Nutrient medium for cultivation of paratuberculosis mycobacteria

FIELD: medicine.

SUBSTANCE: nutrient medium contains chicken eggs, 3-% extract of wood ash, 2-% water solution of malachite green and peat oxidate.

EFFECT: invention makes it possible to reduce term of paratuberculosis mycobacteria detection.

4 tbl, 9 ex

 

The invention relates to veterinary Microbiology, in particular to the cultivation of mycobacteria paratuberculosis.

Known nutritionally dense environment Dubo-Smith in the modification of the A.P. Alakaevoi (agricultural Animals. Methods of laboratory diagnostics of paratuberculosis GOST 26073-84 (ST SEV 3458-81). - Moscow, 1984 - p.8) for the cultivation of mycobacteria paratuberculosis containing one-deputizing potassium phosphate 1 g; disubstituted phosphate sodium 6.25 g; magnesium sulfate 0.01 g; calcium chloride 0.0005 g; zinc sulfate 0.0001 g; copper sulfate 0.0001 g; ammonium citrate iron 0.05 g; asparagine, 1 g; casein hydrolysate 80 cm3; mycobactin 20 cm3; distilled water to 1 liter; sterile not activated serum of cattle (normal) 20%; penicillin 50 IU/cm3environment.

The disadvantage of this environment is the long term growth of mycobacteria paratuberculosis.

The closest entity to the claimed solution is nutritionally dense Lowenstein-Jensen medium with the addition of mycobactin (Bulletin VIEW "Methods and means of diagnosis and control of tuberculosis, brucellosis and paratuberculosis farm animals". Moscow - VIP-74. - s), consisting of the following components: magnesium sulfate 0.25 g; sodium citrate 0.5 g; gelesen Yachnik alum 0.025 g; potassium phosphate one-deputizing - 10.0 g; ammonium citrate one-deputizing 2.5 g; glycocol 5 g; alcoholic extract M.phlei 20 ml; glycerol 2.5 ml; distilled water, and potato extract to a 250 ml; 16-18 eggs; 2%aqueous solution of malachite green 18 ml.

However, this dense nutrient medium does not allow the growth of M. paratuberculosis in shorter periods, and cooking mycobactin is a rather complicated process.

The task of the invention is to expand the Arsenal of nutrient media used for cultivation of Mycobacterium paratuberculosis.

The problem is solved in that a nutrient medium for cultivation of Mycobacterium paratuberculosis, including glycerol, 2%aqueous solution of malachite green, mineral salt, eggs, biologically active additives, according to the invention contains as a dietary Supplement oxidat peat and mineral-salt basics - hood wood ash, in the following ratio of components:

Chicken eggs4-5 pieces
3%extract ash wood100 ml
2%to the aqueous solution of malachite green 4 ml
Glycerin2.0 g
Oxidat peat2.0 g

The cooking medium is produced as follows.

Take 4-5 eggs, wash the brush with soap and water and treated with alcohol. With sterile forceps break the eggs and pour into a sterile flask with beads. The flask was shaken for several minutes after adding each egg until smooth. Add 4 ml of 2%aqueous solution of malachite green and introduced as a salt basics 100 ml of extract ash wood, to which was added 2.0 g of glycerol. As biologically active additives in the proposed environment further added oxidat peat (TU 88 BSSR 135-88). Filtered through a gauze filter, poured into 4-5 ml of medium in a test tube and roll (heated) at a temperature of 85°C for 30 min, the result is the denaturation of the protein and the environment becomes tight.

To study the informativeness and efficiency of the prepared environments they were sowing the following substances: a three-week standardized strain M.paratuberculosis (Central lyubinskiy); isolate obtained after sowing the treated biological material of cattle and the suspension obtained after processing Department tol is the intestine and lymph nodes of cattle. The biomaterial was processed by the method of the A.P. Alakaevoi ("Workshop on veterinary Microbiology" Ed. by Bayrak, VA, V.M. Belyaev, Gitelson SS and others - Moscow, 1980. - 62 C.). Culture of mycobacteria for planting standardized according to the turbidity standard 500 million cells/ml and seeded in a test tube with environments 1 ml of the resulting suspension.

Example 1. The environment is prepared as follows. 4-5 eggs, wash the brush with soap and water and treated with alcohol. With sterile forceps break the eggs and pour into a sterile flask with beads. The flask was shaken for several minutes after adding each egg until smooth. Add 4 ml of 2%aqueous solution of malachite green and introduced as a salt basics 100 ml of extract wood ash.

Hood wood ash is prepared by the following method: take 0.5 g ash, sifted through a sieve, add to 100 ml with distilled water, filtered through a cotton-gauze filter, then through the paper and autoclave at 1.5 ATM 30 minutes

Part hoods add 2.0 g of glycerol and 1.5 g of oxidate peat as a dietary Supplement.

Wednesday poured into 5 ml test tubes and roll in a special apparatus in an inclined position at t 85°C for 30 minutes. Due to clotting in the machine at high temperature the denaturation of the protein, and the environment becomes tight.

Example 2. Prepare CPE is in accordance with example 1 and add 2.0 g of oxidate peat.

Example 3. Prepare the environment in accordance with example 1 and add 2.5 g of oxidate peat

The timing of crop planting a standardized strain M.paratuberculosis; isolate M.paratuberculosis derived from biomaterials and biomaterial obtained from cattle, on media prepared in examples 1, 2 and 3, are presented in table 1.

From the table it follows that the optimal time of growth of a standardized strain M.paratuberculosis; isolate M.paratuberculosis derived from biomaterial and cultures of the biomaterial obtained from cattle received on the environment, stimulating ingredients which are of 0.5%extract of wood ash with the addition of 2.0 g of oxidate peat.

Example 4. The environment is prepared as follows. 4-5 eggs, wash the brush with soap and water and treated with alcohol. With sterile forceps break the eggs and pour into a sterile flask with beads. The flask was shaken for several minutes after adding each egg until smooth. Add 4 ml of 2%aqueous solution of malachite green and introduced as a salt basics 100 ml of extract wood ash.

Hood wood ash is prepared by the following method: take 1.5 grams of ashes, sifted through a sieve, add to 100 ml with distilled water, filtered through a cotton-gauze filter, then through the paper and carlavirus at 1.5 ATM 30 minutes

Part hoods add 2.0 g of glycerol and 1.5 g of oxidate peat as a dietary Supplement.

Wednesday poured into 5 ml test tubes and roll in a special apparatus in an inclined position at t 85°C for 30 minutes. Due to clotting in the machine at high temperature the denaturation of the protein, and the environment becomes tight.

Example 5. The environment is prepared in accordance with example 4 and add 2.0 g of oxidate peat.

Example 6. The environment is prepared in accordance with example 4 and add 2.5 g of oxidate peat.

The results of the test media prepared in examples 4, 5 and 6, are presented in table 2.

Studies have shown that the initial growth of a standardized strain M.paratuberculosis; isolate M.paratuberculosis derived from biomaterial and cultures of the biomaterial obtained from cattle, in a shorter time received on the environment, stimulating ingredients which are 1,5%extract of wood ash with the addition of 2.0 g of oxidate peat.

Example 7. The environment is prepared as follows. 4-5 eggs, wash the brush with soap and water and treated with alcohol. With sterile forceps break the eggs and pour into a sterile flask with beads. The flask was shaken for several minutes after adding each egg until smooth. Doba is given in 4 ml of 2%aqueous solution of malachite green and introduced as a salt basics 100 ml of extract wood ash.

Hood wood ash is prepared by the following method: take 3.0 g ash sifted through a sieve, add to 100 ml with distilled water, filtered through a cotton-gauze filter, then through the paper and autoclave at 1.5 ATM 30 minutes

Part hoods add 2.0 g of glycerol and 1.5 g of oxidate peat as a dietary Supplement.

Wednesday poured into 5 ml test tubes and roll in a special apparatus in an inclined position at t 85°C for 30 minutes. Due to clotting in the machine at high temperature the denaturation of the protein, and the environment becomes tight.

Example 8. The environment is prepared in accordance with example 7 and add 2.0 g of oxidate peat.

Example 9. The environment is prepared in accordance with example 7 and add 2.5 g of oxidate peat.

The results of the test media prepared in examples 7, 8 and 9, are presented in table 3.

From the data obtained it follows that the reduction of the appearance of primary and intensive growth of mycobacteria paratuberculosis happens when you use an experienced medium of the following composition: chicken eggs 4-5 pieces, 100 ml of 3%hoods ash wood, 4 ml of 2%aqueous solution of malachite green, 2.0 g of glycerin, 2.0 g of oxidate peat (example 8).

To establish the diagnostic value and effectiveness offers the experienced environment, we conducted a comparative analysis with known Lowenstein-Jensen medium with mycobactin. The results of the study are presented in table 4.

On the basis of the conducted researches it is established that the proposed nutrient medium, which includes mineral complex - hood of ash birch wood and biological additive in the form of oxidate peat, helps to stimulate the growth of mycobacteria paratuberculosis when planting a standardized strain M.paratuberculosis; isolate and biological material (lymph nodes and the Department of the colon).

Dense nutrient medium for cultivation of Mycobacterium paratuberculosis, including glycerol, 2%aqueous solution of malachite green, mineral salt, eggs, biologically active additives, characterized in that it contains as a dietary Supplement oxidat peat and mineral-salt basics - hood wood ash in the following ratio of components:

Chicken eggs, piece4-5
3%Hood wood ash, ml100
2%Aqueous solution of malachite green, ml4
Glycerin, g2,0
Oxidat peat, g2,0



 

Same patents:

FIELD: medicine.

SUBSTANCE: sample is prepared: an additional weight of nanocarbon forms is dispersed in 1 ml of organic solvents with a degree of polarity smaller than that of water - dimethyl sulphoxide or ethanol. Then it is mixed and exposed to ultrasound for 30 minutes. The prepared nanocarbon suspension is transferred in an aqueous medium to the final concentration of the used solvent 2.5 %. The produced and control samples are added with a viable sensor recombinant luminescent Escherichia coli K12 strain with cloned luxCDABE genes of luminescent Photobacterium leiognathi system. It is followed by incubation for 60 - 180 minutes, measuring luminous intensity and evaluating optical properties of the analysed suspension simultaneously. A toxicity index (T) is calculated with evaluating an actual luminous intensity of the strain (Iact) in comparison with the control of the same concentration of the solvent, considering light absorbing properties of the analysed suspension (D) and an experimental luminescence level of the bacterial luminescent biosensor (Iexp).

EFFECT: invention allows providing higher accuracy and sensitivity of nanocarbon biotoxicity analysis ensured by the introduction of a correction value - the actual luminous intensity of the strain Iact, considering a common factor of emitted light distribution in the analysed suspension.

1 ex

FIELD: medicine.

SUBSTANCE: method involves cultivation of an obligate methanol-assimilating bacterium Methylophilus methylotrophus or Methylobacillus glycogens in a fluid medium with the bacterium secreting an end protein from a bacterial cell where said bacterium has a DNA structure containing a promoter sequence functioning in the methanol-assimilating bacterium, a nucleotide sequence coding a polypeptide containing a signal sequence which functions in the methanol-assimilating bacterium, and a sequence of the end protein functionally connected with the promoter sequence.

EFFECT: method allows producing the protein effectively by means of extracellular secretion, difficult-to-produce by means of secretory production with application of Escherichia coli bacteria.

5 cl, 7 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method provides test inoculation of a nutrient medium containing pancreatic fish flour hydolyzate, fermentative meat peptone, NaCl, Tween-80, CaCl2, sodium thiosulphate (Na2S2O3 × 5H2O), ferrous ammonium sulphate ((NH4)2SO4 × FeSO4 × 6H2O), sorbite, bromthymol blue, irgasan (DP-300), rifampicin, NaOH, agar and distilled water in the preset proportions. Pancreatic fish flour hydolyzate, peptone, NaCl, agar are dissolved with heating, sterilised at 121°C for 20 min and thereafter added in a hot medium of the other components specified above. The inoculations are incubated on the nutrient medium in aerobic conditions at temperature 37°C and/or 28°C for 24-48 h and assessed by the presence of black-centre green or dark grey colonies surrounded by a cloudy precipitate zone in the nutrient medium.

EFFECT: invention allows simplifying and providing higher specificity of Shewanella bacteria recovery and identification.

2 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains yeast water, beef hydrolyzate, sodium chloride, glucose, glycerin, sodium citrate, sodium metabisulphite and distilled water.

EFFECT: invention allows providing optimum conditions for brucellous microbe growth, replication in a transport nutrient medium at any distances.

3 ex

FIELD: medicine.

SUBSTANCE: strain of bacteria Bacillus thuringiensis BIOS-1 VKPM B-10709, possessing insectoacaricidal activity against representatives of leaf-eating and sucking pests, such as representatives of orders Lepidoptera, Coleoptera, Homoptera, Thysanoptera and Acariformes, doing harm to crops, is deposited in All-Russian collection of industrial microorganisms (VKPM), Federal State Unitary Enterprise GosNIIgenetika under number B-10709.

EFFECT: invention makes it possible to increase mortality of representatives of leaf-eating and sucking pests, doing harm to crops.

6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: there is offered a method of preparing the antibiotic Cephalosporin C. A new antibiotic producer Acremonium chrysogenum strain, RNCM No. F-4081D is used. Acremonium chrysogenum, RNCM No.F-4081D is cultivated on an enzymatic nutrient medium containing carbohydrate sources - glucose, corn starch, dextrin, nitrogen sources - a corn extract, Pharmamedia, ammonium sulphate, and also inorganic salts - potassium phosphate, potassium sulphate, chalk, copper sulphate, zinc sulphate, manganese sulphate, ferrous sulphate, and as vegetable fat - rapeseed oil and in addition a phosphatidylcholine and/or sitosterol.

EFFECT: twice increased antibiotic production level, reduced fermentation time.

1 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention can be used in producing nutrient mediums which create the optimum conditions of legionella activity. The nutrient medium contains a enzymatic hydrolyzate of a pig's lung, a enzymatic hydrolyzate of peanut, 1-substituted potassium phosphate, 2-substituted 3-aqueous potassium phosphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water.

EFFECT: invention allows reducing time for legionella detection.

3 ex

FIELD: medicine.

SUBSTANCE: avirulent Vibrio cholerae strain of biovar eltor of serovar Ogawa - a producer of a major protective O1 antigen of serovar Ogawa is produced in a simulation experiment of virulent natural V.cholerae M569 Ogawa strain by spontaneous loss of "СТХφ" prophage at cholera agent continuance in sterile river water. The strain is deposited in the State Collection of pathogenic bacteria "Microbe" Registration No. 262 of the Collection of Miscroorganisms. A feature of the strain is the absence of genes of a core region of "СТХφ" prophage. The strain is avirulent for suckling rabbits, agglutinated by cholera serums O1 and Ogawa in dilution exceeding a diagnostic titre.

EFFECT: use of the invention allows producing a vaccine of O1 protective antigen of serovar Ogawa providing immunity formation in cholera.

5 ex

FIELD: medicine.

SUBSTANCE: avirulent Vibrio cholerae KM 263 strain of biovar eltor of serovar Inaba - a producer of a protective O1 antigen is produced in a simulation experiment of virulent natural V.cholerae M569 Inaba strain by spontaneous loss of "СТХφ" prophage at cholera agent continuance in sterile river water. The strain is characterised by a high production level of the major protective O1 antigen of serovar Inaba.

EFFECT: invention aims at preparing chemical cholera vaccines by formation of antibacterial cholera immunity, and producing purified preparation of the O1 antigen of serovar Inaba for a diagnostic serum preparation .

5 ex

FIELD: medicine.

SUBSTANCE: strain of microorganism Bacillus smithii TBMI12 MSCL P737 is resistant to metronidasole. Strain is applied as food or feed additive, and as component of probiotic compositions. Probiotic composition of said strain in form of endospores is applied as probiotic in order to perform antibacterial impact, colonise gastrointestinal tract and stimulate immune system, as antibacterial medication.

EFFECT: invention ensures resistance to diseases and prevention of bacterial infections with application of strain Bacillus smithii TBMI12 MSCL P737.

11 cl, 3 dwg

FIELD: food industry.

SUBSTANCE: method envisages preparation of an initial suspension represented by a bacterial starter for production of cheese or cultured milk products. The produced initial suspension is placed into a vacuum drier and dried in a mode of pressure modification from atmospheric level to a vacuum amount no less than 4.5 mm Hg during the first quarter of the whole drying process.

EFFECT: invention allows to enhance quality of the end product and reduce the period of its drying.

2 tbl, 2 dwg, 3 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to biotechnology and a Cupriavidus eutrophus VKPM B-10646 bacteria strain which produces polyhydroxy alkanoates (PHA) and a method of producing said strain. The strain is isolated from Ralstonia eutropha VKPM B-8562 during long multi-step selection based on effectiveness of synthesis of multicomponent PHA. PHA is obtained by culturing the strain in conditions of aeration and mixing on a liquid salt medium with limited nitrogen. The medium contains a growing substrate with an additional carbon source. The growing substrate used is glucose or fructose or 3-butyric acid or a gaseous mixture - hydrogen, oxygen and carbon dioxide, or synthetic gas mixed with oxygen. The additional carbon source used is a solution of potassium 3-valarate or solution of potassium 3-valerate and potassium 3-hexanoate, or solution of potassium 3-valerate, potassium 3-hexanoate and acrylate, or solution of potassium 3-valerate, or solution of potassium 3-hexanoate and acrylate, or solution of 3-butyric acid and 4-butyrolactone, or solution of 3-butyric acid, 4- butyrolactone and potassium 3-valerate, or solution of 3-butyric acid, 4- butyrolactone and potassium 3-hexanoate, or solution of 3-butyric acid, 4- butyrolactone, potassium 3-valerate and potassium 3-hexanoate.

EFFECT: invention enables to obtain polyhydroxy alkanoate producer with high output.

2 cl, 1 tbl, 15 ex

FIELD: medicine.

SUBSTANCE: synthetic nutrient medium for growing microorganisms contains citric acid, asparagine, potassium phosphate twice substituted, zinc sulfate, magnesium sulfate, iron sulfate, sodium chloride, sodium phosphate twice-substituted, glycine, succinic acid, distilled water and if necessary agar with specified component ratio.

EFFECT: invention makes it possible to increase nutritional properties of synthetic nutrient media.

2 cl, 1 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: method involves preliminary selection of concentration of a disinfectant solution at which bacteria exhibit partial sensitivity to said disinfectant. The bacteria are exposed to the disinfectant solution at the given concentration. Grown colonies of bacteria are collected after exposure to said disinfectant and then sown on a solid culture medium, followed by culturing at 37°C. Bacteria colonies isolated from those grown at the previous step are selected in amount of 1-299 colony-forming units (CFU/ml). The collected isolated colonies are resown on a culture medium and grown at conditions needed for growth of bacteria of that type, followed by dividing the grown colonies into two parts. One part of the grown bacteria colonies is exposed to the disinfectant at the selected concentration, and the other part is exposed to the disinfectant at bactericidal concentration. If upon exposure to the disinfectant at bactericidal concentration, there is no growth of bacteria or their growth ranges from 1 to 299 (CFU/ml), then the cycle of selecting bacteria grown at the previous step, their resowing on the culture medium, growing colonies of said bacteria at conditions needed for growth of said type of bacteria and exposing the grown colonies to the disinfectant at the selected and bactericidal concentrations is repeated once more until after exposing the column to the disinfectant solution at bactericidal concentration, growth of bacteria on the culture medium is equal to 300 (CFU/ml), which indicates bacterial resistance to the disinfectant.

EFFECT: invention enables to simulate bacterial resistance to a disinfectant, evaluate build-up of resistance and bactericidal potential of hospital strains to disinfectants during their practical use.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method provides test inoculation of a nutrient medium containing pancreatic fish flour hydolyzate, fermentative meat peptone, NaCl, Tween-80, CaCl2, sodium thiosulphate (Na2S2O3 × 5H2O), ferrous ammonium sulphate ((NH4)2SO4 × FeSO4 × 6H2O), sorbite, bromthymol blue, irgasan (DP-300), rifampicin, NaOH, agar and distilled water in the preset proportions. Pancreatic fish flour hydolyzate, peptone, NaCl, agar are dissolved with heating, sterilised at 121°C for 20 min and thereafter added in a hot medium of the other components specified above. The inoculations are incubated on the nutrient medium in aerobic conditions at temperature 37°C and/or 28°C for 24-48 h and assessed by the presence of black-centre green or dark grey colonies surrounded by a cloudy precipitate zone in the nutrient medium.

EFFECT: invention allows simplifying and providing higher specificity of Shewanella bacteria recovery and identification.

2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, and concerns a lactic bacteria Lactobacillus reuteri DSM 17938 strain stimulating IL-10 production and hence CD4+CD25+TR-cell proliferation used for making a probiotic product. The probiotic product contains Lactobacillus reuteri DSM 17938 strain and additionally medium-chain triglyceride oil.

EFFECT: use of the probiotic product promoted a favorable effect on intestinal colic in a newborn baby.

3 cl, 3 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: inoculate contains in a mixture or in a combination, main L-cystein of formula HSCH2CH(NH2)CO2H and at least one B.animalis lactis strain. Said cysteine and at least one B.animalis lactis strain are contained or have the form of at least one frozen granule and/or at least one lyophilizate. The pH value of the solution produced by thawing of at least one granule and/or dissolution, of at least one lyophilizate in the relation making 1 to 2 g of the lyophilizate per 8-10 ml of H2O, makes at least 4. L-cysteine contains in the inoculate in an amount within 1 g per 1·1014 CFU to 1 g per 3.5·1010 CFU, of at least one B.animalis lactis strain or all used B.animalis lactis strains whereas the same are numerous. Using the offered inoculate provides stimulation of B.animalis lactis growth and/or metabolism on a lactic substratum to produce a fermented diary product.

EFFECT: high probiotic value of the product.

21 cl, 9 dwg, 3 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains yeast water, beef hydrolyzate, sodium chloride, glucose, glycerin, sodium citrate, sodium metabisulphite and distilled water.

EFFECT: invention allows providing optimum conditions for brucellous microbe growth, replication in a transport nutrient medium at any distances.

3 ex

FIELD: medicine.

SUBSTANCE: strain of bacteria Bacillus thuringiensis BIOS-1 VKPM B-10709, possessing insectoacaricidal activity against representatives of leaf-eating and sucking pests, such as representatives of orders Lepidoptera, Coleoptera, Homoptera, Thysanoptera and Acariformes, doing harm to crops, is deposited in All-Russian collection of industrial microorganisms (VKPM), Federal State Unitary Enterprise GosNIIgenetika under number B-10709.

EFFECT: invention makes it possible to increase mortality of representatives of leaf-eating and sucking pests, doing harm to crops.

6 tbl, 2 ex

FIELD: biotechnology, microbiology, medicine.

SUBSTANCE: invention relates to the strain Lactobacillus paracasei CNCM I-2116 used for diarrhea prophylaxis causing by pathogenic microorganisms. Supernatant of this strain culture elicits ability to prevent colonization of intestine with pathogenic microorganisms causing diarrhea also and this strain is designated for preparing agent used for prophylaxis and/or treatment of disorders associated with diarrhea. Agent for oral administration represents therapeutically effective dose of the strain L. paracasei CNCM I-2116 or supernatant of its culture and acceptable foodstuff. Invention provides the enhanced viability of the strain in its applying and effectiveness in prophylaxis of adhesion to intestine cells and invasion to intestine cells of pathogenic microorganisms causing diarrhea.

EFFECT: valuable medicinal properties of strain.

5 cl, 8 dwg, 10 ex

Up!