Drug preparation containing prar agonist

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions refers to ophthalmology. A drug preparation stimulates proliferation of epithelial cells of a tarsal gland or epithelial cells of a cornea. The drug preparation contains [3-[2-[4-isopropyl-2-(4-triflouromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxyacetic acid, [4-[3-[2-(4-triflouromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chloriophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy] acetic acid, or their pharmaceutically acceptable salt as an active ingredient. Said active ingredient is applied for making the drug preparation, and as stimulating proliferation of epithelial cells of the tarsal gland or epithelial cells of the cornea.

EFFECT: group of inventions provides treating eye diseases, such as xerophthalmus, tarsal gland dysfunction, corneal epithelial diseases.

18 cl, 3 dwg, 4 tbl, 5 ex

 

The technical field to which the invention relates

The present invention relates to a drug that stimulates the proliferation of epithelial cells mabombo cancer or epithelial cells of the cornea, which contains the PPARδ agonist (receptor-activated proliferation peroxisome) as the active ingredient.

The level of technology

Mabamba gland is a gland that synthesizes lipids enclosed between the upper and lower eyelids (eyelids), and it secretes a lipid through the hole at the conjunctive away from eyelash century. The lipid layer comprising as a component of tear fluid contains a lipid synthesized meibomiae glands, and it prevents the evaporation of tear fluid from the eye surface. It is known that patients with dysfunction mabombo cancer or meibomitis developing dry eyes hypersaline, keratoconjunctivitis epithelial disorders, erosion of the epithelium of the cornea and ulcer of the cornea that are associated with dry eye, such as mabamba iron exhibits functional impairment and secretes a lipid with a lower concentration.

In addition, the cornea consists of epithelium and the outer limiting membrane (Bowman's membrane), stroma, GNC is Rennie limiting membrane (descemetocele shell) and endothelium. Because the cornea is located on the front part of the eyeball, it is sensitive to external environmental influences, resulting in the development of various disorders. Examples of diseases associated with damage to or defect in the epithelial cells of the cornea include dry eye syndrome, ulcers of the cornea, the surface point keratitis, the erosion of the epithelium of the cornea, ocular allergic disorders associated with damage to the cornea, such as vernal conjunctivitis, allergic keratoconjunctivitis, etc. and the like.

At the same time, PPAR is one of the types of intracellular receptors expressed in most vertebrates, and believe that he belongs to a group of transcription factors, closely related to the concentration of intracellular sugar or lipid metabolism and cell differentiation. As for subtypes, known α, δ and γ-types. PPARδ sometimes referred to as PPARβ (non-patent document 1).

With regard to the distribution of PPAR in eye tissues, a well-known expression of PPARα and β in epithelial cells of the cornea of rabbits (non-patent document 2).

Reported that 5-[4-(6-methoxy-1-methyl-1H-benzimidazole-2-ylethoxy)benzyl]thiazolidin-2,4-dione, considered mainly as have the s PPARγ activating action, can be used as a therapeutic agent for keratoconjunctivitis disorders (patent documents 1 and 2), and PPARα, δ and γ agonist is administered for the treatment of eye diseases (conjunctivitis, dry eye syndrome, keratitis etc.) (patent document 3). In addition, it is known that PPARα is distributed in the liver, kidneys and such and effect on lipid metabolism and transport. In addition, also reported that their agonist can be used as a therapeutic agent for the treatment of diseases of the cornea (patent document 4). Reported that PPARδ agonists stimulate the proliferation and differentiation of epithelial cells of the sebaceous glands of rats (non-patent document 3) and contribute to the healing of skin wounds (non-patent document 4). In addition to the above, there is a method of stimulating proliferation of β-cells by introduction nationalidnumber ligand of PPAR and GLP-1 derivative (patent document 5), the inhibition of proliferation of leukemia cells, cancer cells of the prostate gland and similar pioglitazone (PPARγ agonist) (non-patent document 6) and the like.

However, many aspects of the expression and functioning of PPARα, δ, or γ for each animal species and each tissue or cells are still unclear, and it is not known whether suitable PPARδ agonist for the treatment of eye diseases in humans.

Paten the hydrated document 1: WO2005/039574,

patent document 2: JP-A-2001-39976,

patent document 3: WO2002/076177,

patent document 4: JP-A-2005-008570,

patent document 5: WO2002/69994,

patent document 6: WO1998/25598,

non-patent document 1: J Med. Chem. 2000, 43:527-550,

non-patent document 2: J Biol. Chem. 2000, 275:2837,

non-patent document 3: Molecular Genetic and Metabolism 2001, 74:362-369,

non-patent document 4: Am J Clin. Dermatol. 2003, 4(8):523-530.

The invention

Problems that need to be solved by the present invention

One purpose of the present invention is the provision of medicines, is able to stimulate the proliferation of epithelial cells mabombo gland and epithelial cells of the cornea, which can be used mainly in the treatment of eye diseases such as dry eye and the like, and therapeutic tool, which is used stimulant for eye diseases, such as dysfunction mabombo gland, disease of the epithelium of the cornea, dry eye and the like.

Solutions to problems

The inventors of the present invention conducted a thorough investigation, taking into consideration the above-mentioned problems, and found that the specific PPARγ agonist has exceptional activity in the stimulation of proliferation of epithelial cells mabombo gland and epithelial glue is OK corneal layer of the eye that led to the creation of the present invention.

Accordingly, the present invention includes at least the following aspects.

(1) a Drug that stimulates the proliferation of epithelial cells mabombo gland containing [3-[2-[4-isopropyl]-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxucusu acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl]-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl]-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt.

(2) a Drug that stimulates the proliferation of epithelial cells of the cornea of the eye containing [3-[2-[4-isopropyl]-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxucusu acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl]-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt.

(3) a Drug for the treatment of dysfunction mabombo gland containing [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxucusu acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl]-5-thiazolyl]propionyl]-2-methylphenoxy]acetic Ki the lot or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl]-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or their pharmaceutically acceptable salt.

(4) a Drug for the treatment of diseases of the epithelium of the cornea of the eye containing [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxucusu acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl]-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt.

(5) Drug for the treatment of dry eye, containing [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxucusu acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl]-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt.

(6) the Drug of the above-mentioned (5), in which dry eye is dryness of the eyes hypersaline.

(7) Application [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic KIS is the notes, or their pharmaceutically acceptable salts to obtain drugs that stimulate the proliferation of epithelial cells mabombo gland.

(8) Application [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt for a drug that stimulates the proliferation of epithelial cells of the cornea.

(9) Application [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or their pharmaceutically acceptable salts to obtain drugs for the treatment of dysfunction mabombo gland.

(10) Application [3-[2-[4-isopropyl]-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-{4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-about sapolil]propionyl]-2-methylphenoxy]acetic acid, or their pharmaceutically acceptable salts to obtain drugs for the treatment of diseases of the epithelium of the cornea.

(11) Application [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt for a medicinal product for the treatment of dry eye.

(12) Application of the above-mentioned (11), in which dry eye is dryness of the eyes hypersaline.

(13) a Method of stimulating proliferation of epithelial cells mabombo cancer, comprising introducing an effective amount of [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid or its pharmaceutically acceptable salt to a subject in need of promotion of proliferation of epithelial cells mabombo gland.

(14) a Method of stimulating proliferation of corneal epithelial cells blockages, including the introduction of an effective amount of [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt to a subject in need of promotion of proliferation of epithelial cells of the cornea.

(15) a Method of treating dysfunction mabombo cancer, comprising introducing an effective amount of [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl]-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt to a subject in need of treatment dysfunction mabombo gland.

(16) a Method of treating diseases of the epithelium of the cornea, including the introduction of an effective amount of [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-CHL is henyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt to a subject in need of treatment of diseases of the epithelium of the cornea.

(17) a Method of treating dry eye, comprising introducing an effective amount of [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl]-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt to a subject in need of treatment of dry eye.

(18) the Method of the aforementioned (17), in which dry eye is dryness of the eyes hypersaline.

The implementation of the present invention

The present invention relates to a new stimulator of proliferation mabombo cancer or stimulator of proliferation of the cornea, which stimulates the proliferation of epithelial cells mabombo cancer or epithelial cells of the cornea.

In addition, a therapeutic agent of the present invention can be effectively used for the treatment or relief of diseases, for example, dysfunction mabombo cancer, diseases of the epithelium of the cornea, dry eye and the like.

Brief description of drawings

Figure 1 show the and expression of PPARα mRNA, δ and γ grown in the epithelial cells of the cornea of the human eye (top panel), grown in the epithelial cells of the cornea of the rabbit (middle panel) and grown in epithelial cells mabombo cancer monkeys (bottom panel).

The best option is the implementation of the present invention

The present invention relates to a drug that stimulates the proliferation of epithelial cells mabombo gland containing [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxucusu acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or pharmaceutically acceptable salt (hereinafter in the present invention are sometimes collectively be called "the compound of the present invention") as the active ingredient. The drug stimulates the proliferation of epithelial cells mabombo cancer. In addition, the present invention relates to a drug that stimulates the proliferation of epithelial cells of the cornea of the eye containing [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxucusu acid, [4-[3-[2-(4-shall reformer)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid, or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt as an active ingredient. The drug stimulates the proliferation of epithelial cells of the cornea. Stimulator of cell proliferation in the present invention means a drug having the ability to stimulate cell division in order to increase the number of cells, and the drug with the ability to suppress cell necrosis, in order to increase the number of cells.

3-[2-[4-Isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxiana acid (CAS No. 515138-06-4):

contained in the stimulator of the present invention as the active ingredient is a compound having PPARδ agonistic activity, and it is described in WO2003/033493 (detail in example 5).

[4-[3-[2-(4-Trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid (CAS No. 500581-25-8):

contained in the stimulator of the present invention as the active ingredient is a compound having PPARδ agonistic activity, and it is described in WO2003/016291 (detail in example 3).

[4-[3-[2-(2-Hydroxy-4-chlorphen is)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid (CAS No. 500581-27-1):

contained in the stimulator of the present invention as the active ingredient is a compound having PPARδ agonistic activity, and it is described in WO2003/016291 (detail in example 6).

Examples of pharmaceutically acceptable salts of these compounds include metal salts with alkaline metals such as sodium, potassium, etc.; alkaline earth metals such as calcium, magnesium and so on; and the like. In addition, the compound of the present invention also includes their solvate.

PPARδ agonist of the present invention is a substance that binds to the ligand-binding domain (LBD) PPARδ, activates the receptor and regulates PPAR transcription of the target genes. PPARδ agonistic activity can be measured yeast digibridge manner, using chimeric receptor LBD and GAL4 yeast, and reporter gene in order to exclude the influence of other nuclear receptors, the integral present in mammalian cells. Specific examples of the measuring method include PPAR-GAL4 analyses described in the reference documents, T.M. Willson et al., Journal of Medicinal Chemistry, 2000, vol.43, No. 4, pp.528-550 and J.M. Lehmann et al., The Journal of Biological Chemistry, 1995, vol.270, No. 22, pp.12953-12956. It was confirmed that the compound of the present invention has PPARδ agonistic activity according to the methods described in WO2003/033493, p is the emer 12 and WO2003/01629, example 51.

The compound of the present invention can be synthesized according to the descriptions WO2003/033493 (detail, example 5) and WO2003/016291 (detail examples 3, 6).

The stimulator of the present invention, the content of the active ingredient is usually 0,000001-1% by weight, preferably within 0.00001-1% by weight, most preferred of 0.0001-0.1% by weight.

The stimulator of the present invention can contain any media in addition to the above active ingredients.

Examples of the carrier include solvents such as water, alcohol, etc.), buffers (e.g. phosphate buffer, acetate buffer, borate buffer, carbonate buffer, citrate buffer, Tris buffer, glutamic acid, γ-aminocaproic acid, etc.), preservatives (for example, benzalconi chloride, benzethonium chloride, gluconate chlorexidine, chlorbutanol, benzyl alcohol, dehydroacetic sodium, esters of peroxybenzoyl acid, edetate sodium, boric acid, etc.), isotonic agents (e.g. sodium chloride, potassium chloride, glycerin, mannitol, sorbitol, boric acid, glucose, propylene glycol, etc. and the like.

The stimulator of the present invention can be applied toin vivoorin vitroas a drug or the test reagent and the like.

When the stimulator of the present invention is used as the test reagent, it m what should be used as a test reagent in physiology and biochemistry and in different variants of implementation.

When the stimulator of the present invention is used as a medicine, it is suitable as a therapeutic agent for the treatment of diseases associated with injury or atrophy of epithelial cells mabombo cancer and diseases caused by hypofunction of epithelial cells mabombo cancer because the drug stimulates the proliferation of epithelial cells mabombo cancer. Examples of diseases include dysfunction mabombo cancer, inflammation Leibovich glands and the like. In addition, because the epithelial cells mabombo glands secrete the lipid component of the tear fluid, and lipid prevents evaporation of tear fluid and stabilizes the layer of tear fluid, a therapeutic agent of the present invention is suitable for treatment of diseases associated with lipid abnormalities (decreased secretion, replacement of a component) in the tear fluid. Examples of diseases include dryness of the eyes hypersaline.

In addition, the stimulator of the present invention is also suitable as a therapeutic agent for treating diseases associated with injury of the epithelial cells of the cornea (i.e. damage or defect), because it stimulates the proliferation of epithelial cells of the cornea. V. the battery of the present invention is suitable as a therapeutic agent for the treatment of diseases of the epithelium of the cornea, specifically, diseases associated with endogenous diseases, such as Sjogren syndrome, and syndrome of Stevens-Johnson syndrome dry eye (dry eyes) and the like; diseases associated with exogenous diseases such as post-operative disease, drug use, trauma, ulcers of the cornea, inflammation Leibovich glands, exogenous diseases when wearing contact lenses and the like; diseases associated with ocular allergic disorders, accompanied by the defeat of the cornea, such as vernal conjunctivitis, allergic keratoconjunctivitis and the like. The stimulator of the present invention is also suitable for the treatment of superficial point of keratitis and erosion of the epithelium of the cornea. In addition, the stimulator of the present invention is also suitable as a stimulant for wound healing of the cornea.

In addition, the stimulator of the present invention is suitable as pharmaceuticals for the treatment of dry eye in particular is a very suitable as pharmaceuticals for the treatment of dry eyes hypersaline, because the drug also has a stimulating effect on the proliferation of epithelial cells Horny obolos the eyes and the action on the proliferation of epithelial cells mabombo gland and has an effect, directly affecting the tissue of the cornea and the effect of improving the functioning of the lacrimal fluid by the action of the cells Leibovich glands.

In therapeutic agent of the present invention, the content of the active ingredient is usually 0,000001-1% by weight, preferably within 0.00001-1% by weight, most preferred of 0.0001-0.1% by weight.

Examples of subjects for administration of a stimulant or a therapeutic agent of the present invention include mammals (e.g. human, mouse, rat, hamster, rabbit, cat, dog, cow, sheep, monkey and so on).

A therapeutic agent of the present invention can be applied in the form of dosage forms, such as eye drops, band-AIDS, ointment, lotion, creams, oral medications and such, and it may contain, in addition to the aforementioned active ingredients, any media, such as a pharmaceutically acceptable carrier.

The method of introducing a therapeutic agent of the present invention in particular is not limited, provided that achieves the above-mentioned therapeutic effect, it is preferably local ocular administration. Examples of dosage forms for local ocular injection include eye drops and eye ointment.

For example, when therapeutic agent of the present invention note the following in the form of eye drops or eye ointment, stabilizers (for example, sodium bisulfite, sodium thiosulfate, edetate sodium, sodium citrate, ascorbic acid, dibutylaminoethanol etc), agents that increase the solubility (for example, glycerol, propylene glycol, macrogol, polyoxyethylene hydrogenated castor oil etc), suspendresume agents (e.g., polyvinylpyrrolidone, hypromellose, hydroxymethylcellulose, sodium carboxymethylcellulose, and so on), emulsifiers (for example, polyvinylpyrrolidone, soy lecithin, egg yolk lecithin, polyoxyethylene hydrogenated castor oil, Polysorbate 80, and so on), buffers (e.g. phosphate buffer, acetate buffer, borate buffer, carbonate buffer, citrate buffer, Tris buffer, glutamic acid, γ-aminocarbonyl acid etc), viscous agents (for example, water-soluble derivative of cellulose, such as methylcellulose, hydroxyethylcellulose, hypromellose, carboxymethyl cellulose, etc., chondroitin sulfate sodium, galorath sodium, carboxyvinyl polymer, polyvinyl alcohol, polyvinylpyrrolidone, macrogol etc), preservatives (for example, benzalconi chloride, benzethonium chloride, gluconate chlorexidine, chlorbutanol, benzyl alcohol, dehydroacetic sodium, esters of peroxybenzoyl acid, edetate sodium, boric acid, etc.), istoricheskaia (for example, sodium chloride, potassium chloride, glycerin, mannitol, sorbitol, boric acid, glucose, propylene glycol, etc.), pH regulators (for example, chloroethanol acid, sodium hydroxide, phosphoric acid, acetic acid, etc.), substances that have a cooling effect (for example, 1-menthol, d-camphor, d-borneol, mint oil, etc.), ointment bases (white petrolatum, purified lanolin, liquid paraffin, vegetable oil (olive oil, Camellia oil, coconut oil etc) etc) and the like can be added as an excipient. When the number of auxiliary substances varies depending on the type of auxiliary substance, method of application and the like, can be added in such quantities that give a concentration at which it is possible to achieve the intended use of the excipient.

When therapeutic agent of the present invention is used in the form of eye drops or eye ointments, medicinal product can be obtained according to the method commonly used in the pharmaceutical field, for example, based on the method described in the Japanese Pharmacopoeia, 14th Edition, Preparation General Rules, section of eye drop and section of ophthalmic ointment.

Examples of forms of eye drops include water eye drops (water instillation, instillation of a water suspension, viscose instillation and so on), non-aqueous eye drops (non-aqueous Ann is illatio, instillation of a non-aqueous suspensions, etc.), emulsion eye drops and the like.

the pH of the eye drops, defined appropriately, is in the range of 4-8. When eye drops are water instillation, pH particularly preferably adjusted to pH 6-8, based on the solubility of the active ingredient.

Eye drops are usually the dosage form, sterilized by various methods, such as sterilization by filtration, sterilization by irradiation (for example, sterilization of electrons, ultraviolet sterilization, sterilization by gamma-rays and so on), sterilization autoclave, hot air sterilization and the like.

When the dosage form is received in the form of eye drops, the liquid is preferably added to instillation capacity, equipped with a drip hole for the liquid having a small diameter, which allows you to control the amount of drops in order to facilitate instillation in the eye. The material that you want to apply for capacity, is a synthetic polymer, glass, cellulose, pulp weight and such, and it appropriately selected based on the properties and quantity of the used active ingredient and the base. With regard to compressibility and durability, the capacity is preferably produced from a synthetic polymer. Specific examples of mA is Arial synthetic polymer include polyethylene polymer (for example, low-density polyethylene or high density polyethylene), polypropylene polymer, ethylene-propylene copolymer, poly(ethyleneterephthalate) polymer and the like.

Examples of containers for instillation include the capacity in which the tube is inserted into the container, which is formed independently molded with integral shell capacity, in which the fluid tightly closed simultaneously with the molding of the container (for example, WO2004/006826) and the like. When using molded with integral shell capacity, capacity is more important from the point of view of cost or hygiene, as the capacitance and the liquid continuously receive. Capacity for instillation can be a tank with a single dose, which is discarded after use (for example, JP-A-9-207959). When used in this capacity, you can get the drug without preservatives, which is highly safe for the cornea. In addition, the data capacity can be packaged gluing absorbing ultraviolet radiation from the film. In addition, the containers may be colored (brown, green, blue, yellow, etc) in order to improve the absorption characteristics ultrafioletowego radiation.

The present invention relates to a method of stimulating proliferation of epithelial cells mabombo cancer, including the introduction of effective is its number of compounds of the present invention to a subject, need to stimulate proliferation of epithelial cells mabombo cancer. It is desirable to apply the method for the treatment of dysfunction mabombo gland.

In addition, the present invention relates to a method of stimulating proliferation of epithelial cells of the cornea, including the introduction of an effective amount of the compounds of the present invention to a subject in need of promotion of proliferation of epithelial cells of the cornea. It is desirable to apply the method for the treatment of diseases of the epithelium of the cornea.

In addition, the present invention relates to a method of treating dry eye, comprising introducing an effective amount of the compounds of the present invention to patients suffering from dry eyes.

An effective amount of the compounds of the present invention can automatically determine because it varies depending on age, body weight and condition of the subject who is administered a drug, treatment goals and such. When the stimulator or therapeutic agent of the present invention is administered to a person, for example a solution containing the compound of the present invention, with a concentration 0,000001-1% by weight, preferably within 0.00001-1% by weight, most preferred of 0.0001-0.1% by weight, usually buried one to eight times a day for 1-2 caplaw one eye, namely, approximately 50-200 µl per instillation. The number of compounds contained in the solution having the concentration and amount within these ranges, it is possible to cite as an example the actual amount.

Examples

The present invention explain in detail below, referring to experimental examples, which are not construed as limiting.

(Experimental example 1)

Impact on the increase in the number of normal epithelial cells of the cornea of the human eye

1. Used cell

Used normal epithelial cells of the cornea (KURABO).

2. A method of obtaining a solution of the test compound

As the test compounds were applied [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxucusu acid (hereinafter in the present invention referred to as compound A). Compound a was dissolved in ethanol (Wako Pure Chemical Industries, Ltd.) up to 200-fold concentration of the final concentration in culture medium, and the solution was stored at -80°C before use.

As a culture medium for cells to evaluate the effect of increasing the number of cells, compound A is used culture medium (basal medium)obtained by the addition of insulin, hydrocortisone, transferri is a, contained in HCGS set of additional components for growth (KURABO), EpiLife (KURABO).

3. Test method

1) Cell culture and the connection is added to A

Normal epithelial cells of the cornea of the human eye, frozen in liquid nitrogen, were thawed and counted the number of cells. Their total number was transferred to EpiLife, replenished all of the HCGS kit additional components for growth (insulin, epidermal growth factor (mEGF obtained in mice, hydrocortisone, transferrin, an extract of the pituitary gland of the brain of a bull) (4 ml complete medium), and suspended them. The cell suspension was sown on fibronectin-coated 24-hole plate (Becton Dickinson) with cell number of 2×104cells/500 μl/well (1×104cells/cm2since the area of the lower surface was about 2 cm2).

After sowing the cells, the culture, the tablet was kept in an incubator set to 37°C, 5% CO2, 95% air and 100% humidity for 24 hours, and the culture medium was replaced with 400 μl of basal medium (EpiLife, supplemented with insulin, hydrocortisone and transferrin from HCGS additives for growth).

After 24 hours, culture medium was replaced the next cultural environment (each 400 ál):

[1] one basal medium (without add);

[2] basal medium + mEGF (final concentration: 1 ng/ml; group is good control);

[3] basal medium + compound A (final concentration: 0.1 nm, 1 nm, 0.01 µm, 0.1 µm; group adding compound A).

Ethanol (5 ml) was added to 1 ml of each culture medium [1] and [2] in order to uniformly bring the ethanol concentration of the entire culture medium to 0.5%.

2) Measurement of the number of cells

24 hours after the beginning of stimulation by compound A, culturally conditioned medium was removed from each well, and the basal medium, supplemented with 10% Cell Counting Kit-8 (DOJINDO)was added to each well 200 μl. After adding the culture, the tablet was transferred into an incubator set at 37°C, 5% CO2, 95% air and 100% relative humidity and kept for 2 hours. Conditioned medium (100 μl) were transferred to 96-well culture plate to tissue culture (Corning), and the absorption of each well at 450 nm was measured by the reader for tablets (Dainippon Sumitomo Pharma Co., Ltd.), and was used as a factor increasing the number of cells.

4. Statistical analysis

The magnitude of the positive control group and the group with the addition of compound A is calculated based on the average absorption group without addition of 100%, and a group without addition of compared with the group adding compound A and the positive control group according to the criterion of multiple comparisons Dennett (one is th). The critical value that is less than 5% as the test result was considered significant.

5. The test results

Increasing the number of cells the action of each group are shown in table 1. The measured values of absorption show that the number of cells in the positive control group and groups adding compound A is much larger than the number of cells in the group without addition, where the number of cells in the group without adding equal 100%, and the increase in the number of cells expected in these groups (p<0,01). From the test results it was found that compound a increases the number of normal epithelial cells of the cornea of the human eye.

Table 1
GroupThe percentage growth in the number of cells (%)Significant difference compared with the group without addition)
The group without adding the100,0±7,7
mEGFis 147.5±47,2**
10-10M connection A177,4+20,8**
-9M connection A169,0±8,2**
10-8M connection A187,4±10,2**
10-7M connection A172,6+16,0**

Change the number of cells when adding A connection to cultured normal epithelial cells of the cornea of the human eye shown in the figures, relative to the average value of the group without addition of 100% (value + standard deviation, N=3-4). **The table shows a significant difference compared with the group without adding (p<0,01).

(Experimental example 2)

Study a stimulating influence on the wound healing of the epithelium of the cornea

1. Applied animal

Used male Japanese white rabbits (KITAYAMA LABES Co., Ltd.). Experimental animals were used in accordance with international fundamental principles for biomedical research involving animals.

2. The method of obtaining instillation of the test connection

The compound A was used as the test compounds. Compound a was dissolved in the following environment with a concentration of 0.0005% or suspended in the following environment with a concentration of 0.005% and a CR is changed as instillation.

The dihydrate of sodium dihydrophosphate0.05 g
Sodium chloride0.45 g
Especially clean waterEQ.
Polysorbate 800.05 ml
Sodium hydroxideEQ.
The total number of50 ml (pH 7.0)

As a control group introducing compound A was applied the above-mentioned group instillation environment free from drugs.

3. Experimental method

1) Scraping the epithelial cells of the cornea

Animals did intramuscular injection (1 ml/kg) selectae (2% xylazine; Bayer co., Ltd.): ketalar (5% ketamine; DAIICHI SANKYO COMPANY, LIMITED)=1:1 mixture for General anesthesia, and the instillation of the hydrochloride oxybuprocaine (instillation of benoxyl 0,4%; Santen Pharmaceutical CO., Ltd.) and then allocated eyeballs. Applying trefin with a diameter of 10 mm, set the label (diameter 10 mm) on the epithelium of the cornea in the Central part of the cornea, and solid epithelial layer of the cornea in a bulleted circle scraped hand tools is m for scraping under a stereomicroscope. After scraping the surface of the cornea was washed with physiological saline (OTSUKA PHARMACEUTICAL FACTORY, INC.), treatment of epithelial scraping the cornea was completed location of the eyeball back into the socket.

2) Introduction

The instillation of the compound A or instillation Wednesday buried by 50 μl each time in the treated eye by using the pipettor twice daily on the day of scraping the epithelial cells of the cornea and four times a day from the next day to complete the test.

3) Analysis

Using the point in time when carried out scraping the epithelial cells of the cornea in all animals, as the starting time of the test (0 hours), the area of the defect in the epithelium of the cornea was determined quantitatively through 40, 48, 56 and 64 hours based on what assessed wound healing of the epithelium of the cornea. To be precise, 0.1% solution of fluorescein sodium (Wako Pure Chemical Industries, Ltd.) (10 µl) were buried in the treated eye at each time point, and the anterior ocular segment of the animals immediately photographed using a slit lamp with a blue filter, whereby recorded defective region dyed with fluorescein epithelium of the cornea. Shown a picture stored as a digital image on your computer, and the area of the defect progresando what about the fluorescein epithelium of the cornea was measured, using software for image analysis (Image-Pro Plus).

4. Statistical analysis

The area of the defect dyed with fluorescein epithelium of the cornea, as measured at each time point was calculated based on the initial values for each animal taken as 100%, and was taken as the ratio of the remaining defect in the epithelium of the cornea. The ratio of the remaining defect in the epithelium of the cornea in each time point were compared between the group with the instillation of the environment and the group with the instillation of A connection, using the criterion of student. Critical value smaller than 5% as a result was considered significant.

5. Test results

The ratio of the remaining defect in the epithelium of the cornea in the group with instillation environment and the instillation of the compound A at concentrations of 0.0005% and 0.005% at each time of measurement are shown in table 2. It is shown that the ratio of the remaining defect in the epithelium of the cornea was significantly decreased in the group instillation of the compound A in the amount of 0.005% after 40 hours after scraping the epithelial cells of the cornea. The ratio was significantly decreased in groups instillation of the compound A in the amount of 0.0005% and 0.005% after 48 hours. From the test results it is clear that the instillation of A connection will timuerunt healing of the defect in the epithelium of the cornea.

Table 2
GroupGroup instillation environment (%)Group instillation connection And in the amount of 0.0005% (%)Group instillation connection And in the amount of 0.005% (%)
0 hours (initial value)100,0±0,0100,0±0,0100,0±0,0
40 hours later28,1±5,324,8±2,718,6±8,0*
48 hours later18,1±6,111,8±2,9*9,1±6,4*
56 hours later11,1+8,13,8±2,83,4+3,7
64 hours later5,1±6,90,8±1,40,9±1,3

Ratio (%) of the remaining defect epithelium of the cornea after scraping the epithelial cells of the cornea of the rabbit was calculated for each animal based on the initial the second value, equal to 100% (value + standard deviation, N=6). The table shows significant differences with regard to the group instillation environment (p<0,05).

(Experimental example 3)

Impact on the increase in the number of epithelial cells mabombo gland

1. Obtaining epithelial cells mabombo cancer monkeys

Eyelid monkeys allocated and stored in D-PBS, was transferred to a laminar box, and perform the preparation of the cells in sterile conditions as follows.

Selected eyelid was immersed in 80% ethanol for 30 seconds, washed three times with D-PBS, supplemented with 1% penicillin-streptomycin (Invitrogen), and transferred in minimum maintenance medium (MEM; Invitrogen). Adipose tissue and muscle tissue surrounding the tissue mabombo gland century, was removed under a stereomicroscope. They moved in MEM containing 0.3 u/ml collagenase A (Roche Diagnostics) and 2.4 u/ml dispute II (Roche Diagnostics), and were shaken at 37°C for 4 hours and at 4°C over night. Processed by the enzyme tissue was placed under the stereomicroscope, and connective tissue eyelashes century and was removed in order to highlight the fabric mabombo cancer. Trypsin-EDTA (4 ml, Invitrogen) was added to selected glandular tissue, and the mixture was stirred at 37°C for 10 minutes. After conditioning was added thereto MEM (5 ml)containing 10% FBS (Invitrogen) to stop the enzymatic reaction, and the cell is, forming fabric, dispersible repeat the extraction and separation of a mixture of 5 times using a syringe for injection, equipped with a needle for injection 21G. The cell dispersion was passed through 100 μm and 40 μm nylon filters (Cell Strainer; Falcon), and remove the cell mass and the like, contained therein, which cannot be processed by the enzyme. The cell suspension is filtered through filters, collected in a centrifuge tube (50 ml) and centrifuged at room temperature, 1500 rpm for 5 minutes. The layers of cells containing the target cells, obtained by centrifugation, was added 80 μl of D-PBS containing 0.5% bovine serum albumin (BSA; Sigma-Aldrich), and the cells suspended therein for a sufficient period of time. Added to it antifibrillatory antibodies (Militenyi Biotec, 20 μl), and the mixture was stirred at room temperature for 30 minutes. After completion of the reaction with the antibodies was added thereto 2 ml of D-PBS containing 0.5% BSA, and the mixture was centrifuged again at room temperature, 1500 rpm for 5 minutes. The layers of cells containing the target cells, obtained by centrifugation, was added 1 ml of D-PBS containing 0.5% BSA, and the cells suspended therein for a sufficient period of time. The suspension was added dropwise to the LD column (Militenyi Biotec), pre-equilibrated with a solution for washing column (D-PBS containing 2 mm EDTA (DOJINDO LABORATORIES) and 0.5% BSA). Then, 2 ml of the rinse solution column was added dropwise to the LD column. In the period immediately after adding dropwise cell suspension prior to the completion of adding dropwise the solution for washing column, unlabeled antibodies target cells (not fibroblasts), which was not absorbed on the column was recovered in a 50 ml centrifuge tube. Cells collected in a centrifuge tube, centrifuged at room temperature, 1500 rpm for 5 minutes, and air-conditioned environment was removed. Sediment suspended in serum-free culture medium for certain keratinocytes (5 ml), centrifuged at room temperature, 1500 rpm for 5 minutes and removed the air-conditioned environment. Again, the sediment suspended in DK-SFM (3 ml), centrifuged at room temperature and 1,500 rpm for 5 minutes, and removed the air-conditioned environment. Cells suspended in DK-SFM (2 ml) and were sown on 6-hole multicounty tablet for cell cultures that had been treated with collagen. Seeded cells were grown in culture in serum-free culture medium for certain keratinocytes (DK-SFM; Invitrogen, attached extension components were added as specified in the Protocol), were grown in an incubator (SANYO), established at 37°C, 5% CO2, 95% air, 100% humidity, and cultural panorama of the remote control was replaced with a new one every 48 hours before as cells became subconfluent.

2. A method of obtaining a solution of the tested compounds

As the test compounds were applied compound a, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid (hereinafter in the present invention referred to as compound B) or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid (hereinafter in the present invention referred to as compound C). The test compound was dissolved in ethanol (Nacalai Tesque) to 200-fold concentration of the final concentration in culture medium, and the solution was stored at -80°C before use.

To assess stimulating cell proliferation action of the test compounds of the culture medium obtained by removing an additional component added to DK-SFM from DK-SFM, was used as a basal medium (basal DK-SFM). As a positive control to confirm stimulating cell proliferation steps used culture medium (complete DK-SFM), which was obtained by adding the attached additional components to the basal medium.

3. Test method

1) Collagen treatment cultural tablet

The day before the application of cultural tablet 50 μl of 0.01% of type I collagen (Nitta Gelatin Inc.) EXT is ulali in each well of cultural tablet, and collagen is left as a coating wells at 4°C before testing. On the day of the test solution of type I collagen was removed and the precipitate cultural tablet was washed three times with D-PBS, and used in the test as collagen-treated culture of the tablet.

2) Cell culture and adding the test connection

The test was applied epithelial cells mabombo cancer monkeys that were grown in culture medium to subconfluent in cultural tablet (diameter 3.5 cm) and frozen in liquid nitrogen. Cells suspended in Cellbanker (Nippon Zenyaku Kogyo Co., Ltd.) and frozen, was thawed and transferred into 50 ml centrifuge tube, and add 10 times the number of full-DK-SFM. Cell layers were collected by centrifugation at room temperature and 1,500 rpm for 5 minutes. A suitable number of full-DK-SFM was added to a concentration of the obtained cells equal to 3×106cells/ml Cell suspension was added to each well to 64 μl so that the number of cells was 6×104cells/cm2in the area of the lower part (0,32 cm2) collagen-treated 96-well culture plate to tissue culture. After sowing cell culture the tablet was transferred into an incubator set at 37°C, 5% CO2, 95% air, 100% humidity and virusiv is whether in culture medium for 24 hours. The culture medium was replaced with basal DK-SFM (100 μl) and additionally were grown in culture medium for 24 hours. Then the culture medium in each well of the culture of the tablet was replaced with 100 μl of each of the following cultural environments, cultural tablet was placed back in the incubator and started stimulating cells.

[1] One basal medium (basal DK-SFM, the group without addition);

[2] basal medium + extension components (full DK-SFM, positive control group);

[3] basal medium + compound A (final concentration: 0.01 µm, 0.1 µm and 1 µm; group adding compound A);

[4] basal medium + compound B (final concentration: 0.01 µm, 0.1 µm and 1 µm; group add connection B);

[5] basal medium + connection C (final concentration: 0.01 µm, 0.1 µm and 1 µm; group add connection C).

Ethanol (5 ml) was added to 1 ml of each culture medium [1] and [2] to the uniform distribution of the concentration of ethanol in all cultural environments, equal to 0.5%.

2) Measurement of the number of cells

48 hours after the first stimulation of cell culture medium was replaced by culture medium of the above-mentioned [1]-[5], prepared from scratch. After 48 hours the culture medium was replaced again with culture medium of the above-mentioned [1]-[5], prepared from scratch. After 48 hours culture is the red was removed from each well, and the basal medium, supplemented with 10% Cell Counting Kit-8 (DOJINDO)was added to each well 100 μl. After adding the culture, the tablet was transferred into an incubator set at 37°C, 5% CO2, 95% air and 100% relative humidity and kept for 2 hours. After keeping for 2 hours, the absorbance at 450 nm was measured by the reader for tablets (Dainippon Sumitomo Pharma Co., Ltd.), and was used as a factor increasing the number of cells.

4. Statistical analysis

The size of each group, positive control group and the addition of the test compounds was calculated based on the average absorption in the group without addition of 100%, and a group without addition of compared with the group adding the test compounds and the positive control group according to the criterion of multiple comparisons Dennett (one-sided). Critical value less than 5% as the test result was considered significant.

5. Test results

Stimulating effect of increasing the number of cells of each group are shown in table 3. The measured absorption show that the increase in the number of cells in each group adding the test compound is significantly greater than the increase in the group without addition, where the number of cells in the group without adding equal 100%, and the assumed increase in the number of glue is OK. In the group of positive control to confirm the action, stimulating the increase in the number of cells observed a trend of increasing numbers of cells, albeit slight. From the test results, it is clear that each test compound increases the number of epithelial cells mabombo cancer monkeys.

Table 3
GroupThe ratio of the increase in the number of cells (%)Significant differences (relative to the group without addition)
The group without adding the100,0±7,1
Additional components114,2±6,7
10-8M connection A175,3±9,0**
10-7M connection A177,1±9,7**
10-6M connection A189,8±13,1**
10-8M compound B155,0±28,0 **
10-7M compound Bof 174.4±8,9**
10-6M compound B158,8±15,2**
10-8M connection C155,0±11,6**
10-7M connection C175,2±7,8**
10-6M connection C179,4±7,5**

The change in the number of cells when each test compound or additional components (positive control) was added to grown in culture medium epithelial cells mabombo cancer monkeys, shown in the values based on the average value in the group without addition of 100% (value ± standard deviation, N=5 or 10). **The table shows significant differences with regard to the group without adding (p<0,01).

(Experimental example 4)

The effect on the increase in the number of normal epithelial cells of the cornea

1. Used cell

Used normal epithelial cells of the cornea (KURABO).

2. Test the connection and the way in which otopleniya

As the test compounds were applied compound B or compound C. Each of compound B and compound C was dissolved in ethanol (Wako Pure Chemical Industries, Ltd.) up to 200-fold concentration of the final concentration in culture medium, and the solution was stored at -80°C before use.

As the cell culture medium to evaluate actions increasing the number of cells with compound B and compound C, was used culture medium (basal medium)obtained by the addition of insulin, hydrocortisone and transferrin contained in the set of extension components for growth HCGS (KURABO) to EpiLife (KURABO).

3. Test method

1) Cell culture and adding the test connection

Normal epithelial cells of the cornea, frozen in liquid nitrogen, were thawed and counted the number of cells. Their total number was transferred to EpiLife, complete with all components from a set of additional components for the growth of HCGS (insulin, epidermal growth factor (mEGF obtained from mice, hydrocortisone, transferrin, an extract of the pituitary gland of the brain of a bull) (4 ml complete medium), and well suspended in it. The cell suspension was sown on covered with fibronectin 24-well plate (Becton Dickinson) with the number of cells equal to 2×14cells/500 μl/well (1×104cells/cm2since the area of the lower surface the displacement was 2 cm 2). After sowing the cells, the culture, the tablet was kept in an incubator set to 37°C, 5% CO2, 95% air and 100% humidity for 24 hours, and the culture medium was replaced with 400 μl of basal medium (EpiLife, supplemented with insulin, hydrocortisone and transferrin of additional components for the growth of HCGS). 24 hours after that, the culture medium was replaced the next cultural environment (each 400 ál).

[1] One basal medium (without add);

[2] basal medium + mEGF (final concentration: 1 ng/ml; positive control group);

[3] basal medium + compound B (final concentration: 0.01 µm, 0.1 µm, 1 µm; group add connection B);

[4] basal medium + connection C (final concentration: 0.01 µm, 0.1 µm, 1 µm; group add connection C).

Ethanol (5 ml) was added to 1 ml of each culture medium [1] and [2] for the same to bring the ethanol concentration of the entire culture medium to 0.5%.

2) Measurement of the number of cells

24 hours after the beginning of stimulation with compound B or compound C culture conditioned medium was removed from each well, and the basal medium, supplemented with 10% Cell Counting Kit-8 (DOJINDO)was added to each well 200 μl. After adding the culture, the tablet was transferred into an incubator set at 37°C, 5% CO2, 95% who is the ear and 100% humidity and kept for 2 hours. Conditioned medium (100 ál) was transferred into a 96-well culture plate to tissue culture (Corning), and measured the absorbance in each well at 450 nm by the reader for tablets (Dainippon Sumitomo Pharma Co., Ltd.), and was used as a factor increasing the number of cells.

4. Statistical analysis

The size of each group, positive control group and add compound B and compound C was calculated based on the average absorption in the group without addition of 100%, and a group without addition of compared with the group adding compound B or compound C and the positive control group according to the criterion of multiple comparisons Dennett (one-sided). Critical value less than 5% as the test result was considered significant.

5. Test results

Stimulating an increase in the number of cells the action of each group are shown in table 4. The measured absorption show that the number of cells in the positive control group, in the group add connections B and group add a connection C is much larger than the number of cells in the group without addition, where the number of cells in the group without adding equal 100%, and in these groups assumed increase in the number of cells (p<0,01). From the test results it is clear that compound B and compound C uvelichenie the number of normal epithelial cells of the cornea of the human eye.

Table 4
GroupThe rate of increase in the number of cells (%)Significant differences (relative to the group without addition)
The group without adding the100,0±32,2
mEGF232,8±22,5**
10-8M compound B252,4±34,7**
10-7M compound Bfigure of € 256.4±11,0**
10-6M compound B254,3±11,7**
10-8M connection C243,3±6,6**
10-7M connection Cof 247.5±14,1**
10-6M connection Cof 260.2±2,5**

The change in the number of cells in the add connection B or compound C to cool tigerbunny normal epithelial cells of the cornea shown in the values relative to the average value in the group without adding, equal to 100% (value ± standard deviation, N=4). **The table shows a significant difference compared with the group without adding (p<0,01).

(Experimental example 5)

The expression of PPAR in the epithelial cells of the cornea and epithelial cells mabombo gland

1. Used cell

Applied epithelial cells mabombo monkey gland cells were obtained and cultured in a manner analogous to the method of experimental example 3. Applied epithelial cells of the cornea (KURABO) cells were grown in an incubator set to 37°C, 5% CO2, 95% air, 100% humidity in serum-free basal medium for proliferation of normal epithelial cells of the cornea of the human eye (EpiLife; KURABO). Applied epithelial cells of the cornea of the rabbit cells were obtained and grown in the following way.

The cornea of the eye was cut out of the eyeball, isolated from umarsultanova rabbit, kept in saline solution, phosphate buffered Dulbecco (D-PBS; Invitrogen), and transferred in a laminar box. Conducted under sterile conditions following the procedure of obtaining the cells.

Dedicated round slice of the cornea was washed three times with D-PBS, supplemented with 1% penicillin-streptomycin (Invitogen) and transferred in minimum essential medium (MEM; Invitrogen). Endothelial cells of the cornea and descemet shell round slice of the cornea, immersed in MEM, separated with a knife for eye surgery (Alcon), and separated all the fragment of the cornea (the stroma of the cornea and epithelium of the cornea) transferred to MEM, supplemented by dispute II (Roche Diagnostics) with a concentration of 2.4 u/ml Fragment was kept at 37°C for 1 hour, and a round slice of the cornea treated with dispute II, transferred to MEM. The epithelium of the cornea of the round slice of the cornea, immersed in MEM, separated with a knife for eye surgery, and the remainder of the round slice of the cornea (the stroma of the cornea) is removed from MEM. MEM, containing the separated epithelial cells of the cornea, was collected in 50 ml centrifuge tube, centrifuged at room temperature, 1500 rpm for 5 minutes and air-conditioned environment was removed, receiving layers of epithelial cells of the cornea. Layers of epithelial cells of the cornea was added 1 ml of trypsin-EDTA (Invitrogen), and the mixture was well mixed and maintained at 37°C for 5 minutes in order to remove intercellular adhesion. To the mixture was added 9 ml of MEM containing 10% fetal bovine serum (FBS; Invitrogen), to stop the build of the enzymatic reaction, and the mixture was centrifuged again at room temperature, 1500 rpm for 5 minutes, getting layers of epithelial cells of the cornea. To the resulting layers of epithelial cells of the cornea was added 1 ml of serum-free liquid medium for the growth of normal epithelial cells of the cornea of the rabbit (RCGM2; KURABO) to be suspended in her cells, and the cells were sown in the plate for cell culture (10 cm diameter, 10 IWAKI), supplemented with 9 ml RCGM2. Seeded cells were grown in an incubator (SANYO), established at 37°C, 5% CO2, 95% air, 100% humidity. The culture medium was replaced with new medium every 48 hours before the first day of testing.

2. Test method

1) Extraction of total RNA from cells

Total RNA was extracted from each cell according to the conventional method with TRIzol reagent (Invitrogen).

2) Obtaining cDNA from the extracted total RNA

Total extracted RNA was treated with Dnazol at 37°C for 30 minutes in order to remove genomic DNA according to the conventional method for releasing DNA (Ambion).

cDNA was obtained from extracted total RNA according to the conventional method for reverse transcriptase Superscript II (Invitrogen). That is, cDNA, complementary total RNA treated with Dnazol, was obtained from 1 µg total P Is K, using random primer (Invitrogen).

3) Amplification of PPAR gene (polymerase chain reaction; PCR)

PCR PPAR gene was performed according to the conventional method for Platinum PCR SuperMix (Invitrogen). PPAR primer was designed so that the PCR product was approximately 200 base pairs relative to the known sequences of human, chimpanzee, macaque of having, cow, mouse and the like.

PPARα: GTAGAATCTGCGGGGACAAG (sense) (SEQ ID NO:1)

: GTTGTGTGACATCCCGACAG (antisense) (SEQ ID NO:2)

PPARδ: TTCCTTCCAGCAGCTACACA (sense) (SEQ ID NO:3)

: GATCGTACGACGGAAGAAGC (antisense) (SEQ ID NO:4)

PPARγ: CTCCGTGGATCTCTCCGTAA (sense) (SEQ ID NO:5)

: GATGCAGGCTCCACTTTGAT (antisense) (SEQ ID NO:6)

PCR reaction was carried out by a reaction at 94°C for 2 minutes 15 seconds, followed by 35 cycles of 3-stages of reactions at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. The sample after PCR reactions were subjected to electrophoresis on 2% agarose gel, and the DNA separated in the gel were progressively SYBR Gold (Molecular Probes). Image dyed DNA luminescense under UV transilluminator, was stored as digital data.

3. Test results

Strips of DNA after electrophoresis is shown in figure 1. As a result of this testing indicated that all of PPARα, PPARδ and PPARγ expressibility in the epithelial cells of the cornea of a human eye and the epithelial cells of Mamonov the th cancer monkeys. In the epithelial cells of the cornea of the rabbit has only confirmed the expression of PPARδ. Bonazzi et al. reported that PPARα and PPARβ(=δ) of PPAR is expressed in the epithelial cells of the cornea of the rabbit (A. Bonazzi et al., J. Biol. Chem. (2000); 275 (4): 2837-2844). In this article, they used a special way of detecting PPARα, which assumes that the level of expression of PPARα in the epithelial cells of the cornea of the rabbit is very small.

Industrial applicability

According to the present invention provide a new drug that stimulates the proliferation of epithelial cells mabombo cancer or a new tool that stimulates the proliferation of epithelial cells of the cornea, and the drug stimulates the proliferation of epithelial cells mabombo cancer or epithelial cells of the cornea. In addition, a therapeutic agent of the present invention can be effectively used for the treatment or relief of diseases, such as dysfunction mabombo gland, disease of the epithelium of the cornea, dry eye and the like.

This application is based on patent application No. 2007-134183 entered in the register in Japan (date of entry in register: may 21, 2007), the content of which is inserted fully in the present invention by reference.

1. A drug that stimulates the proliferation of epithelial cells mabombo gland containing [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxucusu acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl] propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt.

2. A drug that stimulates the proliferation of epithelial cells of the cornea of the eye containing [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]oxucusu acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt.

3. The drug according to claim 1, where the specified drug is used to treat dysfunction mabombo gland.

4. The drug according to claim 2, where the specified drug is used to treat diseases of the epithelium of the cornea.

5. The drug according to any one of claims 1 or 2, where the specified drug used for the treatment of dry eye.

6. Lakers the governmental tool according to claim 5, in which dry eye is dryness of the eyes caused by hypersplenism.

7. The use of [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt for a drug that stimulates the proliferation of epithelial cells mabombo gland.

8. The use of [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt for a drug that stimulates the proliferation of epithelial cells of the cornea.

9. The use according to claim 7, in which the specified drug is used to treat dysfunction mabombo gland.

10. The use of claim 8, in which the specified drug is used to treat diseases of the epithelium of the cornea.

11. The use according to any one of claims 7 or 8, to which the op specified a drug used for the treatment of dry eye.

12. The application of claim 11, in which dry eye is dryness of the eyes caused by hypersplenism.

13. Method of stimulating proliferation of epithelial cells mabombo cancer, comprising introducing an effective amount of [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt to a subject in need of promotion of proliferation of epithelial cells mabombo gland.

14. Method of stimulating proliferation of epithelial cells of the cornea, including the introduction of an effective amount of [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-1,2-benzisoxazol-6-yl]exucuse acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic acid or [4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or its pharmaceutically acceptable salt to a subject in need of promotion of proliferation of epithelial cells of the cornea.

15. The method according to item 13, wherein said method comprises treating dysfunction Mamonov the th cancer.

16. The method according to 14, wherein said method comprises treating the epithelium of the cornea.

17. The method according to any of PP or 14, wherein said method comprises the treatment of dry eye.

18. The method according to 17, in which dry eye is dryness of the eyes caused by hypersplenism.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely ophthalmology and may be used to treating spastic squint and atypincal squint accompanying type 1 Duane syndrome. It involves exposing a lateral end of an internal rectus muscle, further at 2-3 mm from an attachment point of the muscle to sclera a needle is inserted in an end face of the lateral muscle; the needle is moved at 8-10 mm along the muscle in a distal direction at an angle from the lateral end of the muscle to its middle axial border, and the preparation Disport 15-20 units is introduced. The incisional wound is closed. The similar method is used for surgical manipulations on the internal rectus muscle of the other eye, if the patient suffers from spastic squint and double Duane syndrome.

EFFECT: method provides reduced dynamometric functions of the internal rectus muscles and compensated optimal balance in the oculogyric system.

2 dwg, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to new compounds of formula I or their pharmaceutically acceptable salts showing an ability to inhibit sphingosine kinase, to a based pharmaceutical composition, to a method of inhibiting sphingosine kinase and a method of treating diseases specified in breast cancer, diabetic retinopathy, arthritis and colitis. , wherein X represents -C(R3,R4)N(R5)-, -C(O)N(R4)-; R1 represents phenyl unsubstituted or substituted by 1 or 2 halogens. The values of R2, R3, R4, R5 substitutes are such as specified in the patent claim.

EFFECT: preparation of new compounds.

17 cl, 24 dwg, 9 tbl, 26 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions refers to medicine, namely ophthalmology, and may be used for treating dry eye syndrome and recovered function of lachrymal fluid secretion in a mammal. For this purpose, a composition containing a pharmaceutically effective amount of a Janus kinase 3 inhibitor of the following structure is introduced in a mammal: 3-{(3R,4R)-4-methyl-3-[methyl-(7H-pyrrolo[2,3-d] pyrimidin-4-yl) amino] piperidin-1-yl}-3-oxopropionitryl.

EFFECT: introduction of the Janus kinase 3 inhibitor enables considerable increase of the secreted lachrymal fluid volume.

11 cl, 2 tbl, 6 ex, 8 dwg

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely ophthalmology, and can be used for ensuring regression of ocular neovascularisation. That is ensured by introducing a composition containing a therapeutically effective amount of a receptor tyrosine kinase inhibitor which blocks tyrosine autophosphorylation of VEGF receptor-2 with IC50≤ 10 nM and VEGF receptor-1 with 1C50≤ 10 nM and PDGFR with 1C50≤ 100 nM.

EFFECT: invention provides strong antiangiogenic effectiveness, ensured avoiding visual acuity loss related to ocular neovascularisation.

7 cl, 5 tbl, 8 ex, 9 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to medicine, in particular to ophthalmology. The invention discloses an ophthalmic composition containing ketotifen and a hydrogen peroxide source supplying hydrogen peroxide in the amount approximately from 0.001 to approximately 0.1% (wt %) with pH making 4 to 5.3. What is also disclosed is a method of treating and preventing allergic conjunctivitis with using said composition.

EFFECT: invention provides minimum adverse side effects in treating and preventing conjunctivitis.

16 cl, 4 tbl, 1 ex

Eye drops // 2443416

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to medicine, in particular ophthalmology. Eye drops have a formulation as follows (g/l): timolol maleate (timolol basis) 1.0-6.0; disodium hydrogen phosphate 5.5-16.5; sodium dihydrogen phosphate 0.8-1.5; sodium chloride 2.0-6.0; ethylenediaminetetraacetatic acid disodium salt 0.1-0.5; benzalkonium chloride 0.03-0.1; polyvinylpyrrolidone 1-100, hydroxypropyl methylcellulose 1.0-5.0, water for injections - to 1 l. The viscosity values range within 5 to 20 mPa·s.

EFFECT: invention provides higher viscosity of the eye drops thereby enabling drug prolongation, as well as promotes cornea moistening and causes no irritant action on eye tissues, has long manufacturing and storage stability of the properties.

1 tbl, 4 ex

FIELD: ophthalmology.

SUBSTANCE: main composition contains: (a) ketotifen fumarate to the concentration in calculation to free ketotifen from approx. 0.01 mas. % to approx. 0.1 mas.%;(b) source of hydrogen peroxide ensuring presence of hydrogen peroxide with trace quantities amounting from approximately 0.001 to approximately 0.1% (mas./vol.); (c) one or several stabilizers of hydrogen peroxide compatible with eyes; (d) hypromellose to the concentration from approximately 0.005 mas% to approximately 0.5 mas.%; and (e) sodium carboxymethyl cellulose to the concentration from approx. 0.005 mas.% to approx 0.5 mas.%. At this the value of composition pH amounts to approximately from 4.0 to 5.3.

EFFECT: invention is a method of treatment and prevention of allergic conjunctivitis which is ensured with application locally in the effective quantity of the mentioned eye composition to person with allergic conjunctivitis or sensitive to it.

13 cl, 15 tbl, 4 ex

FIELD: ophthalmology.

SUBSTANCE: invention is a medicine representing the exciter of neurite genesis of eye tissue, use of the stimulator and method of neurite genesis stimulation. The medicine for eye tissue neurite genesis contains N-(1-acetylpiperidine-4-yl)-4-fluorbenzamide or its pharmaceutically applicable salt and medicine for neurite genesis stimulation of cornea and retina containing N-(1-acetylpiperidine-4-yl)-4-fluorbenzamide or its pharmaceutically applicable salt. The method of neurite genesis stimulation of eye tissue, retina neurite genesis includes insertion of effective quantity of N-(1-acetylpiperidine-4-yl)-4-fluorbenzamide or its pharmaceutically applicable salt into subject who in need of eye tissue neurite genesis.

EFFECT: invention allows improving sensibility of retina, improves treatment of Ocular surface disease, disease of retina epithelium, eye disfunction.

15 cl, 1 tbl, 4 dwg

FIELD: pharmaceutical and cosmetic industry.

SUBSTANCE: invention refers in particular to the means of antioxidant, anti-inflammatory and antineoplastic properties. Water-soluble fraction clamat microseaweeds of Aphanizomenon Flos Aquae Ralfs ex Born. & Flah. Var. flos aquae (seaweed of the AFA), possessing antioxidant, anti-inflammatory and antineoplastic properties, including phycobilisome, containing fikotsianin/fikoeritrotsianin (C-PC/PEC), ficoviolobilin (PVB), phytochrome of the AFA, mikosporin-like amino acids, a chlorophyll and carotenes. The extracted biologically-active component of water-soluble fraction of clamat microseaweeds of the AFA. The composition containing water-soluble fraction either the extracted component, or their mix. The application of water-soluble fraction of clamat seaweed or their extracted component (variants).

EFFECT: above described fraction or biologically-active component possess effective antioxidant, anti-inflammatory and antineoplastic properties.

16cl, 37dwg, 2tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to medicine, particularly intraocular drug delivery systems. The system contains a number of microsphres of average diameter within 8 micron to 14 micron, an aqueous carrier for microspheres where the microspheres consist of: brimonidine, where brimonidine makes approximately 0.5 wt % to approximately 15 wt % of the microspheres, and one or more biodegradable polymers representing polymer poly(D,L)lactides with inherent viscosity 0.4 dl/g to 0.8 dl/g where PMC polymer makes 85 wt % to 99.5 wt % of the microspheres, and where the drug delivery system can be injected in an intraocular region through a needle of a syringe calibre 20-26, and the microspheres can release approximately 0.5 mcg/day to approximately 20 mcg/day of brimonidine within a period of time approximately 10 days to approximately 100 days to provide treating eye conditions. The intraocular region represents a subtenon space, a subconjunctival or retrobulbar region.

EFFECT: invention provides release of the therapeutic agent in a therapeutically effective amount for a period of 10 days to one year.

4 cl, 13 tbl, 6 dwg, 7 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to pyridine derivatives of formula

wherein A, R1, R2, R3, R4, R5 and R6 are presented in the description, preparing and using them as pharmaceutically active compounds as immunomodulatory agents.

EFFECT: preparing the pharmaceutical composition showing agonist activity with respect to S1P1/EDG1 receptor and using it for prevention and treatment diseases or disorders associated with activated immune system.

20 cl, 244 ex, 2 tbl

FIELD: chemistry.

SUBSTANCE: invention relates to a compound of formula

,

where R denotes a substituted or unsubstituted thiazolyl group of formula or ; R4 and R5, each independently, are selected from i) hydrogen; ii) a substituted or unsubstituted C1-C6 linear, C3-C6 branched or C3-C6 cyclic alkyl; iii) a substituted or unsubstituted phenyl; iv) a substituted or unsubstituted heteroaryl containing 5 or 6 ring atoms and 1 or 2 heteratoms, where the heteroatoms are selected from nitrogen, oxygen, sulphur and combination thereof; or R4 and R5 can be taken together to form a saturated or unsaturated ring, having 5-7 atoms; said substitutes are independently selected from one or more groups, selected from C1-C6 linear, C3-C6 branched or C3-C6 cyclic alkyl, halogen, hydroxyl or cyano; R6 denotes a group selected from i) hydrogen; ii) a substituted or unsubstituted C1-C6 linear, C3-C6 branched or C3-C6 cyclic alkyl; iii) a substituted or unsubstituted phenyl or iv) a substituted or unsubstituted heteroaryl containing 5 or 6 ring atoms and 1 or 2 heteroatoms, where the heteroatoms are selected from nitrogen, oxygen, sulphur and combination thereof; where said substitutes are independently selected from one or more groups selected from C1-C6 linear, C3-C6 branched or C3-C6 cyclic alkyl, halogen, hydroxyl or cyano; R1 is selected from i) hydrogen; ii) C1-C6 linear or C3-C6 branched alkyl; iii) a substituted or unsubstituted phenyl or iv) a substituted or unsubstituted benzyl; where said substitutes are independently selected from one or more groups selected from C1-C6 linear, C3-C6 branched or C3-C6 cyclic alkyl, halogen, hydroxyl or cyano; R2 is selected from i) C1-C6 linear or C3-C6 branched alkyl or ii) C1-C6 linear or C3-C6 branched alkoxy; R3 denotes hydrogen or C1-C4 linear or C3-C6 branched alkyl.

EFFECT: compounds of formula (I) are effective as human protein tyrosine phosphatase beta (HPTP-β) inhibitors.

20 cl, 10 tbl, 8 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to compounds of formula

and ,

where the ring X represents benzole or pyridine; R1 represents substituted alkyl; R2 represents optionally substituted aryl or optionally substituted 4-7-member monocyclic heterocyclic group or optionally substituted condensed group of heterocyclic group with the benzole ring where the substitutes of optionally substituted aryl, optionally substituted 4-7-member monocyclic heterocyclic group and optionally substituted condensed group of heterocyclic group with the benzole ring are selected from a group consisting of; (1) alkyl optionally substituted by a group selected from halogen and alkoxycarbonyl, (2) alkoxy optionally substituted by halogen, (3) halogen, (4) 4-7-member monocyclic heterocyclic group or (5) amino, optionally mono- or disubstituted alkyl, and (6) hydroxyl, R3 represents hydrogen or alkyl: R4 represents hydrogen, halogen or alkyl; R5 represents hydrogen or alkyl; R6 and R7 are identical or different, and each represents hydrogen or halogen; or pharmaceutically acceptable salt. Also, the invention refers to a IKur blocker containing the compounds described above as an active ingredient, and also to a preventive and therapeutic agent for cardiac arrhythmia and atrial fibrillation.

EFFECT: there are produced and described new compounds applicable as a IKur blocker effective for preventing or treating cardiac arrhythmia, such as atrial fibrillation.

12 cl, 13 ex

FIELD: chemistry.

SUBSTANCE: invention relates to a novel compound of general formula I

,

and a pharmaceutically acceptable salt thereof, where X denotes CH2, CHF or S, Y denotes CN, R1, R2, R3 and R4 denotes hydrogen, n equals 1, m equals 0 or 1, R denotes R11, R12 or R13, where R11 includes at least one group selected from the following b) or c), where optionally substituted heterocyclic and heteroaryl groups are bonded with a noradamantyl part either directly or through a methylene adjacent group or a C-C bond or C-N bond; b) the substituted 5-member heteroaryl group, in which the heteroaryl ring is a monocyclic aromatic ring system, includes two or more heteroatoms selected from nitrogen and oxygen; c) the heterocyclic group is optionally substituted with a C1-C3 alkyl or oxo group, where the heterocyclic ring system is a 5-9-member mono- or bicyclic ring system with one or more heteroatoms selected from a group consisting of nitrogen and sulphur, where heteroatoms can also be present as functional groups, where the heterocyclic ring system can contain one or two double bonds, and where the monocyclic heterocyclic ring can be condensed with a phenyl ring, R12 is selected from hydrogen, halogen, hydroxy, amino and C1-C4 alkoxy; R13 is a substituted phenyl, where the substitutes, which can be identical or different, include at least one group selected from a) hydrogen; b) nitro, amino; c) the saturated or unsaturated monocyclic heterocyclic ring system is optionally substituted with one or more groups selected from C1-C3 alkyl and oxo, where the heterocyclic ring system is a 5-member ring with one or more heteroatoms selected from a group consisting of nitrogen and sulphur, where the heteroatoms can also be present as functional groups. The present invention also relates to a pharmaceutical composition having dipeptidyl peptidase IV inhibiting activity, methods of obtaining the novel compound of formula I and use in treating type II diabetes and diabetic complications as well as for treating dyslipidaemia, hypercholesteremia, obesity and hyperglycaemia.

EFFECT: novel dipeptidyl peptidase IV inhibitors.

10 cl, 1 tbl, 43 ex

FIELD: chemistry.

SUBSTANCE: invention refers to new indazole derivants with the formula (1.0) or to their pharmaceutically acceptable salts and isomerides that act as inactivators in relation to ERK2. In formula (1.0): meanings of the chemical groups Q, R1, R2 are given in the invention formula. The invention also refers to the pharmaceutical composition containing the mentioned compounds and to application of the compounds with the formula (1.0) for production of crude drugs used in malignant growth treatment.

EFFECT: application of the compounds for production of crude drugs used in malignant growth treatment.

65 cl, 611 ex, 27 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: present inventions refers to a new crystalline form of tetomilast hydrate of the X-ray powder diffraction spectrum having characteristic peaks at the angle 20=10.6°, 12.9°, 21.1°, 22.3° and 25.0°, to a new crystalline form of anhydrous tetomilast type C of the X-ray powder diffraction spectrum having characteristic peaks at the angle 2θ=4.2°, 8.2°, 12.0°, 16.4°, 24.7° and 25.9°, to a new crystalline form of acetonitrile tetomilast solvate of the X-ray powder diffraction spectrum having characteristic peaks at the angle 2θ=3.6°, 7.1°, 10.6°, 14.2° and 24.8°, to based pharmaceutical compositions and to methods for preparing.

EFFECT: new crystalline forms shows useful processing characteristics with relation to preparing pharmaceutical drugs of them.

13 cl, 14 dwg, 8 ex

FIELD: chemistry.

SUBSTANCE: present invention relates to a compound of formula I or a pharmaceutically acceptable salt thereof, where R1 denotes C1-C8-alkylaminocarbonyl, which is optionally substituted with a 5- or 6-member heterocyclic ring containing 3-4 ring heteroatoms selected from a group consisting of oxygen, nitrogen and sulphur, where the ring can be optionally substituted with C1-C8-alkyl or C1-C8-alkoxy group ; R2 denotes C1-C3-alkyl or a halogen; one of R3 and R4 denotes R6, and the other denotes R7; R5 denotes hydrogen or halogen; R6 denotes hydrogen, hydroxy group amino group, -SO2R8, -SO2NH2, -SO2NR9R10, -COR8, -CONHR8, -NHSO2R8, nitrile, carboxy, -OR8 or C1-C8-halogenalkyl; R7 denotes hydrogen, OR11, halogen, carboxy, -SO2R8, cyanogroup or C1-C8-halogenalkyl, or when R4 denotes R7, then R7 can also denote -NR12 R13 ; R8 R11 independently denote C1-C8-alkyl or C3-C8-cycloalkyl, which can be optionally substituted with hydroxy group, C1-C8-alkoxy group, nitrile, amino group, C1-C8-alkylamino group or di-C1-C8-alkyl)amino group; any R9 denotes C1-C8-alkyl or C3-C8-cycloalkyl, which can optionally be substituted with hydroxy group, C1-C8-alkoxy group, nitrile, amino group, C1-C8-alkylamino group, di(C1-C8-alkyl)amino group or a 5- or 6-member heterocyclic ring containing one or two ring heteroatoms selected from a group consisting of oxygen and nitrogen, where the ring can optionally be substituted with C1-C8-alkyl, and R10 denotes hydrogen or C1-C8-alkyl; or R9 and R10 together with a nitrogen atom with which they are bonded form a 5- or 6-member heterocyclic ring which can contain one or two additional nitrogen heteroatoms, where the ring can be optionally substituted with C1-C8-alkyl; any R12 denotes C1-C8-alkyl or C3-C8-cycloalkyl which can be optionally substituted with di(C1-C8-alkyl)aminogroup, and R13 denotes hydrogen or C1-C8-alkyl; or R12 and R13 together with a nitrogen atom with which they are bonded form a 5- or 6-member heterocyclic ring which contains one or two additional nitrogen heteroatoms, where the ring can optionally be substituted with C1-C8-alkyl.

EFFECT: possibility of using the compounds to produce a pharmaceutical agent for treating diseases mediated by phosphatidylinositol-3 kinase.

6 cl, 3 tbl, 181 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to compounds of formula in which Q together with carbon and nitrogen atoms whereto attached forms a 9-10-member bicyclic heterocycle, and R1 and R2, R3, R4, R5 and R6 are as specified in cl.1 of the patent claim, or to its enantiomers, or a mixture of its enantiomers, or to its pharmaceutically acceptable salt. Also, an invention refers to a method for activation of glucokinase activity in mammals, by introduction of the compound described above, to a method of treating the pathological conditions associated with glucokinase activity and impaired glucose tolerance by means of introduction of the compound of formula I, to a pharmaceutical composition on the basis of the presented compounds, and also to application of the compounds of formula I for preparing the pharmaceutical composition.

EFFECT: there are produced and described new compounds which are activators of glucokinase activity and can be used as therapeutic agents for preventing and treating impaired glucose tolerance, insulin-independent diabetes and obesity.

14 cl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: water pharmaceutical preparative form contains, at least, one latrunculin, non-ionic surface-active substance and preparation for supporting tonicity, at pH from 4 to 8. Latrunkulin, surface-active substance and preparation for supporting tonicity are compatible in preparative form, and preparative form does not contain more than 0.1% vol/vol dimethylsulfoxide. Latrunculin represents latrunculin A, latrunculin B, desmethyl latrunculin B or latrunculin analogue. Non-ionic surface-active substance is polysorbate, poloxamer or their combination. In accordance with the second version, water pharmaceutical form contains latrunculin, ethanol and preparation for supporting tonicity. Preparative form is intended for reduction of intraocular pressure in mammals. Preparative form by invention is stable during, at least, six months when cooled.

EFFECT: preparative form is intended for reduction of intraocular pressure in mammals.

15 cl, 5 dwg, 7 ex

FIELD: chemistry.

SUBSTANCE: invention relates to a use of N-(2-thiazolyl)amide derivatives of formula

,

where R1 and R2 are independently selected from H, -NO2, halogen, C1-C6 alkyl with a straight chain, where at least one of R1 and R2 is different from H; m equals 0, 1, 2 or 3; X is selected from a group consisting of: indole of formula (A) bound in position 2, indole of formula (B) bound in position 3 and indazole of formula (C) bound in position 3:

, , ,

where R3 is selected from H and C1-C6 alkyl with a straight chain; R4, R5, R6 and R7 are independently selected from H and C1-C6 alkoxy group; R8 is selected from H and C1-C6 alkyl, or any of its pharmaceutically acceptable salts to obtain a medicinal agent for treating or preventing diseases or conditions mediated by GSK-3, especially neurodegenerative diseases such as Alzheimer's disease or insulin-independent sugar diabetes. The invention also relates to a compound of formula (I), a pharmaceutical composition based on said compound and synthesis method thereof.

EFFECT: high efficiency of using said derivatives.

30 cl, 3 tbl, 7 ex

FIELD: organic chemistry, medicine, pharmacy.

SUBSTANCE: invention relates to a prophylactic or therapeutic agent used against hyperlipidemia and comprising as an active component the heterocyclic compound of the formula [1]:

or its pharmaceutically acceptable salt wherein R1 represents aryl optionally substituted with similar or different one-three groups taken among alkyl, halogenalkyl, trihalogen alkyl, alkoxy-group and halogen atom; Het represents bivalent aromatic heterocyclic group of the formula [5]:

wherein X represents oxygen, sulfur atom or NR6 wherein R6 represents hydrogen atom or alkyl; R2 represents hydrogen atom, alkyl or trihalogenalkyl; D represents alkylene and alkenylene; E represents group of the formulae [3] or [4] wherein Y represents oxygen or sulfur atom; R3 and R4 are similar or different and each represents hydrogen atom or alkyl; p = 1; Z represents carboxy-group, alkoxycarbonyl, cyano-group or 1H-5-tetrazolyl. Also, invention relates to new compounds belonging to group of above enumerated heterocyclic compounds of the formula [1] that show effect reducing blood triglycerides level, low density lipoprotein cholesterol, glucose and insulin or effect enhancing high density lipoprotein cholesterol and effect reducing the atherogenic effect. Therefore, these compounds can be used in prophylaxis or treatment of hyperlipidemia, arteriosclerosis, heart ischemic disease, brain infarction, rheocclusion after percutaneous intraluminal coronary angioplasty, diabetes mellitus and obesity.

EFFECT: valuable medicinal properties of compounds and pharmaceutical composition.

29 cl, 1 tbl, 170 ex

Up!