Microbiological composition for stimulating growth and development of mixed legume-grass seeds

FIELD: chemistry.

SUBSTANCE: invention relates to microbiological fertilisers for plants, specifically to a microbiological composition based on Rhizobium (symbiotic nitrogen fixer) legume bacteria. The composition contains Rhizobium lupini bacteria and associative nitrogen-fixing bacteria Flavobakterium, with components in weight ratio of 1.0-1.5:1.5-2.0. Due to synergetic interaction of the components, the composition has high physiological activity and has not phytotoxic effect on crop plants. The invention enables to efficiently increase plant biomass in mixed legume-grass seeds by approximately 7.1-7.8% compared to inoculation of seeds with legume bacteria, and by 8.9-9.9% compared to inoculation of seeds with associative bacteria. The degree of inhibition of crop plants or damage falls 1.4-8-fold compared to control crop plants.

EFFECT: microbiological composition increases accumulation of green material by 87-91 centner per hectare or 20-23% compared to control plants - yield in mixed lupine seeds and barley without inoculation of seeds with microbiological preparations.

2 tbl

 

The invention relates to microbiological fertilizer plants, specifically to microbial composition on the basis of nodule bacteria of the genus Rhizobium (symbiotic fixer).

A known number of trading products - microbiological fertilizer legumes (risotorphine, nitragin)used to stimulate the growth and development of leguminous plants and the consumption rate of the product 200 g/ha (one hectarage) when the content in 1 gram of the drug at least 2.5 billion active cells of root nodule bacteria. These bacteria are gram-negative, not spore-forming, aerobic rods in width from 0.5 to 0.9 microns and a length of 1.2 to 3.0 MK [1].

However, for effective stimulation of the growth and development of bean plants using isotropin requires double handling of seeds and plants as seedlings made 25-27% of the drug on cotyledons that it is impossible to fill in the planting.

Known use as bacterial fertilizers nesimpatiska of nitrogen-fixing bacteria of the genus Klebsiella, Pseudomonas and others, namely associative nitrogen-fixing bacteria with complex actions, which is based on the ability of bacteria how to fix atmospheric nitrogen and to produce postactivity substances (hormones, vitamins from 15-17 and under favorable conditions up to 75 kg/ha of nitrogen in th is) [2].

However, the fixation of molecular nitrogen by these bacterial fertilizers on the basis of nesimpatiska of nitrogen-fixing bacteria of the genus Klebsiella, Pseudomonas insufficient.

Known microbiological compositions for seed treatment composition of the bacterial cells of the genus Pseudomonas containing complex strains of Pseudomonas Species 7G, Pseudomonas Species 7G 2K Pseudomonas Species 17-2 in the ratio 0,7:1,5:0,7-1,5:0,7:1,5 and physiologically active components contained in the culture fluid of Chlorella Vulgaris [3].

Derivatives included in this microbiological composition of strains of the genus Pseudomonas and the culture fluid of Chlorella Vulgaris containing enzymes, vitamins, hormones, antibiotics and exhibiting synergism with strains of the genus Pseudomonas, used in single-species crops of winter wheat, maize and potatoes to stimulate growth and protect plants from diseases with normal 2,3-2,7 1010 cells/ml based 10-12 liters per 1 ton of seeds of grain and 70-80 liters per 1 ton of potatoes [3].

This microbiological composition that includes gram-positive strains of the genus Pseudomonas unfit to stimulate growth and development of heterogeneous agro-ecosystem, for example, mixed crops of lupins and barley due to the toxicity of cultivated plants lupine.

To reduce the toxicity of the composition containing bacteria of the genus Rhizobium lupini at least 2.5 billion active cells of nodule bacteria in 1 gram of the drug, additionally the injected associative nitrogen-fixing bacteria of the genus Flavobacterium sp., containing not less than 4.0 billion active cells in 1 gram at a weight ratio of components 1,0-1,5:1,5-2,0.

The associated analysis of the proposed solutions with the prototype shows that the claimed composition differs from the known to the new ratio of ingredients 1.0 to 1.5 parts nodule bacteria of the genus Rhizobium lupini and 1.5 to 2.0 parts associative bacteria of the genus Flavobacterium sp. depending on the mechanical composition of the soil. Thus, the proposed solution meets the criterion of "novelty".

A new technical solution differs from the known fact that the new balance of the microbial components of the mixture does not cause inhibition of lupine plants, while improving stimulating effect on lupine and barley due to synergism. This allows to make a conclusion on the compliance of the claimed microbiological composition of the criterion of "substantial differences".

A new technical solution is produced and is as follows. One hectare norm of a mixture of seeds of legumes, such as lupins and cereals, for example barley crops-components, using a mechanical mixture comprising 200-300 g restartin and 300-400 g/ha flavobacteria. Packages shall be opened on the day of sowing. The main way to apply restartin and flavobacteria is a presowing cultivation of seeds. The required amount of the drug on the day of sowing bred in the East water at the rate of 5-10 liters of water per 1 ton of seeds and not allowing the suspension to settle, put it on the seeds, which are then thoroughly mixed until a uniform distribution of the drug. Treated with a mixture of restartin and flavobacteria seeds should be protected from direct sunlight. Our seeds were processed manually with the addition of adhesive. As the adhesive used sodium carboxymethyl cellulose (Na) at a dose of 0.2 kg per 10 litres of water. Sowing was carried out on the same day in moist soil.

Risotorphine is a drug is highly effective nodule bacteria grown on peat substrate rich in carbohydrates, minerals, vitamins and trace elements. Loose weight isotropin with a humidity of 50-55% is packaged in plastic bags, 200, 400, 600 or 800 grams. Risotorphine is stored at a temperature of 12-14C in a dark dry place, separately from pesticides. Freezing of drugs is not allowed. Shelf life - 6 months. According to the technical conditions in 1 g of the preparation contains not less than 2.5 billion active nodule bacteria ARRIAM (1990).

Flavobacterium - microbial drug, created on the basis of a highly efficient strain associative nitrogen-fixing bacteria of the genus Flavobacterium sp. Environmentally friendly. Does not require special precautions. Safe for people and the belly is's. Has no analogues in the world. A distinctive feature of flavobacteria is a multi-spectrum exposure. It is used for: winter wheat, rye, barley, forage grasses and sorghum, cabbage, cucumbers and tomatoes, sugar and fodder beet. The drug also has the complexity of the action, which is based on the ability of bacteria to fix atmospheric nitrogen and produce postactivity substances. Stimulating natural processes, Flavobacterium improves mineral and water power plants, increases resistance to disease, accelerates early production, increases yield, improves product quality, reduces the production of nitrates. Dose of 300 grams of flavobacteria allows you to receive additional per hectare: from 20 to 60 tons of high-quality vegetables, 60-70 kg of sugar beet, 3-5 kg of grain (ARRIAM, 1999).

New microbiological composition comprising nodule symbiotic living in symbiosis with the roots of leguminous host plant bacteria and not associative symbiotic living in the root zone (rhizosphere) of cereal plants, bacteria, used in mixed legume-cereal crops and has a number of significant components. As components of a mixture using bacterial preparations risotorphine, nitragin mixed with Flavobacterium with regard to the content of the activities of the respective substances, observing the recommended ratio of components. This microbiological composition is highly effective when introducing his seed on the day of sowing of alfalfa-grass mixtures. New microbiological composition does not inhibit the lupine and the cereal component.

The concentration of bacteria of the genus Rhizobium and bacteria of the genus Flavobacterium sp. in the new microbiological composition of 25-50% higher than when applying separately to each of these bacterial preparations containing nodule or associative bacteria. In addition, after treatment of seeds adhesive substance fixed on germinating seeds bacterial preparations. During germination of seeds of the apical area of the root and root hairs of the host plant to quickly come into contact with microbiological composition. Data on the total yield potential and toxicity of a new microbiological composition in comparison with the known microbiological preparations are shown in table 1.

To calculate the interaction of microbiological preparations in the mixture used equation which allows to calculate theoretical rate of the additive action of the components of the mixture by the amount of increase harvest:

for the two mixture components E=(XY):100

for the three mixture components E=(XYZ):10000

for an n component mixture En=(XYZ...n):100n-1

where x is the yield increase after application of ICRI is a biological preparation 1, %;

z - yield increase after application of microbiological preparation 3;

n - yield increase after application of microbial drug n.

The yield increase after application of microbial drug is defined as the difference with the control without drug. If actually received value is lower than calculated by the formula, microbial agents are antagonists of the above - synergistic, with equality calculated and the obtained values of their action is considered as additive.

Calculation of the synergy in the two-component composition when added to rizotorfina of flavobacteria conducted according to the method, showed the following dependency:

E=(XY):100

Dose (1)

Eactual=612-542=70

Esettlement=(2920):100=5,8

E=Efact.>Eaccount.we can assume synergies, dose (1);

Dose (2)

Eactual=629-542=87

Esettlement=(4128):100=11,5

E=Efact.>Eaccount.we can assume synergies, dose (2);

Dose (3)

Eactual=633-542=91

Esettlement=(4534):100=15,3

E=Efact.>Eaccount.we can assume synergies dose (3).

The data demonstrate the synergistic action of microbiological preparations restartin and flavobacteria, as the actual performance gain originative calculated.

The composition due to the synergistic interaction of the components has a high physiological activity in mixed legume-cereal agro-ecosystem and does not fetotoksicheskoe impact on plants.

The proposed microbiological mixture effective for stimulation and growth and development of various kinds of leguminous plants, including cereals - barley, spring wheat, oats, while growing with legumes, such as lupins. The increase of plant biomass in the mixed crops was approximately 7.1-7.8 per cent higher than from inoculation of seeds with rhizobia, and 8.9-9.9 per cent higher than from inoculation of associative bacteria. New microbiological composition increases the collection of green mass on 87-91 C/ha, or 20-23% to control harvest in mixed crops of lupins and barley without inoculation of seeds microbiological preparations, as shown in table 1. The degree of inhibition of cultivated plants, or damage is reduced compared with the control 1.4-8 times. The share of the cost of acquisition and the introduction of a new microbiological composition is 16-18% of the cost increase in the crop yield.

The study of the use of microbiological preparations with different concentration of cells on the basis specified in the formula bacteria (Rhizobium lupini and Flavobacterium sp.), namely drugs sapronit and drug No. 30 in single-species and mixed Lupi the o-barley crops confirms the achievement of the technical result in the use of other drugs, what is presented in table 2. The increase in the yield of green mass of lupine from the use of saponite amounted to 11.7%in barley from preparation No. 30 is 15.7%and in mixed crops from the joint using saponite and drug No. 30 - 19.7% of the control cases without treatment (table 2).

Table 1
IngredientsProductivity in mixed crop, kg/haThe degree of inhibition of cultivated plants, or damage, %
Bacteria of the genus Rhizobium lupini - drug risotorphine, in g/haBacteria of the genus Flavobakter - drug Flavobacterium, g/haThe yield of green mass, kg/haGain control, kg/ha
100,00471,029,00,7
200,00483,041,00,6
300,00487,045,0 0,6
0200,0462,020,00,8
0300,0470,028,00,9
0400,0476,034,00,7
(1) 100,0200,0512,070,00,3
(2) 200,0300,0529,0of 87.00,2
(3) 300,0400,0533,091,00,3
Control - without-
drugs442,0-1,6

Table 2
OptionDose, g/haThe yield of green mass, kg/haGain control
Sapronit Rhizobium lupiniPreparation No. 30 Flavobakter sp.kg/ha%
Lupin without processing control-451,0--
Barley without processing control--230,0--
Lupin + barley without processing control--442,0--
Lupin + sapronit200-503,752,711,7
Barley + drug no 30- 200266,136,115,7
Lupin + barley + sapronit + drug no 30200300529,0of 87.019,7

Literature.

1. Noisy VK Biological nitrogen and symbiotic nitrogen fixation / Vccy, Div, Minglanilla // Chief agronomist. - 2004. No. 10. - P.27-29).

2. Agroecology / Washinton, Ramalakshmi, A. V. Golubev, etc. Ed. Vasilikou, Auidences. - M.: Kolos, 2000. - S.

3. Patent RU 2291620 C1. (Prototype).

Microbiological composition for the stimulation and development of mixed legume-cereal crops, containing bacteria of the genus Rhizobium lupini, characterized in that it further in microbiological composition is administered bacteria of the genus Flavobacterium sp. when the mass ratio of the components is 1.0 to 1.5:1.5 to 2.0.



 

Same patents:

FIELD: medicine.

SUBSTANCE: method by invention includes cloning if analysed sequence in gene gyrB DNA M. tuberculosis (MBT) by method of polymerase chain reaction (PCR), with further denaturation of PCR-product in presence of denaturing solution for obtaining single-stranded DNA fragments. After that mutations are detected in them by separation of said fragments in polyacrylamide gel. In order to carry out PCR a pair of primers was selected: "external" F1 -5' AGA GTT GGT GCG GCG TAA GA 3', R1 - 5' AAC ACA TGC CCG TTC TCG AT 3' and "internal" F2 - 5' TAA GAG CGC CAC CGA CAT CG 3', R2 -5' GCA TGA ACC GGA ACA ACA AC 3', and amplification modes (1-st stage -94 - 4 min; 2-nd stage - 94 - 30 sec, 59 - 40 sec, 72 - 40 sec (25 cycles); 3-rd stage: 72 - 4 min; 10 - storage), making it possible to clone DNA M. tuberculosis from not only grown cultures, but directly from biological secretions (sputum, BAL). Denaturation of obtained amplicons is carried out in denaturing solution, destabilising double helix at heating. Electrophoretic separation of obtained single-strand fragments of DNA is carried out in 8% polyacrylamide gel with 5% glycerol with voltage 400 V during 5 hours at 8C. Presence of mutations in examined gene is determined by comparing degree of divergence of denatured DNA strands of analysed and sensitive strains of M. tuberculosis to fluorochinolones.

EFFECT: method makes it possible to determine sensitivity of MBT to fluorochinolones in shorter terms, it is available and safe.

1 dwg

FIELD: medicine.

SUBSTANCE: nutrient medium contains chicken eggs, 3-% extract of wood ash, 2-% water solution of malachite green and peat oxidate.

EFFECT: invention makes it possible to reduce term of paratuberculosis mycobacteria detection.

4 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: sample is prepared: an additional weight of nanocarbon forms is dispersed in 1 ml of organic solvents with a degree of polarity smaller than that of water - dimethyl sulphoxide or ethanol. Then it is mixed and exposed to ultrasound for 30 minutes. The prepared nanocarbon suspension is transferred in an aqueous medium to the final concentration of the used solvent 2.5 %. The produced and control samples are added with a viable sensor recombinant luminescent Escherichia coli K12 strain with cloned luxCDABE genes of luminescent Photobacterium leiognathi system. It is followed by incubation for 60 - 180 minutes, measuring luminous intensity and evaluating optical properties of the analysed suspension simultaneously. A toxicity index (T) is calculated with evaluating an actual luminous intensity of the strain (Iact) in comparison with the control of the same concentration of the solvent, considering light absorbing properties of the analysed suspension (D) and an experimental luminescence level of the bacterial luminescent biosensor (Iexp).

EFFECT: invention allows providing higher accuracy and sensitivity of nanocarbon biotoxicity analysis ensured by the introduction of a correction value - the actual luminous intensity of the strain Iact, considering a common factor of emitted light distribution in the analysed suspension.

1 ex

FIELD: medicine.

SUBSTANCE: method involves cultivation of an obligate methanol-assimilating bacterium Methylophilus methylotrophus or Methylobacillus glycogens in a fluid medium with the bacterium secreting an end protein from a bacterial cell where said bacterium has a DNA structure containing a promoter sequence functioning in the methanol-assimilating bacterium, a nucleotide sequence coding a polypeptide containing a signal sequence which functions in the methanol-assimilating bacterium, and a sequence of the end protein functionally connected with the promoter sequence.

EFFECT: method allows producing the protein effectively by means of extracellular secretion, difficult-to-produce by means of secretory production with application of Escherichia coli bacteria.

5 cl, 7 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method provides test inoculation of a nutrient medium containing pancreatic fish flour hydolyzate, fermentative meat peptone, NaCl, Tween-80, CaCl2, sodium thiosulphate (Na2S2O3 5H2O), ferrous ammonium sulphate ((NH4)2SO4 FeSO4 6H2O), sorbite, bromthymol blue, irgasan (DP-300), rifampicin, NaOH, agar and distilled water in the preset proportions. Pancreatic fish flour hydolyzate, peptone, NaCl, agar are dissolved with heating, sterilised at 121C for 20 min and thereafter added in a hot medium of the other components specified above. The inoculations are incubated on the nutrient medium in aerobic conditions at temperature 37C and/or 28C for 24-48 h and assessed by the presence of black-centre green or dark grey colonies surrounded by a cloudy precipitate zone in the nutrient medium.

EFFECT: invention allows simplifying and providing higher specificity of Shewanella bacteria recovery and identification.

2 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains yeast water, beef hydrolyzate, sodium chloride, glucose, glycerin, sodium citrate, sodium metabisulphite and distilled water.

EFFECT: invention allows providing optimum conditions for brucellous microbe growth, replication in a transport nutrient medium at any distances.

3 ex

FIELD: medicine.

SUBSTANCE: strain of bacteria Bacillus thuringiensis BIOS-1 VKPM B-10709, possessing insectoacaricidal activity against representatives of leaf-eating and sucking pests, such as representatives of orders Lepidoptera, Coleoptera, Homoptera, Thysanoptera and Acariformes, doing harm to crops, is deposited in All-Russian collection of industrial microorganisms (VKPM), Federal State Unitary Enterprise GosNIIgenetika under number B-10709.

EFFECT: invention makes it possible to increase mortality of representatives of leaf-eating and sucking pests, doing harm to crops.

6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: there is offered a method of preparing the antibiotic Cephalosporin C. A new antibiotic producer Acremonium chrysogenum strain, RNCM No. F-4081D is used. Acremonium chrysogenum, RNCM No.F-4081D is cultivated on an enzymatic nutrient medium containing carbohydrate sources - glucose, corn starch, dextrin, nitrogen sources - a corn extract, Pharmamedia, ammonium sulphate, and also inorganic salts - potassium phosphate, potassium sulphate, chalk, copper sulphate, zinc sulphate, manganese sulphate, ferrous sulphate, and as vegetable fat - rapeseed oil and in addition a phosphatidylcholine and/or sitosterol.

EFFECT: twice increased antibiotic production level, reduced fermentation time.

1 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention can be used in producing nutrient mediums which create the optimum conditions of legionella activity. The nutrient medium contains a enzymatic hydrolyzate of a pig's lung, a enzymatic hydrolyzate of peanut, 1-substituted potassium phosphate, 2-substituted 3-aqueous potassium phosphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water.

EFFECT: invention allows reducing time for legionella detection.

3 ex

FIELD: medicine.

SUBSTANCE: method by invention includes cloning if analysed sequence in gene gyrB DNA M. tuberculosis (MBT) by method of polymerase chain reaction (PCR), with further denaturation of PCR-product in presence of denaturing solution for obtaining single-stranded DNA fragments. After that mutations are detected in them by separation of said fragments in polyacrylamide gel. In order to carry out PCR a pair of primers was selected: "external" F1 -5' AGA GTT GGT GCG GCG TAA GA 3', R1 - 5' AAC ACA TGC CCG TTC TCG AT 3' and "internal" F2 - 5' TAA GAG CGC CAC CGA CAT CG 3', R2 -5' GCA TGA ACC GGA ACA ACA AC 3', and amplification modes (1-st stage -94 - 4 min; 2-nd stage - 94 - 30 sec, 59 - 40 sec, 72 - 40 sec (25 cycles); 3-rd stage: 72 - 4 min; 10 - storage), making it possible to clone DNA M. tuberculosis from not only grown cultures, but directly from biological secretions (sputum, BAL). Denaturation of obtained amplicons is carried out in denaturing solution, destabilising double helix at heating. Electrophoretic separation of obtained single-strand fragments of DNA is carried out in 8% polyacrylamide gel with 5% glycerol with voltage 400 V during 5 hours at 8C. Presence of mutations in examined gene is determined by comparing degree of divergence of denatured DNA strands of analysed and sensitive strains of M. tuberculosis to fluorochinolones.

EFFECT: method makes it possible to determine sensitivity of MBT to fluorochinolones in shorter terms, it is available and safe.

1 dwg

FIELD: medicine.

SUBSTANCE: nutrient medium contains chicken eggs, 3-% extract of wood ash, 2-% water solution of malachite green and peat oxidate.

EFFECT: invention makes it possible to reduce term of paratuberculosis mycobacteria detection.

4 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: sample is prepared: an additional weight of nanocarbon forms is dispersed in 1 ml of organic solvents with a degree of polarity smaller than that of water - dimethyl sulphoxide or ethanol. Then it is mixed and exposed to ultrasound for 30 minutes. The prepared nanocarbon suspension is transferred in an aqueous medium to the final concentration of the used solvent 2.5 %. The produced and control samples are added with a viable sensor recombinant luminescent Escherichia coli K12 strain with cloned luxCDABE genes of luminescent Photobacterium leiognathi system. It is followed by incubation for 60 - 180 minutes, measuring luminous intensity and evaluating optical properties of the analysed suspension simultaneously. A toxicity index (T) is calculated with evaluating an actual luminous intensity of the strain (Iact) in comparison with the control of the same concentration of the solvent, considering light absorbing properties of the analysed suspension (D) and an experimental luminescence level of the bacterial luminescent biosensor (Iexp).

EFFECT: invention allows providing higher accuracy and sensitivity of nanocarbon biotoxicity analysis ensured by the introduction of a correction value - the actual luminous intensity of the strain Iact, considering a common factor of emitted light distribution in the analysed suspension.

1 ex

FIELD: medicine.

SUBSTANCE: method involves cultivation of an obligate methanol-assimilating bacterium Methylophilus methylotrophus or Methylobacillus glycogens in a fluid medium with the bacterium secreting an end protein from a bacterial cell where said bacterium has a DNA structure containing a promoter sequence functioning in the methanol-assimilating bacterium, a nucleotide sequence coding a polypeptide containing a signal sequence which functions in the methanol-assimilating bacterium, and a sequence of the end protein functionally connected with the promoter sequence.

EFFECT: method allows producing the protein effectively by means of extracellular secretion, difficult-to-produce by means of secretory production with application of Escherichia coli bacteria.

5 cl, 7 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method provides test inoculation of a nutrient medium containing pancreatic fish flour hydolyzate, fermentative meat peptone, NaCl, Tween-80, CaCl2, sodium thiosulphate (Na2S2O3 5H2O), ferrous ammonium sulphate ((NH4)2SO4 FeSO4 6H2O), sorbite, bromthymol blue, irgasan (DP-300), rifampicin, NaOH, agar and distilled water in the preset proportions. Pancreatic fish flour hydolyzate, peptone, NaCl, agar are dissolved with heating, sterilised at 121C for 20 min and thereafter added in a hot medium of the other components specified above. The inoculations are incubated on the nutrient medium in aerobic conditions at temperature 37C and/or 28C for 24-48 h and assessed by the presence of black-centre green or dark grey colonies surrounded by a cloudy precipitate zone in the nutrient medium.

EFFECT: invention allows simplifying and providing higher specificity of Shewanella bacteria recovery and identification.

2 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains yeast water, beef hydrolyzate, sodium chloride, glucose, glycerin, sodium citrate, sodium metabisulphite and distilled water.

EFFECT: invention allows providing optimum conditions for brucellous microbe growth, replication in a transport nutrient medium at any distances.

3 ex

FIELD: medicine.

SUBSTANCE: strain of bacteria Bacillus thuringiensis BIOS-1 VKPM B-10709, possessing insectoacaricidal activity against representatives of leaf-eating and sucking pests, such as representatives of orders Lepidoptera, Coleoptera, Homoptera, Thysanoptera and Acariformes, doing harm to crops, is deposited in All-Russian collection of industrial microorganisms (VKPM), Federal State Unitary Enterprise GosNIIgenetika under number B-10709.

EFFECT: invention makes it possible to increase mortality of representatives of leaf-eating and sucking pests, doing harm to crops.

6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: there is offered a method of preparing the antibiotic Cephalosporin C. A new antibiotic producer Acremonium chrysogenum strain, RNCM No. F-4081D is used. Acremonium chrysogenum, RNCM No.F-4081D is cultivated on an enzymatic nutrient medium containing carbohydrate sources - glucose, corn starch, dextrin, nitrogen sources - a corn extract, Pharmamedia, ammonium sulphate, and also inorganic salts - potassium phosphate, potassium sulphate, chalk, copper sulphate, zinc sulphate, manganese sulphate, ferrous sulphate, and as vegetable fat - rapeseed oil and in addition a phosphatidylcholine and/or sitosterol.

EFFECT: twice increased antibiotic production level, reduced fermentation time.

1 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention can be used in producing nutrient mediums which create the optimum conditions of legionella activity. The nutrient medium contains a enzymatic hydrolyzate of a pig's lung, a enzymatic hydrolyzate of peanut, 1-substituted potassium phosphate, 2-substituted 3-aqueous potassium phosphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water.

EFFECT: invention allows reducing time for legionella detection.

3 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains chicken eggs, 3-% extract of wood ash, 2-% water solution of malachite green and peat oxidate.

EFFECT: invention makes it possible to reduce term of paratuberculosis mycobacteria detection.

4 tbl, 9 ex

Up!