Polyepitope protein composition for inducing immune response against foot-and-mouth disease virus

FIELD: chemistry.

SUBSTANCE: polyepitope proteins consisting of two or more protein fragments of the foot-and-mouth disease virus, particularly serotype O/Taiwan/99, connected by linker amino acid sequences, are constructed. The vaccine polyepitope protein can be characterised by general formula VP4(X1 -X2)-GRL-VP1(X3-X4)-GRL-VP1 (X5-X6)GRL-2C(X7-X8)-GRL-3D(X9-X10)-GRL-3D(X11-X12), where GRL is a glycine-rich linker, Xn-Xm are integers denoting the number of amino acid residues of the corresponding foot-and-mouth disease virus protein, VP4, VP1, 2C, 3D are names of foot-and-mouth disease proteins. The invention discloses a nucleotide sequence (NS) which codes peptides included in the polyepitope protein, a recombinant plasmid which facilitates synthesis of a hybrid polyepitope protein in procaryote (E.coli) and eucaryote (plant) cells, and a solvent composition for a foot-and-mouth disease vaccine based on the polyepitope protein.

EFFECT: polyepitope protein has high immunising power and can be considered a potential recombinant vaccine against foot-and-mouth disease.

15 cl, 7 dwg, 2 tbl, 6 ex

 

The technical field to which the invention relates.

This invention relates to the field of immunology, protein engineering and biotechnology. It can be used to create polyepitopic vaccine proteins for immunization of animals against FMD.

Relevance

1) the Infectious agent of foot and mouth disease

The FMD virus is a typical representative of the family Picornaviridae and the genus Aphthovirus. Its genome presents single-stranded linear (+) RNA with Dantewada plots are approximately 8500 nucleotides. The genomic RNA encodes extended the precursor protein, which proteoliticeski processed at the intermediate and Mature structural and nonstructural proteins. The virus has icosahedral capsid composed of four structural proteins VP1, VP2, VP3 and VP4. The virions are unstable at pH below 6.5 and easily dissociate with the formation of 12S pentameron. Serological methods are able to distinguish seven serotypes of the virus: A, O, C, Asia-1, SAT (South Africa) -1, -2 and-3. Also has more than 60 subtypes of the virus. On the territory of CIS countries commonly found viruses serotypes Of A.

2) Disease

Outbreaks occur in all countries, where agriculture is used toed animals. The main reason for the spread of FMD is considered to be the international trade of Pets. Nabolevshii to the disease FMD cattle, less susceptible pigs, sheep, goats, more than 70 species of wild animals and people. The virus is transmitted from infected animals to healthy airborne. The first symptoms may appear within 2-3 days after infection. In infected animals there is a glow, impaired gait, lameness, aphthous lesion of the mucous membrane of the oral cavity, skin, udder and Milpitas cracks limbs. Despite the fact that the disease FMD does not lead to high mortality rates among adult animals, it manifests itself in weight loss, a sharp decrease in milk production. Death often occurs in young animals with weakened immune systems. They observed violations of functions of the cardiovascular system and skeletal muscles. Cattle and sheep and goats can be asymptomatic carriers of the virus, while gaining the ability to infect other animals within 2-3 years.

3) Economic damage

With regard to virus serotype O in Taiwan in 1997 occurred more than 6 thousand foci, had died or been culled more than 4 million pigs, the total economic damage amounted to about 10 billion dollars. The last outbreak of FMD in the UK in 2001 resulted in losses of approximately $ 6 billion pounds. With the emergence of foci of FMD And 22 in the Balkan countries in 199 year economic damage exceeded $ 300 million. Elimination of this disease in the Moscow region in 1995 cost approximately 14.6 million rubles in prices of that period, and in the Primorsky region in 2000 to 8.7 million rubles.

The level of technology

1) methods of disease control

In the late 19th and early 20th centuries the only way to control FMD was the slaughter of diseased animals. In 30-ies of the last century in Germany was created the first vaccine against FMD virus. The vaccine was obtained by inactivation of live virus with formalin in the presence of aluminum hydroxide. The virus to her had been collecting tissue epithelium and the fluid from the aft infected animals. This method of obtaining the vaccine could not provide sufficient material for immunization required for disease control. This situation lasted until the moment when in the middle of the last century in France was developed the first method for propagation of the virus in epithelial cells of the tongue healthy cows and was established the first commercial production of vaccines against FMD virus. Modern vaccines are produced from virus, cell culture-derived, processing binary ethylenimine. In the late 90-ies of the world production of such vaccines was about 1 billion doses per year [1]. In the Russian Federation proactive vaccination preparations inactivated virus is about the new control FMD susceptible livestock of agricultural animals. For pre-emptive vaccination is necessary to carry out constant monitoring of the epidemiological situation in the country and bordering countries. In case of hearth disease vaccination are susceptible farm animals in the neighboring areas.

In the invention EN 2332233 (2008.08.27) described a method of manufacturing a vaccine against FMD, including the cultivation of the virus in suspension culture cells KSS-21 at a temperature of 36-37°C, purification of viral suspension from the ballast impurities, inactivation, concentration of the obtained virus antigen and the compound concentrate antigen with adjuvant. Vaccine against FMD obtained by this method may contain antigenic material of the virus of type a, or Asia-1 in an effective amount 146S component, gel aluminium hydroxide, saponin and supportive environment. Although vaccination is similar preparations of inactivated FMD virus is quite effective, this vaccine is not produced in many countries with intensive livestock production for the following reasons:

1. concern about the ability to infect animals or humans with a virus diverted infectious material during its manufacture or incomplete inactivation;

2. the complexity of the fast developments of the vaccine in an emergency situation is the second occurrence of the disease site;

3. for the production of vaccines required expensive specially equipped laboratory, providing high biosecurity production;

4. viral drugs used for the production of vaccines, this supernatant cell suspension that is infected with FMD virus. These drugs, depending on the quality of production, may contain a different number of viral nonstructural proteins contaminating the vaccine. In vaccinated this vaccine animals, along with antibodies against structural proteins of FMD virus, antibodies against polluting non-structural proteins. The presence of antibodies against non-structural proteins makes it difficult significant difference in vaccinated animals from infected using immunological methods of diagnosis of the disease;

5. the vaccine is unstable at high temperatures, which complicates its transportation and storage.

Thus, to resolve the above problems, it is necessary the creation of new vaccines, which do not require the experience of a pathogen, easy to obtain and relatively inexpensive.

2) Develop methods of disease control

As vaccines can be used attenuated viral variants that have lost their pathogenicity as a result of mutations of the original strains and does not require inactivation. Main advantages : the STV live vaccines is, they activate humoral and cellular components of the immune system, causing a balanced immune response. In addition, these vaccines are relatively cheap, so as to immunize you need a small dose of the virus, as it is able to multiply in the infected organism.

Impaired FMD virus, with some degree of immunogenicity, the classic way get his passages in the insensitive foot and mouth disease of animals (mice, rabbits) [2, 3]. However, getting a virus, weakened immune animals simultaneously immunogenicity, low pathogenicity and infectious for vaccinated animals, is a complex technical task. A significant drawback of vaccines based on attenuated virus is its genetic instability that can lead to the acquisition of virulence. To improve vaccine based on a live virus researchers tried to change the genome of the virus. In this case, the principle of attenuation was based on the delegation or the modification of sites in the genomic RNA, affecting infectious characteristics of the virus [4-6]. However, a significant positive results in these papers had been received.

One approach to the creation of FMD vaccines is getting empty capsid" or virusology particles (The H). Non-infectious HCV FMD lacking genomic RNA, are formed in a number in cell cultures, animals infected with the virus. Such HPV contain a complete set of antigenic sites of viral capsid and immunologically identical to intact virions. To develop technologies for HPV necessary gene co-expression of the precursor capsid proteins and viral processorsa protease 3C. HPV FMD could be obtained using recombinant baculovirus expressing the necessary protein components in the cells of the silkworm [7]. Drugs such HPV is able to induce protective immunity in pigs, however, the cost of such drugs is quite high.

Application WO 2006063445 (2006.06.22) describes the construction of recombinant FMD vaccines, based on the expression in animal cells modified by gene predecessor structural proteins of FMD virus, coding sequences are separated artificially by introducing sites for proteolysis of cell protease non-viral origin, providing processing of the capsid precursor proteins for Assembly of HPV. The disadvantage of this approach is the relatively low output immunogenic HPV and high cost of the drug.

Another direction of research opportunities safe alter the exploring vaccines against FMD virus is the use of individual viral proteins or peptides. Such vaccines is called a subunit. Because of the immunodominant epitope of the virus particle is located in the G-H loop of capsid protein VP1 [8], subunit vaccines against FMD virus are usually the drugs of this protein or its fragments [9-13]. The disadvantage of existing develop subunit vaccines is the low effectiveness of immunization to protect animals against infection. For the induction of protective immune response drugs capsid protein VP1 in pigs inoculated with 105-fold the dose of virus that causes infection of 50% of tissue culture cells (TCID50), needed three immunization (one seed and two reinforcing) by 3 and 2 mg protein, respectively [14], which were produced during the two and a half months.

VP1 and its antigenic peptides were obtained in bacterial, yeast and plant expression systems protein, and animal tissue cultures. Some works devoted to the creation of synthetic vaccines using different ways conjugated peptides VP1 [15]or receiving of live recombinant vaccines using vectors based on vaccinia virus [16, 17] or adenovirus [18, 19]. Such vaccines are able to induce neutralizing antibodies in laboratory animals, however, protectively such drugs for selskohozyays the public animals, as a rule, small.

The mechanisms of protective immunity against FMD virus is poorly understood. Some data indicates that protection from infection in addition to humoral immunity plays an important role in T-cell immunity. In a recent work by computer analysis predicted the potential participation of the N-terminal sequence of non-structural protein of FMDV 2C in its recognition by cells of the immune system [20]. Although this peptide does not have a protective action, his inclusion in the composition of protein for immunization may be appropriate. In another paper [21] immunogenic T-cell epitopes were identified in the protein that performs the function of RNA-dependent RNA polymerase 3D. It was shown that a recombinant vaccinia virus expressing the gene of 3D, able to provide partial protection of pigs against infection with FMD virus in the absence of a humoral response. Conducted the mapping T-cell epitopes in the protein 3D using a set of peptides for their ability to induction of specific proliferative responses and synthesis of gamma-interferon. Identified protein sequences can be promising for inclusion in the composition of synthetic vaccines against FMD virus.

In the invention EN 2202613 (1996.09.18) described immunogenic peptides of the virus PWD the RA sequences comprising at least eight amino acids, corresponding to fragments of the non-structural proteins, which have been selected by immunoreactivity with specific FMD virus antibody or by immunoreactivity with specific virus T-lymphocytes. The main disadvantages of this approach is the relatively high cost of the vaccine medication and limited set of epitopes provided by the immunized animal, the size of the amino acid chain immunogenic peptide.

In the application CN 1270839 (2000.10.25) offered the vaccine against FMD, based on plasmid construction of chimeric antibodies bearing the epitope of VP1 protein, the built-in variable region heavy and light chain immunoglobulins pigs. This plasmid transferout mammalian cells and receive lines producing chimeric antibodies with high yield. The disadvantage of this approach is the relatively high cost of the final product and the presence in the protein vaccine potential neverexperienced epitopes of antibodies.

The invention

The present invention provides a highly effective candidate recombinant vaccine against FMD. The basis of the invention lies in the principle of increasing the effectiveness of induction and balance the immune system when using subunit vaccines immune the gene protein educated set of the most effective epitopes of FMDV within a single polypeptide chain. Vaccination such polyepitope proteins containing a combination of well-studied b - and T-cell epitopes of the virus leads to improved immune response in the animal and contributes to a more effective protection.

The invention includes:

a) design of structures for the expression of recombinant polyepitope protein of FMDV,

b) synthesis of the gene encoding the recombinant polyepitope protein N-RE, including epitopes of structural proteins VP4 and VP1 and non-structural 2C and 3D, separated glenbogie the linkers, and six amino acid residues histidine (6×His), which allows affinity purification of the protein, N-end,

C) creating a strain of E. coli producer of recombinant polyepitope protein N-RE,

g) the development of a Protocol for isolation and purification of recombinant polyepitope protein N-RE from bacteria and plants,

d) the test results of the drugs on laboratory animals, indicating the high immunogenicity of recombinant polyepitope protein N-RE contributing to the protection of animals from FMD.

Thus, the first aspect of the present invention is the design polyepitope proteins for immunization of animals against FMD virus is different serotypes and subtypes. Recom is inantly polyepitopic protein consists of fragments of structural proteins VP4 and VP1 and non-structural 2C and 3D, split flexible glenbogie the linkers. The General formula of such proteins VP4(X1-X2)-GRL-VP1(X3-X4)-GRL-VP1(X5-X6)-GRL-2C(X7-X8)-GRL-3D(X9-X10)-GRL-3D(X11-X12) is presented in figure 1, where GRL means licensekey linker consisting of a sequence of four amino acid residues glycine and two serine or a sequence of four amino acid residues glycine, two serine, glutamic acid and phenylalanine, following one after another, a Xn-Xm - integers reflecting the numbers of amino acid residues of the corresponding protein of FMDV (VP4, VP1, 2C, 3D) from the starting methionine in the sequence of the protein precursor encoded in the genome of FMDV this serotype. The amino acid composition of the individual fragments and the number of X1-X12 individual and are determined based on a multiple alignment of known protein sequences of FMDV and protein sequences of FMDV, which creates a subunit vaccine based on polyepitope protein according to the principle described in this invention (Figure 2). For example, for design polyepitope protein vaccine against FMD virus subtype O/Taiwan/99 (amino acid sequence of GenBank CAD62369) number X1-x2, X3-X4, X5-X6, X7-X8, X9-X10 and X11-X12 equal 222-241, 859-883, 924-937, 1175-1183, 1863-1977 and 2283-2322 respectively. For affinity purification of recombinant p. lepidophora protein at the N - or C-end of the sequence can be added to the amino acid sequence of six histidine residues, chitinase domain etc.

The second aspect of the present invention is a recombinant DNA with the nucleotide sequence of the gene N-PE (Figure 3), which encodes the recombinant polyepitope protein vaccine for FMD virus serotype O/Taiwan/99 having the formula 6H-VP4(222-241)-4G2S-VP1(859-883)-4G2S-VP1(924-937)-4G2SEF-2C(1175-1183)-4G2S-3D(1863-1977)-4G2S-3D(2283-2322), where 6N is a sequence of six amino acid residues histidine, a 4G2S and 4G2SEF - glenbogie linkers comprising the amino acid sequence of the four residues glycine and two serine or a sequence of four amino acid residues glycine, two serine, glutamic acid and phenylalanine, following one after another, respectively.

The third aspect of the present invention is a recombinant plasmid pet-23a(+)-NRE for synthesis of hybrid polyepitope protein vaccine for FMD virus serotype O/Taiwan/99 in the cells of the bacteria E. coli, consisting of a modified in polylinker plasmids pet-23a(+) inserting a recombinant DNA gene N-D (Figure 4).

The fourth aspect of the present invention is a recombinant plasmid pA7248-AMV-H-PE for synthesis of hybrid polyepitope protein vaccine for FMD virus serotype O/Taiwan/99 in plants Nicotiana benthamiana, consisting of a modified in polylinker plasmids re-AMV [22] by inserting a recombinant DNA sequence of the gene N-D (Figure 5).

The fifth aspect of the present invention is a recombinant strain of the E.coli bacteria, producer hybrid polyepitope vaccine protein N-RE against FMD virus serotype O/Taiwan/99.

The sixth aspect of the present invention is the composition of the solution of solvent for vaccine against FMD virus based polyepitope protein for immunization according to the principle described in this invention. As the solvent used is an aqueous solution containing 10 mm Tris(hydroxymethyl)aminomethane - hydrochloric acid (Tris-HCl) pH 8.0 and 4 M urea.

The seventh aspect of the present invention represented by the test results, medications polyepitope proteins in laboratory animals. It was shown that (1) immunization of Guinea pigs leads to the induction of immune responses against FMD virus serotype O/Taiwan/99 and (2) immunization of Guinea pigs medicines polyepitopic protein provides protection against Contracting the virus. Thus, polyepitope proteins can be used as the basis for vaccines against FMD virus.

Brief description of figures

Figure 1 - Formula recombinant polyepitope protein for the induction of immune responses against the virus. GRL means licensekey linker consisting of a sequence of four amino acid residues glycine and two serine or n the coherence of the four amino acid residues of glycine, two serine, glutamic acid and phenylalanine, following one after another, a Xn-Xm are integers reflecting the numbers of amino acid residues of the corresponding protein of FMDV (VP4, VP1, 2C, 3D) from the starting methionine in the sequence of the protein precursor encoded in the genome of FMDV this serotype.

Figure 2 Multiple alignment of amino acid sequences of the protein precursor of FMDV serotypes A, O, C, Asia1, SAT1, SAT2, SAT3 (FMDV_A, FMDV_O, FMDV_C, FMDV_Asia1, FMDV_SAT1, FMDV_SAT2 and FMDV_SAT3 respectively) and epitopes of FMDV O/Taiwan/99 (HPE_VP4, HPE_VP1_1, HPE_VP1_2, HPE_2C, HPE_3D_1 and HPE_3D_2)constituting the recombinant protein vaccine according to the formula VP4(X1-X2)-GRL-VP1(X3-X4)-GRL-VP1(X5-X6)-GRL-2C(X7-X8)-GRL-3D(X9-X10)-GRL-3D(X11-X12) and the principle described in this invention. For design polyepitope protein vaccine against of FMDV O/Taiwan/99 numbers X1-x2, X3-X4, X5-X6, X7-X8, X9-X10 and X11-X12 equal 222-241 (A), 859-883 (B), 924-937 (), 1175-1183 (G), 1863-1977 (D) and 2283-2322 (E), respectively. To illustrate a multiple sequence alignment of protein-precursors of FMDV O/Taiwan/99 and serotypes A, O, C, Asia1, SAT1, SAT2, SAT3 were used amino acid sequence of GenBank CAD62369 and R, AT, R, ESR, EAT, EAT and EAT respectively.

Figure 3 Nucleotide and amino acid sequence of the recombinant protein N-R.E.

Figure 4 - Structure the tour recombinant expression vector pet-23a(+)-N-R.E.

Figure 5 - Structure of recombinant plasmids pA7248-AMV-H-PE.

6 - Expression, isolation and purification of N-D protein obtained in E. coli. 1 - molecular weight Marker; 2 - Total protein cell culture, not transformed expression by plasmid; 3 - Total protein cell culture transformed with the plasmid pet-23a(+)-N-R.E.

Fig.7 - Expression of protein N-RE in N.benthamiana plants. 1 - molecular weight Marker; 2 - total protein cell culture of E. coli transformed with the plasmid pet-23a(+)-N-RE, on the gel approximately 0.5 μg protein N-D; 3 - a sample of leaf tissue from the area, agroecologies mixture of cultures of cells transformed pA7248-AMV-GUS and HCPro; 4 - sample of leaf tissue from the area, agroecologies mixture of cultures of cells transformed pA7248-AMV-H-PE and HCPro; 5 - preparation of purified protein N-PE isolated from plants.

The implementation of the invention

Example 1. Recombinant protein molecule N-RE and coding its recombinant nucleic acid.

To create a nucleotide sequence of the DNA recombinant gene encoding a protein consisting of epitopes of FMDV were used amino acid sequences of known b-cell epitopes of structural proteins and T-cell epitopes of non-structural proteins of FMD virus serotype O/Taiwan/99 listed below. B-cell epitopes: VP4 (222-241) [23], VP1 (859-883) [24 and (924-937) [25]; and T-cell epitopes: 2C (1175-1183) [26], 3D (1863-1977) and (2283-2322) [27]. In order to avoid potential problems of protein folding epitopes were separated by "flexible" licensestyle the linkers G4S2. In order to increase the efficiency of expression of the recombinant protein, codon sets the composition of the coding DNA sequence was optimized for expression in plants of the genus Nicotiana. To clone the gene into the expression vector at the 5'end of this DNA were added to the sequence of restriction sites AscI and NdeI and 3'-end sequences of sites XhoI and XmaI. Between sequences, encoding the b-cell and T-cell epitopes, was added to the sequence of the EcoRI site. DNA gene was synthesized by the company Evrogen (Russia).

Using PCR and primers m13f (CGCCAGGGTTTTCCCAGTCACGAC), M13R (CAGGAAACAGCTATGAC), pHisPE (ACCTTGGGCGCGCCCATATGCATCATCACCATCACCATATAATCAATAACTATTATATG) on the N-end of such a chimeric sequence was added to the amino acid sequence of six amino acid residues histidine for the possibility of separating the protein. PCR was performed under the following conditions: (1) 98°C 10 sec, (2) 56°C - 30 sec, (3) 72°C - 30 sec, steps 1-3 were repeated 30 times.

The obtained PCR product was used to obtain a fragment containing a recombinant nucleic acid encoding a protein N-RE. For this he was treated with restrictase NdeI and XhoI, were isolated fragment of 0.77 is.P.N., representing the desired recombinant nucleic acid.

Example 2. Creating a recombinant expression vector and E. coli strain - producer of recombinant protein N-R.E.

To create a recombinant expression vector recombinant nucleic acid that represents the DNA fragment size of 0.77 TPN cut from the PCR product using restricted NdeI and XhoI, cloned in the expression vector pet-23a(+) restriction sites NdeI and XhoI. The obtained recombinant expression vector was designated as pet-23a(+)-N-RE. In this vector the recombinant nucleic acid encoding a N-D, is under the control of T7 promoter, which ensures its expression in the cell of the bacterium Escherichia coli by the method of induction. The result of restriction analysis of the clones was detected desired plasmid containing an insert of the correct size. The correct nucleotide sequence of the inserts of the plasmids was confirmed by sequencing.

The resulting plasmid (pet-23a(+)-N-PE) was used to transform E.coli strain Rosetta2 with the pRARE2 plasmid, allowing efficient translation of rare codons. Expression of protein N-PE was produced by the method of self-induction [28]. Transformed cells Rosetta2 and sowed on LB agar with 1% glucose and incubated for 12 hours at 37°C. a Single colony was transferred in the ZYP-0.8G, cultures were grown for 7 hours at 37°C with constant stirring. The cell culture was perseval on Wednesday ZYP-5052 and grown at 37°C for 12-48 hours. The level of expression of recombinant protein N-PE was performed by analysis of total protein preparations isolated from bacterial cultures using SDS-PAGE. The maximum production level of recombinant protein N-RE was about 80% of the total cellular protein (6).

Example 3. Isolation and purification of the recombinant protein H-D

Bacterial protein with six amino acid residues were isolated under denaturing conditions by affinity chromatography on Ni-NTA-sepharose (Promega) in column (QIAGEN, Germany) according to modified methods 10 and 17 guide The QIAexpressionist™ QIAGEN (Germany). To do this, expressing the cell culture was centrifuged at 13000 rpm for 5 minutes and the precipitate resuspendable buffer pH 8.0, containing 100 mm NaH2PO4, 10 mm Tris·Cl, 6 M GuHCl at a rate of 1 ml buffer 80 mg of sediment was mixed on a rotating mixer for 30 min, the Cell lysate was centrifuged at 14000 rpm for 15 min and supernatant was collected. The supernatant was incubated with equilibrated in buffer A. the suspension of Ni-NTA sepharose for 30 min with constant stirring. Transferred the mixture of lysate and the sorbent in the column. Washed sorbent, Botero is A, twice buffer At pH 8.0 containing 100 mm NaH2PO4, 10 mm Tris·Cl, 8 M urea, twice buffer With pH 6.3, containing 100 mm NaH2PO4, 10 mm Tris·Cl, 8 M urea, buffer D pH 5.9 containing 100 mm NaH2PO4, 10 mm Tris·Cl, 8 M urea, buffer E pH 4.5, containing 100 mm NaH2PO4, 10 mm Tris·Cl, 8 M urea. Was suirable protein buffer F containing 6 M GuHCl, 0.2 M acetic acid. Fractions of the eluate containing the maximum amount of protein were dialyzed against a solution of 4 M urea, 10 mm Tris-HCl pH 8.0. From 65 mg of cell sediment was contributed approximately 1 mg H-D protein with a relatively high level of treatment is not less than 95%.

Example 4. The immunogenicity of the candidate vaccine based on the N-PE obtained in E. coli.

To characterize the immunogenicity and protective action of bacterial N-D protein oil emulsion was administered to 3 groups of Guinea pigs (each group of 8 animals) intramuscularly in the hind leg of the proteins in different doses: the first group with 350 μg of protein; the second is 120 mcg; third at 40 mcg. Preparation for immunization was prepared from 30 parts of the aqueous phase containing N-D protein in 4 M urea, 10 mm Tris pH 8.0 and 70 parts of oil adjuvant Montanide ISA 70 company SEPPIC (France). The fourth group was the control and 8 Guinea pigs, which protein is not entered.

Through 17 days after immunization the animals were selected serum, which the ies were tested using the reaction of microneutralization (RMN) (table 1).

Table 1
The results of the study immunogenic and protective activity of bacterial H-D protein in Guinea pigs
Group numberThe amount of injected proteinThe results of the activity of the protein
RMNcontrol infection: the number of protected animals/number of animals in the experience
1350 mcg<1:458/8
2120 mcg<1:328/8
340 mcg<1:164/8
4not entered>1:160/8

RMN spent on culture 96-well tablets company "Costar" in transplantable cell cultures kidney pig IB-RS-2 against 100 TCD50the culture of FMDV type O/Taiwan/99. Before on the stop by the reaction of the blood serum of Guinea pigs was diluted 1:4 supportive environment Needle and iactiveaware at a temperature of 56°C for 30 min to remove non-specific inhibitors. Serum was titrated two-step, starting with a dilution of 1:16, was added an equal volume of the working dose of FMDV and kept for 1 h at 37°C. Then, wells were made suspension culture cells with a concentration of 0.8×106cells/cm3. The tablets were kept for 48 h in CO2-incubator with 5% CO2and a temperature of 37°C. the Reaction was taken into account under the inverted microscope, the titer of the serum was calculated by the method of Cerberus. Neutralizing antibody levels of the test serum was considered marginal serum dilution at which the neutralization of infectious steps 100 TCD50virus in 50% of infected cell culture IB-RS-2. Positive thought of the serum activity of antibodies in a dilution of 1:45 and above.

After 21 days after immunization groups of Guinea pigs were exposed to infection control adapted to these animals with FMD virus O/Taiwan/99 homologous vaccine strain intradermal in the plantar surface of the hind limbs in a dose of 104,0GD50/0.2 cm3. Analysis of infection was performed after 7 days and was assessed by generalization yasunaga process. Generalization believed education secondary aft of the fore limbs, which were not introduced virus. Control vaccine was considered valid if 8 unvaccinated pigs generalizada the Noi form was sick at least 7 animals.

A single immunization of Guinea pigs emulsion vaccine containing previfem volume of bacterial N-D protein in quantities 350 mcg and 120 mcg, induced in animals the formation of neutralizing antibodies to FMD virus type O/Taiwan/99 detected in RMN. Data protectively animals are consistent with the data RMN their sera. All immunized such doses of animal protein there was no appearance of secondary aft on each front paw after 7 days after infection. The group of pigs immunized with bacterial N-RE in the amount of 40 µg secondary atty was detected in 4 out of 8 pigs. Symptoms of FMD appeared in 8 non-immunized (control) Guinea pigs.

Example 5. Creating a recombinant expression vector recombinant protein N-D in plants Nicotiana benthamiana.

To create a recombinant vector for the expression of H-D protein in the cells of Nicotiana benthamiana recombinant nucleic acid that represents the DNA fragment size of 0.77 TPN cut from Poland product using restricted AscI and XmaI, cloned in the binary vector pA7248-AMV by restriction sites AscI and XmaI. The obtained recombinant expression vector was designated as pA7248-AMV-N-RE. The correct nucleotide sequence of the inserts of the plasmids was confirmed by sequencing. The obtained plasmid pA7248-AMV-H-PE was used for the van to transform Agrobacterium tumefaciens strain ANA. The transformation was carried out by standard methods [31]. In an ice bath to the competent cells were added to 0.5 μg of plasmid DNA. Cells kept for 5 min at 37°C, then added 500 μl of LB medium and grown for 4 hours at 28°C with constant stirring. Cells were sown on LB-agar and incubated at 28°C for 3-4 days. The colony of agrobacteria transformed design pA7248-AMV-H-PE, was selected using a panorama screening with a pair of specific primers PVXseq456 (GAGAGAAATTGGCAAGGGCT) and PVXdAvr (CAGTCAGGCGCATAATTGAT). PCR was performed under the following conditions: (1) 94°C - 30 sec, (2) 42°C - 30 sec, (3) 72°C - 2 min, steps 1-3 were repeated 25 times.

To improve the efficiency of transient expression of the target protein plants were agronatural mixture of cultures transformed by the vector with the target gene and vector-producer of the suppressor of RNA silencing protein P24 virus associated with twisting of leaves of grapes 2 (GLRaV-2) or HCPro the mosaic virus turnip, cloned in a modified plasmid pCambia2301. In these plasmids the nucleotide sequence of the T-DNA is flanked by areas necessary for its transfer to the nucleus, was replaced by the following sequence: the website of recognition of restrictase AscI, the sequence of the 35S promoter, the site of recognition of restrictase PmeI, the sequence of the open reading frame that encodes a protein suppressor, sites usnavi the Oia restricts > PST and StuI, sequence nos and 35S transcription terminators. The obtained constructs were named rsar and pCCaHCPro and used to transform Agrobacterium tumefaciens strain ENA.

Cell culture Agrobacterium transformed designs re-AMV-H-PE, pA7248-AMV-GUS (see below), pCCaHCPro or rsar, were grown in LB medium with antibiotics (kanamycin, rifampicin, gentamicin) and with 10 mm MES (2-(N-Morpholino)-econsultancy acid) 12 hours on a shaker at 28°C. Cells were besieged at 4000 rpm for 5 minutes, the precipitate resuspendable in inducing buffer containing 10 mm MgSO4, 10 mm MES. Was determined by optical density, was preparing a suspension of cells in inducing buffer to an optical density (OD600) of 0.2. Solution was added to acetosyringone (final concentration of 150 μm) and kept for 3 hours at room temperature. Suspension of Agrobacterium cells, transformed design, coding target gene (pA7248-AMV-H-PE), and the design of the suppressor of RNA silencing (HCPro or P24) were mixed and injected by syringe without a needle into the intercellular space of leaves of plants.

As a negative control was used the same fabric sheet, infiltrated the culture of agrobacteria transformed design pA7248-AMV-GUS, bearing a sequence of β-glucuronidase. To obtain the vector pA7248-AMV-GUS sequence encoding a β-g is koronides, was cloned in plasmid pA7248-AMV by restriction sites AscI and XhoI.

Cells of plants, agroekologichnyj design pA7248-AMV-H-PE and HCPro or R24, were able to Express the protein with an electrophoretic mobility as the protein N-RE, expressed in bacteria (7). The share of protein N-RE in the plant was 0.7-1% of total protein of the sheet.

Isolation and purification of N-D protein from plants were conducted by the method similar to the selection of protein N-RE of bacteria. 120 g of fresh plant tissue was allocated approximately 8 mg N-D protein (67 mg of protein from 1 kg of plant tissue).

Example 6. The immunogenicity of the candidate vaccine based on the N-PE obtained in plants.

To characterize the immunogenicity and protective action of bacterial N-D protein obtained in a plant expression system by immunization of Guinea pigs at concentrations similar when vaccination bacterial protein N-D (300, 120 and 40 µg).

Through 17 days after vaccination at 24 immunized with different doses of antigen and 4 control Guinea pigs were sampled blood. The obtained serum of Guinea pigs were tested in indirect variant enzyme immune assay (ELISA) antigen of FMDV O/Taiwan/99 (test system of the FGI "ARRIAH") and using a set OF FMDV Ab PrioCHECK (table 2).

Table 2.
The results of the study immunogenic and protective activity of plant N-D protein in Guinea pigs
Group numberThe amount of injected proteinThe results of the activity of the protein
O FMDV Ab PrioCHECK PI (PIfloor≥50%)the test system of the FGI "ARRIAH"control infection: the number of protected animals/number of animals in the experience
1350 mcg78±14,7%>1008/8
2120 mcg70±22,7%>1008/8
340 mcg58,5±19,7%>506/8
4Not entered16,3±6,5%<500/8

Indirect option ELISA PR is led by the standard procedure with some modifications. The antigens of the virus strains O/seaside/OO, O/Manisa and O/Taiwan/99 was obtained from suspensions of infected human cell culture pgsk-30 in the process of precipitation of inactivated viral particles 8% solution of polyethylene glycol (6000 mm D) with the addition of NaCl to a final concentration of 0.9% and treatment with chloroform, followed by purification and concentration of antigen by ultracentrifugation through a 20% sucrose solution. Analysis of preparations of the antigen of FMDV was performed in 12%-15% SDS page [29].

Concentrated and purified antigen of FMDV was adsorbing holes in 96-well polystyrene tablet company "Nunc" MaxiSorp, Denmark) in carbonatebearing buffer (pH 9,6) number 1-2 µg protein per well. Unbound antigen sites in the wells were blocked with buffer BSA-TBST (0.02 M Tris-HCl, 0.15 M NaCl, 0.05% tween-20, 1% BSA). Samples were applied to the tablet in the buffer TBST with 5% fetal serum (FCS-TBST) method twofold serial dilutions. Incubated for 30 min at 37°C. After four times washing of the plate with buffer TBST in each well was made 50 ál individualo immunoperoxidase conjugate (branch "MEGAMALL" SE of epidemiology and Microbiology them. Nofamily RAMS), diluted in FCS-TBST 1:1000. Incubated for another 30 min at 37°C. Then the plate again washed. Staining produced by using a substrate mixture of ABTS (Mr Biomeicals, USA). After 10-15 min the reaction was stopped by 1% Ds-Na. The reaction was taken into account using a multichannel spectrophotometer by measuring the optical density (OD) at a wavelength of 405 nm. The titer of the serum was considered the final dilution at which the OD of the wells was less than or equal to twice the average OD value of the negative control.

As a reference test for the detection of antibodies against FMD virus type O used a commercial set OF FMDV Ab PrioCHECK (the Netherlands). The production reaction were performed according to the manufacturer's instructions, and a positive value is considered, the percentage of inhibition (PI) ≥50%.

Through 17 days after a single immunization of Guinea pigs a dose of 350 μg of antibodies determined according to the reference test OF FMDV Ab PrioCHECK, were induced in all vaccinated animals.

A single immunization of pigs with vaccine made on the basis of an oil adjuvant Montanide ISA 70 containing previfem the amount of plant N-D protein in quantities 350 mcg and 120 mcg, caused the formation in animals neutralizing antibodies to FMD virus type O/Taiwan/99 detected in ELISA. All immunized such doses of animal protein there was no appearance of secondary aft on the front paws through 7 days after infection. The group of pigs immunized with plant N-RE in the amount of 40 mg, the secondary is nye atty appeared in 2 of 8 pigs. Symptoms of FMD appeared in 8 non-immunized Guinea pigs.

The results of the evaluation of the immunogenicity of bacterial and plant polyepitopic protein N-RE on Guinea pigs indicate that after a single immunization dose of 120 mcg in combination with an oil adjuvant Montanide ISA 70, he is able to induce an immune response in animals detected by the methods of ELISA and RMN, and cause resistance to control infection with homologous adapted FMD virus type O/Taiwan/99. Consequently, the resulting preparation can be considered as a candidate for a vaccine against FMD virus.

The results obtained in Guinea pigs can extrapolate the achieved effect on farm animals.

The obtained data about the effectiveness of candidate vaccines against FMD virus protein-based, consisting of effective epitopes of the virus, suggest that this approach can be successfully used in the creation of other antiviral vaccines) preparations for immunization of animals against FMD virus is different serotypes and subtypes.

When carrying out the invention, in addition to the methods disclosed in the examples used are well known in the art the techniques described in the manuals of molecular biology and genetic engineering [30, 31].

1. Polyepitopic protein vaccine against FMD virus, consisting of two or more fragments of the proteins of the FMD virus, the United linker amino acid sequence, preferably a glycine-rich linker sequences, with the preferred option of vaccine proteins are proteins with the General formula VP4(X1-X2)-GRL-VP1(X3-X4)-GRL-VP1(X5-X6)-GRL-2C(X7-X8)-GRL-3D(X9-X10)-GRL-3D(X11-X12), where GRL denotes glycine-rich linker, Xn-Xm are integers reflecting the numbers of amino acid residues of the corresponding protein of FMDV, VP4, VP1, 2C, 3D titles proteins of FMD virus.

2. Polyepitopic vaccine protein according to claim 1, where GRL consists of a sequence of four amino acid residues glycine and two serine or a sequence of four amino acid residues glycine, two serine, glutamic acid and phenylalanine.

3. Polyepitopic vaccine protein according to claim 1 or 2, where the amino acid composition of the individual fragments and the number of X1-X12 individual and are determined based on a multiple alignment of known protein sequences of FMDV and protein sequences of FMDV, which creates a subunit vaccine based on polyepitope protein, according to the principle described in this invention.

4. Polyepitopic vaccine the trees according to claim 3 against FMD virus subtype O/Taiwan/99 (amino acid sequence of GenBank CAD62369), where the number of X1-x2, X3-X4, X5-X6, X7-X8, X9-X10 X11 X12 equal 222-241, 859-883, 924-937, 1175-1183, 1863-1977 and 2283-2322, respectively.

5. Polyepitopic vaccine protein according to claim 3, bearing at N - or C-end amino acid sequence applicable for affinity purification of the protein, including the sequence of six histidine residues or chitin-binding domain.

6. Polyepitopic vaccine protein according to claim 5 for FMD virus serotype O/Taiwan/99 having the formula 6H-VP4(X1-X2)-4G2S-VP1(X3-X4)-4G2S-VP1(X5-X6)-4G2SEF-2C(X7-X8)-4G2S-3D(X9-X10)-4G2S-3D(X11-X12), where 6N is a sequence of six amino acid residues histidine, 4G2S sequence glycine-rich linker of four amino acid residues glycine and two serine, 4G2SEF sequence glycine-rich linker of four amino acid residues glycine, two serine, glutamic acid and phenylalanine.

7. The nucleotide sequence encoding polypeptide according to any one of claims 1 to 6.

8. The nucleotide sequence according to claim 7, encoding six amino acid residues of histidine, b-cell epitopes of FMDV: VP4 (222-241), VP1 (859-883) and (924-937) and T-cell epitopes: 2C (1175-1183), 3D (1863-1977) and (2283-2322), divided flexible glycine-rich linkers G4S2.

9. The recombinant plasmid containing the nucleotide sequence according to claim 7, for synthesis of hybrid polyepitope protein vaccine for FMD virus in to ecah prokaryotes or eukaryotes.

10. The recombinant plasmid according to claim 9, providing a synthesis of hybrid polyepitope protein vaccine for FMD virus in plants or plant cells.

11. The recombinant plasmid according to claim 9, providing a synthesis of hybrid polyepitope protein vaccine for FMD virus in yeast.

12. The recombinant plasmid according to claim 9, providing a synthesis of hybrid polyepitope protein vaccine for FMD virus in animal cells.

13. The recombinant plasmid according to claim 9, providing a synthesis of hybrid polyepitope protein vaccine for FMD virus in bacteria.

14. The composition of the solution of solvent for vaccine against FMD virus based polyepitope protein according to any one of claims 1 to 5 for immunization, which is an aqueous solution containing a buffer and denaturing agent, is preferred denaturing agent is urea.

15. The composition of the solution of solvent on 14 containing as a buffer of 10 mm Tris(hydroxymethyl)aminomethane - hydrochloric acid (Tris-HCl) pH 8.0 and as a denaturing agent 4 M urea.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: microorganism, which codes antigens and protein toxins, contains a first component, which is at least one nucleotide sequence coding at least at least one complete or partial antigen of at least one wild-type or mutated protein, a second component which is at least one nucleotide sequence coding for at least one protein toxin and/or at least one protein toxin subunit, a third component consisting of at least a first subcomponent which is at least one nucleotide sequence coding at least one transport system which enables the expression of the first and second components on the outer surface of the microorganism and/or enables the secretion of the expression products of the first and second components, and/or coding at least one signal sequence which enables the secretion of the expression products of the first and second components, and/or optionally, from the second subcomponent, which is at least one nucleotide sequence coding at least one protein for lysing the microorganism in the cytosol of mammalian cells and for intracellularly releasing plasmids or expression vectors, which are contained in the lysed microorganism; and a fourth component which is at least one nucleotide sequence for at least one activation sequence for the expression of one or more of the first, second and third components, wherein said activation sequence can be activated in the microorganism and/or is tissue cell-specific, tumour cell-specific, macrophage-specific, dendrite-specific, lymphocyte-specific, function-specific or non-cell-specific, wherein any of the first, second, third or fourth components, present in the microorganism more than once, are independently identical or different, wherein the first and second components are different from each other. Also disclosed are a medicinal agent for stimulating immune response and a pharmaceutical composition based on said microorganism, methods of obtaining said microorganism, the corresponding expression plasmid and expression vector for obtaining said microorganism.

EFFECT: invention enables to obtain novel antitumour vaccines, which induce a strong systemic cellular immune system response, which increases effectiveness of antitumour therapy.

21 cl, 22 dwg, 8 ex

FIELD: biotechnologies.

SUBSTANCE: invention is related to biotechnology, in particular to production of n-butanol by means of carbohydrate-containing raw material fermentation with recombinant bacteria. The following plasmid DNA are constructed: pBCS, containing genes of butanol biosynthesis crt, bed, etfB, etfA and hbd from C.acetobutylicum and pTHL-BCS, containing, apart from earlier mentioned, gene thi from C.acetobutylicum. Plasmids may be replicated both in gram-negative (E.coli) and in gram-positive (L.brevis) bacteria. Recombinant strain-producers of n-butanol are produced on the basis of bacteria Lactobacillus brevis: strain Lactobacillus brevis VKPM V-10044, containing plasmid pBCS; strain Lactobacillus brevis VKPM V-10043, containing plasmid pTHL-BCS, which are able to synthesise butanol and resistant to its concentration of 2.0-2.8 wt % in liquid medium. Method is developed for synthesis of butanol on the basis of recombinant bacteria L.brevis, which combine ability to synthesise butanol with resistance to its concentrations in liquid medium of at least 2.0 wt %, which makes it possible to produce butanol using both glucose and xylose as source of carbon in mediums for cultivation.

EFFECT: invention makes it possible to increase synthesis efficiency.

5 cl, 2 tbl, 8 ex

FIELD: chemistry.

SUBSTANCE: method of producing cyclopropyl-condensed inhibitors of dipeptidyl peptidase IV involves using BOC-protected amine with structural formula (3) , obtained through reductive amination of acid with formula (1) by treating the said acid with ammonium formate, nicotinamide adenine dinucleotide, dithiothreitol and partially purified concentrate of phenyl alanine dehydrogenase and formate dehydrogenase (PDH/FDH) enzymes and without separation - by treating the obtained amine of formula (2) with ditertbutyl dicarbonate, obtaining BOC-protected amine.

EFFECT: cutting on costs.

13 cl, 7 ex

FIELD: medicine.

SUBSTANCE: claimed are expression vectors for obtaining IL-21 in E.coli cells. IL-21 coding nucleotide sequence, included in composition of novel vectors, contains modifications aimed at optimisation of codons and secondary mRNA structure for translation in E.coli. As a result of transformation with claimed vector structures E.coli strains suitable for industrial scale application have been obtained. Methods of wide scale IL-21 production which use said strains have been elaborated, allowing to obtain more than 1g/l of recombinant cytokine.

EFFECT: novel compounds possess useful biological properties.

14 cl, 1 dwg, 12 tbl, 19 ex

FIELD: biotechnology, in particular provision storage.

SUBSTANCE: bacteriocin represents polypeptide isolated from lactobacillus sakei 2512 and is capable to suppress lysteria growth and reproducing. Bactericin has specific amino acid sequence represented in claims. Nuclear acid sequence encoding said polypeptide is disclosed. Also disclosed is a vector including nuclear acid sequence for cloning and/or expression of polypeptide, for example in transformed cells, selected from Lactococcus, Lactobacillus, etc. Method for production of recombinant polypeptide is developed. Claimed bactericin or strain 2512 are used as component of bactericide composition, being capable to suppress growth of gram positive pathogenic bacteria, in particular Listeria monocytogenes.

EFFECT: large scale application of bacteriocin against pathogenic or undesired flora in food industry.

13 cl, 2 dwg, 1 tbl, 3 ex

Anti-plague vaccine // 2197988
The invention relates to a vaccine used to protect against infection by the bacterium Yersinia pestis, as well as to a method for protection of human or animal against infection Y

FIELD: medicine.

SUBSTANCE: engineered recombinant protein molecule for preparing a recombinant vaccine for an infection caused by swine influenza virus (HlNlv-2009). The molecule consists of a residue of methionine, a sequence of extracellular M2 protein domain of 2 to 24 amino acids and a sequence of a nuclear hepatitis B virus antigen of 4 to 149 amino acids. The molecule is able to form virus-like particles. There are also disclosed a recombinant nucleic acid coding such molecule, a vector for its expression, virus-like particles formed by such molecules and a vaccine based on the prepared virus-like particles.

EFFECT: prepared vaccine can be considered as a candidate recombinant swine influenza virus vaccine.

6 cl, 8 dwg, 3 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: what is offered is an expression construct for expression of single- or multipass transmembrane polypeptides in a bacterial host cell. Said construct contains a protein-coding polynucleotide, a strictly sensitive promoter of lower basal activity in the host-cell, and a leader sequence comprising a translation initiation enhancer. The strictly sensitive promoter comprises at least one positive control element and at least one negative control element. One or more positive and negative control elements represent a heterologous control element. Besides, what is offered is a method for producing the expressed transmembrane polypeptide and a method of recovering it form the host cell.

EFFECT: methods provide producing the high-yield transmembrane polypeptides either of native conformation, or in a soluble form.

53 cl, 28 dwg, 5 tbl, 10 ex

FIELD: medicine.

SUBSTANCE: invention describes nucleotide sequence (dwg.2), coding immunogenic polypeptide LcrV(G113), serving the base for construction of recombinant plasmid DNA pETV-I-3455, with the size 6538 bp, which codes immunogenic polypeptide LcrV(G113). Plasmid consists of plasmid pBR322 replicon, β-lactamase gene, determining resistance to ampicillin, T7-promoter, 1ac-operator, f1-replicon and DNA fragment, flanked by the sites for restrictases Ndel and Hindlll, coding synthesis of protein LcrV(G113), which starts from initiating codon ATG. Described is recombinant strain of bacteria E. coli BL21 (DE3)/pETV-I-3455 - producer of immunogenic polypeptide LcrV(G113) with amino acid sequence, represented on dwg.3, where tryptophan in position 113 (W113) is substituted with glycin. Described is method of obtaining said polypeptide by cultivation of strain E. coli BL21(DE3)/pETV-I-3455. Cells are destroyed in buffer solution by ultrasound and polypeptide is isolated successively by gel-permeation chromatography with application of carrier TSK HW-40, anion-exchanging and hydrophobic chromatography.

EFFECT: invention makes it possible to obtain product with high immunogenic and protective activity.

5 cl, 10 dwg, 2 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to recombinant plasmid DNA pER-Hir coding a hybrid protein capable to autocatalytic breakdown to form [Leul, Thr2]-63-desulphatohirudin, to Escherichia coli to an ER2566/pER-Hir strain - a producer of said protein and a method for producing genetically engineered [Leu 1, Thr2]-63-desulphatohirudin. The presented recombinant plasmid DNA consists of the SapI/BamHI fragment of DNA plasmid pTWIN-1 containing a promoter and a terminator of T7-RNA-polymerase transcription, an amplifier of phages T7 gene 10 translation, β-laktamase (Ap) gene, modified mini-intein Ssp DnaB gene, with an integrated sequence of a chitin-binding domain, and the SapI/BamHI-fragment of DNA containing a sequence of a gene of recombinant [Leul, Thr2]-63-desulphatohirudin-1 containing β-laktamase (Ap) gene as a genetic marker, and unique recognition sites of restriction endonucleases located at the following distance to the left from the site BamHI: Nrul - 186 base pairs, Ndel - 594 base pairs, Xbal - 882 base pairs, EcoRV - 2913 base pairs, Hpal - 2966 base pairs.

EFFECT: inventions allow producing said compound which is used as a drug applied to prevent blood hypercoagulation.

3 cl, 1 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: what is offered is a new method for producing human methionine-free interferon-alpha2b. The method starts with recombinant plasmid DNA containing a human interferon-alpha2b gene which is foregone by an enteropeptidase proteolysis site, and used to transform Escherichia coli cells. The cells are cultured, and inclusion bodies of the synthesised predecessor are isolated. It is followed by partial renaturation of the isolated predecessor in the presence of dithioerythrole preventing closure of disulphide bonds. The predecessor is hydrolysed by the enteropeptidase enzyme with producing human methionine-free interferon-alpha2b. After completion of the predecessor hydrolysis reaction, complete renaturation of human interferon-alpha2b is carried out in the presence of a pair of cystine and cysteine compounds promoting closure of disulphide bonds. The produced protein is purified by a chromatography in a KM-sepharose.

EFFECT: higher yield.

5 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: invention can be used for producing recombinant human interleukin-11 (rIL-11). The recombinant plasmid DNA pET32M/mTrx-rhIL-11 is produced by a method which involves synthesis of four fragments of a recombinant human interleukin-11 gene from oligonucleotide primers, cloning of each fragment in a plasmid vector pGEM5z restricted by EcoRV endonuclease, transformation of each of 4 plasmids of E.coli cells of strain DH5a, selection of clones coding the related fragments of the recombinant human interleukin-11 gene, selection of plasmids with the recombinant human interleukin-11 gene without mutations, combination of all fragments of the recombinant human interleukin-11 gene in the plasmid vector pUC19, construction of the vector pET32M of the plasmid pET32b, recloning of the recombinant human interleukin-11 gene in an expression vector pET32M, coding thioredoxin 1 E.coli with substitution of Asn84/Gln. The produced DNA is used to transform the E.coli BL21 (DE3) strain cells to produce the E.coli BL21 (DE3)/pET32M/mTrx-rhIL-11 strain that is a producer of recombinant human interleukin-11 as an ingredient of soluble fused protein mTrx-rhlL-11.

EFFECT: effective production of recombinant interleukin-11 in Escherichia coli cells.

3 cl, 5 dwg, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: polypeptide contains extracellular and transmembrane domains of a human tissue factor. A DNA fragment coding this polypeptide, and a plasmid pET28a(+) are used to produce a genetic make-up enabling biosynthesis of the recombinant human tissue factor. Also, the E coli BL21 [DE3]/p6E-tTF strain that is a producer of the recombinant human tissue factor is offered.

EFFECT: high-yield recombinant protein and simplified recovery and purification procedures.

2 cl, 4 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: stable inheritance effect is independent of an insertion position and orientation. The introduction of said sequence essentially reduces the loss frequency of both low-copy, and high-copy vectors. The given invention can find application in plasmid-bearing strain selection. And the cultivation of said strains does not require a selective medium to be used.

EFFECT: higher stability of vector inheritance.

1 dwg, 1 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of biotechnology and deals with recombinant plasmid DNA, which contains sequence of gene of mature staphylokinase Staphylococcus aureus with replacement of codons K74, E75 and R77 with triplets, which code Ala, of strain Escherichia coli MZ09 and method of obtaining recombinant protein, which contains sequence of gene of mature staphylokinase with replacement of codons K74, E75 and R77 with Ala-coding triplets. Essence of method includes recombinant plasmid DNA, which codes sequence of gene of mature protein of staphylokinase from Staphylococcus aureus staphylokinase with replacement of codons K74, E75 and R77 with Ala-coding triplets, which has nucleotide sequence, given in dwg.1. Invention also includes strain Esherichia coli MZ09, producent of recombinant staphylokinase, with sequence, given in dwg.1, as well as method of its obtaining.

EFFECT: invention makes it possible to obtain staphylokinase protein which possesses high fibrinogenic activity, with output of recombinant protein to 20% from total amount.

3 cl, 2 dwg

FIELD: medicine.

SUBSTANCE: agent contains mutant luciferase of glowworms Luciola mingrelica (SEQ ID No:2), recovered from recombinant cells E.coli transformed by plasmid pETL7, luciferin, magnesium sulphate, tris-(oxymethyl)-aminomethane, acetic acid, sodium ethylene aminotetraacetate, dithiotreitol, bovine serum albumin, sucrose and water.

EFFECT: higher sensitivity of ATP test, lower enzyme consumption.

2 cl, 3 dwg, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: invention claims synthetic DNS molecule encoding L1 HPV58 protein, where codons are optimised for high expression level in yeast cell. Also invention claims expression vector, yeast host cell, HPV58 virus-like particle and method of its obtainment, and pharmaceutical composition including such VLP.

EFFECT: invention can be applied in medicine for efficient immune prevention of papillomavirus infection by neutralising antibodies and cell-mediated immunity, and for treatment of developed HPV infections.

10 cl, 10 dwg, 8 ex

Up!