Nucleic acid detection by method based on target-specific hybrid linkage

FIELD: medicine.

SUBSTANCE: what is offered is a method for target nucleic acid (NA) detection providing a) NA sample enrichment by target sequences ensured by DNA-RNA hybrid formation between the NA-target and a probe complementary at least to its site, linkage of the produced hybrids with a solid carrier and removal of the NA both/either non-hybridised and/or non-linked with a substrate; b) amplification of the target NA enriched samples and target NA detection in the produced set with the help of an oligonucleotide complementary to a first target NA site, and a probe complementary to a second target NA site where an oligonucleotide sequence and a probe sequence form with the target NA the DNA-RNA hybrid detected by any of a set of common methods.

EFFECT: new method is high-sensitive and high-specific and enables to distinguish between high-homologous NA sequences.

22 cl, 19 tbl, 17 ex

 

The text descriptions are given in facsimile form.

1. Method of detecting at least one nucleic acid target, comprising:
a) the formation of many enriched nucleic acid targets, including:
i) mixing at least one nucleic acid target with a nucleic acid probe complementary to at least a section of at least one nucleic acid target, for the formation of DNA-RNA hybrid target, and if the nucleic acid target is RNA, the probe is DNA, and if the nucleic acid target is DNA, the probe is RNA;
ii) binding of the DNA-RNA guy is reed-target on a solid medium; and
iii) remove any nucleic acid that does not form a DNA-RNA hybrid, target, or which is not bound on a solid medium for the formation of many of the enriched nucleic acid target;
b) amplificatoare many enriched nucleic acid targets from stage a) for formation of set of amplified targets; and
c) detection of at least one nucleic acid target in the set of amplified targets when
i) mixing a variety amplified targets chosen by the oligonucleotide and nucleic acid probe, and select oligonucleotide hybridizes with the first section of the amplified targets and nucleic acid probe is complementary to the second portion of the amplified targets, and if amplificatory the target is DNA, then select the oligonucleotide and nucleic acid probes are RNA, and if amplificatory the target is RNA, then select the oligonucleotide and the nucleic acid probe is DNA to form a complex of the DNA-RNA hybrid target /oligonucleotide/ probe; and
ii) detection of complex DNA-RNA hybrid target /oligonucleotide/ probe by the DNA-RNA hybrid-specific binding agent, for detecting at least one nucleic acid target.

2. The method according to claim 1, in which to study the binding of (a) a solid carrier anywhereman with DNA-RNA hybrid-specific binding agent, thereby linking at least one nucleic acid target on a solid medium.

3. The method according to claim 1, in which the DNA-RNA hybrid-specific binding agent selected from the group consisting of a DNA-RNA hybrid-specific antibodies, monoclonal or polyclonal antibodies or their fragments, protein catalytically inactive ribonuclease H, nucleic acid, aptamer nucleic acid and the oligonucleotide and the DNA-RNA hybrid-specific binding agent binds to DNA-RNA hybrid with the formation of a triplex structure.

4. The method according to claim 2, in which the DNA-RNA hybrid-specific binding agent is a DNA-RNA hybrid-specific antibody.

5. The method according to claim 2, in which the DNA-RNA hybrid-specific binding agent is a nucleic acid probe complementary to the nucleic acid target.

6. The method according to claim 3, in which the DNA-RNA hybrid-specific binding agent Machen detectable label.

7. The method according to claim 6, in which the label is detectable by colorimetry, chemiluminescence, fluorescence or light scattering.

8. The method according to claim 1, in which amplificatoare is isothermal amplification.

9. The method according to claim 8, in which DNA polymerase is used in isothermal amplification.

10. The method according to claim 8, in which the random primers used is used in the isothermal amplification.

11. The method according to claim 10, in which the random primers are pentamerone.

12. The method according to claim 10, in which random primers contain a subpopulation of sequences of primers specific for the disease.

13. The method according to claim 1, in which the selected oligonucleotides are associated with a solid carrier.

14. The method according to claim 1, wherein the solid carrier is selected from the group consisting of a tablet, microplate, microtiter tablet, slides, cups, microsilica, particles, microparticles, glass, wire, chip, microchip, strips, membranes, chips and tubes.

15. The method according to 14, in which the solid carrier is made from a material selected from the group consisting of glass, silicon, plastic, polystyrene, polyethylene, polypropylene and polycarbonate.

16. The method according to 14, in which the solid support is modified for the content of carboxyl, amino, hydrazide, aldehyde group, a nucleic acid or nucleotide derivative, a primary amino group or dye.

17. The method according to claim 1, additionally comprising adding probe-blocker.

18. The method of detection of each of the at least one nucleic acid target, comprising:
(a) hybridization of at least one nucleic acid target with a nucleic acid probe complementary to at least a section of nucleic sour the s-target for the formation of DNA-RNA hybrid target, and if the nucleic acid target is RNA, the probe is DNA, and if the nucleic acid target is DNA, the probe is RNA;
b) binding of the DNA-RNA hybrid-target DNA-RNA hybrid-specific antibody conjugated to a solid carrier;
c) separating unbound nucleic acid target from the captured DNA-RNA hybrid target;
d) amplificatoare associated DNA-RNA hybrid target for formation of set of amplified targets, and amplificatori using random primers and DNA polymerase;
e) the hybridization of the nucleic acid probe complementary to the first sector of the amplified targets for the formation of the amplified hybrid DNA-RNA;
f) hybridization of the oligonucleotide conjugated to a solid carrier with a second area of the amplified hybrid DNA-RNA, and the solid carrier is selected;
g) selecting the amplified hybrid DNA-RNA using select solid carrier; and
h) detecting at least one amplified nucleic acid target by binding DNA-RNA hybrid-specific binding agent with amplified hybrid DNA-RNA, and the presence of the amplified hybrid DNA-RNA indicates the presence of nucleic acid-m is Sheni.

19. The method according to p, in which the solid support conjugated with oligonucleotides, is distinguishable by microsilica.

20. The method according to claim 19, in which the distinct microsort has detektiruya label selected from the group consisting of a fluorescent label, gold label and an enzymatic label.

21. Multiplex method of detecting at least one of target DNA, including:
(a) hybridization of at least one of target DNA, at least one first RNA probe that is complementary to at least a section of at least one DNA-mirzaii, for forming at least one DNA-RNA hybrid;
b) associating at least one DNA-RNA hybrid, at least one DNA-RNA hybrid-specific antibody conjugated with microsilica;
c) separating unbound nucleic acids from at least one DNA-RNA hybrid for forming at least one enriched target;
d) amplificatoare at least one enriched DNA target for forming at least one amplified DNA targets using random primers and DNA polymerase;
e) a second hybridization RNA probe complementary to the first sector of amplified DNA target to form amplified DNA-RNA hybrid;
f) hybridization of DNA oligonu is leotide with the second plot amplified(s) of target DNA(s), moreover, DNA-oligonucleotide anywhereman at least one selectable microsilica; and
(g) detection of at least one amplified DNA target by binding DNA-RNA hybrid-specific antibodies with amplified DNA-RNA hybrid and a selection of amplified target based on specific choose microsilica.

22. The method according to claim 1, wherein the nucleic acid target is HPV nucleic acid, and nucleic acid probe complementary to at least a section of the nucleic acid target, include a sequence selected from SEQ ID NO:36-56, and the sequence of the oligonucleotides comprise a sequence selected from SEQ ID NO:66-124.



 

Same patents:

FIELD: medicine.

SUBSTANCE: diagnostic technique for abnormal chromatin packing in male sterility is based on a quantitative estimation of chromatin hydrolysis depth in sperm nuclei immobilised on slides. Hydrolysis by micrococcal nuclease is followed by preparation washing from soluble chromatin. Chromatin DNA without hydrolysis by nuclease and after hydrolysis is stained by fluorochrome DAPI and examined for the distinctions in a degree of fluorescence of the initial and nuclease-processed samples. A check value is a nature of chromatin hydrolyzate of fertile donor sperm cells characterised by the spermogram values. The prepared images are analysed by comparing brightness of the sperm cell images, and the abnormal chromatin packaging is shown by DNA amount extracted by nuclease relatively to total DNA.

EFFECT: use of the declared technique allows simplifying diagnosing of male sterility within the therapies in extracorporeal fertilisation and homologous insemination programs.

6 cl, 1 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: method involves application of a diagnostic multiplex panel (DMP) designed for simultaneous identification of a set of possible microorganisms which can be found in a biological sample, with applying primer extension reaction to high conserved nucleotide sequences in sampled microorganisms. The biological sample is immobilised either on, or in a solid substratum in a first position, then transferred to the other position and extracted on the solid substratum so that to extract DNA of any microorganism which is found in the sample. It is followed by amplification of nucleic acid on the extracted DNA of microorganisms, then target sequences are mixed with primers with using the DMP. It results in genotyping of any microorganisms found and identifying of the required microorganisms. For implementation of the method, the diagnostic multiplex panel (DMP) applicable for genotyping of pathogenic microorganisms, and a testing kit for microorganisms is used.

EFFECT: use of the invention allows reliable selection of the biological samples and their testing, providing simultaneous testing of a set of microorganisms.

22 cl, 2 dwg, 3 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method provides contact of said cell with a peptide nucleic acid (PNA) molecule and a photosensitising agent and cell exposure to light at wave length effective to activate the photosensitising agent where said PNA molecule is conjugated with positive peptide. Also, there are described compositions containing such conjugated PNA molecules, the cells produced with the use of the method, and application of the method.

EFFECT: effective cell capture of peptide nucleic acid molecules conjugated with positive peptide.

37 cl, 13 dwg, 9 ex

FIELD: medicine.

SUBSTANCE: there is offered an improved method for recovery of protein expressed from an open reading frame 2 of porcine circovirus type 2. The method involves the stages of introduction of recombinant baculovirus containing coding sequences of the open reading frame 2, in an insect cell contained in a culture medium. It is followed by expression of the open reading frame 2 by baculovirus and recovery of the expressed protein from a supernatant. Recovery is carried out approximately from the 5th day following cell infection to enable significant amounts of the recombinant protein to be expressed and secreted from the cells in the culture medium.

EFFECT: such methods avoid expensive and labour-intensive recovery procedures requiring separation and recovery of the recombinant protein from an internal cell space.

32 cl, 3 dwg, 24 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: offered test system for quantitative determination of Streptococcus agalactiae includes species-specific primers having nucleotide sequences 5'-CAGTTGAATCCAAATGTTACGG-3' and 5'-TAATGCTGTTTGAAGTGCTG-3', and a probe having a nucleotide sequence 5'-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3'. A DNA target for specific amplification is a gene cfb Streptococcus agalactiae fragment between 685 and 762 nucleotide residues of its complete sequence.

EFFECT: invention allows quick and high-specific detection of Streptococcus agalactiae in samples of a biological material and determination of the definition of its quantitative content.

2 dwg, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method includes separation by centrifugation of heparinised mononuclear cells of umbilical blood (further UB) in gradient of density on Ficoll-Paque™PLUS. After that realised are thorough washing in PBS+0.1 % BSA medium and denaturation at temperature 82°C of suspension, consisting of UB cells and control cell culture 1301, supported in RPMI medium with addition of 10% bull serum of glutamine and penicillin with streptomycin. After that, analysed and control cells are distributed in two pairs of test tubes, adding to them up to 0.5 ml PBS 0.1% BSA solution, centrifuging with acceleration 500 g for 5 minutes. Then in two rest tubes with cells poured is hybridisation buffer, and into the second pair - poured is hybridisation buffer with peptide-nuclein probe. After that, they are incubated in darkness for 2-20 hours, washed, mixed, centrifuged, stained in solution of propidium-iodide and RNK A. After that, analysis of cell samples is carried out with determination of their relative length telomeres depending on length of telomeres of cell culture 1301, taking into account DNA index.

EFFECT: invention makes it possible to increase quality of determination of properties of transplant, samples of hemopoetic stem cells of umbilical blood for transplantation.

1 ex

FIELD: medicine.

SUBSTANCE: method of predicting development of arterial hypertension in pregnant women consists of realisation of DNA separation from peripheral venous blood, carrying out polymerase chain reaction, finding out data about presence of polymorphism of α-adducin 1 gene. If carrying genotype 460WW of gene of α-adducin 1 ADD1 G460W is detected, conclusion about risk of hypertension development in pregnant women is made.

EFFECT: increased efficiency of predicting arterial hypertension development in pregnant women.

1 ex, 1 tbl, 2 dwg

FIELD: medicine.

SUBSTANCE: invention represents primer sets for carrying out LIMP or PCR used for Saccharomyces pastorianus detection. Also, there are presented sets for Saccharomyces pastorianus detection containing a primer set according to the invention in a combination with a primer set for carrying out LAMP used for Saccharomyces bayanus detection, and also in a combination with a primer set for carrying out LAMP used for Saccharomyces cerevisiae and Saccharomyces pastorianus detection. There are presented methods for Saccharomyces pastorianus detection.

EFFECT: invention provides precise, quick and easy identification of Saccharomyces pastorianus yeast by means of PCR or LIMP.

19 cl, 4 dwg, 5 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: what is presented is a method for Apo2L/TRAIL sensitivity prediction of a malignant tissue or cell sampled from a mammal, involving the stages as follows: sampling a malignant tissue or cell from a mammal; analysing the sample malignant tissue or cell for detecting expression of one or more biomarkers selected from a group of fucosyl transferase 3, fucosyl transferase 6, sialyl-Lewis A and/or X antigen (antigens) where expression of one or more specified biomarkers is an indicator of the fact that the specified sampled tissue or cell is sensitive to apoptosis-inducing activity Apo2L/TRAIL. Also, what is described is a method of apoptosis induction in the sampled malignant tissue or cell of a mammal. What is offered is a method of treating a malignant tumour in a mammal. The inventions enables using the detection of expression of one or more biomarkers as the indicator of the fact that a sample is sensitive to apoptosis-inducing agents, such as Apo2L/TRAIL and DR5 agonist antibodies. Specific biomarkers to be examined include fucosyl transferases, particularly fucosyl transferase 3 (FUT3) and/or fucosyl transferase 6 (FUT6), as well as sialyl-Lewis A and/or X antigens.

EFFECT: method improvement.

35 cl, 22 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: what is offered is a method for producing high-polymer yeast RNA of used beer yeast. Used beer yeast concentrated by centrifugation is suspended in an aqueous solution of oleic acid titrated by alkali to pH 7-8. The suspension is kept at 98-102°C for 40-60 minutes. The hot lysate is settled for 20-24 h at room temperature. A supernatant is poured out with using a siphon. Then NaCl is added to the poured out liquid to the concentration 2-3 M. The suspension is kept for 20-96 h at room temperature. Then it is centrifuged without cooling in a low-speed centrifuge. The prepared cakes are consistently washed out in the NaCl solution 2-3 M and 92-96% ethanol by resuspension at room temperature and low-speed centrifugation.

EFFECT: invention promotes spread-out of the raw-material base and simplification of the high-polymer RNA technology.

1 ex

FIELD: chemistry.

SUBSTANCE: disclosed is a preparation of high-polymer RNA from baker's yeast. The high-polymer RNA is extracted using sodium dodecyl sulphate. RNA is salted out with sodium chloride. Washing is carried out at low centrifuging rate of 1000 - 3000 g for 10 minutes without cooling.

EFFECT: obtained preparation is free from impurity association of RNA with proteins and polysaccharide and has narrow-directed stimulation of hemapoiesis.

1 dwg

FIELD: medicine.

SUBSTANCE: method implies using a Bacillus bacterium modified in such a manner that it contains an inactivated gene coding 3-hexulose-6-phosphatesynthase. The method involves cultivation of said bacterium in a nutrient medium. It is followed by recovery of said purine nucleoside from a culture fluid.

EFFECT: invention allows increasing production of purine nucleosides, such as inosine, xanthosine, guanosine or adenosine.

9 cl, 2 dwg, 2 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: present invention can be used during DNA diagnostics in medicine, veterinary, sanitary and epidemiological analysis and in criminalistics to identify criminals. The method of amplifying specific nucleic acid fragments employs thermally stable DNA polymerase having chain-displacement activity. Also, the present method employs direct and reverse primers in form of head-to-tail arranged tandem recurrent sequences of the main primer. The present invention enables to amplify specific DNA or RNA fragments with increasing multiplication factor for each cycle.

EFFECT: shorter reaction time and high sensitivity of the reaction.

4 cl, 8 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: amplification of target products in carried out in special DNA thermocycler, provided with a special reaction thermal unit. Said thermocycler provides in reaction vessels, which are represented by standard polypropylene test tubes, temperature ingredients, oriented at angle to direction of gravitation action. Time of said amplification constitutes 1-5 minutes.

EFFECT: invention makes it possible to accelerate PCN by means of convection and simplify its carrying out preserving high specificity.

4 cl, 2 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: claimed is method of postnatal DNA-diagnostics of mucoviscidosis. 14 most significant mutations 1677delTA, W1282X (R), 2143delT, G542X, R553X, G551D, 2184InsA, N1303K, 394DelTT, R334W, R347P, CFTR del21kb, delF508 in gene of mucoviscidosis CFTR are analysed. Method includes multiplex amplification of gene mutation populations in clinical sample of DNA by two-stage nested polymerase chain reaction (PCR) with application of selected set of primers.

EFFECT: invention makes it possible to diagnose presence of mucoviscidosis with high accuracy, due to simultaneous analysis of several mutations at a time.

4 dwg, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method includes alkaline lysis of bacterial cells and depositing of cellular walls by centrifugation. Afterwards supernatant is filtered, and RNA admixture is removed from produced filtrate by means of filtrate treatment with RNA-ase. Then plasmid DNA is deposited with isopropyl alcohol. Then divisional fractioning of plasmid DNA is carried out with ethyl alcohol, when first ethyl alcohol is added to solution of plasmid DNA to concentration of 45-53%, then ethyl alcohol is added to concentration of 55-58%, and in the end ethyl alcohol is added to concentration of 60-67%. Afterwards lipopolysaccharide remains are removed with the help of reverse-phase sorbent with hydrophobised surface.

EFFECT: improved cleanliness and yield of plasmid DNA.

3 cl, 1 tbl, 4 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, in particular to extraction of physiologically active compounds and can be used in medicine. Dry yeast is suspended in a 1-2% aqueous solution of oleic acid titrated with an alkali to pH 7-8. The suspension is kept at 99-102°C for 40-60 minutes. Lysate cooled to 35-45°C is centrifuged without cooling. The supernatant fluid is discharged and NaCl is added to the discharged fluid until achieving concentration of 2-3 M. The suspension is kept for 20-24 hours at room temperature and centrifuged without cooling. Low-polymeric RNA is extracted from the obtained supernatant and the precipitate-extraction cake is washed with two portions of 2-3 M solution of NaCl and with four portions of 92-97% ethanol via successive resuspension at room temperature and centrifuging. High-polymeric RNA is extracted from the obtained extraction cake using distilled water and then dried using a conventional method. Ethanol is reclaimed through distillation. Natural oligoribonucleotides are extracted from the low-polymeric RNA through gel filtration on Sepharose-4B.

EFFECT: invention enables to obtain high-polymeric RNA with considerably high molecular weight as a result of using dry baker's yeast without preliminary soaking or using high temperature.

5 cl, 1 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: oligonucleotide with double specificity for synthesis of nucleic acid molecule in elongation reaction on matrix has the following general formula: 5'-Xp-Yq-Zr-3'. Method of obtaining oligonucleotide with double specificity includes selection of sequence of target nucleic acid. After that constructing of sequence of oligonucleotide, which contains hybridisation sequence and separating section, containing at least three universal bases, so that hybridisation section penetrates enters hybridisation sequence, producing in said oligonucleotide three sections. After that location of separating section in said nucleotide is determined.

EFFECT: claimed invention allows to carry out matrix-depending reactions with much higher specificity.

28 cl, 13 dwg, 1 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: method of high-polymeric RNA manufacture from yeast includes yeast slurring in 1-2% aqueous solution of oleic acid titrated with alkali up to pH 7-8 followed by suspension's long simmering. Hot lysate is precipitated for 22 hours at room temperature. High-polymeric RNA is precipitated from supernatant with sodium chloride; extracted cake, containing high-polymeric RNA is flushed subsequently with 2 doses of 3 M solution of sodium chloride and 5 doses of 94% ethanol by resuspending at room temperature followed by low-speed centrifugation.

EFFECT: possibility to obtain target product - high-polymeric RNA.

1 ex

FIELD: biotechnology.

SUBSTANCE: nucleic acids are extracted from biomass in the presence of hydrogen peroxide in the low concentration as retaining substance. Obtained extract is treated with proteolytic enzyme and RNA is precipitated with acid in the presence of calcium salt. Purification of product is carried out with aqueous solutions of acetone and calcium and sodium chlorides followed by purification of sodium nucleate with an aqueous-acetone solution in the presence of activated carbon. Invention provides elevating yield of the end product and to improve its quality. Invention can be used for preparing sodium nucleate from baking yeast.

EFFECT: improved preparing method.

1 ex

Up!