Method of nanocarbon analysis for biotoxicity

FIELD: medicine.

SUBSTANCE: sample is prepared: an additional weight of nanocarbon forms is dispersed in 1 ml of organic solvents with a degree of polarity smaller than that of water - dimethyl sulphoxide or ethanol. Then it is mixed and exposed to ultrasound for 30 minutes. The prepared nanocarbon suspension is transferred in an aqueous medium to the final concentration of the used solvent 2.5 %. The produced and control samples are added with a viable sensor recombinant luminescent Escherichia coli K12 strain with cloned luxCDABE genes of luminescent Photobacterium leiognathi system. It is followed by incubation for 60 - 180 minutes, measuring luminous intensity and evaluating optical properties of the analysed suspension simultaneously. A toxicity index (T) is calculated with evaluating an actual luminous intensity of the strain (Iact) in comparison with the control of the same concentration of the solvent, considering light absorbing properties of the analysed suspension (D) and an experimental luminescence level of the bacterial luminescent biosensor (Iexp).

EFFECT: invention allows providing higher accuracy and sensitivity of nanocarbon biotoxicity analysis ensured by the introduction of a correction value - the actual luminous intensity of the strain Iact, considering a common factor of emitted light distribution in the analysed suspension.

1 ex

 

The technical field to which the invention relates.

The invention relates to the field of toxicology and hygienic measurement technologies, and in particular to methods of measurement and testing with the use of viable microorganisms.

In particular, the invention is intended for determination of biological activity (biotoxicity) nanoglide, structured in the form of nanotubes or fullerenes. The task of testing biotoxicity similar objects is determined by the fact that, due to their small dimension and large specific surface area nanomaterials may have different biological (including toxic) properties than substance in the usual physico-chemical status. In this regard, the need for a comprehensive Toxicological evaluation of each individual nanomaterial incorporated into the Concept of Toxicological research, methodology, risk assessment, methods of identification and quantification of nanomaterials", approved by resolution of the Chief state sanitary physician of Russian Federation from October 31, 2007, №79.

Thus, the inventive method is intended for use in research centers and environmental toxicology, as well as the laboratories of the centers of hygiene, sanitation and epidemiology and specifications the selected services of the Federal bodies of Executive power, implementing departmental sanitary-and-epidemiologic supervision in the sphere of consumer rights protection and human welfare.

The level of technology

The use of nanotechnology and nanomaterials is one of the most intriguing areas of science and technology in the twenty-first century. To date, the world is already registered and issued more than 1,800 types of nanomaterials (i.e. structures in the size range up to 100 nanometers). Given that in the future it is expected close contact with nanomaterials, the study of the potential risks of their use seems to be paramount. Currently, such research has been started in the United States (FDA), the European Union, as well as in a number of international organizations (who, FAO, ILSI).

Increased attention to this problem is determined by the fact that nanomaterials may have different physico-chemical properties and biological activity than the same substance in the form of solid phases or macroscopic dispersion. Accordingly, they belong to a fundamentally new types of materials and products characterization of potential risk to human health and condition of the habitat in all cases is required.

The first study of biological activity of nanoparti were linked to and the use of the object of exposure of laboratory animals - mice, rats and rabbits. However, the results proved to be quite controversial, and not so much answer the questions as prompted many new ones. So in the works [1, 2] reported on the potential toxicity of carbon nanotubes in the aerosol application, leading to the formation of specific lung granulomas. Similar effects were found in the work [3] for cutaneous application of nanoparti that was also accompanied by the formation of granulomas and changes in peripheral blood cells, although not led to the development of lethal effects in the whole range of studied concentrations. On the other hand, in [4] reported limited reactivity of carbon nanomaterials and positive health effects of carbon nanotubes in bone tissue regeneration. In turn, in [5], it is concluded that the very low toxicity of carbon nanomaterials high degree of purification.

From the point of view of the applicant, the reason for this uncertainty lies not only in the extraordinary diversity of carbon nanomaterials, but also that the study of their effects in complex biological systems was not preceded by testing more clearly reacting molecular and cell models with the formation of the basic ideas about the nature of the biological and the efficiency of nanoparti.

An invaluable role in the solution of this problem can be played by microorganisms with a high degree of biochemical similarities with higher organisms and due to this, showing significant correlation between the scores of biotoxicity with results obtained using more complex models. In the words of Nobel laureate 1965 Jacques Lucien Mono (Jacques Lucien Monod): "What is true for the bacteria Escherichia coli is true for the elephant". In the end, the simplicity of the organization, a high rate of metabolism and energy, as well as some other physiological features make the bacteria most convenient and widely used tool for biotesting.

Among the used touch microorganisms one of the most popular options are y (spontaneously luminous) bacteria, which is explained by the following main points: 1) the enzyme system generate a glow of such bacteria is tightly integrated with the main energy flows bacterial cells, and therefore it quickly and sensitively to change their activity when exposed to toxic substances; 2) the intensity of illumination can precisely be measured in real time, allowing you to quickly and accurately determine the parameters of biotoxicity a large number analyzer the controlled trial [6].

The most common system in the world for bioluminescent biotesting is "Microtox"produced by AZUR Environmental (USA) and incorporating lyophilized y marine bacteria species Vibrio fischeri strain NRRL B-11177 [7]. Technology for biotesting with its use fixed ISO # 11348 "Water Quality - Determination of the Inhibitory Effect of Water Samples on the Light Emission of Vibrio fischeri (Luminescent Bacteria Test)".

The principle of the method consists in forming the touch of the microorganism of the analyzed sample and the control (without toxicant) sample. The environmental features of Vibrio fischeri, in natural conditions, living in sea water, necessitates the inclusion in the analyzed sample of NaCl to a final concentration of 2-3%, and the creation of a control sample based on purified (distilled) water with the same NaCl. After 30 minutes (Express version 5-minute) incubation measure the intensity of illumination in the experimental (Iabout) and control (Ito) cells with use of special recording device - bioluminometer, and calculate the coefficients of the toxicity of the sample (7) by the formula T=((Ito-Iabout)/Ito)×100%, where Ito- the intensity of the glow in the control cell, Iaboutthe intensity of Ocenia in the experimental cell. The magnitude of T<20% characterize the sample as non-toxic, T from 20 to 50% as toxic and T≥50% as highly toxic.

For more than 20 years using the test-system "Microtox" positively proved itself to research quality industrial, sewage and natural waters, soils and sediments, as well as determine the degree of toxicity of newly synthesized chemical compounds and pharmaceuticals. In particular, available for the use of computer database Computox" (Environment Canada), containing certain using Toxicological values AS exceeds 1500 names of chemical substances.

However, dissemination of this method to assess biotoxicity nanoglide forced to admit the existence of significant limitations.

The first of them is the difficulty of creating sedimentation and aggregately stable suspensions of nanoparti in water and, especially, in the presence of accelerating the coagulation of the electrolyte (2-3% NaCl). The consequence of this is the lack of intensity of the touch of the microorganism under test particles nanoglide, leading to the reduction or complete absence of its impact on the level of bioluminescence. So conducted using the test system Microtox" investigation of single-walled carbon nanotubes and C60-f is therenow [8, 9] evaluated the data connection nanoglide as non-toxic, which were in conflict with the results of studies based on other methods of assessing toxicity.

A partial solution to this problem can be achieved by replacing the marine bacterium Vibrio fischeri on freshwater y microorganisms, in particular a recombinant strain of Escherichia coli K12 TG1 with cloned luxCDABE genes Photobacterium leiognathi, manufactured in the Russian Federation under the commercial name "Ecolum" [10]. The need for such change is determined by eliminating the need for inclusion in the analyzed samples of additional quantities of NaCl with the appropriate use of quality control chemically pure distilled water with no other significant differences in the procedure for biotesting. In particular, using a similar approach implemented "Method of determining the toxicity of chemicals, polymers, materials and products using bacterial test "Ecolum" [11]. The set of essential characteristics of this solution can be recognized by the method of the prototype. However, based on his use of option valuation biotoxicity nanoglide of available scientific and technical literature is not known.

Another important limitation of use is increased bioluminescent method for the assessment of nanoparti is determined by its ability to absorption and scattering of light, emitted touch microorganisms. The result can be distorted (low) the results of registration of the intensity of bioluminescence in the experimental samples, leading to the formation of erroneous values of indices of toxicity. A known solution to this problem is to use so-called "test flash". - flash assay) [12], the essence of which is the kinetic determination of the intensity of the luminescence in the first second after mixing the sample with a touch microorganism, and after 15 or 30 minutes of joint incubation. To achieve a positive effect is the elimination of the influence of colour and turbidity of the analyzed samples for the study, and the disadvantages are the necessity of using only special expensive automated equipment that allows the simultaneous making/mixing of the analyzed samples and registration glow in the kinetic mode with decisiontime intervals.

Thus, the main reasons that prevent obtaining the desired result when using the prototype method are: 1) lack of approaches for contact luminescent microorganisms with test particles nanoglide as a consequence of sedimentation and aggregate instability of their suspensions; 2)distorting the optical properties of the test suspensions of nanoparti on the result of determination of the intensity of the glow inside them touch luminescent microorganisms.

Alternative approaches, leading to the elimination of these shortcomings in the available literature are not described.

Thus, the inventive method is not known from the prior art, that is new.

The invention

The technical result, which directed the inventive method, is to improve the accuracy and sensitivity of the determination of biotoxicity nanoglide.

The essence of the proposed method, formulated at the level of functional generalization and underlying it, is the following:

- biotoxicity nanoglide (WELL) is determined by the degree of its dispergirovannom in the test sample, which may be increased prior suspendirovanie WELL in organic solvents with less than water, polarity and subsequent sonification, with the exception of the optical properties of suspensions WELL the results of biological testing using luminescent bacteria can be achieved by introducing a correction value that takes into account the patterns of distribution of emitted light in the test suspension.

Accordingly, when implementing the proposed method of determining biotoxicity nanoglide using luminescent bacteria characteristic actions, the order of their execution and conditions for the exercise in sravnenie is with the method of the prototype [11] are represented as follows (table 1).

Table 1
Comparative characteristics of actions, the execution order and conditions when determining biotoxicity nanoglide using the proposed method and the prototype method
Compare the characteristicsPrototype method [11]The inventive method
Stage I - preparation of samples tested
The introduction of the analyzed sample in organic solvent is less than that of water, degree of polarity-dimethyl sulfoxide or ethanol
Sonication-in the source cell type, 30 min
The introduction of chemically pure distilled waterin the ratio of 1:5to a final solvent concentration of 2.5%
Stage II - formation that is classical effect in relation to the touch microorganism
Used touch luminescense microorganismEscherichia coli K12 with cloned luxCDABE genes P.leiognathiThe same
Incubation time30 minThe same
The incubation temperature+22-24°CThe same
Control samplechemically pure distilled water2.5% of the solvent in chemically pure distilled water
Stage III - registration of the reaction, the assessment of the level of biotoxicity investigated sample
The registration methodBioluminometerThe same
Additional determination of the light absorption of the investigated sample-Spectrometry in the range of glow touch luminescense microorganism (420-580 nm)
Correction of certain values of bioluminescence taking into account the optical properties of the investigated sample-
The calculation of the toxicity indexT=((Ito-IODA)/Ito)×100%T=((Ito-IEast)/Ito)×100%
Criteria biotoxicityT<20% of the sample is non-toxic; 20%≤T<50% - sample-toxic; T≥50% - sample of highly toxicThe same

At the first stage of determining biotoxicity nanoglide spend three consecutive steps: 1) a portion of the analyzed sample WELL contribute in a glass bottle with an organic solvent is less than that of water, degree of polarity: dimethylsulfoxide (dielectric 45) or ethanol (dielectric 24); 2) capacity is treated with ultrasound, for example, placing it on 30 minutes in a bath-type source; 3) transfer part of the resulting suspension in a chemically pure distilled water so that the final concentration of DMSO or ethanol amounted to 2.5% of the final volume.

The maintenance phase is prinzipialno differs from the prototype method, not providing similar sample preparation and results-oriented research biotoxicity water-soluble chemical compounds. At the same time, the bulk connections of nanoparti are Leopoldine (hydrophobic) compounds, when applied to the aquatic environment not forming a true solution, and the dispersed system. Accordingly, the proposed sample preparation conditions for increasing the degree of dispersion of suspensions WELL, providing revealing his true biological activity.

In the second stage of determining biotoxicity nanoglide form of a series of three experimental and three control samples in a volume of 900 ml, the latter of which represent 2.5% solutions of organic solvents used in the first stage to improve the dispersion of suspensions WELL (DMSO or ethanol). In these tests contribute identical amounts (100 μl) of bacterial luminescense biosensor "Ecolum", as active principle containing cells of Escherichia coli K12 with cloned luxCDABE genes P.leiognathi. The sample was incubated for 30 minutes at +22-24°C.

The content of the stage - the formation of toxic effects present in the sample compounds nanoglide against the touch of the microorganism, which is manifested in the decrease in its level of bioluminescence, - prinzipialno not differ from that in the method prototype.

The third stage is a hardware check of the glow intensity touch of a microorganism in a test (IODA) and control (Ito) samples using a predetermined device - bioluminometer. Further to exclude the influence of the optical properties of the test suspensions of nanoparti on the result of the evaluation of their biotoxicity conducting a study of light absorption (D) suspension WELL with the intended use for this device is a spectrophotometer (an), followed by calculation of the true intensity of the glow touch microorganism (IEast) taking into account a correction value that takes into account the patterns of distribution of emitted light in the test suspension. The obtained values are used for the final calculation of the coefficient of toxicity (T) of the analyzed sample by the formula T=((Ito-IEast)/Ito)×100%. When the values of T<20% of the sample was evaluated as non-toxic, with 20%≤T<50% as toxic and at T≥50% as highly toxic.

The contents of the phase register of the reaction and the calculation of the level of biotoxicity investigated sample has significant differences from those in the method prototype, as it involves considering and excluding the distorting effect of intrinsic optical properties of a suspension nanogl the kind of the result of its bioluminescent biotesting. Said identifies the need to determine the light absorption of the investigated samples with the intended use for this device is a spectrophotometer (spectrofluorimetry). The registered values are further used to calculate the true light intensity touch microorganism (IEastdepending on the light-absorbing properties of the studied suspensions of nanoparti (D) and defined in the experiment, the level of luminescence of the bacterial luminescense biosensor (IODA) by the formula:

where:

IEast- the true intensity of the touch of the microorganism;

IODA- defined in the experiment, the level of luminescence of the bacterial luminescense biosensor;

g(λishare luminescence biosensor (in fraction of the total light intensity), recorded at a certain wavelength in the range 420-580 nm;

D(λi- amount of light absorption of the investigated suspension nanoglide on this wave length.

The possibility of obtaining a technical result when performing these actions at specified intervals of values is defined as a complex causal chain.

1. Connection nanoglide (WELL) are lifornia (in this case, the hydrophobic) particles in an aqueous medium forming coarse sedimentation and aggregately unstable suspension. To increase the degree of dispersion of such systems offered their creation-based solvents with less than water, the value of dielectric permeability - DP (dimethyl sulfoxide, DP=45 or ethanol, PD=24), followed by the transfer of part of the formed suspension in the aquatic environment. The use of other solvents, including with even lower values of dielectric permittivity (benzene, DP=2,27; toluene, PD=2.3; seraglio, DP=2,64; trichlormethane, PD=with 4.64 etc) when implementing the proposed method is impossible due to their severe toxicity (see also section 2). In turn, the probable cause underlying the achieved stabilization of suspensions of nanoparti is adsorption and solvation mechanism of lowering of the surface energy due to adsorption of the stabilizer and the molecules of the dispersion medium on the surface of the particles WELL. Experimental evidence of the effectiveness of the proposed approach are obtained from the sedimentation stability in different ways formed suspensions WELL studied by centrifugation at different multiplicities of g (acceleration of gravity).

2. Rationale valid final concentration of dimethyl sulfoxide or ethanol was given based on the experimental study of the effect of different concentrations of d is the R of solvents on the level of bioluminescence used when implementing the proposed method touch of Escherichia coli K12 with cloned luxCDABE genes P.leiognathi. The optimum concentration will not cause suppression of bioluminescence and, at the same time, allowing to bring in suspension maximum number of test WELL was installed such at 2.5% of the final volume of the sample. For the other investigated solvents with low dielectric constant such concentration was not less than 8-10 times lower than that testified to their own expressed biotoxicity the use of touch microorganism.

3. Additional action proposed to improve the degree of dispersion of suspensions of nanoparti is their sonication (ULTRASONIC), leading to mechanical separation of the particles WELL. Experimental evidence for the feasibility of such actions were obtained from the sedimentation stability in different ways formed suspensions WELL studied by centrifugation at different multiplicities of g (acceleration of gravity). While similar studies after different time of ULTRASONIC impact as sufficient permitted to establish his 30-minute duration. A further increase of time of ULTRASONIC impacts not already led to a significant increase in the dispersion of the formed suspension. In a separate series of experiments, also the setting, the combination of dimethyl sulfoxide or ethanol with ULTRASONIC exposure increases the dispersion of suspensions of nanoparti much more than that each of these actions separately.

4. The achieved increase of the degree of dispersion of nanoparti simultaneously accompanied by a decrease in its light transmitting properties, which is explained in the following complex causality: 1) until the particle size of the WELL is much greater than the wavelength of light, the absorption values are proportional to the area of the surface; 2) the closer the particle size WELL to the wavelength of light absorption of light by the surface area per unit increases. This fact registered experimentally in the evaluation of light absorption suspensions formed on the basis of identical weight quantities WELL, but using the prototype method and the proposed method. At the same time it creates an obstacle for the implementation of bioluminescent test biotoxicity nanoglide, which consists in the absorption fraction emitted touch microorganism of light as it passes through the suspension and leading to registration distorted (low) of the luminance values.

5. To exclude the distorting influence of the intrinsic optical properties of a suspension of nanoparti on the bioluminescent bio is sterowania proposed procedure for the correction of certain values of bioluminescence taking into account the optical properties of the investigated samples. While the novelty of such actions is determined by the following points: 1) calculations although based on the use of the law of the Bouguer-Lambert-Bera, describing the nature of light attenuation during propagation in an absorbing medium, but due to the fact that the law describes a monochromatic beam of light produced by the calculations involve the calculation for the n-th number of wavelengths; 2) analyze the wavelength range is determined by the spectrum of light emission used a touch of Escherichia coli K12 with cloned luxCDABE genes P.leiognathi (420-580 nm) with accounting for certain values of the fraction of the total light emission, emitted in each spectral range; 3) during the computation takes into account that light (bioluminescence) occurs inside of the analyzed samples, respectively, before moving to the Registrar (photomultiplier tube) passing through different thickness layers suspension nanoglide. Experimental verification of this approach allowed us to ascertain its adequacy for the task that was manifested in the correction (increasing) values of the true intensity of the glow touch microorganism (IEast), is proportional to the values of the light absorption of the tested suspension nanoglide.

In General, pain is irua above materials about the essence of the proposed method, the characteristic action, the order of their execution and conditions for the exercise, it can be stated that the inventive method does not follow from the prior art and according to this indicator should be assessed as complying with the criterion of "inventive step".

Information confirming the possibility of carrying out the invention

To determine biotoxicity nanoglide bioluminescent method of biotesting in a sterile glass container bring his equipment in the amount specified by research objectives.

In the further sequence of action when implementing the proposed method, conditions and modes are as follows:

1) to achieve dispersion of nanoparti to its mounting type organic solvent is dimethyl sulfoxide or ethanol categories reagent grade., then intensively mixed by pipetting;

2) a glass container with suspension of nanoparti in an organic solvent is placed in the source cell type treated with ultrasound for 30 minutes.

3) part of the resulting suspension is transferred into chemically pure distilled water so that the final concentration of organic solvent was equal to 2.5% of the final volume;

4) form a series of three experimental and three control samples in a volume of 900 μl each, the last of which p is establet a 2.5% solution used organic solvent chemically pure distilled water;

5) in a bottle of commercially available luminescense biosensor "Ecolum"containing lyophilized recombinant strain of Escherichia coli K12 with cloned luxCDABE genes P.leiognathi make 10 ml of distilled water, shaken several times, incubated for 30 min in the chiller at +2-4°C to stabilize the luminescence levels, then bring to room temperature +22-24°C;

6) in experimental and control samples contribute 100 ál of biosensor and intensively mixed by pipetting;

7) the cell with the test and control samples incubated in the same conditions for 30 minutes at +22-24°C;

8) cuvettes sequentially placed in the measuring cell bioluminometer and measure the level of illumination in the visible blue-green region of the spectrum when 420-580 nm within 30-60 seconds, the intensity of illumination in three experimental (IODA) and three control (Ito) the sample average;

9) using a spectrophotometer (spectrofluorimetry) are conducting a study of light absorption (D) test suspension nanoglide in the range 420-580 nm;

10) on the basis of the measurements carried out calculation of the true intensity of the glow touch microorganism (IEastdepending on the light-absorbing properties of the investigated suspension nanoglide (D) and a certain level of bacterial luminescence is minastirea biosensor (I ODA) by the formula:

where IEast- the true intensity of the touch of the microorganism; IODA- defined in the experiment, the level of luminescence of the bacterial luminescense biosensor; g(λishare luminescence biosensor (in fraction of the total light intensity), recorded at a certain wavelength in the range 420-580 nm; D(λi- amount of light absorption of the investigated suspension nanoglide on this wave length.

11) do the final calculation of biotoxicity T of the investigated samples nanoglide by the formula T=((Ito-IEast)/Ito)×100%;

12) when the values of T<20% connection nanoglide assessed as non-toxic, at T from 20 to 50% as toxic and at T≥50% as highly toxic.

Using the described sequence of actions when assessing biotoxicity nine different compounds nanoglide helped to demonstrate the feasibility of carrying out the invention, as well as the advantage of the proposed method compared with the method of the prototype.

So water sedimentation and aggregation unstable suspension WELL according to the results of bioluminescent analysis using the prototype method were evaluated as biotoxin only three of the nine investigated cases. In particular, biotoxicity least is detected and the samples of single-walled carbon nanotubes, directly isolated from the reaction zone; single-walled carbon nanotubes, underwent the procedure extraction with toluene and the acid treatment with HCl and HNO3with subsequent thermal oxidation in air, and C60-fullerenes, functionalized with amine groups. At the same time the analysis allows to link a significant proportion of the tested biotoxicity WELL with the presence of the impurity elements. While a significant relationship inhibition of bacterial bioluminescence and calculated on the basis of the values of biotoxicity from the presence of certain metals in drugs WELL recorded for Cr (P<0,01), as well as Ni, Zn, Y, Sm, Gd and Ho (P<0,05). Said determined and the existence of water suspensions WELL a strong positive correlation between the total indicator of the presence of impurity substances (XOM) and certain values of biotoxicity (r=0,747; P<0,05). Thus, using the prototype method allows to identify not so much its own biological activity (biotoxicity) nanoparti as the effects present in the technological impurities.

On the other hand, using the proposed method for increasing the degree of dispergirovannom nanoglide, was accompanied by an increase in detected values of its biotoxin the tee. In particular, in the case of using dimethyl sulfoxide and further processing by ultrasound as biotoxin could be estimated 7 out of 9 of the studied drugs, and the use of ethanol, followed by treatment with ultrasound - 6 of 9. At the same time the use of the proposed method was accompanied by the loss of significance of the impurity composition WELL in determining their biotoxicity (values of correlation coefficient r from 0,255 to 0,393; P>0,05), thereby identifying one's own biological activity of nanoparti.

Example

To study biotoxicity carbon nanomaterial (C60-fullerene) was made several batches in the number 2,96 mg, corresponding to 4×10-6M

When conducting research on the method prototype sample of the investigated carbon nanomaterial was placed in a glass vessel, filled 5-fold volume of chemically pure distilled water with pH 7.0-7.4 and kept for 24 hours. The resulting suspension was diluted with distilled water to a concentration of 100 μm, which was formed by a series of three experimental samples. As a control, was formed by a series of three samples of chemically pure distilled water used for the suspension of nanoparti. The obtained experimental and control samples in a volume of 900 μl was introduced into the measuring cuvette, after which there W is added 100 μl of the suspension touch luminescent bacteria Escherichia coli K12 with cloned luxCDABE genes P.leiognathi, recovered from the dried state of the commercially available drug "Ecolum" (NVO "Immunotec", Russia). After 30-minute incubation at +22-24°C cuvette with the sample was placed in a device for registering biological glow - bioluminometer "Botox" (LLC "HEPA", Russia) and measured the level of bioluminescence in control and experience. Index of toxicity (T) was calculated by the formula T=((Ito-Iabout)/Ito)×100%, where Ito- the intensity of the glow in the control cell, Iabout- the intensity of illumination in the experimental cell.

The results obtained using the prototype method, allows us to reveal the toxicity index level T=-129% (value glow in the prototype was exceeded one in control), in accordance with existing regulations were made to evaluate the investigated sample C60-fullerene as non-toxic. In a parallel experiment was conducted to determine the viability of the used touch microorganisms after exposure to C60-fullerenol also showed no development of bactericidal effect.

When conducting research on the method prototype sample of the investigated carbon nanomaterial was placed in a glass vessel, which was introduced 1 ml of dimethylsulfoxide, and then intensively mixed by pipetting. Later the vessel was placed in istochniknnov type "Sapphire CTS (CJSC FSC "Sapphire", Russia), where he was treated with ultrasound for 30 minutes. In the next step, part of the resulting suspension was transferred into chemically pure distilled water with a pH of 7.0-7.4 so that the final concentration of dimethyl sulfoxide was 2.5% of the final volume and concentration of C60-fullerene was equal to 100 μm. As control was used a series of three samples of 2.5% solution of the appropriate organic solvent chemically pure distilled water. Prepared in a similar manner the test and control samples were made in the measuring cuvette in a volume of 900 μl, after which there was added 100 μl of a suspension of luminescent bacteria Escherichia coli K12 with cloned luxCDABE genes P.leiognathi recovered from the dried state of the commercially available drug "Ecolum" (NVO "Immunotec", Russia). After 30-minute incubation at +22-24°C cuvette with the sample placed in the instrument recording biological glow - bioluminometer "Botox" (OOO "HEPA", Russia), measured the level of luminescence in control and experience, and then spent the calculation of indices of toxicity (T) in the above formula.

In parallel was determined by the light absorption of the investigated samples nanoglide (D) in the spectral range 420-580 nm using intended for this device - spectrofluorimetry "Fluorat-Panorama (NPF "Lumex", Russia). The registered values are further used to calculate the true light intensity touch microorganism (IEastdepending on the light-absorbing properties of the studied suspensions of nanoparti (D) and defined in the experiment, the level of luminescence of the bacterial luminescense biosensor (IODA) by the formula:

where IEast- the true intensity of the touch of the microorganism; IODA- defined in the experiment, the level of luminescence of the bacterial luminescense biosensor; g(λishare the glow of the used strain of Escherichia coli K12 with cloned luxCDABE genes .leiognathi at a certain wavelength in the range 420-580 nm in a fraction of the total light intensity is pre-defined with the use of device "Fluorat-02-Panorama (NPF "Lumex", Russia); D(λi- amount of light absorption of the studied suspensions of C60-fullerene on this wave length.

The results obtained using the proposed method, revealed biotoxicity study drug C60-fullerene, characterized by the value of the index of toxicity at the level of T=26%, which is in accordance with the applicable regulations were made to evaluate this sample nanoglide as toxic. In parallel experiments for the op is to edeleny viability used a touch of microorganisms after exposure to C60-fullerenol also helped to secure the development of bactericidal effect in relation to more than 20% taken in the experience of target cells, consistent with the above data obtained bioluminescent method.

Thus, a positive result is achieved when using the proposed method, appeared to increase the sensitivity and the accuracy of biotoxicity nanoglide (in particular, C60-fullerene), including those associated with the development of bactericidal effect against the touch of the organism.

Sources of information

How to determine biotoxicity nanoglide by examining the effect on the luminous intensity (IEast) recombinant luminescense strain of Escherichia coli K12 genes with fluorescent system Photobacterium leiognathi compared to its fluorescence intensity in control (Ito) and the subsequent calculation of the toxicity index according to the formula T=((Ito-IEast)/Ito)·100%, wherein a portion of the investigated compounds nanoglide pre-dispersed in the organic solvent is less than that of water, degree of polarity - dimethyl sulfoxide or ethanol; mix thoroughly and treated with ultrasound; the resulting suspension is transferred into the aqueous medium to a final concentration of solvent used is 2.5%; then created in study and control sample, representing a 2.5%aqueous solution dimethyls is lfixed or ethanol, make luminescense strain and after co-incubation for 60-180 min measure the intensity of luminescence in parallel in the wavelength range of bioluminescence touch of strain (λi) determine the optical properties of the tested suspension nanoglide, on what basis they calculate the true light intensity touch microorganism (IEastdepending on the light-absorbing properties of the studied suspensions of nanoparti (D) and defined in the experiment, the level of luminescence of the bacterial luminescense biosensor (IODAthe formula

where IEast- the true intensity of the touch of the microorganism;
IODA- defined in the experiment, the level of luminescence of the bacterial luminescense biosensor;
g(λishare luminescence biosensor (in fraction of the total light intensity);
D(λi- the absorption coefficient of the investigated suspension nanoglide at this wavelength.



 

Same patents:

FIELD: medicine.

SUBSTANCE: method involves cultivation of an obligate methanol-assimilating bacterium Methylophilus methylotrophus or Methylobacillus glycogens in a fluid medium with the bacterium secreting an end protein from a bacterial cell where said bacterium has a DNA structure containing a promoter sequence functioning in the methanol-assimilating bacterium, a nucleotide sequence coding a polypeptide containing a signal sequence which functions in the methanol-assimilating bacterium, and a sequence of the end protein functionally connected with the promoter sequence.

EFFECT: method allows producing the protein effectively by means of extracellular secretion, difficult-to-produce by means of secretory production with application of Escherichia coli bacteria.

5 cl, 7 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method provides test inoculation of a nutrient medium containing pancreatic fish flour hydolyzate, fermentative meat peptone, NaCl, Tween-80, CaCl2, sodium thiosulphate (Na2S2O3 × 5H2O), ferrous ammonium sulphate ((NH4)2SO4 × FeSO4 × 6H2O), sorbite, bromthymol blue, irgasan (DP-300), rifampicin, NaOH, agar and distilled water in the preset proportions. Pancreatic fish flour hydolyzate, peptone, NaCl, agar are dissolved with heating, sterilised at 121°C for 20 min and thereafter added in a hot medium of the other components specified above. The inoculations are incubated on the nutrient medium in aerobic conditions at temperature 37°C and/or 28°C for 24-48 h and assessed by the presence of black-centre green or dark grey colonies surrounded by a cloudy precipitate zone in the nutrient medium.

EFFECT: invention allows simplifying and providing higher specificity of Shewanella bacteria recovery and identification.

2 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains yeast water, beef hydrolyzate, sodium chloride, glucose, glycerin, sodium citrate, sodium metabisulphite and distilled water.

EFFECT: invention allows providing optimum conditions for brucellous microbe growth, replication in a transport nutrient medium at any distances.

3 ex

FIELD: medicine.

SUBSTANCE: strain of bacteria Bacillus thuringiensis BIOS-1 VKPM B-10709, possessing insectoacaricidal activity against representatives of leaf-eating and sucking pests, such as representatives of orders Lepidoptera, Coleoptera, Homoptera, Thysanoptera and Acariformes, doing harm to crops, is deposited in All-Russian collection of industrial microorganisms (VKPM), Federal State Unitary Enterprise GosNIIgenetika under number B-10709.

EFFECT: invention makes it possible to increase mortality of representatives of leaf-eating and sucking pests, doing harm to crops.

6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: there is offered a method of preparing the antibiotic Cephalosporin C. A new antibiotic producer Acremonium chrysogenum strain, RNCM No. F-4081D is used. Acremonium chrysogenum, RNCM No.F-4081D is cultivated on an enzymatic nutrient medium containing carbohydrate sources - glucose, corn starch, dextrin, nitrogen sources - a corn extract, Pharmamedia, ammonium sulphate, and also inorganic salts - potassium phosphate, potassium sulphate, chalk, copper sulphate, zinc sulphate, manganese sulphate, ferrous sulphate, and as vegetable fat - rapeseed oil and in addition a phosphatidylcholine and/or sitosterol.

EFFECT: twice increased antibiotic production level, reduced fermentation time.

1 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention can be used in producing nutrient mediums which create the optimum conditions of legionella activity. The nutrient medium contains a enzymatic hydrolyzate of a pig's lung, a enzymatic hydrolyzate of peanut, 1-substituted potassium phosphate, 2-substituted 3-aqueous potassium phosphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water.

EFFECT: invention allows reducing time for legionella detection.

3 ex

FIELD: medicine.

SUBSTANCE: avirulent Vibrio cholerae strain of biovar eltor of serovar Ogawa - a producer of a major protective O1 antigen of serovar Ogawa is produced in a simulation experiment of virulent natural V.cholerae M569 Ogawa strain by spontaneous loss of "СТХφ" prophage at cholera agent continuance in sterile river water. The strain is deposited in the State Collection of pathogenic bacteria "Microbe" Registration No. 262 of the Collection of Miscroorganisms. A feature of the strain is the absence of genes of a core region of "СТХφ" prophage. The strain is avirulent for suckling rabbits, agglutinated by cholera serums O1 and Ogawa in dilution exceeding a diagnostic titre.

EFFECT: use of the invention allows producing a vaccine of O1 protective antigen of serovar Ogawa providing immunity formation in cholera.

5 ex

FIELD: medicine.

SUBSTANCE: avirulent Vibrio cholerae KM 263 strain of biovar eltor of serovar Inaba - a producer of a protective O1 antigen is produced in a simulation experiment of virulent natural V.cholerae M569 Inaba strain by spontaneous loss of "СТХφ" prophage at cholera agent continuance in sterile river water. The strain is characterised by a high production level of the major protective O1 antigen of serovar Inaba.

EFFECT: invention aims at preparing chemical cholera vaccines by formation of antibacterial cholera immunity, and producing purified preparation of the O1 antigen of serovar Inaba for a diagnostic serum preparation .

5 ex

FIELD: medicine.

SUBSTANCE: blood serum is diluted with physiologic saline in the ratio 1:2, 1:5, 1:10, 1:20 and 1:50, and tracheobronchial aspirates are diluted with physiologic saline in the ratio 1:2, 1:4, 1:8, 1:16 and 1:32. A solid nutrient medium of the following composition is prepared: a nutrient microbiological dry agar 26.5 g, a nutrient yeast extract 1.22 g, lactose 10.7 g, disodium phosphate 0.48 g, anhydrous sodium sulphite 0.83 g, sodium carbonate 0.03 g, sodium hydroxide 5.0 g, distilled water 1000 ml, pH 8.0 which contains the test strain Micrococcus lysodeiktikus 2665 in the concentration 50 million microbial cells in 1 ml of the medium. Simultaneously with the material being analysed, a reference concentration 5 mcg/ml is introduced in the wells of the diameter 8 mm on each Petri dish. In 18 hours of the incubation procedure at 37°C, a diameter of test strain growth retardation zone surrounding the wells are measured. The vancomycin concentration, mcg/ml is determined by a calibration curve of growth retardation zone diameter to the reference vancomycin concentration.

EFFECT: use of the declared method allows determining the vancomycin concentration in the biological fluids and ensuring higher clinical effectiveness.

2 ex

FIELD: chemistry.

SUBSTANCE: method involves collecting dust samples with a sterile cotton wool wad from 10-20 cm2 of any surface or the sterile cotton wool filter of a vacuum cleaner. The dust samples are put into a sterile physiological solution, followed by extraction for 30-60 minutes at room temperature while stirring. The supernatant liquid is collected and multiple cultures of the obtained extract are prepared from the liquid. The obtained cultures are sown in a semi-liquid thioglycol medium and modified thioglycol medium obtained by adding defibrinated blood to the thioglycol medium in a given amount. Culturing is performed for 10 days at temperature 37°C and daily visual monitoring, followed by determining the number of microbial cells which are calculated from the McCready probability table, which is compiled based on data on growth properties of microorganisms and tinctorial properties of the bacterial community of the dust sample are determined through microscopic examination of smears of the mixed culture mass which is gram-stained.

EFFECT: simultaneous quantitative determination of the total bacteria number and obtaining cultural, morphological, tinctorial and haemolytic characteristics of the bacterial community of dust samples from buildings.

FIELD: chemistry.

SUBSTANCE: biosensor contains photo-autotrophic microalgae cells, the fluorescent characteristics of the photosynthesis system of which vary in the presence of cytotoxic chemical compounds in their surroundings: heavy metal ions and herbicides. Cells of green and diatomic microalgae are immobilised in cryogenic gel of polyvinyl alcohol: a cell suspension is deposited on a surface and the cells enter macropores of the polymer carrier under the effect of centrifugal force (5000-14000 g) for 1-10 minutes. A highly sensitive and stable biosensor is obtained based on components taken in the following ratio in wt %: microalgae cells 0.015-1.1; polyvinyl alcohol 7-15; aqueous phase - up to 100. Low concentrations of heavy metals and herbicides in aqueous systems are determined at flow rate of up to 360 ml/h based on the change in the value of relative variable fluorescence chlorophyll cells in the biosensor. The biosensor can be used for a maximum of 60 days.

EFFECT: high sensitivity of the biosensor.

2 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: detection and identification of biological objects and their nanocomponents are enabled by exposure to radiation, monochromatic or nonmonochromatic radiation, including laser, sensing of one or more samples containing microobjects and their nanokcomponents with the use of a set of sample response measurement and record devices. The responses characteristics of each radiation conversion event are measured separately or in the aggregate, transferred and reduce in a diagnostically linear form. It is followed normalisation, correction and creation of a base of the reference and diagnosed parametres of microobjects and/or their nanocomponents. Further, the reference, diagnosed and identified microobjects and/or their nanocomponents are recognised and compared with experience data of required parametres on the basis of measurement with the use of a matrix.

EFFECT: use of the declared method allows precise qualitative and quantitative analysis of detected, identified, diagnosed parametres of the microobjects and their nanocomponents on the basis of optical measurement.

4 cl, 12 dwg, 1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: cultivated microbiological objects count is ensured by the measurements of their morphological compositions by determining the size distribution of microorganism cells in a nutrient fluid by variation of scattered light intensity. The fluid flow is sounded with monochromatic coherent light; interaction signal of probe radiation and analysed microbiological objects are recorded by the measurement of amplitude and duration of scattered light pulses by analysed particles; and functions derived from the measurements are plotted in the form of two-dimensional distribution of specified amplitudes and durations expressing statistic parameters of light scattering intensity by particles. After said functions, the size distribution of analysed cultivated microbiological objects and decay products of the nutrient fluid is derived.

EFFECT: higher measurement accuracy due to eliminated error caused by foreign particles that are decay products of the nutrient fluid in cultivation of the analysed microbiological objects.

9 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: invention concerns medicine, particularly method of cardiomyocyte selection from cardiomyocyte-containing cell mix without genetic alteration incardiomyocytes. Method of cardiomyocyte content boost in cardiomyocyte-containing cell mix without genetic alteration. Method of cardiomyocyte obtainment without genetic alteration to cardiomyocytes. Method of cardiomyocyte content assessment in cardiomyocyte-containing cell mix.

EFFECT: possible efficient selection of cardiomyocytes from cardiomyocyte-containing cell mix without genetic alterations.

20 cl, 16 dwg, 14 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: method can be used in microbiology, food industry for estimation of viability of unicellular organisms (yeasts, etc.), which demonstrate difference of dielectric properties. Per cent content in mixture of live and dead unicellular microorganisms is determined by deviation of measured value of dielectric permeability from dielectric permeability of mixtures, consisting only of live and only of dead unicellular microorganisms, or by experimental dependence of second derivative of dielectric permeability on humidity.

EFFECT: elaboration of distant methods of assessment in continuous flow, in elaboration of industrial methods of control over live microorganism production.

2 dwg

FIELD: medicine.

SUBSTANCE: invention concerns medical microbiology. The method of chronic urogenital gonococcal infection course forecast involves seeding of accompanying fungi of Candida genus in case of gonococcus detection, and persistence factors of accompanying microorganisms is evaluated. If titration of fungi of Candida genus gives not less than 102 colony-forming cells per millilitre and antilysozyme activity evolves simultaneously in the quantity not less than 1.3 mcg/ml per optical density unit, and anticomplementary activity not less than 1.5·106 antilytic complement units, then chronic character of urogenital infection is confirmed diagnosed.

EFFECT: increased accuracy of chronic urogenital gonococcal infection course forecast.

2 ex, 3 tbl

FIELD: medicine.

SUBSTANCE: method involves carrying out bacteriological study of esophageal mucous membrane biopsy samples. No microorganism growth or predominant Streptococcus spp., Peptostreptococcus spp., Staphylococcus spp. in monoculture or culture association in the amount of equal to or greater than 103-104 CFU/g (colony formation units), and no Escherichia coli, Bacteroides spp., Enterococcus faecalis, Enterococcus faecium, Candida spp. in monoculture or culture association in the amount of equal to or greater than 102-107 CFU/g, and optionally increased total microorganisms quantity to 104-107 CFU/g being observed, alkaline ingredient availability in refluxate in gastroesophageal reflux cases is declared to take place.

EFFECT: enabled alkaline ingredient availability and microbiocenosis disorders intensity evaluation.

FIELD: medicine.

SUBSTANCE: method involves determining duodenal juice acidity, duodenum bulbary and postbulbary department insemination degree with H.pylori. Ulcer edge and pyloric canal area bioptates are subjected to immunological and histological examination. Duodenal juice acidity being equal to or higher than 6.5 mmole/h and duodenal mucous membrane insemination degree being equal to or higher than 100 bacteria in vision field, IgG antibodies to H.pylori diluted in 1:160 proportion and higher, gastric metaplasia being detected in pyloric canal bioptates of ulcer edges among hypertrophied smooth muscle cells of separate groups of atrophied and deformed smooth muscle cells divided by layers of loose connecting tissue having blood vessels, fibroblasts, lymphocytes and macrophages, and anisochromia being detected when staining hypertrophied smooth muscle cells, pylorostenosis development is to be predicted.

EFFECT: high accuracy in predicting pylorostenosis development clinical course.

FIELD: medicine.

SUBSTANCE: method involves separating pure microorganism cultures from nasal mucous membrane and/or rhinopharynx microflora and identifying them. Anti-lysozyme activity is determined in pure culture and microbial insemination share in the general microbial insemination index is calculated for biotope under study. The first value being equal to or greater than 3 mcg/ml and the second one greater than 45%, rhinotubal microorganism migration into middle ear tympanic cavity is to be predicted.

EFFECT: high accuracy in predicting clinical course of inflammation in middle ear.

2 tbl

FIELD: chemistry.

SUBSTANCE: disclosed is use of a Yarrowia lipolytica VKPM Y-3492 yeast strain as a biosensor for detecting 2,4,6-trinitrotoluene in different media. Free or immobilised cells of Yarrowia lipolytica VKPM Y-3492 yeast are used to detect 2,4,6-trinitrotoluene in different media. Use of the Yarrowia lipolytica VKPM Y-3492 yeast strain enables to detect 2,4,6-trinitrotoluene in a wide range of concentration from 0.1 to 100 mg/l without using cultures, in a wide range of pH from 4.5 to 8.0 and temperature from +10°C to +33°C.

EFFECT: improved method.

4 ex

Up!