Lactobacillus application for treating viral infections

FIELD: medicine, pharmaceutics.

SUBSTANCE: what is offered in application of at least one strain of probiotic bacteria specified in Lactobacillus plantarum 299, DSM 6595, Lactobacillus plantarum 299v, DSM 9843, Lactobacillus plantarum HEAL 9, DSM 15312, Lactobacillus plantarum HEAL 19, DSM 15313, Lactobacillus plantarum HEAL 99, DSM 15316, Lactobacillus paracasei 8700:2, DSM 13434 and Lactobacillus paracasei 02A, DSM13432 for preparing a composition for treating and/or preventing a viral infection caused by 'cold' virus, and a related method for treating and/or preventing. A number of days for which 'cold' symptoms are experienced has been also reduced in a group of patients having been taking a probiotic.

EFFECT: what is shown is intensified immune protection against antiviral infection that promotes decreasing 'cold' episodes in comparison with the controls.

16 cl, 13 dwg, 3 ex

 

The technical field to which the invention relates

The present invention relates to the use of at least one strain of probiotic bacteria selected from Lactobacillus, for the production of pharmaceutical compositions for the treatment and/or prevention of viral infections.

The level of technology

Probiotic bacteria are live microorganisms that, when applied in adequate amounts, exert beneficial effects on the recipient. The most commonly used bacteria in probiotic products areLactobacilliandbifidobacteria. These bacteria are generally safe as probiotics on the basis of these by the body. The lack of pathogenicity applies to all age groups and for individuals with a weakened immune system. When receiving different probiotic bacteria have been shown favorable clinical effect in various physiological or pathological cases. The most pronounced side effects was expressed in diarrhea caused by antibiotic therapy or rotavirus infection. There are also studies that have shown positive clinical effects in inflammatory bowel disease, atopic dermatitis and hypercholesterolemia after administration of probiotic bacteria. The mechanism of action of probiotic bacter the th respect to these clinical improvements is not clear. In vitro studies in human beings as well as in vivo and in vitro in animals have shown that various species of lactobacilli act differently on innate and acquired immune system. Basically, clinical research has shown that stimulation of the innate cellular immune system and humoral immune responses to spontaneous infection and systemic or oral immunization. As for the impact on the innate immune system, there have been reports about enhanced phagocytic activity polymorphonuclear cells (PMN) and increased antitumor activity of NK-cells (natural killer cells). Information about clinical trials, which demonstrated effects on specific cellular immune system after administration of probiotic bacteria, are missing.

In accordance with the present invention was studied in detail the effects on innate and acquired immune system daily intake oflactobacillior gram-negative bacteriaP.Lundensi. Interestingly, observed the activation of specific cellular immune system in subjects receivingL.plantarumand such signs in subjects receivingL.paracasei. In addition, subjects receiving various kinds oflactobacilliwatched strengthen the immune system effects on the innate immune system, such as the increasing population of NKT cells and increased phagocytic activity. However, the imposition of gram-negative bacteriaP.lundensisdid not have an effect on various immune parameters measured during the experiments described here.

The growing interest in probiotics as alternative means, arose with the development of resistance to antibiotics and disorders at different treatment of infections. There is a need in the probiotic functional foods for zelogo problem solving cold. This clearly follows from the large number of cases of respiratory infections each year. Usually, to reduce the incidence of colds, used foods with a high content of vitamin C. On the market presents a wide range of such products that affect the immune system.

The objective of this proposal is to study whether probiotic functional food product after regular introduction to affect the symptoms of the common cold in a similar fashion and, thus, can there be an alternative solution for this problem of society.

Brief description of the invention

The object of the present invention is the use of at least one strain of probiotic bacteria selected from Lactobacillus, for the production of pharmaceutical compositions for the treatment and/or prevention of viral infections.

Another object really invented the Yu is a method of treating and/or preventing viral infections, in which at least one strain of probiotic bacteria selected from Lactobacillus, is administered to the individual.

Brief description of figures

The figure 1 shows the number of volunteers reporting any minor adverse gastrointestinal effects during the study.

The figure 2 shows the initial number (day 0) of various lymphocytes per ml of blood (mean±SEM (standard error of the mean))).

The figure 3 shows the initial (day 0) the percentage or GMFI (mean±SEM) of lymphocytes positive for various activators cells and markers of memory.

Figure 4. Subjects randomly divided into nine different studied groups. The study began with a two-week washout period. After that took part in the study period. During this period, the subjects consumed a single dose of the investigational product per day for 14 (groupL.plantarumHeal19,L.fermentum,L.paracasei,L.gasseri,L.rhamnosus,P.Lundensis) or 35 days (groupL.plantarum299v and placebo). Each dose contained 1010colony forming units (CFU) (grouplactobacillior 109SOME bacteria (P.lundensis).

Figure 5. The percentage of lymphocytes expressing the activation phenotypes CD8CD25, CD8HLA-DR, CD4CD25 and CD4HLA-DR were analyzed by flow what cytometry. Shown are average for the group (±SEM) for individual ratios of day 14/day 0 and day 35/day 0 (only for groupsL.plantarumand placebo).

Figure 6. The percentage of lymphocytes expressing phenotypes memory CD8CD45RO and CD4CD45RO, were analyzed by flow cytometry. Shown are average for the group (±SEM) for individual ratios of day 14/day 0 and day 35/day 0 (only for groupsL.plantarumand placebo).

Figure 7. The percentage of positive lymphocytes markers NKT cells (CD56CD16CD3), were analyzed by flow cytometry. The calculations for the group conducted individual ratios (day 14/day 0).

Figure 8. Phagocytic activity of neutrophils was analyzed incubare cells whole blood with FITC-labeled E. coli or S.aureus. The ratio between the mean fluorescence values obtained at day 14 and day 0 was determined individually, and group calculations shown in this figure.

The figure 9 shows the ratio of lymphocytes, expressively phenotypes activation CD4CD25 in experiment 2.

The figure 10 shows the ratio of lymphocytes, expressively phenotypes activation of CD4+CD25++in experiment 2.

The figure 11 shows the ratio of lymphocytes, expressively phenotypes of activated CD8+HLA-DR+in experiment 2.

The figure 12 shows the ratio of lymphocytes, expressively phenotypes of activated CD8+CD25+ in the xperiment 2.

The figure 13 shows the ratio of lymphocytes, expressively phenotypes activation CD4CD45RO in experiment 2.

A detailed description of the invention

Lactobacillus used according to the invention can be, without limitation selected from the group consisting ofLactobacillusplantarum,Lactobacillus rhamnsosus,Lactobacillus fermentum,Lactobacillus paracaseiandLactobacillus gasseri.

Lactobacillus plantarum,used according to the invention can be, without limitation selected from the group consisting ofLactobacillus plantarum299, DSM 6595,Lactobacillus plantarum299v, DSM 9843,Lactobacillus plantarumHEAL 9, DSM 15312,Lactobacillus plantarumHEAL 19, DSM in 15,313 andLactobacillus plantarumHEAL 99, DSM 15316.

Lactobacillus paracasei,used according to the invention can be, without limitation selected from the group consisting ofLactobacillus paracasei8700:2 (DSM 13434Lactobacillus paracasei02A, DSM13432.

Lactobacillus gasseri,used according to the invention can be, without limitation selected from the group consisting ofLactobacillus gasseriVPG44, DSM 16737.

Of course, other probiotic strains of bacteria, other than specifically disclosed herein may be used in the present invention and included in the scope of claims of the invention insofar as they provide the desired effect, that is, have a preventive effect on viral infection or facilitates viral infection.

In one embodiment, a pharmaceutical com is osili used at least two strains of probiotic bacteria. These at least two strains can be introduced sequentially or simultaneously. Thus, the strains can be introduced into the mixture in a single composition or they can be entered sequentially in different compositions.

The invention provides the possibility of treating viral infections. Viral infections are those caused by the virus, without limitation, selected from the group consisting of herpes simplex virus I, herpes simplex II, herpes zoster virus, cold virus, rhinovirus, adenovirus, parainfluenza virus, respiratory syncytial virus, enterovirus, and coronavirus. Any other viral infection, not specifically mentioned here, which is influenced by probiotic bacteria, also included in the scope of claims of the present invention. It is known that there are many different viruses and their forms that cause colds. All these viruses included in the scope of claims of the present invention.

In the present description, the term "treatment and/or prevention" includes prophylactic administration to the individual, i.e. the introduction of probiotic bacteria was initiated before the development of the disease or viral infection to prevent disease/infection, and treatment of already developed at individual diseases/infections. In the latter case, writing is carried out, for example, relief of symptoms or an improvement of the General condition of the patient, or more rapid recovery of the patient from the disease/infection. Thus, the individual may be a person at risk of developing infection or the patient has already developed an infection.

In an embodiment of the invention each specified(s) strain(s) present in the pharmaceutical composition in an amount, without restrictions from 1×106to approximately 1×1014SOME, preferably from about 1×108to approximately 1×1012and more preferably from about 1×109to approximately 1×1011.

The pharmaceutical composition according to the invention can be a drug in liquid or solid form.

If the pharmaceutical composition is a solid product, it can be prepared in the form of tablets, sucking tablets, candy, chewing tablets, chewing gum, capsules, sachets, powders, granules, particles, coated, coated tablets, tablets with enteric coating capsules with enteric coating, rassasyvanii strips or films.

If the pharmaceutical composition is a liquid preparation, it can be prepared in the form of oral solution, suspensions, emulsions or syrups. Specify the second composition may further include a carrier without limitation, independently selected from the group consisting of oat flour, lactic acid fermented foods, resistant starch, dietary fiber, carbohydrates, proteins and glycated proteins.

In an embodiment of the invention mentioned pharmaceutical composition is a health food, functional food, dietary Supplement, nutritional product or food preparation.

The pharmaceutical composition according to the invention used according to the invention or obtained according to the invention, may also include other substances such as inert carrier or pharmaceutical acceptable accessories, carriers, preservatives, etc. that are known to specialists in this field.

The term "pharmaceutical composition" is not necessarily relates to pharmaceutical compositions in its usual sense, but can also refer to a food composition, dietary Supplement, functional food, medical food or nutritional product up until it turns the desired effect, i.e. the treatment or prevention of viral infections. Specified food composition may be selected from the group consisting of beverages, yogurts, juices, ice cream, bread, biscuits, products from crushed grain bars for a healthy lifestyle, pastoor the different products and nutritional products. The food composition may further include a carrier, where the specified media is a selected from the group consisting of oat flour, lactic acid fermented foods, resistant starch, dietary fiber, carbohydrates, proteins and glycated proteins.

Thus, the advantages of using the composition according to the invention lies in the possibility of preventive administration, i.e. before the development of viral infection. Used in the pharmaceutical composition does not necessarily represent the pharmaceutical composition in its usual sense, and can also be a dietary Supplement or functional food product, which is very convenient for a normal healthy individual for preventive consumption of the composition according to the invention.

Examples

Example 1

Subjects and research settings

For the blind, placebo-controlled study were selected fifty-seven healthy volunteers aged 18-55 years (mean age, 26 years). Subjects randomly divided into eight groups receiving one of the following gram-positive bacteria,L.plantarum299v (n=7),L.Plantarum Heal19 (n=7),L.fermentum35D (n=7),L.paracasei8700:2 (n=7),L.gasseriVPG44 (n=7),L.rhamnosus271 (n=7), or gram-negative bacteria,P.lundnsis (n=7) or placebo (n=10). The dose of bacteria was 1010bacteria/day forlactobacilliand 109bacteria/day forP.lundensis. The control group was given skimmed milk powder (1 g). Depending on the group, the duration of the study was 6 or 9 weeks, consisting of a two-week washout period, 2 or 5 weeks of active study period and 2 weeks of follow-up period (figure 4). Each subject was given a list of products containing probiotic products should not be consumed during the entire study period. Peripheral blood samples were collected from the subjects by venipuncture two or three times on day 0, day 14 and 35 day. The diary, in which each subject was noted adverse effects, health status, and confirming the reception of the investigated product, kept in the course of the study.

Flow cytometry

Phenotypic analysis of lymphocytes in whole blood did flow cytometry. The following monoclonal antibodies to human were used as surface markers for different cell populations: CD3 FITC (SK7), CD4 APC (SK3), CD8 PerCP (SKl), CD19 PerCP (SJ25C1), CD56 PE (MY31), CD16 PE (B73.1), and CD5 FITC (L17F12). The following monoclonal antibodies to human were used to determine the various activation and markers: CD25 FITC (2A3), PE HLA-DR (L243), CD45RO PE (UCHL-I), CD38 PE (HB7), CD27 P (L128), and CD11b PE (D12). All antibodies were purchased from Becton-Dickinson (Erembodegum, Belgium). Whole blood (100 μl) were incubated with antibodies (10 μl/antibody) for 30 minutes at 4°C in the dark. Then added 2 ml of solution for lysis FACS (Becton-Dickinson) and incubated for 15 minutes at 20°C in the dark. Cells were washed by adding 3 ml of FACSFlow and centrifuged at 300×g for 5 minutes, Washed cells resuspendable in 200 ál of FACSFlow and were analyzed on a FacsCalibur (Becton-Dickinson) with CellQuest software.

The study of phagocytosis

The phagocytic activity of granulocytes and monocytes quantitatively evaluated using the PHAGOTEST® (Orpegen Pharma, Heidelberg, Germany) according to the manufacturer's instructions with some modifications. Briefly, 20×106E. colilabeled with FITC, orS.aureuslabeled with FITC was added to pre-chilled whole blood (100 μl). Blood cells and bacteria were incubated at 37°C for analysis 10 FacsCalibur with CellQuest software.

Calculations

Changes in various immune parameters of individuals was determined by calculating the relationship between the values obtained at day 14 and day 0, or the value obtained in 35 day 0 and day. This relationship was used for all calculations and statistical calculations.

Statistical calculations

All statistical assessments were performed, use the I Stat-view. The criterion U Mann-Witne was used when comparing different groups.

Results

Clinical observations

Fifty-four of the fifty-seven volunteers completed the full study. Two individuals were excluded due to infection and treatment with antibiotics (one in the placebo group and one in the group receivingP.lundensis). One individual was excluded on day 16 due to pregnancy (placebo group). While receiving investigational products reported only moderate adverse gastrointestinal side effects (figure 1).

Activation of T-cells when receiving lactobacilli

Observed a significant individual deviations of the values in the original data (day 0) in respect of activation markers on CD4+and CD8+T-cells. Baseline data on the percentage of cells expressing different cell surface markers, as shown in figure 2. Between different groups at this point in time there was no significant differences. As witnessed a very large individual deviations within the values that were compared, the correlation values at day 14 and 35 day values at day 0 for each individual. All calculations and comparisons were performed using these values of the ratios (day 14/day 0 and day 35/day 0). After 14 days of receiving the investigational product, containing the th L.plantarum299v, observed approximately twofold increase in expression of the activation marker CD25 on CD8+T-cells (p=0.01) (figure 5). We also observed strong, although insignificant (p=0,12), the value of the improved regulation of HLA-DR on CD8+cells after administration ofL.plantarum299v. In addition, we also observed a trend towards activation of CD4+T cells after administration ofL.Plantarum299v. Taking other kinds oflactobacilliincluded in this study, as well as gram-negative bacteriaP.lundensisnot activated nor CD8+nor CD4+T-cells. However, the observed trend of increasing expression of HLA-DR on CD4+T-cells (p=0,18) when receiving aL.paracasei.

Receivelactobacillicauses the memory phenotype CD4+ T cells

The average geometric values of fluorescence intensity (GMFI) of the expression of CD45RO on CD4+ and CD8+ T-cells was compared between groups receiving different investigational products. As noted above, were used for comparison calculations for groups based on a single correlation values (day 14/day 0 and day 35/day 0). After 35 days of receiving the investigational product containingL.Plantarum299v, CD45RO GMFI on CD4+ T-cells increased significantly (p=0.03). We also observed a trend towards increased expression of CD45RO on CD8+ T-cells after administration ofL.plantarum(6). In addition, intake ofL.paracaseiseems to be having a positive effect is CT at strengthening the regulation of CD45RO on CD8+ T-cells (p=0,10) (6).

The impact on different groups of cells after administration of the investigational product

ReceiveL.paracaseicaused an increase in the percentage of lymphocytes identified as NKT cells (p=0.06) (Fig.7). The relative increase/decrease compared to day 0 could not be detected in relation to other groups of cells, such as CD4+ T cells, CD8+ T-cells, B-cells, B-1 cells (CD19+CD5+), NK cells, granulocytes and monocytes.

Phagocytic activity

Granulocytes and monocytes were identified on the chart FSC-SSC. Tested the properties of these cells to phagocytosis of FITC-labeled gram-positive or gram-negative bacteria. As shown in Fig, granulocytes from volunteers who receivedL.plantarum299v (p=0,064),L.plantarumHeal19(p=0,064),L.fermentum(p=0,064) orL.paracasei(p=0.05) were more effective than leukocytes from volunteers who received placebo during phagocytosis of gram-negative bacteriaE. coli. However, it was not revealed any differences between the groups in the phagocytosis of gram-positive bacteriaS.aureus. Were not detected any differences in phagocytic activity of monocytes (data not shown).

Discussion

The main task of the immune system is quick and sharp response to microorganisms, thus preventing and treating infection. When the destruction of the microorganisms used in the tsya powerful mechanisms also do harm to our own tissues. So you need no reaction on our own tissue and into harmless substances present in the environment. Therefore, the immune system develops and provides tolerance as to the components of our own body and to food and proteins that fall during breathing. If it fails, it can be caused by many diseases. The way to achieve specific immune tolerance is the main task of the immune system.

A Central role in all immune responses belongs to T cells-helper cells. If T-cell-helper activates its specific antigen, it becomes activated, shares, Matures and develops a number of cytokines that control the action of other cell types in the immune system, such as cytotoxic T-cells and B-cells. Activation of T cells-helper cells necessary to obtain a large part of the types of immune responses, including antibody production. On the contrary, in the absence of activated T cells-helper cells missing a large part of the types of immune responses.

There are several mechanisms for activation of T cells-helper cells and the maintenance of tolerance. One mechanism is the elimination in the thymus T cells that recognize and react with the tissues. However, this elimination is not t aetsa full, in addition, we must also develop specific immune tolerance to exogenous antigens. Otherwise, we would react sharply to any type of substances that fall inside that would cause General inflammation and wasted immune resources.

Regulatory T-cell is the cell type that is Central to the maintenance of tolerance. This type of cell can be recognized by certain markers, such as surface expression of CD4 and CD25, the capture of intracellular CTLA-4 and transcription of nuclear Foxp3 protein. Regulatory T cells can prevent the activation of other T cells at a meeting with safe substances and, therefore, prevent any type of unwanted immune responses.

In this context, the symbol "+" in combination with any marker, such as CD4+ and CD25+, means that the marker is expressed on T-cells. For example, CD4+CD25+ T cells represents T cells that Express both CD4 marker and CD25 marker on the surface. However, this indicates that the token is present, but does not give information about the number of the marker that is expressed. In the present description, the symbol "++" in combination with a marker, such as CD4 CD25++ or ++means that in this case expressed a large number of the marker. Regulatory T-cells are cells of the large number of CD25 on the surface, that is, CD4+CD25++ cells. On the other hand, CD4+CD25+ T cells are only activated T-cells. Sometimes the symbols "+" and "++" are not used, for example, only CD4CD25, this means that cells are activated, such as CD4+CD25+ cells. Thus, CD4CD25 same as CD4+CD25+. At the mention of regulatory T-cells, they are always written as CD4+CD25++ cells.

This blind, placebo-controlled study is unique in that it represents the first study that compares the effects of taking different gramlactobacillior gram-negative bacteriaP.lundensison a number of immune parameters. Interestingly, the receivingP.lundensishad no impact on any of the measured parameters. On the contrary, receivinglactobacillihad an impact on the various components of both specific and innate immune system. New information obtained during this study was that the admission ofL.plantarumhad a clear positive effect on the activation and the induction of memory cells in groups of T cells. Observed a significant increase in the regulation of IL-2 receptor α chain (CD25) and a strong trend towards increased regulation of HLA-DR on cytotoxic T-cells. The trend towards increased regulation of these markers of activation were also observed in the ratio of T-helper cells after administration ofL.plantarum. Expression of activation markers shows the presidents of the three cells begin to proliferate in response to antigen-specific or non-specific effects and that these cells quickly show their effector functions, compared with T cells alone. Mechanisms againstL.plantarumcaused the activation of T-cells, can be performed by antigen presenting cells that activate toll-like receptors recognize microbial compounds. Activation of antigen presenting cells makes them more effective in presenting antigen to T-cells. In addition, both helper and cytotoxic T cells showed different expression of toll-like receptors, which likely makes these cells sensitive to non-specific activation of microbial components and products.

By analogy with T-helper cells, the expression of CD45RO also probably marks the population of memory cells among cytotoxic T-cells. It was found a significant increase in the expression of this cell marker of memory T-helper cells and the tendency to strengthen the regulation on cytotoxic T-cells while receivingL.plantarumwithin 35 days. In addition, intake ofL.paracaseialso showed a trend towards increased regulation of CD45RO on cytotoxic T-cells. As for naive T cells, CD45RO+ T cells can secrete a wide range of cytokines. In addition, CD45RO+ T cells can proliferate and produce IL-2 upon stimulation with complex CD3-TCR close to optimal conditions, whereas naive T cells require a strong incentive is the CD3-TCR to perform these functions. The formation of T-cell memory is important for the induction of an effective immune response after infection and vaccination.

On innate cellular immune system is also affected by the introduction of probiotic bacteria. It was demonstrated that the population of natural killer T (NKT) cells increased after takingL.paracasei. NKT cells are a subpopulation of lymphocytes, which together Express the marker CD56 NK cells and the receptor complex marker CD3-T cells. Research in humans and mice have shown that NKT cells play a Central role in the regulation of autoimmune diseases such as multiple sclerosis, diabetes type I and systemic lupus. NKT cells also exhibit effector functions against cells infected tumors and viruses. Thus, NKT cells are pleiotropic in their properties. Other clinical studies that assess the immunological effects of probiotic bacteria, showed that takingL.rhamnosusHN001 andBifidobacterium lactisHN019 enhances the antitumor activity of NK-cells (including NKT) K562 cells. This study was also confirmed by the observation that the phagocytic activity polymorphonuclear cells is increased after administration of variouslactobacilli. In the observed effects on various immune parameters in this study mo is but to assume, joint activation of cytotoxic T cells and an increase in NKT cells aimed at strengthening the immune defense against viral infections and/or tumors. In vitro results suggesting thatlactobacillistimulates mononuclear cells to secrete IL-12 and IL-18, supports theory that the reception of these bacteria stimulates activity, mediated by cells.

In accordance with the present invention it was concluded that takingL.plantarumandL.paracaseihas a strong effect on the specific and innate cellular immune system. However, enhancing immune function, shown here, currently it is difficult to correlate with proven benefits for health. For specific applications of these results requires additional clinical studies in individuals with, for example, viral infections or tumors. In such studies, especially it would be interesting to compare the effects of the introduction ofL.plantarumandL.paracaseiseparately or in combination.

Example 2

The purpose of this example was to investigate the effects on the immune system, with the introduction of the same specieslactobacilliover a longer period of time compared to the sequential introduction of several species oflactobacilli(of various types).

Volunteers were given powder with wyssen the mi freezing bacteria within 14 or 35 days. As gram-positive bacteria used as probiotic bacteriaLactobacillus plantarum299v, separately or in combination withL.rhamnosus,L.fermentum,L.paracaseiandL.gasseri. As gram-negative bacteria usedPsedomonas lundensis.

Were studied the following groups:

1)Lactobacillus plantarum35 days

2)L.plantarum7 DN,L.rhamnosus7 DN,L.fermentum7 DN,L.paracasei7 DN,L.gasseri7 Nam. Just 35 days. (Series)

3) a mixture ofL.plantarum,L.rhamnosus,L.fermentum,L.paracasei,L. gasseri. Only 14 days

4)L.rhamnosus14 days

5)L.fermentum14 days

6)L.paracasei14 days

7)L.gasseri14 days

8)Pseudomonas lundensis14 days

Control group 1) Placebo 35 days

Control group 2) Placebo 14 days

Blood samples were taken at 0, 14 and 35 day. The content of T-helpers (CD4+) expressing large amounts of CD25 was determined in each group of flow cytometry as described in example 1.

Results

On day 14 was observed borderline increase in CD4+CD25++ T cells, individuals, consistently consuming five different strains of lactobacilli.

Discussion

It has been shown that T cells-helper cells (CD4+) expressing c high density of CD25 molecule (CD4+CD25++) are important for the prevention of autoimmune diseases, allergies and inflammatory bowel disease. Found that these cells the number of these cells increases after successive reception of various lactobacilli, that shows that taking these bacteria can be useful for individuals, with the risk of the aforementioned diseases.

Experiment 3

The purpose of this study is to investigate the influence of the intake of lactic acid bacteria in freeze dried form/functional food product for at least 3 months on the severity of the symptoms and incidence and duration of colds.

It is important that this study is performed in vivo in humans, since no study in vitro or animal studies, did not reflect the degree of effectiveness when administered to humans. The property of these bacteria do not change in the intestinal tract, with the introduction immediately after cultivation was shown early in the research.

Thus, the aim is to explore whether the use of mixtureLactobacillus plantarum299v (DSM 9843) andLactobacillus paracasei8700:2 (DSM 13434) (1×109CFU/day) to reduce the risk of colds.

The study was conducted within 90 days and 500 individuals participated in the study. 250 individuals received the active product and 250 individuals received placebo.

The study double-blind, randomized and placebo-controlled with two Parallels.

Exclusion criteria: - Known lack of tolerance or Allergy to any component included in the drug; treatment and is largei drugs; treatment of severe gastro-intestinal disorders; pregnancy or breastfeeding; immunization against influenza in the last 12 months; and smokers.

Consumption of probiotics: driedLactobacillus plantarum299v andLactobacillus paracasei8700; 2. As cryoprotectants added sucrose, maltodextrin and gelatin hydrolysate. The daily dose was 1 g of lyophilisedLactobacilli(approximately 1×109CFU/day). The dose was taken at Breakfast.

The products have been manufactured, packaged and labeled Probi AB, Lund, Sweden. The quality of the product was also tested Probi AB. Each sachet contains: the name of the study, shelf life, storage conditions, the manufacturer, the name of the manufacturer and his/her phone number. In addition to the above information, the number assigned to the entity, shall be placed on the secondary packaging. Detailed instructions on dissolution and reception invested in a single secondary packaging. The product comes in the form of sachets.

With 14 days to 104 days subjects should not consume products containing probiotic bacteria. The subject is given a list of probiotic foods that should not be consumed during the study.

Fecal samples are 1 day (prior to receiving the investigational product), day 15 (after admission) and 104 (after admission). Samples must be collected in two tubes not later than 18 hours before delivery for analysis and during this period should be stored in the refrigerator. Samples analyzed against lactobacilli.

Blood samples are collected at 1 and 15 days. Samples are analyzed in relation to CD4+ and CD8+.

In the light of experiments 1 and 2 is expected observation improved protection against colds individuals consuming probiotic mixture, compared with the placebo group.

1. Applying at least one strain of probiotic bacteria Lactobacillus selected from Lactobacillus plantarum 299, DSM 6595, Lactobacillus plantarum 299v, DSM 9843, Lactobacillus plantarum HEAL 9, DSM 15312, Lactobacillus plantarum HEAL 19, DSM in 15,313, Lactobacillus plantarum HEAL 99, DSM 15316, Lactobacillus paracasei 8700:2 (DSM 13434 and Lactobacillus paracasei 02A, DSM 13432, for the manufacture of a composition for treatment and/or prevention of a viral infection caused by the cold virus.

2. The use according to claim 1, using at least two strains of probiotic bacteria.

3. The use according to claim 2, where these strains are introduced sequentially or simultaneously.

4. The use according to claim 1, where the specified composition is a pharmaceutical composition.

5. The use according to claim 4, where this pharmaceutical composition is a liquid preparation or solid preparation.

6. The use according to claim 5, where the specified solid drug is selected from the group consisting of tablets, rassasyvanii tablets, candies, chewing tablets, chewing gums, capsules, sachets, powders, granules, particles coated tablets with pokr is a tie, tablets or capsules containing enteric-soluble coating, rassasyvanii strips or films.

7. The use according to claim 5, where the specified liquid drug is selected from the group consisting of oral solutions, suspensions, emulsions and syrups.

8. The use according to claim 1 or 2 where the specified composition comprises a carrier.

9. The use of claim 8, where this composition is a health food, functional food, dietary Supplement, nutritional product or a food product.

10. The use of claim 8, where the specified media independently selected from the group consisting of oat flour, lactic acid fermented foods, resistant starch, dietary fiber, carbohydrates, proteins and glycated proteins.

11. The use according to claim 9, where the specified media independently selected from the group consisting of oat flour, lactic acid fermented foods, resistant starch, dietary fiber, carbohydrates, proteins and glycated proteins.

12. The use of claim 10 or 11, where the specified food product is selected from the group consisting of beverages, yogurts, juices, ice cream, bread, biscuits, products from crushed grain bars for a healthy lifestyle and pasty products.

13. The use according to any one of claims 1, 2, 4 and 9, where the content of each specified what about the strain(s) in the composition is from about 1·10 5to about 1·1014SOME, preferably from about 1·108to about 1·1012and more preferably from about 1·109to about 1·1011SOME.

14. A method of treating and/or preventing a viral infection caused by the cold virus, where at least one strain of probiotic bacteria Lactobacillus selected from the group consisting of Lactobacillus plantarum 299, DSM 6595, Lactobacillus plantarum 299v, DSM 9843, Lactobacillus plantarum HEAL 9, DSM 15312, Lactobacillus plantarum HEAL 19, DSM in 15,313, Lactobacillus plantarum HEAL 99, DSM 15316, Lactobacillus paracasei 8700:2 (DSM 13434 and Lactobacillus paracasei 02A, DSM13432 are introduced to the individual.

15. The method according to 14, where introduced at least two strains of probiotic bacteria.

16. The method according to clause 15, where these strains are introduced sequentially or simultaneously.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention relates to microbiological fertilisers for plants, specifically to a microbiological composition based on Rhizobium (symbiotic nitrogen fixer) legume bacteria. The composition contains Rhizobium lupini bacteria and associative nitrogen-fixing bacteria Flavobakterium, with components in weight ratio of 1.0-1.5:1.5-2.0. Due to synergetic interaction of the components, the composition has high physiological activity and has not phytotoxic effect on crop plants. The invention enables to efficiently increase plant biomass in mixed legume-grass seeds by approximately 7.1-7.8% compared to inoculation of seeds with legume bacteria, and by 8.9-9.9% compared to inoculation of seeds with associative bacteria. The degree of inhibition of crop plants or damage falls 1.4-8-fold compared to control crop plants.

EFFECT: microbiological composition increases accumulation of green material by 87-91 centner per hectare or 20-23% compared to control plants - yield in mixed lupine seeds and barley without inoculation of seeds with microbiological preparations.

2 tbl

FIELD: chemistry.

SUBSTANCE: invention relates to microbiological fertilisers for plants, specifically to a microbiological composition based on Rhizobium (symbiotic nitrogen fixer) legume bacteria. The composition contains Rhizobium lupini bacteria and associative nitrogen-fixing bacteria Flavobakterium, with components in weight ratio of 1.0-1.5:1.5-2.0. Due to synergetic interaction of the components, the composition has high physiological activity and has not phytotoxic effect on crop plants. The invention enables to efficiently increase plant biomass in mixed legume-grass seeds by approximately 7.1-7.8% compared to inoculation of seeds with legume bacteria, and by 8.9-9.9% compared to inoculation of seeds with associative bacteria. The degree of inhibition of crop plants or damage falls 1.4-8-fold compared to control crop plants.

EFFECT: microbiological composition increases accumulation of green material by 87-91 centner per hectare or 20-23% compared to control plants - yield in mixed lupine seeds and barley without inoculation of seeds with microbiological preparations.

2 tbl

FIELD: medicine.

SUBSTANCE: method by invention includes cloning if analysed sequence in gene gyrB DNA M. tuberculosis (MBT) by method of polymerase chain reaction (PCR), with further denaturation of PCR-product in presence of denaturing solution for obtaining single-stranded DNA fragments. After that mutations are detected in them by separation of said fragments in polyacrylamide gel. In order to carry out PCR a pair of primers was selected: "external" F1 -5' AGA GTT GGT GCG GCG TAA GA 3', R1 - 5' AAC ACA TGC CCG TTC TCG AT 3' and "internal" F2 - 5' TAA GAG CGC CAC CGA CAT CG 3', R2 -5' GCA TGA ACC GGA ACA ACA AC 3', and amplification modes (1-st stage -94° - 4 min; 2-nd stage - 94° - 30 sec, 59° - 40 sec, 72° - 40 sec (25 cycles); 3-rd stage: 72° - 4 min; 10° - storage), making it possible to clone DNA M. tuberculosis from not only grown cultures, but directly from biological secretions (sputum, BAL). Denaturation of obtained amplicons is carried out in denaturing solution, destabilising double helix at heating. Electrophoretic separation of obtained single-strand fragments of DNA is carried out in 8% polyacrylamide gel with 5% glycerol with voltage 400 V during 5 hours at 8°C. Presence of mutations in examined gene is determined by comparing degree of divergence of denatured DNA strands of analysed and sensitive strains of M. tuberculosis to fluorochinolones.

EFFECT: method makes it possible to determine sensitivity of MBT to fluorochinolones in shorter terms, it is available and safe.

1 dwg

FIELD: medicine.

SUBSTANCE: nutrient medium contains chicken eggs, 3-% extract of wood ash, 2-% water solution of malachite green and peat oxidate.

EFFECT: invention makes it possible to reduce term of paratuberculosis mycobacteria detection.

4 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: sample is prepared: an additional weight of nanocarbon forms is dispersed in 1 ml of organic solvents with a degree of polarity smaller than that of water - dimethyl sulphoxide or ethanol. Then it is mixed and exposed to ultrasound for 30 minutes. The prepared nanocarbon suspension is transferred in an aqueous medium to the final concentration of the used solvent 2.5 %. The produced and control samples are added with a viable sensor recombinant luminescent Escherichia coli K12 strain with cloned luxCDABE genes of luminescent Photobacterium leiognathi system. It is followed by incubation for 60 - 180 minutes, measuring luminous intensity and evaluating optical properties of the analysed suspension simultaneously. A toxicity index (T) is calculated with evaluating an actual luminous intensity of the strain (Iact) in comparison with the control of the same concentration of the solvent, considering light absorbing properties of the analysed suspension (D) and an experimental luminescence level of the bacterial luminescent biosensor (Iexp).

EFFECT: invention allows providing higher accuracy and sensitivity of nanocarbon biotoxicity analysis ensured by the introduction of a correction value - the actual luminous intensity of the strain Iact, considering a common factor of emitted light distribution in the analysed suspension.

1 ex

FIELD: medicine.

SUBSTANCE: method involves cultivation of an obligate methanol-assimilating bacterium Methylophilus methylotrophus or Methylobacillus glycogens in a fluid medium with the bacterium secreting an end protein from a bacterial cell where said bacterium has a DNA structure containing a promoter sequence functioning in the methanol-assimilating bacterium, a nucleotide sequence coding a polypeptide containing a signal sequence which functions in the methanol-assimilating bacterium, and a sequence of the end protein functionally connected with the promoter sequence.

EFFECT: method allows producing the protein effectively by means of extracellular secretion, difficult-to-produce by means of secretory production with application of Escherichia coli bacteria.

5 cl, 7 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method provides test inoculation of a nutrient medium containing pancreatic fish flour hydolyzate, fermentative meat peptone, NaCl, Tween-80, CaCl2, sodium thiosulphate (Na2S2O3 × 5H2O), ferrous ammonium sulphate ((NH4)2SO4 × FeSO4 × 6H2O), sorbite, bromthymol blue, irgasan (DP-300), rifampicin, NaOH, agar and distilled water in the preset proportions. Pancreatic fish flour hydolyzate, peptone, NaCl, agar are dissolved with heating, sterilised at 121°C for 20 min and thereafter added in a hot medium of the other components specified above. The inoculations are incubated on the nutrient medium in aerobic conditions at temperature 37°C and/or 28°C for 24-48 h and assessed by the presence of black-centre green or dark grey colonies surrounded by a cloudy precipitate zone in the nutrient medium.

EFFECT: invention allows simplifying and providing higher specificity of Shewanella bacteria recovery and identification.

2 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains yeast water, beef hydrolyzate, sodium chloride, glucose, glycerin, sodium citrate, sodium metabisulphite and distilled water.

EFFECT: invention allows providing optimum conditions for brucellous microbe growth, replication in a transport nutrient medium at any distances.

3 ex

FIELD: medicine.

SUBSTANCE: strain of bacteria Bacillus thuringiensis BIOS-1 VKPM B-10709, possessing insectoacaricidal activity against representatives of leaf-eating and sucking pests, such as representatives of orders Lepidoptera, Coleoptera, Homoptera, Thysanoptera and Acariformes, doing harm to crops, is deposited in All-Russian collection of industrial microorganisms (VKPM), Federal State Unitary Enterprise GosNIIgenetika under number B-10709.

EFFECT: invention makes it possible to increase mortality of representatives of leaf-eating and sucking pests, doing harm to crops.

6 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to microbiological fertilisers for plants, specifically to a microbiological composition based on Rhizobium (symbiotic nitrogen fixer) legume bacteria. The composition contains Rhizobium lupini bacteria and associative nitrogen-fixing bacteria Flavobakterium, with components in weight ratio of 1.0-1.5:1.5-2.0. Due to synergetic interaction of the components, the composition has high physiological activity and has not phytotoxic effect on crop plants. The invention enables to efficiently increase plant biomass in mixed legume-grass seeds by approximately 7.1-7.8% compared to inoculation of seeds with legume bacteria, and by 8.9-9.9% compared to inoculation of seeds with associative bacteria. The degree of inhibition of crop plants or damage falls 1.4-8-fold compared to control crop plants.

EFFECT: microbiological composition increases accumulation of green material by 87-91 centner per hectare or 20-23% compared to control plants - yield in mixed lupine seeds and barley without inoculation of seeds with microbiological preparations.

2 tbl

FIELD: chemistry.

SUBSTANCE: invention relates to microbiological fertilisers for plants, specifically to a microbiological composition based on Rhizobium (symbiotic nitrogen fixer) legume bacteria. The composition contains Rhizobium lupini bacteria and associative nitrogen-fixing bacteria Flavobakterium, with components in weight ratio of 1.0-1.5:1.5-2.0. Due to synergetic interaction of the components, the composition has high physiological activity and has not phytotoxic effect on crop plants. The invention enables to efficiently increase plant biomass in mixed legume-grass seeds by approximately 7.1-7.8% compared to inoculation of seeds with legume bacteria, and by 8.9-9.9% compared to inoculation of seeds with associative bacteria. The degree of inhibition of crop plants or damage falls 1.4-8-fold compared to control crop plants.

EFFECT: microbiological composition increases accumulation of green material by 87-91 centner per hectare or 20-23% compared to control plants - yield in mixed lupine seeds and barley without inoculation of seeds with microbiological preparations.

2 tbl

FIELD: medicine.

SUBSTANCE: method by invention includes cloning if analysed sequence in gene gyrB DNA M. tuberculosis (MBT) by method of polymerase chain reaction (PCR), with further denaturation of PCR-product in presence of denaturing solution for obtaining single-stranded DNA fragments. After that mutations are detected in them by separation of said fragments in polyacrylamide gel. In order to carry out PCR a pair of primers was selected: "external" F1 -5' AGA GTT GGT GCG GCG TAA GA 3', R1 - 5' AAC ACA TGC CCG TTC TCG AT 3' and "internal" F2 - 5' TAA GAG CGC CAC CGA CAT CG 3', R2 -5' GCA TGA ACC GGA ACA ACA AC 3', and amplification modes (1-st stage -94° - 4 min; 2-nd stage - 94° - 30 sec, 59° - 40 sec, 72° - 40 sec (25 cycles); 3-rd stage: 72° - 4 min; 10° - storage), making it possible to clone DNA M. tuberculosis from not only grown cultures, but directly from biological secretions (sputum, BAL). Denaturation of obtained amplicons is carried out in denaturing solution, destabilising double helix at heating. Electrophoretic separation of obtained single-strand fragments of DNA is carried out in 8% polyacrylamide gel with 5% glycerol with voltage 400 V during 5 hours at 8°C. Presence of mutations in examined gene is determined by comparing degree of divergence of denatured DNA strands of analysed and sensitive strains of M. tuberculosis to fluorochinolones.

EFFECT: method makes it possible to determine sensitivity of MBT to fluorochinolones in shorter terms, it is available and safe.

1 dwg

FIELD: medicine.

SUBSTANCE: nutrient medium contains chicken eggs, 3-% extract of wood ash, 2-% water solution of malachite green and peat oxidate.

EFFECT: invention makes it possible to reduce term of paratuberculosis mycobacteria detection.

4 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: sample is prepared: an additional weight of nanocarbon forms is dispersed in 1 ml of organic solvents with a degree of polarity smaller than that of water - dimethyl sulphoxide or ethanol. Then it is mixed and exposed to ultrasound for 30 minutes. The prepared nanocarbon suspension is transferred in an aqueous medium to the final concentration of the used solvent 2.5 %. The produced and control samples are added with a viable sensor recombinant luminescent Escherichia coli K12 strain with cloned luxCDABE genes of luminescent Photobacterium leiognathi system. It is followed by incubation for 60 - 180 minutes, measuring luminous intensity and evaluating optical properties of the analysed suspension simultaneously. A toxicity index (T) is calculated with evaluating an actual luminous intensity of the strain (Iact) in comparison with the control of the same concentration of the solvent, considering light absorbing properties of the analysed suspension (D) and an experimental luminescence level of the bacterial luminescent biosensor (Iexp).

EFFECT: invention allows providing higher accuracy and sensitivity of nanocarbon biotoxicity analysis ensured by the introduction of a correction value - the actual luminous intensity of the strain Iact, considering a common factor of emitted light distribution in the analysed suspension.

1 ex

FIELD: medicine.

SUBSTANCE: method involves cultivation of an obligate methanol-assimilating bacterium Methylophilus methylotrophus or Methylobacillus glycogens in a fluid medium with the bacterium secreting an end protein from a bacterial cell where said bacterium has a DNA structure containing a promoter sequence functioning in the methanol-assimilating bacterium, a nucleotide sequence coding a polypeptide containing a signal sequence which functions in the methanol-assimilating bacterium, and a sequence of the end protein functionally connected with the promoter sequence.

EFFECT: method allows producing the protein effectively by means of extracellular secretion, difficult-to-produce by means of secretory production with application of Escherichia coli bacteria.

5 cl, 7 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method provides test inoculation of a nutrient medium containing pancreatic fish flour hydolyzate, fermentative meat peptone, NaCl, Tween-80, CaCl2, sodium thiosulphate (Na2S2O3 × 5H2O), ferrous ammonium sulphate ((NH4)2SO4 × FeSO4 × 6H2O), sorbite, bromthymol blue, irgasan (DP-300), rifampicin, NaOH, agar and distilled water in the preset proportions. Pancreatic fish flour hydolyzate, peptone, NaCl, agar are dissolved with heating, sterilised at 121°C for 20 min and thereafter added in a hot medium of the other components specified above. The inoculations are incubated on the nutrient medium in aerobic conditions at temperature 37°C and/or 28°C for 24-48 h and assessed by the presence of black-centre green or dark grey colonies surrounded by a cloudy precipitate zone in the nutrient medium.

EFFECT: invention allows simplifying and providing higher specificity of Shewanella bacteria recovery and identification.

2 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains yeast water, beef hydrolyzate, sodium chloride, glucose, glycerin, sodium citrate, sodium metabisulphite and distilled water.

EFFECT: invention allows providing optimum conditions for brucellous microbe growth, replication in a transport nutrient medium at any distances.

3 ex

FIELD: medicine.

SUBSTANCE: strain of bacteria Bacillus thuringiensis BIOS-1 VKPM B-10709, possessing insectoacaricidal activity against representatives of leaf-eating and sucking pests, such as representatives of orders Lepidoptera, Coleoptera, Homoptera, Thysanoptera and Acariformes, doing harm to crops, is deposited in All-Russian collection of industrial microorganisms (VKPM), Federal State Unitary Enterprise GosNIIgenetika under number B-10709.

EFFECT: invention makes it possible to increase mortality of representatives of leaf-eating and sucking pests, doing harm to crops.

6 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: declared invention refers to chemical-pharmaceutical industry, and concerns new solid pharmaceutical dosage forms of valganciclovir hydrochloride for oral administration after reduced in water. These new pharmaceutical dosage forms are applicable for treating or controlling viruses, such as herpes virus or cytomegalovirus.

EFFECT: new solid pharmaceutical dosage form shows high stability.

8 cl, 4 ex, 4 tbl

Up!