Method of diagnosing sensitivity of mycobacterium tuberculosis strains to fluorochinolones by gene gyr b

FIELD: medicine.

SUBSTANCE: method by invention includes cloning if analysed sequence in gene gyrB DNA M. tuberculosis (MBT) by method of polymerase chain reaction (PCR), with further denaturation of PCR-product in presence of denaturing solution for obtaining single-stranded DNA fragments. After that mutations are detected in them by separation of said fragments in polyacrylamide gel. In order to carry out PCR a pair of primers was selected: "external" F1 -5' AGA GTT GGT GCG GCG TAA GA 3', R1 - 5' AAC ACA TGC CCG TTC TCG AT 3' and "internal" F2 - 5' TAA GAG CGC CAC CGA CAT CG 3', R2 -5' GCA TGA ACC GGA ACA ACA AC 3', and amplification modes (1-st stage -94° - 4 min; 2-nd stage - 94° - 30 sec, 59° - 40 sec, 72° - 40 sec (25 cycles); 3-rd stage: 72° - 4 min; 10° - storage), making it possible to clone DNA M. tuberculosis from not only grown cultures, but directly from biological secretions (sputum, BAL). Denaturation of obtained amplicons is carried out in denaturing solution, destabilising double helix at heating. Electrophoretic separation of obtained single-strand fragments of DNA is carried out in 8% polyacrylamide gel with 5% glycerol with voltage 400 V during 5 hours at 8°C. Presence of mutations in examined gene is determined by comparing degree of divergence of denatured DNA strands of analysed and sensitive strains of M. tuberculosis to fluorochinolones.

EFFECT: method makes it possible to determine sensitivity of MBT to fluorochinolones in shorter terms, it is available and safe.

1 dwg

 

The present invention relates to medicine, in particular to a method of diagnosing the sensitivity .tuberculosis office (ILO) to fluoroquinolones. This method allows you to detect mutations in the gyrB gene, contributing to the sustainability office to these drugs, by amplification of the corresponding DNA sequences of the investigated gene of the office with the subsequent analysis of the obtained amplicons in the presence of mutations after denaturation and electrophoretic separation in polyacrylamide gel.

Currently, along with the spread of strains of the multidrug resistance (ILO-MDR) were recorded cases of allotment of sick strains with the so-called extensively drug-resistant (extensively drag resistance - XDR), i.e. the office-MDR resistant to fluoroquinolones and one, two drugs from the group of aminoglycosides. Such patients are becoming more (in different regions of Russia from 4.9 to 20% of all patients, from the office-MDR, UGA et al., (2009)) and they form a new dangerous "TB infections that are resistant to all major anti-TB drugs (PTP).

Drugs fluoroquinolone series (ofloxacin, ciprofloxacin, levofloxacin, and others) are now widely used for the treatment of multidrug resistance in the composition of the back row of the TA. The most promising of these are the fourth generation fluoroquinolones, namely, moxifloxacin and Gatifloxacin, which in vivo studies and in vitro showed high farmakokineticescoy activity in relation to, in particular ciprofloxacin-resistant strains office-MDR (Zhao Century, Pine R. et al. Fluoroquinolone action against clinical isolates of Mycobacterium tuberculosis: effects of a C-8 Methoxyl Group on survival in liquid media and in human macrophages // Antimicr. Agents and Chemother. - 1999, - p.661-666).

The effectiveness of treatment depends primarily on the timing of the start of therapy, therefore, rapid drug susceptibility testing office to these drugs is a priority for choice of therapy of multidrug resistance. To date, microbial drug sensitivity to the office fluoroquinolones, make use of a dense environments Levenshtein-Jensen medium. Time the result is an average of 2-3 months, in addition to new drugs, such as Gatifloxacin and sparfloxacin, not known critical concentration, allowing to determine the resistance of strains of the office.

The use of liquid culture media in modern automated systems WASTES MGIT 960 may allow to reduce the time of receipt of the culture of the office to 10-18 days. At present, however, for the sensitivity analysis of the office for fluoroquinolones registered terouanne (certified) culture tests on liquid nutrient media in the world.

Technologies based on molecular-genetic methods for determining drug sensitivity to the office of PTP significantly reduce the time to two days to obtain results with high sensitivity and specificity.

It is known that resistance to all fluoroquinolones group is cross-sectional in nature and is developed through the emergence of mutations (single nucleotide substitutions in genes target gyrA (320 BP) and less frequently in gyrB (375 BP), encoding a bacterial ATP-dependent DNA topoisomerase type II (DNA girazu), consisting of the same subunits (Ginsburg, A., H. Grosset, Bishai W. Fluoroquinolones, tuberculosis and resistance // The Lancet. - 2003. - v.3. - p.432-442). The 42-85% of clinical strains resistant to these drugs is associated with mutations in the QRDR region of gyrA gene (Yew W. et al. Genotypic and phenotypic resistance of M.tuberculosis to rifampicins and fluoroquinolones // Int J Tuberc Lung Dis 2002. - v.6. - p.936-937, Sulivan E. et al. Emergence of fluoroquinolone-resistant tuberculosis in New York City. Lancet - 1995. - v.345. - p.1148-1150). Approximately 7% of the strains of the resistance associated with mutations in the gyrB gene (Wang J et al. Fluoroquinolone resistance in Mycobacterium tuberculosis isolates: associated genetic mutations and relationship to antimicrobial exposure // J. Antimicr. Chemotherapy. - 2007. - v.59. - p.860-865). Currently describes the following nucleotide substitutions in the QRDR of gyrB gene region R485H, S486F, N538T, N538D, TR, D500A, D500H, D500N, G509A, E540V, E540D (An D. et al. Beijing genotype of M. tuberculosis is significantly associated with high-level fluoroquinolone resistance in Vietnam // Antimicrobial agents and chemotherapy. - 2009. - p.4835-4839) these substitutions occur independently in gyrB, or in combination with mutations in gyrA (Groll A, et al. Fluoroquinolone resistance in Mycobacterium tuberculosis and mutations in gyrA and gyrB // Antimicr. Agents and Chemother. - 2009. - p.4498-4500). Therefore, from our point of view, the simultaneous detection of mutations in two genes gyrA (previous invention No. 2343197 "Way to diagnose the sensitivity of strains of Mycobacterium tuberculosis to fluoroquinolones) and gyrB can provide additional information on the investigated strain and improve correlation with microbiological results of the analysis of the office of drug sensitivity to these drugs.

For detection of bacterial mutations there are a number of molecular methods, the main stage which is the accumulation of the studied DNA using polymerase chain reaction (PCR). From the quality of the DNA amplification (PCR) depends on the specificity of the subsequent stages. Directly to identify nucleotide substitutions using the following methods: allele-specific PCR, the analysis of the polymorphism of the lengths of restriction fragments, sequencing, method, denaturing gradient gel electrophoresis, a method of conformational polymorphism single-stranded fragments (SSCP), etc. Each of these methods has both advantages and disadvantages and basically use them for research purposes (Victor T., Jordan A. Detection of drug resistance mutation in genes of M. tuberculosis by a dot-blot hibridization strategy // Int. J.Tubercle and Lung Disease. - 1999. - v.2. - p.346-349; Ramaswamy S. Musser J. Molecular genetic basis of antimicrobial agent resistance in M.tuberculosis // Tubercle and Lung Disease. - 1998. - v.79. - p.3-29).

The analogue of this invention is a method of identifying mutations using the method of single-stranded conformation polymorphism fragments of the genes in the DNA of the office responsible for resistance to fluoroquinolones in patients with tuberculosis. (A. Cheng, W. Yew Multiplex PCR amplimer conformation analysis for rapid detection of gyrA mutations in fluoroquinolone-resistant Mycobacterium tuberculosis clinical isolates // Antimicrob. Agents a Chemotherapy. - 2004. - v.48. - p.596-601).

A prototype of this invention is the previously proposed complex, including polymerase chain reaction with further analysis of the amplicons by SSCP method for identifying mutations in the gyrA gene of the office responsible for resistance to fluoroquinolones (previous invention No. 2343197).

This method consists of several stages:

1. Analyzed the DNA sequence of the studied gene amplified by the PCR method.

2. The PCR product is subjected to thermal denaturation in the presence of the double helix destabilizing agents such as formamide, transferred to ice.

3. The mixture is applied on a polyacrylamide gel and separated by high-voltage electophoresis. The analyzed single-stranded DNA-sequences of equal magnitude, but differ in the spatial organization of molecules due to substitutions have time is to their electrophoretic mobility. The obtained electrophoretic profiles specific for the studied sequence, and in case of replacement of one nucleotide in the chain of the investigated DNA regions diverge at different distance from each other.

4. The degree of divergence denaturirovannykh threads detected by staining the gel with a dye of silver nitrate or Sybr Green 2.

Thus, this method is quite affordable (PCR, electrophoresis technique now used in many laboratories), the specific work carried out directly with the DNA of mycobacteria) and sensitive enough (using the PCR method can detect the DNA of single cells).

Differences between our proposed method from the previous one consists in the following. Study of the sensitivity of the office to fluoroquinolones spend one gyrB gene, is also involved in the development of resistance to these drugs. To do this, picked up two pairs of primers ("external" and "internal") and the program for amplification for sequential PCR (Nested"RT-PCR), which allows to identify the office directly from respiratory material. After the electrophoresis on electrophoregram can be identified mutations in the gene gyrB. Thus, within two days, you can define the sensitivity to fluoroquinolones by two genes and thus provide verojatno the ü identify mutations responsible for the sustainability office to these drugs, an additional 7-10% of cases.

Were developed conditions for each of the stages of the method:

1. for DNA synthesis, the office of the gene gyrB of several primer pairs were selected as follows:

"external": F 1 - 5'AGAGTTGGTGCGGCGTAAGA3'

R 1 - 5'AACACATGCCCGTTCTCGAT3'

"internal": F 2 - 5'TAAGAGCGCCACCGACATCG3'

R 2 - 5'GCATGAACCGGAACAACAAC3'

To assess the specificity of the selected primers was performed comparative analysis of nucleotide sequences from the GenBank database using the BLAST program. Found no cross-reactions using these primers with the DNA of other species of microorganisms and humans.

2. For PCR with the "outer" and "inner" primers was selected the composition of the reaction buffer, where important components were the buffer type, concentration triphosphates, the concentration of magnesium ions. To prevent contamination in the first reaction mixture was added brazillionaires.

3. Changing the parameters of the annealing temperature of the primers, the time of each cycle and the number of cycles was selected single optimal amplification for holding the first and second PCR increases the sensitivity of the method to detect DNA of the office of the respiratory patient material. Selected conditions are the following: 1st stage - 94° C 4 min; 2-nd stage - 94° C 30 sec, 59° - 40 with the to, 72° - 40 s (25 cycles); 3rd step: 72° C 4 min; 10° - storage;

4. For electrophoretic separation of single-stranded DNA fragments were selected conditions denaturation of the obtained amplicons (the ratio of amplicon and denaturing solution, the denaturation time), the composition of polyacrylamide gel (percentage of polyacrylamide, glycerol and composition of the buffer, separation voltage, the time of electrophoresis, temperature), in order to enhance the separation of the investigated single-stranded amplicons. Selected conditions coincide with the conditions for electrophoretic separation of DNA by the office of the gene gyrA (previous invention No. 2343197), which greatly simplified the work is to study the conformation polymorphism single-stranded fragments of both genes. Selected conditions are the following: denaturation mix 4 ál of the sample with 6 µl of denaturing solution and spend denaturation at 95° C for 10 min, the separation denaturirovannykh amplicons performed in 8% polyacrylamide gel with 5% glycerol, at a voltage of 400 volts for 5 hours at a temperature of 8°C in TBE buffer.

5. To visualize the results of electrophoresis of the color of the gel was performed using nitrate of silver.

Detection results.

After staining, the gel was evaluated under white light (visually) without specifically what about the equipment. Painted denatured amplicons represent strips for each sample. To identify mutations in the gene, along with the amplicons of the sample under study investigated the amplicon DNA sensitive strains of the office. The drawing shows a photograph of the electrophoretic profiles of DNA samples MBT resistant to fluoroquinolones tracks 3-6, 8, sensitive strains - tracks 1, 2, 7.

The way to diagnose the sensitivity of Mycobacterium tuberculosis (MBT) for fluoroquinolones by asking polymerase chain reaction-based amplification of DNA analyzed and sensitive strains of the office, followed by denaturation of DNA by polyacrylamide gel electrophoresis, comparison of the results of electrophoresis and determination of sensitiveness of the office according to the degree of divergence of the single-stranded DNA strands in the study and sensitive strains, characterized in that the amplification of DNA of Mycobacterium tuberculosis sequentially carried out with selected two pairs of primers: "external" F1 - 5'AGAGTTGGTGCGGCGTAAGA3', R1 - 5'AACTGCCCGTTCTCGAT3' and ' internal ' F2 - 5'TAAGAGCGCCACCGACATCG3', R2 - 5'GCATGAACCGGA3'mode amplification 1st stage - 94° C 4 min; 2-nd stage - 94° 30 sec, 59° C for 40 s, 72° C - 40 C (25 cycles); 3rd step: 72° C 4 min; 10° - storage, separation of amplification products in the ratio of 4 μl of the sample and 6 µl of denaturing solution carried out by electrophoresis in 8%polyacrylamide gel with a 5%n the m glycerol at a voltage of 400 V for 5 h at 8°C, the color of the gel is carried out with the help of silver nitrate.



 

Same patents:

FIELD: medicine.

SUBSTANCE: nutrient medium contains chicken eggs, 3-% extract of wood ash, 2-% water solution of malachite green and peat oxidate.

EFFECT: invention makes it possible to reduce term of paratuberculosis mycobacteria detection.

4 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: sample is prepared: an additional weight of nanocarbon forms is dispersed in 1 ml of organic solvents with a degree of polarity smaller than that of water - dimethyl sulphoxide or ethanol. Then it is mixed and exposed to ultrasound for 30 minutes. The prepared nanocarbon suspension is transferred in an aqueous medium to the final concentration of the used solvent 2.5 %. The produced and control samples are added with a viable sensor recombinant luminescent Escherichia coli K12 strain with cloned luxCDABE genes of luminescent Photobacterium leiognathi system. It is followed by incubation for 60 - 180 minutes, measuring luminous intensity and evaluating optical properties of the analysed suspension simultaneously. A toxicity index (T) is calculated with evaluating an actual luminous intensity of the strain (Iact) in comparison with the control of the same concentration of the solvent, considering light absorbing properties of the analysed suspension (D) and an experimental luminescence level of the bacterial luminescent biosensor (Iexp).

EFFECT: invention allows providing higher accuracy and sensitivity of nanocarbon biotoxicity analysis ensured by the introduction of a correction value - the actual luminous intensity of the strain Iact, considering a common factor of emitted light distribution in the analysed suspension.

1 ex

FIELD: medicine.

SUBSTANCE: method involves cultivation of an obligate methanol-assimilating bacterium Methylophilus methylotrophus or Methylobacillus glycogens in a fluid medium with the bacterium secreting an end protein from a bacterial cell where said bacterium has a DNA structure containing a promoter sequence functioning in the methanol-assimilating bacterium, a nucleotide sequence coding a polypeptide containing a signal sequence which functions in the methanol-assimilating bacterium, and a sequence of the end protein functionally connected with the promoter sequence.

EFFECT: method allows producing the protein effectively by means of extracellular secretion, difficult-to-produce by means of secretory production with application of Escherichia coli bacteria.

5 cl, 7 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method provides test inoculation of a nutrient medium containing pancreatic fish flour hydolyzate, fermentative meat peptone, NaCl, Tween-80, CaCl2, sodium thiosulphate (Na2S2O3 × 5H2O), ferrous ammonium sulphate ((NH4)2SO4 × FeSO4 × 6H2O), sorbite, bromthymol blue, irgasan (DP-300), rifampicin, NaOH, agar and distilled water in the preset proportions. Pancreatic fish flour hydolyzate, peptone, NaCl, agar are dissolved with heating, sterilised at 121°C for 20 min and thereafter added in a hot medium of the other components specified above. The inoculations are incubated on the nutrient medium in aerobic conditions at temperature 37°C and/or 28°C for 24-48 h and assessed by the presence of black-centre green or dark grey colonies surrounded by a cloudy precipitate zone in the nutrient medium.

EFFECT: invention allows simplifying and providing higher specificity of Shewanella bacteria recovery and identification.

2 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains yeast water, beef hydrolyzate, sodium chloride, glucose, glycerin, sodium citrate, sodium metabisulphite and distilled water.

EFFECT: invention allows providing optimum conditions for brucellous microbe growth, replication in a transport nutrient medium at any distances.

3 ex

FIELD: medicine.

SUBSTANCE: strain of bacteria Bacillus thuringiensis BIOS-1 VKPM B-10709, possessing insectoacaricidal activity against representatives of leaf-eating and sucking pests, such as representatives of orders Lepidoptera, Coleoptera, Homoptera, Thysanoptera and Acariformes, doing harm to crops, is deposited in All-Russian collection of industrial microorganisms (VKPM), Federal State Unitary Enterprise GosNIIgenetika under number B-10709.

EFFECT: invention makes it possible to increase mortality of representatives of leaf-eating and sucking pests, doing harm to crops.

6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: there is offered a method of preparing the antibiotic Cephalosporin C. A new antibiotic producer Acremonium chrysogenum strain, RNCM No. F-4081D is used. Acremonium chrysogenum, RNCM No.F-4081D is cultivated on an enzymatic nutrient medium containing carbohydrate sources - glucose, corn starch, dextrin, nitrogen sources - a corn extract, Pharmamedia, ammonium sulphate, and also inorganic salts - potassium phosphate, potassium sulphate, chalk, copper sulphate, zinc sulphate, manganese sulphate, ferrous sulphate, and as vegetable fat - rapeseed oil and in addition a phosphatidylcholine and/or sitosterol.

EFFECT: twice increased antibiotic production level, reduced fermentation time.

1 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention can be used in producing nutrient mediums which create the optimum conditions of legionella activity. The nutrient medium contains a enzymatic hydrolyzate of a pig's lung, a enzymatic hydrolyzate of peanut, 1-substituted potassium phosphate, 2-substituted 3-aqueous potassium phosphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water.

EFFECT: invention allows reducing time for legionella detection.

3 ex

FIELD: medicine.

SUBSTANCE: avirulent Vibrio cholerae strain of biovar eltor of serovar Ogawa - a producer of a major protective O1 antigen of serovar Ogawa is produced in a simulation experiment of virulent natural V.cholerae M569 Ogawa strain by spontaneous loss of "СТХφ" prophage at cholera agent continuance in sterile river water. The strain is deposited in the State Collection of pathogenic bacteria "Microbe" Registration No. 262 of the Collection of Miscroorganisms. A feature of the strain is the absence of genes of a core region of "СТХφ" prophage. The strain is avirulent for suckling rabbits, agglutinated by cholera serums O1 and Ogawa in dilution exceeding a diagnostic titre.

EFFECT: use of the invention allows producing a vaccine of O1 protective antigen of serovar Ogawa providing immunity formation in cholera.

5 ex

FIELD: medicine.

SUBSTANCE: what is offered is a method for target nucleic acid (NA) detection providing a) NA sample enrichment by target sequences ensured by DNA-RNA hybrid formation between the NA-target and a probe complementary at least to its site, linkage of the produced hybrids with a solid carrier and removal of the NA both/either non-hybridised and/or non-linked with a substrate; b) amplification of the target NA enriched samples and target NA detection in the produced set with the help of an oligonucleotide complementary to a first target NA site, and a probe complementary to a second target NA site where an oligonucleotide sequence and a probe sequence form with the target NA the DNA-RNA hybrid detected by any of a set of common methods.

EFFECT: new method is high-sensitive and high-specific and enables to distinguish between high-homologous NA sequences.

22 cl, 19 tbl, 17 ex

FIELD: medicine.

SUBSTANCE: diagnostic technique for abnormal chromatin packing in male sterility is based on a quantitative estimation of chromatin hydrolysis depth in sperm nuclei immobilised on slides. Hydrolysis by micrococcal nuclease is followed by preparation washing from soluble chromatin. Chromatin DNA without hydrolysis by nuclease and after hydrolysis is stained by fluorochrome DAPI and examined for the distinctions in a degree of fluorescence of the initial and nuclease-processed samples. A check value is a nature of chromatin hydrolyzate of fertile donor sperm cells characterised by the spermogram values. The prepared images are analysed by comparing brightness of the sperm cell images, and the abnormal chromatin packaging is shown by DNA amount extracted by nuclease relatively to total DNA.

EFFECT: use of the declared technique allows simplifying diagnosing of male sterility within the therapies in extracorporeal fertilisation and homologous insemination programs.

6 cl, 1 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: method involves application of a diagnostic multiplex panel (DMP) designed for simultaneous identification of a set of possible microorganisms which can be found in a biological sample, with applying primer extension reaction to high conserved nucleotide sequences in sampled microorganisms. The biological sample is immobilised either on, or in a solid substratum in a first position, then transferred to the other position and extracted on the solid substratum so that to extract DNA of any microorganism which is found in the sample. It is followed by amplification of nucleic acid on the extracted DNA of microorganisms, then target sequences are mixed with primers with using the DMP. It results in genotyping of any microorganisms found and identifying of the required microorganisms. For implementation of the method, the diagnostic multiplex panel (DMP) applicable for genotyping of pathogenic microorganisms, and a testing kit for microorganisms is used.

EFFECT: use of the invention allows reliable selection of the biological samples and their testing, providing simultaneous testing of a set of microorganisms.

22 cl, 2 dwg, 3 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method provides contact of said cell with a peptide nucleic acid (PNA) molecule and a photosensitising agent and cell exposure to light at wave length effective to activate the photosensitising agent where said PNA molecule is conjugated with positive peptide. Also, there are described compositions containing such conjugated PNA molecules, the cells produced with the use of the method, and application of the method.

EFFECT: effective cell capture of peptide nucleic acid molecules conjugated with positive peptide.

37 cl, 13 dwg, 9 ex

FIELD: medicine.

SUBSTANCE: there is offered an improved method for recovery of protein expressed from an open reading frame 2 of porcine circovirus type 2. The method involves the stages of introduction of recombinant baculovirus containing coding sequences of the open reading frame 2, in an insect cell contained in a culture medium. It is followed by expression of the open reading frame 2 by baculovirus and recovery of the expressed protein from a supernatant. Recovery is carried out approximately from the 5th day following cell infection to enable significant amounts of the recombinant protein to be expressed and secreted from the cells in the culture medium.

EFFECT: such methods avoid expensive and labour-intensive recovery procedures requiring separation and recovery of the recombinant protein from an internal cell space.

32 cl, 3 dwg, 24 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: offered test system for quantitative determination of Streptococcus agalactiae includes species-specific primers having nucleotide sequences 5'-CAGTTGAATCCAAATGTTACGG-3' and 5'-TAATGCTGTTTGAAGTGCTG-3', and a probe having a nucleotide sequence 5'-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3'. A DNA target for specific amplification is a gene cfb Streptococcus agalactiae fragment between 685 and 762 nucleotide residues of its complete sequence.

EFFECT: invention allows quick and high-specific detection of Streptococcus agalactiae in samples of a biological material and determination of the definition of its quantitative content.

2 dwg, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method includes separation by centrifugation of heparinised mononuclear cells of umbilical blood (further UB) in gradient of density on Ficoll-Paque™PLUS. After that realised are thorough washing in PBS+0.1 % BSA medium and denaturation at temperature 82°C of suspension, consisting of UB cells and control cell culture 1301, supported in RPMI medium with addition of 10% bull serum of glutamine and penicillin with streptomycin. After that, analysed and control cells are distributed in two pairs of test tubes, adding to them up to 0.5 ml PBS 0.1% BSA solution, centrifuging with acceleration 500 g for 5 minutes. Then in two rest tubes with cells poured is hybridisation buffer, and into the second pair - poured is hybridisation buffer with peptide-nuclein probe. After that, they are incubated in darkness for 2-20 hours, washed, mixed, centrifuged, stained in solution of propidium-iodide and RNK A. After that, analysis of cell samples is carried out with determination of their relative length telomeres depending on length of telomeres of cell culture 1301, taking into account DNA index.

EFFECT: invention makes it possible to increase quality of determination of properties of transplant, samples of hemopoetic stem cells of umbilical blood for transplantation.

1 ex

FIELD: medicine.

SUBSTANCE: method of predicting development of arterial hypertension in pregnant women consists of realisation of DNA separation from peripheral venous blood, carrying out polymerase chain reaction, finding out data about presence of polymorphism of α-adducin 1 gene. If carrying genotype 460WW of gene of α-adducin 1 ADD1 G460W is detected, conclusion about risk of hypertension development in pregnant women is made.

EFFECT: increased efficiency of predicting arterial hypertension development in pregnant women.

1 ex, 1 tbl, 2 dwg

FIELD: medicine.

SUBSTANCE: invention represents primer sets for carrying out LIMP or PCR used for Saccharomyces pastorianus detection. Also, there are presented sets for Saccharomyces pastorianus detection containing a primer set according to the invention in a combination with a primer set for carrying out LAMP used for Saccharomyces bayanus detection, and also in a combination with a primer set for carrying out LAMP used for Saccharomyces cerevisiae and Saccharomyces pastorianus detection. There are presented methods for Saccharomyces pastorianus detection.

EFFECT: invention provides precise, quick and easy identification of Saccharomyces pastorianus yeast by means of PCR or LIMP.

19 cl, 4 dwg, 5 tbl, 4 ex

FIELD: medicine, psychiatry.

SUBSTANCE: one should isolate DNA out of lymphocytes of peripheral venous blood, then due to the method of polymerase chain reaction of DNA synthesis one should amplify the fragments of hSERT locus of serotonin carrier gene and at detecting genotype 12/10 one should predict the risk for the development of hallucino-delirious forms of psychoses of cerebro-atherosclerotic genesis.

EFFECT: more objective prediction of disease development.

3 ex

Up!