamHI - 930/934, EcoRI ~ 1566/1570. The recombinant bacterial strain Escherichia coli BL21/pTB323 - producer of hybrid polypeptide GST-ΔMPT64 with the properties of the mycobacterial antigen ΔMPT64 is deposited in the Collection of Microorganisms of Federal State Research Institution State Science Centre Vector, No. B-1028. The recombinant polypeptide GST-ΔMPT64 produced by the recombinant strain under the invention contains as a carrier protein the N-terminal polypeptide fragment glutathione-S-transferase S.j. (226 amino acid residues, 26.31 kDa) and has a complete amino acid sequence (431 amino acid residues, 48.76 kDa) presented in the description.

EFFECT: using the invention enables developing the high-purity polypeptide in the preparation amounts with the preserved immunogenic properties and provided separation of the target protein from the amino acid sequence of the carrier protein for studying of the immunogenic properties of the target protein.

3 cl, 4 dwg, 4 tbl, 6 ex

 

The invention relates to biotechnology, in particular genetic engineering, and allows you to get the microbiological synthesis of simplified technology new hybrid polypeptide GST-ΔMPT64 with properties of species-specific protein antigenMycobacterium tuberculosisMPT64 (also corresponding homologous protein MPB64Mycobacteriumbovis), which can be used for early diagnosis of tuberculosis infection caused by one of two types -Mycobacterium tuberculosisorMycobacterium bovis.

The variety of forms of tuberculosis, the distribution of erased picture of the disease, as well as individual reaction of an organism to infection represent a serious problem for the diagnosis of tuberculosis infection in General and for early diagnosis in particular.

The classical methodology of diagnosis of tuberculosis associated with use of skin reactions at the injection of tuberculin (PPD) - purified protein derivative [1]. However, the problem of specificity and sensitivity of skin tests in the case of persons vaccinated with BCG, it is not possible to distinguish them from individuals infected with pathogenic mycobacteria that cause tuberculosis development in this test [2]. One of the reasons for false positive results after the reaction to Mantoux test associated with the manifestation of cross-reactivity to non-tuberculous mycobacteria. You know, Thu is about 10% of people show reactivity to non-tuberculous mycobacteria, of which 30% are positive skin test.

Among the classical methods of diagnosis of tuberculosis highest specificity has a method of identifying the culture of the pathogen in the crop sample. Widespread also Cytology (microscopic) methods for the detection of tubercle bacilli in smears after coloring dye. However, both of these methods are of little use when abacilar forms of tuberculosis when bacilli are absent in the bioassay. In addition, the cultivation of mycobacteria due to their slow growth is a long process, and cytological identification does not have sufficient sensitivity, error-prone and largely depends on the qualification of personnel.

Methods serodiagnosis based on the detection of antibodies to antigens of mycobacteria that are currently widely used for screening due to the relatively low cost, fast production procedures, high sensitivity and specificity among infected individuals [3]. Serological methods are very diverse. The sensitivity and specificity of tests that use technology enzyme-linked immunosorbent assay (ELISA), varies in a rather wide range and is 40-85% and 67-100% according to the government. On the one hand, this is due to the fact that often indicators of humoral immune response in tuberculosis is reduced, and this in turn leads to the fact that antibodies obtained in the human body to a virulent mycobacteria that cause tuberculosis in humans, cross-react with a set of non-pathogenic antigens of mycobacteria and many agents of other diseases. On the other hand, antimycobacterial and hormonal therapy have a suppressive effect on the production of antibodies in tuberculosis. The last factor is essential when identifying markers of humoral immunity in TB patients, since the reduced level of antibodies entails a decline in the share of positive results in the ELISA, which is relatively low [4].

The literature describes a large number of new proteins (polypeptides) of the Mycobacterium tuberculosis complex, which can be used in diagnostic tests. Known and nucleotide sequences encoding these proteins. Most of this collection has similarities with proteins of other species of the genus Mycobacterium and even other genera of bacteria. A number of proteins of the culture filtrate, secreted by MycobacteriumM. tuberculosisand having immunogenic and enzymatic activity associated with pathogenesis. One is about the complete analysis of the protein composition (composition) in these fractions remains to be elucidated [5].

With the development of TB infection is an important role for T-cells and other T cells or T-cell effectors (e.g., CD4, CD8) [6]. For example, CD4 T-cells produce immune interferon (IFN-γ, IFN-γ), which is a stimulator in the infected organism antimycobacterial macrophages, as shown in mouse models [7], as well as an activator of macrophages person in suppressing infectionM. tuberculosis[8].

Mapping changes in T-cell and b-cell immunity helps to identify the level of protective response of the immune system, aimed at the synthesis of antibodies to bacterial antigens. The study of intracellular functional activity of immunocompetent cells allows to obtain information about the pathological process [9].

High level production of γ-IFN stimulates T-cell activation, characterizing cellular immunity in tuberculosis invasion. Choice as a prognostic factor in the diagnosis of tuberculosis γ-interferon is not random. Malfunction in a chain of IFN production is a reflection of the dysfunction of the immune system [10].

γ-IFN-analysis based on quantitative determination of the level of γ-IFN stimulation of lymphocytes in whole cell cultures of blood, incubated in ECENA 16-20 h with protein antigens M. tuberculosisand control antigens. As a result of stimulation of effector T-cells in the blood is rapid secretion of cytokines responsible for the effector functions of the cellular immune response, while IFN-γ is one of the few cytokines that is produced in this process and serves as a specific marker for cellular mediators of the immune response.

As complex mycobacterial antigens for such diagnostic tests can be used tuberculin (PPD) or culture filtrates (CF)M. tuberculosisH37Rv. Unlike the skin test γ-IFN-analysis allows differentiation between BCG-vaccinated and infected patients. Generally, the results of clinical isolates using the gamma interferon analysis show a lower percentage vaccinated with a positive result for the presence of tuberculosis infection, defined according to the skin test. This difference indicates that the results of the skin test using PPD have low specificity in the case of BCG-vaccinated patients.

The most suitable polypeptides that play the role of mycobacterial antigens in gamma interferon analysis, are proteins, highly specific for virulent strains of tuberculosis and simultaneously the military missing in vaccine BCG strains.

The use of species-specific proteins allows to differentiate the different phases of the development of tuberculosis infection in comparison with results obtained using other, non-specific proteins, as well as the high level of T-cell response to species-specific antigens, which correlates with protective immunity against M. tuberculosis and the risk of developing active TB.

In the literature known immunogenic protein MPB64, first identified Harboe M. et al. [11]. As a native protein MPB64 was detected in the culture fluid (filtrate)Mycobacterium bovisBCG Tokyo. Later A.V. Andersen et al. [12], using monoclonal antibodies obtained on protein MPB64 found similar protein in the culture filtrateMycobacterium tuberculosisH37Rv, which is identified as MPT64. It was also shown that the nucleotide sequence of both genes encoding these proteins, the same as [13, 14]. The molecular mass of the purified native protein is 24 kDa. The main advantage of protein MPT64 that it is highly specific for virulent species of causative agents of tuberculosis (M. tuberculosis, M. bovis, M. africanum) [12] and in contrast to these well-known early proteins, as ESAT-6 and CFP10, is missing, as was shown by H. Li et al., unfortunately, only in some genomes BCG vaccine strains [15]. MPT64 along with the main secretory the mi protein, such as ESAT-6 and CFP10, is one of the antigens that cause the development of T-cell response. This process is accompanied by increased production of γ-IFN. Gene protein MPT64 is part of the genomic fragment RD2 size 10,79 thousand gel present in the genomes of strains ofM. tuberculosisandM. bovis, including some strains ofM. bovisBCG [16]. Despite this, it can be used for diagnostic purposes in conjunction with other early proteins (ESAT-6, CFP10), and independently in the case of its use in relation to persons previously vaccinated with vaccine strains not containing in its genome a genempt64. It can also be used in relation to persons in countries in which abolished vaccination against tuberculosis, or vaccinated and diseased (infected), based on the difference obtained immune response only between vaccinated and simultaneously vaccinated and infected (infected).

Isolation and purification of protein MPT64 from the culture filtrate of Mycobacterium can be performed using safe vaccine strains containing the gene of the protein MPB64, homologous 100% MPT64. However, this procedure is costly and complicated, and the yield of the target product is extremely low. This is why the technique of recombinant DNA to obtain specified what about the protein for practical diagnostic purposes is economically feasible.

Known genetic engineering method of obtaining a recombinant polypeptide with properties of mycobacterial antigen MPT64 used for diagnostic purposes [17, prototype]. In this case, the target protein get in the composition of the recombinant fusion protein containing the C-end of the domain structure of the target protein (full and abbreviated - without leader peptide variants amino acid sequence), whereas the N-terminal amino acid sequence includes the sequence maltsevazamkovaja protein (genemalE) as a protein carrier (expressing the vector pMAL-p).

However, this design (prototype) does not contain the site of proteolysis, allowing to separate the target protein from the amino acid sequence of a protein carrier to conduct subsequent studies on the comparison of the immunogenic properties of the protein, close to the native structure of the target or directly on the target.

The technical result of the invention is to provide such genetic constructs and recombinant strain of bacteriaEscherichia colion its basis - producer of hybrid polypeptide with properties of species-specific mycobacterial antigen ΔMPT64 having such a construction that would allow us to develop highly targeted polypeptide in preparation the x quantities while maintaining the immunogenic properties of the latter and the possibility of separating the target protein from the amino acid sequence of carrier protein for the study of immunogenic properties of the target protein.

This result is achieved by constructing recombinant plasmid DNA pTB323 that encodes a chimeric polypeptide: glutathione-S-transferase (GST) + a shortened version without the leader peptide, protein MPT64 (hereinafter rΔMPT64). When this gene that encodes a polypeptide with properties of mycobacterial antigen ΔMPT64, is in the same reading frame with the gene glutathione S-transferase fromSchistosomajaponicum(GST unlimited company.) (Fig. 1A and B).

Recombinant plasmid DNA RTV (Fig. 1 a and B) with an average molecular weight of 3.6 MDA has a size 5574 P.N. (design image plasmids, restrictee card size calculations performed using NEBcutter V2.0 (UK) in on-line mode (http://tools.neb.com/NEBcutter2/index.php)) and consists of the following elements:

- EcoRI-BamHI fragment of the vector plasmid pGEX-2T (Pharmacia Biotech) size 4938 gel, containing the gene for β-lactamase induced tac-promoter, lacI geneqencoding the protein is a repressor of Lac operon, a gene fragment glutathione-S-transferase fromS. japonicumwith multiple site for cloning (MSC) genes in 3-terminal part of the gene and a nucleotide sequence that encodes a site of proteolysis by thrombin and located in front MSC;

- EcoRI-BamHI fragment size 636 gel containing flanked by sites for the restriction endonucleases EcoRI and BamHI shortened MPT64 gene, obtained by amplification with the corresponding gene fragment c genomic DNA M. tuberculosis;

also contains:

as a genetic marker gene β-lactamase determining the stability of the transformed plasmid RTV cellsE. colito the antibiotic ampicillin;

unique restriction sites: BamHI - 930/934, EcoRI - 1566/1570 (indicated by the position of the splitting of the appropriate restriction endonucleases on both circuits, numbering when this is carried out on the same chain).

The presence of recombinant polypeptide rΔMPT64 GST-fragment allows to develop preparative quantities of the target protein using affinity chromatography on glutationreductase. These design features important for biotechnological cycle associated with the selection of the recombinant protein. It is the presence of GST-fragment allows to reduce the purification of the recombinant polypeptide and to obtain a highly purified protein with properties of mycobacterial antigen MPT64. When the accumulation in the cell rΔMPT64 almost (only slightly) is not subjected to degradation. He also consistently behaves in stimulation of whole cell cultures of blood in the process of diagnostic analysis. Apparently, the presence of GST-fragment in the composition of the chimeric protein helps to protect it from the effects of enzymes blood upon stimulation of whole cell cultures of blood in the process of diagnostic analysis. Prolong the of his actions upon stimulation of whole blood or mononuclear cells in whole blood with the use of such structures refers to the important factors of the stability of these proteins. This immunogenic properties of the proposed chimeric structure of the polypeptide is not lost. The principal difference of the chimeric polypeptide rΔMPT64 from the original prototype MAL-ΔMPT64 is that the recombinant protein, the resulting expression is a single education, including species-specific immunodominant structural epitopes of the native protein ΔMPT64 who does not possess a functional activity of GST-fragment. Located between the polypeptide fragments of GST and ΔMPT64 (Fig. 2) the site of thrombin hydrolysis allows you to get mycobacterial antigen ΔMPT64 free of N-terminal polypeptide fragment of the GST. Recombinant antigen ΔMPT64 on the N-end after cleavage by thrombin will contain only two additional amino acid residue glycine is N-terminal, serine - second amino acid residue, followed by the amino acid sequence of strictly corresponding target protein ΔMPT64 - without leader peptide, the first 23 amino acid residues of the full MPT64.

To obtain a bacterial strain-producer chimeric protein rΔMPT64 competent cellsE. coliBL21 transform the constructed target plasmid RTV. The resulting strain of bacteriaE. coliBL21/RTV characterized by the following features:

Morphological features. The morphological characteristics of the strain-producer of recombinant protein rΔMPT64 not differ from the original strain ofE. coliBL21, not containing target plasmid.

Cultural characteristics. Cultural characteristics of strain-producer of recombinant protein rΔMPT64 not differ from the original strain ofE. coliBL21, not containing target plasmid.

Resistance to antibiotics. Cells of strain-producer of recombinant protein rΔMPT64 are resistant to ampicillin due to the presence of the target plasmid.

A significant differencestrainE. coliBL21/RTW is that it provides a synthesis of the chimeric polypeptide rΔMPT64 (GST-ΔMPT64) with properties of mycobacterial antigen ΔMPT64 with the level of expression of 1.8 to 12 mg/ml protein.

The resulting strain was deposited in the culture Collection of microorganisms (CCM) fsri SRC VB "Vector" of Rospotrebnadzor under number B-1028.

Chimeric polypeptide rΔMPT64 (GST-ΔMPT64) (Fig. 2)produced by recombinant strain BL21/RTWE. socontains as a protein carrier N-terminal polypeptide fragment of glutathione-S-transferase unlimited company. (226 S.A. with a molecular mass of 26,31 kDa; the calculation is performed using the Compute pI/Mw tool (Switzerland) in on-line mode (http://cn.expasy.org/tools/pi_tool.htmlhttp://cn.expasy.org/tools/pi_tool.html))connected through its terminal site of thrombin hydrolysis (LVPR^GS) with C-terminal polypeptide fragm NTM species-specific mycobacterial antigen ΔMPT64 (205 S.A. with a molecular mass of 22,46 kDa; the calculation is performed using the Compute pI/Mw tool), and has a complete amino acid sequence (431 S.A., 48,76 kDa; the calculation is performed using the Compute pI/Mw tool, shown in Fig. 3.

The invention is illustrated in the following graphics.

Fig. 1 A. organization of the recombinant plasmids RTW, where GST - gene protein glutathione-S-transferase; ΔMPT64 - cloned fragment obtained by amplification using PCR and including shortened gene protein MPT64; unique BamHI and EcoRI sites of the restriction endonucleases used to create this design; ptac - synthetic promoter present in the vector (pGEX-2T) and the recombinant plasmids; ApRgene β-lactamase (bla-gene)providing a transformed bacterial cells resistant to ampicillin.

Fig. 1 B. Restriction map of the target plasmid RTV. The image construction plasmids pTB323 (5574 P.N.). a - fused recombinant protein GST-ΔMPT64 size 431 S.A. Image built using NEBcutter V2.0 (UK) (http://tools.neb.com/NEBcutter2/index.php)

Fig. 2. The parts of the coupling when the introduction of gene Δmpt64plasmids pTB323 in gene glutathione S-transferase (gstin comparison with the similar plot in the original (vector) plasmid pGEX-2T. NP - nucleotide sequence, up - amino acid follow etelnost. The first codon of the protein is shown after installation of the nucleotide sequence of the site of proteolysis by thrombin, the stop codon at the end of the gene-insertion underlined.

Fig. 3. The complete nucleotide and amino acid sequence of the recombinant polypeptide GST-ΔMPT64 where LVPR^GS - amino acid sequence of the site of recognition and hydrolysis of the protease thrombin (highlighted).

For a better understanding of the invention the following specific examples of its implementation.

Example 1. Construction of recombinant plasmids RTV.

Used as a vector plasmid pGEX-2T (Pharmacia) and strains: JM103E. coli{Δ(lac-proAB), thi, strA, supE, endA, sbcB, hsdR-, [F' traD36, proAB, lacIq, ZΔM15]}; BL21E. coliB {F-, dcm, ompT, hsdS (rB- mB-), gal}.

As a source of nucleotide material (matrix) to obtain using polymerase chain reaction (PCR) and cloned amplifierarava fragment using genomic DNAM. tuberculosisH37Rv isolated from inactivated cells of mycobacteria. The gene encoding the protein ΔMPT64, amplified using primers:

5'-CGGGATCCGCGCCCAAGACCTACTG-3' (forward primer for genempt64);

5'-CGGAATTCGTCCTCGCGAGTCTAGG-3' (reverse primer for genempt64). PCR is carried out in a volume of 50 μl on the amplifier "Terzic" ("DNA-technology", Moscow) with the temperature-time profile: 94°C - 3 min; 10 cycles of [94°C 30 sec, 45 the C - 30 s, 72°C - 50], 35 cycles [94°C 30 sec, 60°C 30 sec, 72°C - 50], 72°C - 3 minutes Complete nucleotide sequence of the cloned gene (mpt64) for the selection of the nucleotide sequences of the primers were extracted from the database (DB) of the Institut Pasteur (http://genolist.pasteur.fr/TubercuList/) (France). The melting temperature of the primers selected on the basis of the obtained from the database of the extended nucleotide sequence comprising the truncated gene Δmpt64using the NTI program Suite 8. Annealing of the primers in the first 10 cycles carried out at a low temperature annealing (45°C), because the 5'-end nucleotide sequence of 8 concentration, the structure of which the restriction site (in this case, BamHI or EcoRI), cannot form the DNA-matrix (M. tuberculosisa perfect hybrid duplex in the initial flow PCR after a long 3'-end portion of the primer formed it). In this case, the calculation of the melting temperature of each primer are only fully hybridization sequence, discarding the first 8 determination of the structure of the primer. Calculations of the melting temperature for primers was performed using the program NTI Suite 8 or Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html) (USA) 5'-end sequence of 8 concentration is complementary to the primary nucleotide sequence of each primer and DL is the creation of a site of recognition for the restriction endonucleases BamHI and EcoRI, respectively, to facilitate later cloning.

The reaction mixture comprises polymerase buffer containing 60 mm Tris-HCl, pH 8.5, 25 mm KCl; 1.5 mm MgCl2;10 mm 2-mercaptoethanol; 0.1% Triton X-100; 4 deoxynucleosides - dATP, DSTF, dCTP and TTP - with the final concentration of 0.2 mm of each; the primers with the concentration of each of 0.15-0.25 μm and 5 units of Taq-DNA-polymerase ("Simanim", , Novosibirsk, Russia). The obtained PCR fragment (amplicon) length 646 gel purify presidenial ethanol in the presence of sodium acetate, pH of 4.8, and tRNA as a carrier [18]. The purified preparation of amplicon dissolved in 80 μl of TE buffer and then conducting hydrolysis in EcoRI buffer (SibEnzyme") with the restriction endonucleases BamHI and EcoRI at 37°C for 3-5 h Obtained from the target amplicon restrictly fragment with two sticky ends periostat, as described above, is dissolved in 40 ál of TE-buffer or bidistilled water and used without additional purification in the reaction ligating split vector molecule (pGEX-2T) using the restriction endonucleases BamHI and EcoRI, also containing two sticky end - BamHI and EcoRI. Mix 2-5 ál of restrict-amplicon (0.5 pmol) with 500 ng (0.15 pmol) of vector DNA pGEX-2T/BamHI/EcoRI in 20 μl ligase buffer (SibEnzyme"), heated at 65°C for 3-5 min, cooled rapidly in ice, add 20 units of DNA ligase of phage T4 and the reaction mixture is transferred in a thermostat, where was incubated over night at 16 is C. An aliquot ligase mixture (1-2 µl) was used for transformation of competent cellsE. colistrain JM103, prepared according to the method using a solution of calcium chloride [18], which are sown on plates with agar medium containing ampicillin at a concentration of 50 μg/ml Cup incubated at 37°C over night. Search for clones containing the desired insert, carried out directly from the colonies using PCR analysis using as amplimers oligonucleotides, complementary to the different circuits of the vector molecule and located on both sides from the cloning of the fragment. While the clones containing the insert shortened gene Δmpt64after separation amplificata electrophoresis in agarose gel (1.2%in the presence of ethidium bromide to show painted under UV light strip corresponding to the length of 806 BP, which exceeds the length of the cloned fragment, this fragment contains a portion of the nucleotide sequence of the source vector molecule. After selection of the target plasmids are given in analytical quantities and carry out the necessary restriction analysis (detection of the presence of the restriction sites BamHI and EcoRI). Received target plasmid was designated as pTB323. Scheme of plasmid DNA is shown in Fig. 1 a and 1 B.

Example 2. Getting the producer strain, when cultivation is AI cells which are products of chimeric protein GST-ΔMPT64.

Transformation of cells of a strain ofE. coliBL21 carried out by the introduction of DNA target plasmids pTB323 in competent cells prepared by the method using a solution of calcium chloride [18], and then plated on plates with agar medium containing ampicillin at a concentration of 50 μg/ml Cup incubated at 37°C over night. The appeared colonies are clones of the producer strain.

Cells from each selected clone (usually less than 10) were seeded in 1 ml of YT liquid medium with ampicillin at a concentration of 50 μg/ml for the night cell cultures and incubated at 37°C without swing. The next day seeded overnight culture of each clone in the ratio of 1:100 2 ml of fresh medium YT with ampicillin at a concentration of 50 μg/ml and incubated at 37°C with swing speed 160 rpm to density D550= 0.5 to 0.8. Gene expression Δmpt64induce the addition of isopropyl-β-D-galactopyranoside (IPTG) to a final concentration of 0.5-1.0 mm, incubated at 37°C under intensive aeration (160-170 rpm) for 3-5 h, and then select an aliquot of cell suspension of each clone and derived from cell culture lysates analyzed by electrophoresis in 10%SDS page under denaturing conditions according to laemmli's method. The final selection of clones was carried out by the ability to culture cells of each individual clone to produce the greatest possible quantity is two (after induction) recombinant protein rΔMPT64, the amount and concentration of which is judged by electrophoretic painting (in our case, the parameters of cultivation - 37°C and 1.0 mm IPTG).

Example 3. Selection of the recombinant protein GST-ΔMPT64.

Cells of strain BL21E. colitransformed by the plasmid pTB323, grown in LB medium with ampicillin (50 μg/ml) overnight at 37°C. the overnight culture (1:100) seeded in 150 ml of LB medium with ampicillin (50 μg/ml) and pokasivaut to the density D550= 0.8 V for 3 hours Then induce the expression of target protein GST-ΔMPT64 adding IPTG to a concentration of 1.0 mm. Induced cells grow at 37°C for 5 h, after which the cell culture is cooled to 0°C and the cells harvested by centrifugation at 5000g for 15 min at 4°C. the Expression of the target protein GST-ΔMPT64 analyzed by electrophoresis according to laemmli's method in 12%polyacrylamide gel and immunoblotting with monoclonal antibodies to protein-media GST. The results of this analysis show the presence of induced cell cultureE. colistrain BL21/pTB323 in the processing of cellular precipitation lytic buffer GST-ΔMPT64 protein with a molecular weight of about 48-50 kDa, which corresponds to the calculated molecular mass. In control lysates of cellsE. coliBL21 andE. coliBL21/pGEX-2T protein of this molecular weight is missing (according to electrophoresis). This protein is colored in immunoblotting with monoclonal is antibodies to protein-media GST.

For analysis, cells resuspended in 8 ml of cold (0°C) PBS-buffer containing 140 mm NaCl, 2.7 mm KCl, 10 mm Na2HPO4, 1.8 mm KH2PO4, pH 7.3, 1 mm PMSF (protease inhibitor), and destroy ultrasound in an ultrasonic disintegrator (Ultrasonic processor Cole Parmer) 3×30 s with an interval of 1 min between treatments at an amplitude of 50 A. To ultrasonic desintegrator add Triton X-100 to 1%, incubated for 30 min at 0°C and separate the fraction of soluble proteins from debris by centrifugation at 12000g for 40 minutes Then mix the supernatant with 200 μl glutathiones (Glutathione Sepharose 4B (Amersham, Biosciences AB) and incubated for 30 min with slow stirring at room temperature for affine binding protein GST-ΔMPT64. The mixture is then transferred into microcolony by repeated centrifugation at 600g, washed several times with column FSB buffer and perform the elution of the recombinant protein buffer for elution containing 10 mm restored glutathione in 50 mm Tris-Hcl, pH 8.0. The result is a purified preparation of recombinant protein with a concentration of 1.5 mg/ml

Example 4. Holding IFN-γ analysis.

1st stage(stimulation of whole cell culture of blood to the target antigen). Samples of heparinized venous blood of patients is stirred gently in a circular motion for 20 minutes Distribute 100 ál in 96-LUN is cnie plates (Nunc, USA)containing 150 µl/well of complete RPMI medium 1640 with L-glutamine. Mix thoroughly and make the antigen GST-ΔMPT64 at a concentration of 10 μg/ml per well. Separately introduce 100 μl of buffer solution in the wells with zero control (without addition of antigen and mitogen RNA at a concentration of 5 μg/ml per well. Gently mix. Incubated tablets 24-48 h at 37°C in a humid atmosphere containing 5% CO2.

2nd stage. To conduct IFN-γ assays in control wells tablet with adsorbed monoclonal antibody to gamma interferon production BD Biosciences contribute 100 ál of standard samples gamma-interferon production BD Biosciences in different concentrations (from 300-150-75-37,5-18,8-9,4-4,7 PG/ml). In the remaining wells tablets make 100 μl samples of whole blood after stimulation, placed in a shaker and incubated for 2 h at room temperature. After incubation, the wells tablets washed 3 times with wash buffer (FSB-T). After washing each well of the tablet make 100 ál of conjugate biotinylated antibodies to IFN-γ production from BD Biosciences and incubated for 60 min at room temperature. After incubation wash the tablets 3 times with the buffer solution FSB-T, then in each well of the tablet add 100 ál of conjugate avidin-horseradish peroxidase production BD Biosciences working divorced is I. Incubate 60 min at room temperature. After incubation tablets washed 5 times with wash buffer (FSB-T) and 3 times with distilled water. Then bring in each well of the tablet 100 μl of a solution of TMB (3,3',5,5'-tetramethylbenzidine), put the tablets in the dark place, and incubated at room temperature for 30 minutes the Reaction is stopped by the addition to each well of the tablet in 50 µl of stop solution (0,9 N solution of N2SO4). Measure the optical density on automatic spectrophotometer type MultiScan" at a wavelength of 450 nm.

To assess the concentration of IFN-γ in the samples using calibration curve in logarithmic coordinates: the x - axis the concentration of IFN-γ (PG/ml), the y-axis is the value of optical density of the sample. According to the obtained values are conducting a calibration curve and calculate the quantitative content of IFN-γ in PG/ml or IU/ml in the test and control samples. The results are calculated from the mean OD in three holes (p < 0,05). The Cutoff values for IFN-γ > 300 PG is considered positive.

Example 5. Mononuclear cells whole cell cultures of blood (2×105cells/well)isolated by standard procedure using gradient centrifugation in the presence of reagents Ficoll-Hipac, suspended in 50 μl of complete cell cultural the second medium RPMI 1640 and distributed in 96-well plates (Nunc, MaxiSorb, USA)containing 150 µl/well of complete medium RPMI 1640 production of SRC VB "Vector". Then to each well of the tablet make chimeric antigen GST-ΔMPT64 at a concentration of 5-10 µg/ml; in the control wells contribute mitogen (Con A or RNA) in a concentration of 4 μg/ml in triplicate. The final volume of the reaction medium in the well of the tablet is 250 µl. Incubated tablets 16-24 h at 37°C in a humid atmosphere containing 5% CO2.

To conduct IFN-γ assays in control wells tablets adsorbed monoclonal antibody to gamma interferon make 100 ál of standard and control samples. In the remaining wells tablets make 100 μl samples of blood plasma after stimulation. Put in a shaker and incubated for 2 h at room temperature. After incubation, the wells are washed 3 times with wash buffer (FSB-T). After washing each well of the tablet make 100 ál of conjugate biotinylated antibodies to IFN-γ and incubated for 60 min at room temperature. After incubation wash the tablets 3 times with the buffer solution FSB-T, then in each well of the tablet add 100 ál of conjugate avidin-horseradish peroxidase in the working dilution and incubated for 60 min at room temperature. After incubation tablets washed 5 times with wash buffer solution (PSBT) and 3 times with distilled water. Then to each well of the tablet make 100 μl of a solution of TMB (3,3',5,5'-tetramethylbenzidine), put the tablets in the dark place, and incubated at room temperature for 30 minutes the Reaction is stopped by the addition to each well of the tablet in 50 µl of stop solution (0,9 N solution of N2SO4). The optical density of samples was measured on an automated spectrophotometer type MultiScan" at a wavelength of 450 nm.

To assess the concentration of IFN-γ in the samples using calibration curve in logarithmic coordinates: the x - axis the concentration of IFN-γ (PG/ml), the y-axis is the value of optical density of the sample. According to the obtained values are conducting a calibration curve and calculate the quantitative content of IFN-γ in PG/ml or IU/ml in the test and control samples. The results are calculated from the mean OD in three holes (p < 0,05). The Cutoff values for IFN-γ > 300 PG/ml is considered positive.

Example 6. Sorption µa to IFN-γ production BD OptEIA Reagent carried out using 0.1 M carbonate buffer, pH 9.6 for 16 h at 4aboutWith the plates (Nunc, MaxiSorb, USA). After washing tablets wash buffer (FSB, pH 7.0) 3 times with 300 µl/well hold the lock on the surface of the hole blocking buffer solution FSB, pH 7.0, containing 10% fetal serum for 60 min at on the th temperature, followed by washing tablets, as described above.

The prepared tablet with sorbed µa to IFN-γ used in the conduct of IFN-γ analysis. For this purpose, in each well of the tablet bring in 150 μl of complete medium RPMI 1640. Samples of heparinized venous blood of patients gently mixed and then distributed to 100 μl in 96-well plates (Nunc, USA). Mix thoroughly and make a solution of antigen GST-ΔMPT64 in RPMI 1640 with 0.2 mm glutamine at a concentration of 10 μg/ml per well. In wells a-1, B-1 and C-1 contribute mitogen RNA, wells D-1, E-1 add 100 ál of diluent buffer solution (zero control). Gently mixed, incubated tablets 24-48 h at 37°C in a humid atmosphere containing 5% CO2when mixing. After incubation tablets washed with 5×300 μl/well buffer solution FSB-T and 5×300 μl of distilled water. To construct the calibration graph when conducting IFN-γ-analysis of previously conducted incubation with standard calibration samples IFN-γ. To do this in the control wells tablets adsorbed monoclonal antibody to gamma interferon production BD Biosciences contribute 100 ál of standard samples gamma-interferon production BD Biosciences in different concentrations (from 300-150-75-37,5-18,8-9,4-4,7 PG/ml) or 100 ál of standard calibration samples containing IFN-γ (2000-1000-500300-100-50-0 PG/ml) and control sample (330 PCs/ml IFN-γ) production "Vector-best". Incubated according to the instructions for use of the kits. After incubation the strips of tablets washed 3 times with wash buffer (FSB-T). After washing each well of the tablet make 100 ál of conjugate biotinylated antibodies to IFN-γ and incubated for 60 min at room temperature. After incubation tablets washed 3 times with buffer solution FSB-T, to each well of the tablet add 100 ál of conjugate avidin-peroxidase or streptavidin-horseradish peroxidase in the working dilution and incubated for 60 min at room temperature. After incubation tablets washed 5 times with wash buffer (FSB-T), 3 times with distilled water, then bring to each well of the tablet 100 μl of a solution of TMB (3,3',5,5'-tetramethylbenzidine). The tablets are placed in a dark place, and incubated at room temperature for 30 minutes the Reaction is stopped by the addition to each well of the tablet in 50 µl of stop solution (0,9 N solution of N2SO4) and measure the optical density on automatic spectrophotometer type MultiScan" at a wavelength of 450 nm. The results of the analysis represent the Cutoff values that get constructed calibration curves as described above.

Tuberculosis control is carried out to detect active TB and screening of persons and ausich contact using the tuberculin skin test. Fast way early detection of infection in the blood using recombinant proteins is an alternative skin test. Identifying the level of IFN-γ correlates with the stage and extent of TB infection, the level of immune response and the probability of progression to active TB. Table 1 presents the results of detection of active tuberculosis using IFN-γ-analysis, as well as among healthy population. The conducted studies show that received recombinant protein allows to identify active tuberculous process among patients with pulmonary tuberculosis. The level of IFN-γ among healthy contingent does not exceed the limit value >300 PG/ml IFN-γ, corresponding to a risk or group of TB patients. These data demonstrate the specificity of the method.

Table 1

IFN-γ-analysis of tuberculosis during stimulation of the hybrid protein rMPT-64 patients with active form of tuberculosis

PatientsIFN-γ (PG/ml)
PPDrΔMPT-64Mitogen
ConAPHA
21 410084567004782
223650198573245421
2328505545303218
244870320073006710
255110275596508971
266200284978618764
271732057801234414230
2839806748514352
2958304210 1987021340
301035074001830017235
31212004151654014530
32573020651234713247
33670572345032410
341534038751765018930
352319640985
36745821902341028750
371048062401934018745
613017453450029560

The Cutoff values for IFN-γ > 300 PG/ml were considered positive, the results were calculated from the average values of the three holes (ρ < 0, 01) and expressed in PG/ml using the calibration graph.

The analytical sensitivity of the test was 1.2 to 1.7 IU/ml IFN-γ for negative (zero) control sample from the blood plasma of the subjects (results are presented in table. 2).

Table 2.

IFN-γ-analysis of pulmonary tuberculosis during stimulation of the hybrid protein rΔMPT64 and mitogens

PatientsIFN-γ (IU/ml)
PPDrΔMPT-64Mitogen
ConAPHA
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
54,3
27,0
59,2
73,0
24,8
11,7
4,7
2,9
5,3
27,6
57,2
10,9
62,3
1,7
33,4
7,2
98,7
74,6
43,1
67,3
4,23
to 4.1
3,1
1,3
1,9
0,98
1,12
1,2
0,57
0,23
0,12
3.7V
6,1
0,3
0,78
9,75
8,9
11,7
111,2
103,4
56,7
32,1
of 148.4
to 129.2
49,7
19,7
139,7
24,6
44,7
to 163.1
68,7
56,9
67,2
23,8
36,0
77,8
72,2
23,5
184,2
154,7
63,5
47,6
123,0
117,0
43,2
23,1
to 126.8
21,3
53,1
143,9
65,3
72,1
57,4
19,7
34,5
67,3
78,1
32,3
179,3
165,7

For another group of patients with tuberculosis infection results in the production of IFN-γ was expressed in IU/ml using the calibration graph. The analytical sensitivity of the test was 1.2 to 1.7 IU/ml IFN-γ for negative (zero) control sample from the blood plasma of subjects.

Clinical status of patients with different forms of tuberculosis infection identified using a hybrid protein rΔMPT64 presented in table 3. For another group of patients with tuberculosis infection results in the production of IFN-γ was expressed in IU/ml using the calibration graph.

Table 3.

The clinical status of TB cases detected using recombinant protein rMPT-64 using IFN-γ-analysis

No.
PM
TB infectionSensitivity (%)Specificity
(%)
1Infiltrative tuberculosis lay them 73-8474-97
2Focal pulmonary TB72-8380-94
3Disseminated tuberculosis70-8282-94
4Fibrous-cavernous lung tuberculosis77-8583-100

Table 4 presents the results of a comparative study of the specificity and sensitivity of the recombinant protein rΔMPT64 compared to PPD-tuberculin stimulation of whole cell cultures of blood. The specificity of the recombinant protein in IFN-γ-analysis in detection of TB is higher than the PPD tuberculin.

Some forms of TB (acute progressive) may not be detected during the screening. Patients with such processes fall mainly in the General hospital, where the diagnosis is often difficult because of the similarity of the x-ray pictures with nonspecific lung diseases. The only reliable method of diagnosis in such cases is a direct smear is ioscope sputum or use of IFN-γ analysis. All investigated groups of patients with pulmonary TB had a positive reaction using microscopic methods, culture, x-ray and molecular biology (PCR analysis).

1. Recombinant plasmid DNA RTV encoding a hybrid polypeptide: glutathione-S-transferase (GST) and a shortened version of the protein MRT (rΔ64), has an average molecular weight of 3.6 MDA, size 5574 P.N. and consists of the following elements:
- EcoRI-BamHI - fragment vector plasmids pGEX-2T size 4938 gel, containing the gene for β-lactamase induced tac-promoter, lacI geneqencoding the protein is a repressor of Lac operon, a gene fragment glutathione-S-transferase from S. japonicum with multiple site for cloning (MSC) genes in the 3'end of this gene and a nucleotide sequence that encodes a site of proteolysis by thrombin and located in front MSC;
- EcoRI-BamHI fragment size 636 gel containing flanked by sites for the restriction endonucleases EcoRI and BamHI shortened gene MRT obtained by amplification of the corresponding gene fragment from genomic DNA of M. tuberculosis;
and contains:
as a genetic marker gene β-lactamase determining the stability of the transformed plasmid RTV the cells of E. coli to antibiotic ampicillin;
unique restriction sites: BamHI - 930/934, EcoRI - 1566/1570.

2. Recombinant bacterial strain Escherichia coli BL21/pTB323 producing hybrid polypeptide GST-ΔMPT64 properties of mycobacterial antigen Δ64 containing recombinant plasmid DNA RTV according to claim 1 and deposited in the Collection of microorganisms fsri SRC VB "Vector" of Rospotrebnadzor under number B-1028.

3. Recombinant polypeptide GST-ΔMPT64 produced by recombinant strain BL21/pTB323 E.coli according to claim 2, contains as a protein carrier N-terminal polypeptide fragment of glutathione-S-transferase unlimited company. (226 S.A. with a molecular mass of 26,31 kDa), linked via its terminal site of thrombin hydrolysis (LVPR^GS) with C-terminal polypeptide fragment species-specific mycobacterial antigen Δ64 (205 S.A. with a molecular mass of 22,46 kDa) and has a complete amino acid sequence (431 S.A. with a molecular mass of 48,76 kDa), is shown in figure 3.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: polyepitope proteins consisting of two or more protein fragments of the foot-and-mouth disease virus, particularly serotype O/Taiwan/99, connected by linker amino acid sequences, are constructed. The vaccine polyepitope protein can be characterised by general formula VP4(X1 -X2)-GRL-VP1(X3-X4)-GRL-VP1 (X5-X6)GRL-2C(X7-X8)-GRL-3D(X9-X10)-GRL-3D(X11-X12), where GRL is a glycine-rich linker, Xn-Xm are integers denoting the number of amino acid residues of the corresponding foot-and-mouth disease virus protein, VP4, VP1, 2C, 3D are names of foot-and-mouth disease proteins. The invention discloses a nucleotide sequence (NS) which codes peptides included in the polyepitope protein, a recombinant plasmid which facilitates synthesis of a hybrid polyepitope protein in procaryote (E.coli) and eucaryote (plant) cells, and a solvent composition for a foot-and-mouth disease vaccine based on the polyepitope protein.

EFFECT: polyepitope protein has high immunising power and can be considered a potential recombinant vaccine against foot-and-mouth disease.

15 cl, 7 dwg, 2 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: engineered recombinant protein molecule for preparing a recombinant vaccine for an infection caused by swine influenza virus (HlNlv-2009). The molecule consists of a residue of methionine, a sequence of extracellular M2 protein domain of 2 to 24 amino acids and a sequence of a nuclear hepatitis B virus antigen of 4 to 149 amino acids. The molecule is able to form virus-like particles. There are also disclosed a recombinant nucleic acid coding such molecule, a vector for its expression, virus-like particles formed by such molecules and a vaccine based on the prepared virus-like particles.

EFFECT: prepared vaccine can be considered as a candidate recombinant swine influenza virus vaccine.

6 cl, 8 dwg, 3 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: what is offered is an expression construct for expression of single- or multipass transmembrane polypeptides in a bacterial host cell. Said construct contains a protein-coding polynucleotide, a strictly sensitive promoter of lower basal activity in the host-cell, and a leader sequence comprising a translation initiation enhancer. The strictly sensitive promoter comprises at least one positive control element and at least one negative control element. One or more positive and negative control elements represent a heterologous control element. Besides, what is offered is a method for producing the expressed transmembrane polypeptide and a method of recovering it form the host cell.

EFFECT: methods provide producing the high-yield transmembrane polypeptides either of native conformation, or in a soluble form.

53 cl, 28 dwg, 5 tbl, 10 ex

FIELD: medicine.

SUBSTANCE: invention describes nucleotide sequence (dwg.2), coding immunogenic polypeptide LcrV(G113), serving the base for construction of recombinant plasmid DNA pETV-I-3455, with the size 6538 bp, which codes immunogenic polypeptide LcrV(G113). Plasmid consists of plasmid pBR322 replicon, β-lactamase gene, determining resistance to ampicillin, T7-promoter, 1ac-operator, f1-replicon and DNA fragment, flanked by the sites for restrictases Ndel and Hindlll, coding synthesis of protein LcrV(G113), which starts from initiating codon ATG. Described is recombinant strain of bacteria E. coli BL21 (DE3)/pETV-I-3455 - producer of immunogenic polypeptide LcrV(G113) with amino acid sequence, represented on dwg.3, where tryptophan in position 113 (W113) is substituted with glycin. Described is method of obtaining said polypeptide by cultivation of strain E. coli BL21(DE3)/pETV-I-3455. Cells are destroyed in buffer solution by ultrasound and polypeptide is isolated successively by gel-permeation chromatography with application of carrier TSK HW-40, anion-exchanging and hydrophobic chromatography.

EFFECT: invention makes it possible to obtain product with high immunogenic and protective activity.

5 cl, 10 dwg, 2 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to recombinant plasmid DNA pER-Hir coding a hybrid protein capable to autocatalytic breakdown to form [Leul, Thr2]-63-desulphatohirudin, to Escherichia coli to an ER2566/pER-Hir strain - a producer of said protein and a method for producing genetically engineered [Leu 1, Thr2]-63-desulphatohirudin. The presented recombinant plasmid DNA consists of the SapI/BamHI fragment of DNA plasmid pTWIN-1 containing a promoter and a terminator of T7-RNA-polymerase transcription, an amplifier of phages T7 gene 10 translation, β-laktamase (Ap) gene, modified mini-intein Ssp DnaB gene, with an integrated sequence of a chitin-binding domain, and the SapI/BamHI-fragment of DNA containing a sequence of a gene of recombinant [Leul, Thr2]-63-desulphatohirudin-1 containing β-laktamase (Ap) gene as a genetic marker, and unique recognition sites of restriction endonucleases located at the following distance to the left from the site BamHI: Nrul - 186 base pairs, Ndel - 594 base pairs, Xbal - 882 base pairs, EcoRV - 2913 base pairs, Hpal - 2966 base pairs.

EFFECT: inventions allow producing said compound which is used as a drug applied to prevent blood hypercoagulation.

3 cl, 1 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: what is offered is a new method for producing human methionine-free interferon-alpha2b. The method starts with recombinant plasmid DNA containing a human interferon-alpha2b gene which is foregone by an enteropeptidase proteolysis site, and used to transform Escherichia coli cells. The cells are cultured, and inclusion bodies of the synthesised predecessor are isolated. It is followed by partial renaturation of the isolated predecessor in the presence of dithioerythrole preventing closure of disulphide bonds. The predecessor is hydrolysed by the enteropeptidase enzyme with producing human methionine-free interferon-alpha2b. After completion of the predecessor hydrolysis reaction, complete renaturation of human interferon-alpha2b is carried out in the presence of a pair of cystine and cysteine compounds promoting closure of disulphide bonds. The produced protein is purified by a chromatography in a KM-sepharose.

EFFECT: higher yield.

5 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: invention can be used for producing recombinant human interleukin-11 (rIL-11). The recombinant plasmid DNA pET32M/mTrx-rhIL-11 is produced by a method which involves synthesis of four fragments of a recombinant human interleukin-11 gene from oligonucleotide primers, cloning of each fragment in a plasmid vector pGEM5z restricted by EcoRV endonuclease, transformation of each of 4 plasmids of E.coli cells of strain DH5a, selection of clones coding the related fragments of the recombinant human interleukin-11 gene, selection of plasmids with the recombinant human interleukin-11 gene without mutations, combination of all fragments of the recombinant human interleukin-11 gene in the plasmid vector pUC19, construction of the vector pET32M of the plasmid pET32b, recloning of the recombinant human interleukin-11 gene in an expression vector pET32M, coding thioredoxin 1 E.coli with substitution of Asn84/Gln. The produced DNA is used to transform the E.coli BL21 (DE3) strain cells to produce the E.coli BL21 (DE3)/pET32M/mTrx-rhIL-11 strain that is a producer of recombinant human interleukin-11 as an ingredient of soluble fused protein mTrx-rhlL-11.

EFFECT: effective production of recombinant interleukin-11 in Escherichia coli cells.

3 cl, 5 dwg, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: polypeptide contains extracellular and transmembrane domains of a human tissue factor. A DNA fragment coding this polypeptide, and a plasmid pET28a(+) are used to produce a genetic make-up enabling biosynthesis of the recombinant human tissue factor. Also, the E coli BL21 [DE3]/p6E-tTF strain that is a producer of the recombinant human tissue factor is offered.

EFFECT: high-yield recombinant protein and simplified recovery and purification procedures.

2 cl, 4 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: stable inheritance effect is independent of an insertion position and orientation. The introduction of said sequence essentially reduces the loss frequency of both low-copy, and high-copy vectors. The given invention can find application in plasmid-bearing strain selection. And the cultivation of said strains does not require a selective medium to be used.

EFFECT: higher stability of vector inheritance.

1 dwg, 1 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of biotechnology and deals with recombinant plasmid DNA, which contains sequence of gene of mature staphylokinase Staphylococcus aureus with replacement of codons K74, E75 and R77 with triplets, which code Ala, of strain Escherichia coli MZ09 and method of obtaining recombinant protein, which contains sequence of gene of mature staphylokinase with replacement of codons K74, E75 and R77 with Ala-coding triplets. Essence of method includes recombinant plasmid DNA, which codes sequence of gene of mature protein of staphylokinase from Staphylococcus aureus staphylokinase with replacement of codons K74, E75 and R77 with Ala-coding triplets, which has nucleotide sequence, given in dwg.1. Invention also includes strain Esherichia coli MZ09, producent of recombinant staphylokinase, with sequence, given in dwg.1, as well as method of its obtaining.

EFFECT: invention makes it possible to obtain staphylokinase protein which possesses high fibrinogenic activity, with output of recombinant protein to 20% from total amount.

3 cl, 2 dwg

FIELD: agriculture.

SUBSTANCE: invention represents reference strains Francisella tularensis of tularensis subtype, including two genetic groups AI and AII, of holartica subtype, including biovars japonica, erythromycin-sensitive and erythromycin-resistant, Erys and EryR, and of mediasiatica subtype. Strains are deposited in the State Collection of Pathogenic Microbes "Microbe". All strains are natural, apart from the strain of holartica subtype, biovar japonica, which is extracted from a human being. Strains are produced by selection of clones that stably preserve phenotypic properties and containing genes, nucleotide sequence of which is specified for the type and subtype. The set of reference DNA preparations is created on the basis of these strains and may be used for genetic and immunological research.

EFFECT: using the invention will make it possible to increase efficiency of diagnostic research, to standardise and to increase quality of diagnostic preparations at production stages.

4 cl, 4 dwg, 1 tbl, 10 ex

FIELD: chemistry.

SUBSTANCE: invention describes extracted polypeptide including mutant A subunit of heat-labile enterotoxin E.coli (LT) that has only one mutated residue which is K, R, H or Y compared to heat-labile enterotoxin of wild type containing particular amino-acid sequence (stated in description). Mutant A subunit contains amino-acid replacement in position that matches position 61 LT of the wild type. LT containing such mutant A subunit shows decreased toxicity compared to its wild type analog. According to the invention the polypeptide can be used as adjuvant. It also describes vaccine for immune response induction containing bacterial or viral antigen and polypeptide as an adjuvant. The invention describes nucleic acid coding mutant A subunit LT E.coli, expression vector and transformed cell containing such vector.

EFFECT: provides for production of vaccines using highly immunogenic and non-toxigenic adjuvant.

16 cl, 2 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: offered test system for quantitative determination of Streptococcus agalactiae includes species-specific primers having nucleotide sequences 5'-CAGTTGAATCCAAATGTTACGG-3' and 5'-TAATGCTGTTTGAAGTGCTG-3', and a probe having a nucleotide sequence 5'-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3'. A DNA target for specific amplification is a gene cfb Streptococcus agalactiae fragment between 685 and 762 nucleotide residues of its complete sequence.

EFFECT: invention allows quick and high-specific detection of Streptococcus agalactiae in samples of a biological material and determination of the definition of its quantitative content.

2 dwg, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method provides recovery of DNA of an analysed strain followed by PCR with using nucleotide primers of terC, ilvN and inv genes of the following sequences: 89-S - AATCAAATCTCGCCCAGC, 89-As -GCTGCGTATCATTTCACC; 45-S - AGTGGTCTGCTTCTCTGG, 45-As -CGGCATACACAGAATACC; inv839 - TACCTGCACTCCCACAAC, inv1007 -CCCATACGCTGATCTACC. The analysed strains are differentiated by matching the sizes of the derived fragments of terC, ilvN and inv genes with the similar fragments in typical strains of principal and nonprincipal plague agents.

EFFECT: invention allows quick, effective and reliable differentiation of the strains.

1 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention describes mutations of the amino acid sequence of the protein of atpE mycobacteria (M. tuberculosis and M. smegmatis), which determine their resistance to DARQ J. Obtained are coding mutant forms of atpE nucleic acids, vectors containing said forms and host cells expressing mutant proteins.

EFFECT: invention discloses use of said host cells in a method of identifying compounds which can be used as antimicrobial agents for mycobacteria strains resistant to existing drugs.

5 cl, 4 dwg, 7 tbl

FIELD: medicine.

SUBSTANCE: polypeptides exhibit antimicrobial activity and recovered polynucleotides coding these polypeptides. Nucleic acid constructs, vectors and host cells contain said polynucleotides.

EFFECT: applicability of polypeptides in veterinary science and medicine, as well as in forage production.

16 cl, 6 tbl, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention concerns biotechnology and health care. Recombinant adenovirus p53 is capable of lowering side effects of the type caused by anti-tumour chemotherapy and radio-therapy. In cancer patients, recombinant adenovirus p53 can restore operation of organs, including blood analysis, liver functioning, kidney functioning etc in order to improve the quality of life of patients, for example improvement of appetite, mental status and the like.

EFFECT: invention can be used in medicine.

19 cl, 7 dwg, 4 tbl, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: compounds, included into one of compositions represent polypeptides, which contain at least immunogenic fragment of protein CT858 or protein CT089 Chlamydia trachomatis with specific amino acid sequence, or polynucleotides, coding immunogenic fragments of said proteins. Compounds, included into other composition, represent fused polypeptides, which contain immunogenic fragment of protein CT858 or CT089 and fusion partner, selected from immunologic fusion partners, expression amplifiers, affine markers and unrelated known proteins of Chlamydia trachomatis. Said compositions can be used for stimulation of specific T-cell response to Chlamydia trachomatis, for inhibition of infection development and for treatment of infection induced by Chlamydia trachomatis, ensuring high level of immune response and therapeutic effect.

EFFECT: described are compositions based on compounds for prevention and treatment of Chlamydia infection.

11 cl, 16 dwg, 7 tbl, 13 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and is a lipolytic enzyme which is obtained from one Streptomyces. Such a lipolytic enzyme has an amino acid sequence reduced to SEQ ID No.4, or an amino acid sequence which is at least 70% identical to it. The invention also relates to use of a lipolytic enzyme in a method of producing lyso-glycolipid, lysophospholipid, in an oil refining method, in phospholipid processing methods, in bio-conversion of polar lipids and in production of food products.

EFFECT: invention enables to obtain a novel enzyme having glycolipid hydrolysing action.

46 cl, 17 dwg, 4 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: strain is prepared of a commercial producer, a mutant strain, Aspergillus awamori M-2002 (Russian National Collection of Microorganisms F-3771D) with using methods of induced mutagenesis and plasmid transformation. The strain A.awamori amyR - T-19 is deposited in Russian National Collection of Microorganisms of Scryabin Institute of Biochemistry and Physiology of Microorgnisms of the Russian Academy of Sciences No. 4277D, stored in a lyophilised condition on a mowed wort agar in the Department of Enzymatic Preparation in Food Industry of State Scientific Institution All-Russian Research Institution of Food Biotechnology of Moscow Russian Agricultural Academy.

EFFECT: invention provides considerably higher glucoamylase yield from a substratum unit.

1 tbl, 2 ex

Up!