Method of simulating build-up of bacterial resistance to disinfectant

FIELD: chemistry.

SUBSTANCE: method involves preliminary selection of concentration of a disinfectant solution at which bacteria exhibit partial sensitivity to said disinfectant. The bacteria are exposed to the disinfectant solution at the given concentration. Grown colonies of bacteria are collected after exposure to said disinfectant and then sown on a solid culture medium, followed by culturing at 37C. Bacteria colonies isolated from those grown at the previous step are selected in amount of 1-299 colony-forming units (CFU/ml). The collected isolated colonies are resown on a culture medium and grown at conditions needed for growth of bacteria of that type, followed by dividing the grown colonies into two parts. One part of the grown bacteria colonies is exposed to the disinfectant at the selected concentration, and the other part is exposed to the disinfectant at bactericidal concentration. If upon exposure to the disinfectant at bactericidal concentration, there is no growth of bacteria or their growth ranges from 1 to 299 (CFU/ml), then the cycle of selecting bacteria grown at the previous step, their resowing on the culture medium, growing colonies of said bacteria at conditions needed for growth of said type of bacteria and exposing the grown colonies to the disinfectant at the selected and bactericidal concentrations is repeated once more until after exposing the column to the disinfectant solution at bactericidal concentration, growth of bacteria on the culture medium is equal to 300 (CFU/ml), which indicates bacterial resistance to the disinfectant.

EFFECT: invention enables to simulate bacterial resistance to a disinfectant, evaluate build-up of resistance and bactericidal potential of hospital strains to disinfectants during their practical use.

1 tbl, 1 ex

 

The proposed method relates to biotechnology can be used to simulate the formation of the resistance of bacteria to disinfectants, as well as for the evaluation of bactericidal action of disinfectants.

The resistance of microorganisms to the use of disinfectants is one of the most urgent issues to be addressed, to prevent the formation and spread of resistant to disinfectants (DS) strains of microorganisms in health care settings(1, 2, 3).

Overcoming resistance is impossible without understanding the regularities of its formation. Unfortunately, the existing requirements to develop new DS do not provide research opportunities and conditions for the development of resistant to them variants of microorganisms, in particular bacteria. The necessity of studying the formation of the resistance of bacteria to DS and its parameters caused the need for the proposed development.

Ways of modeling the formation of the resistance of bacteria to disinfectants can be used both for scientific purposes and in the manufacture of disinfectants and testing centers.

Currently no known ways to generate bacterial resistance to disinfectants.

Object of the present invention which is a development of the method, simulating the development of resistance of bacteria to disinfectants.

The problem is solved by the proposed simulation method of forming the resistance of bacteria to the sanitizer air (DS), including preliminary selection of the concentration of the solution DS, in which bacteria are incomplete sensitivity to this means, the exposure to the bacteria solution DS for a given concentration, the selection of grown colonies of bacteria after exposure to DS and seeding them on a solid nutrient medium, and then grown bacteria in an amount of from 1 to 299 colony forming units (CFU/ml) select isolated colonies of bacteria which subcultured on nutrient medium and grown them when the conditions necessary for the growth of bacteria of this type, one part of the grown colonies of bacteria affect the solution DS chosen concentration, on the other part of the grown colonies of bacteria affect the solution DS bacterial concentration, and if when exposed to a solution of disinfectant bactericidal concentrations of bacteria growth is absent or their growth is from 1 to 299 (CFU/ml), the cycle of selection were grown in a previous step, bacteria, reseeding of bacteria on a nutrient medium, the cultivation of these colonies of bacteria under the conditions necessary for the growth of this bacterial species, and the impact of the as-grown colonies of bacteria solution DS chosen bactericidal concentrations repeat as many times while after exposure to bacteria colonies solution disinfectant bactericidal concentration the growth of bacteria on a nutrient medium will not be 300 colony forming units (CFU/ml), which is judged on the formation of bacterial resistance to this the sanitizer air.

It is preferable that grew from 1 to 299 colony forming units (CFU/ml) microorganism selected a few isolated colonies, namely the growth of single colonies - a number from 1 to 5 to select all the colonies, with an increase from 6 to 299 selected colonies from 5 to 10 colonies.

It is preferable that the re-seeding of isolated colonies of the microorganism is carried out on a solid nutrient medium, in particular on the beveled nutrient agar.

The proposed method through the systematic effects of DS in low concentration makes it possible to simulate the resistance of bacteria to the action of DS due to the adaptation of bacteria to JS.

Therefore, the proposed method can be used for:

- objective assessment of development of resistance of bacteria to disinfectants with a quantitative assessment of the results;

- identify the mechanism of resistance of bacteria to various disinfectants;

assessment of dose and time effective disinfectant when forming color stability, and different bacteria to various disinfectants;

- to test disinfectants on the stage of their development to improve the bactericidal capacity;

to simulate the resistance of bacteria in laboratory conditions for use of these data in terms of a practical health centers of infectious diseases, preventive disinfection.

The proposed method is implemented as follows

Pre-select the DS concentration at which bacteria are incomplete sensitivity to the tool and which is characterized by the growth of bacteria in the amount of 1 - 299 colony forming units (CFU/ml), based on the bactericidal concentrations of the disinfectant prepared serial dilution and then apply a solution for this DS on a suspension of the tested bacteria, while at the stage of selection of DS concentration at which bacteria shows a partial sensitivity to the tool, and at all subsequent stages is used, the exposure time (exposure time DS on bacteria), suggesting a bactericidal effect for the appropriate disinfectant and disinfectant the tool may be submitted by any disinfectant with active substance on the basis of different chemical groups, and bacteria - any type of bacteria (pathogenic, the river is VNO-pathogenic), isolated from clinical material, objects in the external environment, the test bacteria), then act on the bacteria solution DS for a given concentration and selected grown after exposure to DS bacterial colonies, which are sown on solid nutrient medium, and then grown bacteria in an amount of from 1 to 299 colony forming units (CFU/ml) select isolated colonies of bacteria, in particular with the growth of single colonies - a number from 1 to 5 to select all the colonies, with an increase from 6 to 299 selected colonies from 5 to 10 colonies are subcultured on nutrient medium in particular beveled on nutrient agar, and grown them, maintaining at the conditions necessary for the growth of bacteria of this type, and then one part of the grown colonies affect the solution DS chosen concentration, on the other part of the grown colonies affected with a solution of disinfectant bactericidal concentration, and if when exposed to a solution of disinfectant bactericidal concentration there is no growth of bacteria or their growth is from 1 to 299 CFU/ml, the cycle of selection were grown in a previous step, bacteria, their subculture on nutrient medium, growing colonies of bacteria by incubating them with the conditions necessary for the growth of this bacterial species, and impacts on both parts of the grown colonies solution DS, repeat as many times until after you near the action in the colonies solution DS in bactericidal concentrations the growth of bacteria on a nutrient medium will not be 300 colony forming units (CFU/ml), which is judged on the formation of bacterial resistance to this the sanitizer air, because it is well known that the strain of bacteria resistant to disinfectants in their growth more than 300 CFU/ml

An example of specific performance of the proposed method

Pre-made selection of the concentration of DS based on Quaternary ammonium compounds (trade name "Precept"), in which bacteria species E. coli (test strain M-17) showed incomplete sensitivity to this agent, which is characterized by the growth of bacteria 1-299 CFU/ml, for this purpose, a suspension of bacteria of the species E. coli (turbidity 5 units on Mcfarland) was affected by the DS solution in concentrations 0,5%; 0,1%; 0,05%; 0,02%; 0,01% within 60 minutes, followed by seeding of bacteria on solid nutrient medium (mastopathy agar) and curing at 37C during the day, and then made the quantification of bacterial growth, into account it was found that at a concentration of DC 0,02% bacteria of this species showed incomplete sensitivity to this DC, and the growth of bacteria ranged from 30 to 160 CFU/ml in different experiments, while at a concentration DC of 0.5%to 0.1%, 0.05% bacterial growth was not detected, but at concentrations DS 0.01% bacterial growth was more than 300 CFU/ml (data shown in table). It should be noted that at the stage of additional comfo is and at all subsequent stages were used exposure time (exposure time DS on bacteria), assuming bactericidal effect for the appropriate disinfectant after was chosen concentration of the solution DS, in which bacteria showed incomplete sensitivity to this agent. Next on suspended bacteria was affected by the DS solution with a concentration of 0.02% for 60 minutes, after which the mixture containing bacteria, the solution DC Converter DC was planted on a solid nutrient medium (mastopathy agar) and incubated at 37C during the day, and then from the grown colonies of bacteria in an amount of from 60 colony forming units (CFU/ml) were selected 10 isolated colonies that have perestal on a solid nutrient medium (cut mastopathy agar)and grown these colonies, maintaining them at 37C for days, next from each of the grown colonies was prepared suspension of bacteria, with one part of the obtained suspension was affected by solution DS in bactericidal concentration (0.5%) for 60 minutes, and the other part of the suspension of bacteria was affected by the chosen concentration (0,02%) during 60 minutes with subsequent seeding mixture and maintaining, as a result, when exposed to DC in bactericidal concentrations the growth of bacteria was absent, therefore the cycle of cultivation of the microorganism, selection grown in the previous step colonies of the microorganism, damage to the Oia bactericidal concentration and selected concentration was repeated 6 times, in the result the impact on the colonies of bacteria solution disinfectant bactericidal concentration (0.5%) for 60 minutes growth of bacteria on a nutrient medium was 300 colony forming units (CFU/ml), which was judged on the formation of the bacterial species E. coli (strain M-17) resistance to this the sanitizer air.

* the concentration of the disinfectant, recommended guidelines

** low concentration of disinfectant

*** used exposure time of 60 minutes, as recommended by the guidelines for the use of DS.

As can be seen from the obtained results, the proposed method allows to simulate the formation of the resistance of bacteria to the sanitizer air and can be used as a research tool for evaluating the formation of resistance of nosocomial strains to disinfectants at the stage of their practical application in the laboratory for later overcome when using and practical health care to improve disinfection measures and justification rotation DS in health care institutions, centers of infectious diseases, preventive disinfection, as well as in the development of the disinfectant for the evaluation of bactericidal potential and p is dbora optimal modes of disinfection and disinfectant production funds.

Sources of information

1. Sokolova NF Actual problems of disinfection for the prevention of nosocomial infections in hospitals. Nosocomial infections in hospitals of different profile. Prevention, treatment, complications. Abstracts of the 3rd scientific and practical conference. M., 2005, p.21.

2. Chapman J.S. Disifectant resistance mechanisms, cross-resistance, co-resistance International Biodeterioration &Biodegradation. 2003, Vol.51, Is. 4, p.271.

3. Russel A.D. Bacterial adaptation and resistance to antiseptics, desinfectants and preservatives is not a new phenomenon J. Hosp. Infect. 2004, Vol.57, Is. 2, p.97.

1. The simulation method of forming the resistance of bacteria to the sanitizer air (DS), including preliminary selection of the concentration of the solution DS, in which bacteria are incomplete sensitivity to this means, the exposure to the bacteria solution DS for a given concentration, the selection of grown colonies of bacteria after exposure to DS and seeding them on a solid nutrient medium, and then grown bacteria in an amount of from 1 to 299 colony forming units (CFU/ml) select isolated colonies of bacteria which subcultured on nutrient medium and grown them when the conditions necessary for the growth of bacteria of this type, one part of the grown colonies of bacteria impact solution DS chosen concentration, on the other part of the grown colonies of bacteria affect the solution disinfectant bactericidal concentration is then, and if when exposed to a solution of disinfectant bactericidal concentrations of bacteria growth is absent or their growth is from 1 to 299 (CFU/ml), the cycle of selection were grown in a previous step, bacteria, reseeding of bacteria on a nutrient medium, the cultivation of these colonies of bacteria under the conditions necessary for the growth of this bacterial species, and impacts on the grown colonies of bacteria solution DS selected and bactericidal concentrations repeat as many times until after exposure to bacteria colonies solution disinfectant bactericidal concentration the growth of bacteria on a nutrient medium will not be 300 colony forming units (CFU/ml), which is judged on the formation of bacteria resistance to this the sanitizer air.

2. The method according to claim 1, characterized in that from which grew from 1 to 299 colony forming units (CFU/ml) bacteria selected a few isolated colonies, namely: the growth of single colonies number from 1 to 5 select all the colonies, with an increase from 6 to 299 selected colonies from 5 to 10 colonies.

3. The method according to claim 1, characterized in that the re-seeding of isolated colonies of bacteria carried out on a solid nutrient medium, in particular on the beveled nutrient agar.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: disclosed is use of a Yarrowia lipolytica VKPM Y-3492 yeast strain as a biosensor for detecting 2,4,6-trinitrotoluene in different media. Free or immobilised cells of Yarrowia lipolytica VKPM Y-3492 yeast are used to detect 2,4,6-trinitrotoluene in different media. Use of the Yarrowia lipolytica VKPM Y-3492 yeast strain enables to detect 2,4,6-trinitrotoluene in a wide range of concentration from 0.1 to 100 mg/l without using cultures, in a wide range of pH from 4.5 to 8.0 and temperature from +10C to +33C.

EFFECT: improved method.

4 ex

FIELD: medicine.

SUBSTANCE: diagnostic technique for abnormal chromatin packing in male sterility is based on a quantitative estimation of chromatin hydrolysis depth in sperm nuclei immobilised on slides. Hydrolysis by micrococcal nuclease is followed by preparation washing from soluble chromatin. Chromatin DNA without hydrolysis by nuclease and after hydrolysis is stained by fluorochrome DAPI and examined for the distinctions in a degree of fluorescence of the initial and nuclease-processed samples. A check value is a nature of chromatin hydrolyzate of fertile donor sperm cells characterised by the spermogram values. The prepared images are analysed by comparing brightness of the sperm cell images, and the abnormal chromatin packaging is shown by DNA amount extracted by nuclease relatively to total DNA.

EFFECT: use of the declared technique allows simplifying diagnosing of male sterility within the therapies in extracorporeal fertilisation and homologous insemination programs.

6 cl, 1 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: biochip comprises a solid carrier having working areas with clusters containing probes, and an identifier. The solid carrier consists of two parts coupled by means of a flexible multilayer sheet fixed on their surface by an adhesive layer. The probe clusters are symmetrised with respect to a longitudinal or transversal carrier axis a multilayer flexible sheet and/or on a solid carrier surface. If bent, the multilayer sheet makes the probe cluster arranged on the first and second carrier portions to match and forms reaction volumes either by means of through holes executed in the flexible multilayered sheet the arrangement of which is matched with the cluster arrangement, or by means of inserts fixed along the borders of the multilayer sheet supplied with the adhesive layer.

EFFECT: invention allows simplifying operation with a small amount of the analysed substance used in hybridisation, and also higher diagnostic result reproducibility ensured by effective hybridisation in a minimal amount of the hybridisation mixture and creation of identical conditions for a set of hybridisation clusters integrated in the biochip.

5 cl, 8 dwg

FIELD: medicine.

SUBSTANCE: method involves application of a diagnostic multiplex panel (DMP) designed for simultaneous identification of a set of possible microorganisms which can be found in a biological sample, with applying primer extension reaction to high conserved nucleotide sequences in sampled microorganisms. The biological sample is immobilised either on, or in a solid substratum in a first position, then transferred to the other position and extracted on the solid substratum so that to extract DNA of any microorganism which is found in the sample. It is followed by amplification of nucleic acid on the extracted DNA of microorganisms, then target sequences are mixed with primers with using the DMP. It results in genotyping of any microorganisms found and identifying of the required microorganisms. For implementation of the method, the diagnostic multiplex panel (DMP) applicable for genotyping of pathogenic microorganisms, and a testing kit for microorganisms is used.

EFFECT: use of the invention allows reliable selection of the biological samples and their testing, providing simultaneous testing of a set of microorganisms.

22 cl, 2 dwg, 3 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method involves sampling of an analysed material from proper microbiocoenosis of each cell which are found in hospital facilities. The bacilli identification process is followed by their analysis for pathogenicity and sampling of all strains of non-pathogenic bacilli, then each strain of non-pathogenic bacilli is cultivated individually, studied with respect to ability to probiotic properties, and the detected probiotics are selected. Each of the selected probiotic strains are cultivated separately, and each prepared probiotic culture is used to produce a bacterial suspension dosed 108-109 microbial cells per 1 ml of physiologic saline, and the suspensions of all probiotic cultures are mixed in equal proportions. As required, the prepared mixture of the bacterial suspensions is sprayed over the structural cell elements.

EFFECT: invention allows providing higher sanitary microbiological purity of the animal medium in veterinary hospital environment.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method provides contact of said cell with a peptide nucleic acid (PNA) molecule and a photosensitising agent and cell exposure to light at wave length effective to activate the photosensitising agent where said PNA molecule is conjugated with positive peptide. Also, there are described compositions containing such conjugated PNA molecules, the cells produced with the use of the method, and application of the method.

EFFECT: effective cell capture of peptide nucleic acid molecules conjugated with positive peptide.

37 cl, 13 dwg, 9 ex

FIELD: medicine.

SUBSTANCE: method provides contact of said cell with a peptide nucleic acid (PNA) molecule and a photosensitising agent and cell exposure to light at wave length effective to activate the photosensitising agent where said PNA molecule is conjugated with positive peptide. Also, there are described compositions containing such conjugated PNA molecules, the cells produced with the use of the method, and application of the method.

EFFECT: effective cell capture of peptide nucleic acid molecules conjugated with positive peptide.

37 cl, 13 dwg, 9 ex

FIELD: medicine.

SUBSTANCE: there is offered an improved method for recovery of protein expressed from an open reading frame 2 of porcine circovirus type 2. The method involves the stages of introduction of recombinant baculovirus containing coding sequences of the open reading frame 2, in an insect cell contained in a culture medium. It is followed by expression of the open reading frame 2 by baculovirus and recovery of the expressed protein from a supernatant. Recovery is carried out approximately from the 5th day following cell infection to enable significant amounts of the recombinant protein to be expressed and secreted from the cells in the culture medium.

EFFECT: such methods avoid expensive and labour-intensive recovery procedures requiring separation and recovery of the recombinant protein from an internal cell space.

32 cl, 3 dwg, 24 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: offered test system for quantitative determination of Streptococcus agalactiae includes species-specific primers having nucleotide sequences 5'-CAGTTGAATCCAAATGTTACGG-3' and 5'-TAATGCTGTTTGAAGTGCTG-3', and a probe having a nucleotide sequence 5'-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3'. A DNA target for specific amplification is a gene cfb Streptococcus agalactiae fragment between 685 and 762 nucleotide residues of its complete sequence.

EFFECT: invention allows quick and high-specific detection of Streptococcus agalactiae in samples of a biological material and determination of the definition of its quantitative content.

2 dwg, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method provides test inoculation of a nutrient medium containing pancreatic fish flour hydolyzate, fermentative meat peptone, NaCl, Tween-80, CaCl2, sodium thiosulphate (Na2S2O3 5H2O), ferrous ammonium sulphate ((NH4)2SO4 FeSO4 6H2O), sorbite, bromthymol blue, irgasan (DP-300), rifampicin, NaOH, agar and distilled water in the preset proportions. Pancreatic fish flour hydolyzate, peptone, NaCl, agar are dissolved with heating, sterilised at 121C for 20 min and thereafter added in a hot medium of the other components specified above. The inoculations are incubated on the nutrient medium in aerobic conditions at temperature 37C and/or 28C for 24-48 h and assessed by the presence of black-centre green or dark grey colonies surrounded by a cloudy precipitate zone in the nutrient medium.

EFFECT: invention allows simplifying and providing higher specificity of Shewanella bacteria recovery and identification.

2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, and concerns a lactic bacteria Lactobacillus reuteri DSM 17938 strain stimulating IL-10 production and hence CD4+CD25+TR-cell proliferation used for making a probiotic product. The probiotic product contains Lactobacillus reuteri DSM 17938 strain and additionally medium-chain triglyceride oil.

EFFECT: use of the probiotic product promoted a favorable effect on intestinal colic in a newborn baby.

3 cl, 3 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: inoculate contains in a mixture or in a combination, main L-cystein of formula HSCH2CH(NH2)CO2H and at least one B.animalis lactis strain. Said cysteine and at least one B.animalis lactis strain are contained or have the form of at least one frozen granule and/or at least one lyophilizate. The pH value of the solution produced by thawing of at least one granule and/or dissolution, of at least one lyophilizate in the relation making 1 to 2 g of the lyophilizate per 8-10 ml of H2O, makes at least 4. L-cysteine contains in the inoculate in an amount within 1 g per 11014 CFU to 1 g per 3.51010 CFU, of at least one B.animalis lactis strain or all used B.animalis lactis strains whereas the same are numerous. Using the offered inoculate provides stimulation of B.animalis lactis growth and/or metabolism on a lactic substratum to produce a fermented diary product.

EFFECT: high probiotic value of the product.

21 cl, 9 dwg, 3 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains yeast water, beef hydrolyzate, sodium chloride, glucose, glycerin, sodium citrate, sodium metabisulphite and distilled water.

EFFECT: invention allows providing optimum conditions for brucellous microbe growth, replication in a transport nutrient medium at any distances.

3 ex

FIELD: medicine.

SUBSTANCE: strain of bacteria Bacillus thuringiensis BIOS-1 VKPM B-10709, possessing insectoacaricidal activity against representatives of leaf-eating and sucking pests, such as representatives of orders Lepidoptera, Coleoptera, Homoptera, Thysanoptera and Acariformes, doing harm to crops, is deposited in All-Russian collection of industrial microorganisms (VKPM), Federal State Unitary Enterprise GosNIIgenetika under number B-10709.

EFFECT: invention makes it possible to increase mortality of representatives of leaf-eating and sucking pests, doing harm to crops.

6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: strain of Bifidobacterium longum is separated from bowels content of healthy baby and is deposited in Government collection of microorganisms of normal microflora (GKNM) FSIS "MNIIEM named after G.N. Gabrichevskiy Rospotrebnadzor " under registration number 230. Strain multiplies in various nutrition mediua with accumulation of production biomass with high concentration of bifidobacteria.

EFFECT: Bifidobacterium longum strain has acid-forming activity, antagonistic activity with respect to pathogenic and opportunistic microorganisms, ferments milk, which makes it possible to apply it for obtaining bifidocontaining production.

2 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: method of indicating hospital strains of Pseudomonas aeruginosa, Staphylococcus aureus, Enterobacter cloacae involves identification of an isolated pure culture of bacteria, inoculating the identified bacteria on blood-meat infusion agar while washing accumulated bacteria - S.aureus - after 12 hours, and Exloacae and P.aeruginosa - after 8 hours with sodium chloride solution. Electrical resistance of the suspension of bacteria in the sodium chloride solution is determined at bacteria concentration of 500000 in 1 ml in a dc electric field with 2.8 V across the electrodes. If electrical resistance for P.aeruginosa bacteria ranges from 579 to 674 kom, S.aureus 545-642 kom, Exloacae 452-584 kom and epidemiological data on recording five or more disease cases from one infection source, the isolated infectious agent is considered a hospital strain.

EFFECT: invention cuts time for conducting laboratory investigations and detecting circulation of hospital strains in hospitals, use of the invention does not require intraspecific identification of bacteria.

2 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains enzymeatic hydrolyzate of beef meat, sodium chloride, sodium phosphate bisubstituted, sodium sulfite, Karpuzidi stimulant and purified water in specified component ratio.

EFFECT: invention makes it possible to obtain quality nutrient medium for culturing microbial cells of plague microbe of vaccine strain EB in sufficient quantity during 48 h.

1 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: method involves treating a water-based medium containing sulphate-reducing bacteria SRB in industrial aqueous systems of chemical production and oil refining. Inhibition of production of biogenic sulphide with SRB takes place as a result of synergetic action of a biocide component in a first concentration and a metabolic inhibitor in a second concentration. The biocide immediately destroys the first portion of SRB. The biocide component is selected from a group comprising aldehydes, amine-type compounds, halogenated compounds, sulphur compounds, salts of quaternary phosphonium and/or combinations thereof. The metabolic inhibitor inhibits growth of a second portion of SRB without its direct destruction. The metabolic inhibitor component is selected from a group comprising nitrite, molybdate, tungstate, selenate, anthraquinone and/or combinations thereof. Contact between the SRB and the biocide and metabolic inhibitor can take place continuously, intermittently or simultaneously.

EFFECT: method ensures efficient inhibition of production of biogenic sulphide with SRB during combined use of components in considerably lower concentrations than if the biocide or metabolic inhibitor was used separately.

25 cl, 2 dwg, 1 ex

FIELD: agriculture.

SUBSTANCE: method to produce a probiotic preparation based on sporogenous strains Bac.subtilis and Bac.licheniformis includes their cultivation, mixing of bacterial cells biomasses with protector of microbial cells and subsequent sterile dehydration. For this purpose the method applies the strain Bac.subtilis VKM V-2287 D and the strain Bac.licheniformis VKM V-2414D. Strain biomasses are mixed at the ratio of 1:1. A protector of microbial cells is lactose in amount that provides for cell titre in the finished product after drying of at least 1X1011 CFU/g.

EFFECT: method makes it possible to produce a pluripotential preparation, which may be used to prevent gastrointestinal diseases in farm animals and birds, prevention of stress actions, correction of microflora in intestine in case of digestion processes disturbance.

6 tbl, 2 ex

FIELD: biotechnology, microbiology, medicine.

SUBSTANCE: invention relates to the strain Lactobacillus paracasei CNCM I-2116 used for diarrhea prophylaxis causing by pathogenic microorganisms. Supernatant of this strain culture elicits ability to prevent colonization of intestine with pathogenic microorganisms causing diarrhea also and this strain is designated for preparing agent used for prophylaxis and/or treatment of disorders associated with diarrhea. Agent for oral administration represents therapeutically effective dose of the strain L. paracasei CNCM I-2116 or supernatant of its culture and acceptable foodstuff. Invention provides the enhanced viability of the strain in its applying and effectiveness in prophylaxis of adhesion to intestine cells and invasion to intestine cells of pathogenic microorganisms causing diarrhea.

EFFECT: valuable medicinal properties of strain.

5 cl, 8 dwg, 10 ex

Up!