Method of detection of specific staphylococcus ige-antibodies in blood serum of patient with allergic diseases, hypersensitive to staphylococcus allergens, with using test system for detection of specific staphylococcus ige-antibodies, active allergen substance (aas) recovered from staphylococcus and diagnostic technique for staphylococcus allergy

FIELD: medicine.

SUBSTANCE: invention provides an IFA test system for detection of specific staphylococcus IgE-antibodies in blood serum of a patient with allergic diseases, hypersensitive to staphylococcus allergens; a method for detection of specific staphylococcus IgE-antibodies in blood serum of the patient with allergic diseases, hypersensitive to staphylococcus allergens, with using said test system; and a diagnostic technique for staphylococcus allergy.

EFFECT: application of the declared invention allows detecting staphylococcus allergy.

12 cl, 4 ex, 2 tbl, 1 dwg

 

The invention relates to medicine, namely to Allergology, immunology and clinical laboratory diagnostics.

In Russia allergic diseases suffers from 10 to 30% of the population [1]. Infectious-dependent form in the structure of allergic diseases constitute up to 75% of all allelopathy, among which should be noted seriously leaking diseases: bronchial asthma, chronic bronchitis, rhinitis, allergic, complicated by infection, often leading patients to disability [2]. The economic costs of allergic diseases, complicated by infection, is extremely high due to repeated annual exacerbations of chronic infections in patients.

Based infectious-dependent forms of Allergy is Hyper-reactive sensitised patient's body to allergens, microbes that live on the skin and mucous membranes of the nose, throat, bronchi of patients[3, 4, 5, 6, 7]. Allergenic properties of the microbe depend on the nature of its metabolites, ways of their transformation within the human body, from the specifics of the relationships of living microbial cells with the host organism.

The variety of ways the impact of microbes on macro determines the complexity of the problem allergenicity of bacteria and their metabolites [8]. Earlier studies by numerous authors [9, 10], in particular the staff of the SSC-In is titute immunology FMBA Addo, Vneconomy et al. 1997-2003, it was shown that staphylococci play an important role in the pathogenesis of infectious-dependent forms of Allergy. It was proved the possibility of the formation of immediate type hypersensitivity in patients with respiratory allergic diseases, atopic dermatitis on allergens Staphylococcus. The latter is an important criterion for the assignment of patients allergen-specific immunotherapy allergovaccination from Staphylococcus aureus [11] and further tactics of treatment of patients with immediate type Allergy to Staphylococcus.

The proposed test is an ELISA system allows in terms of "in vitro" to identify specific binding of IgE antibodies in the blood sera of patients sensitized allergens Staphylococcus, and is a necessary addition as in clinical and laboratory diagnosis of staphylococcal allergies, and when developing strategies allergen-specific immunotherapy.

Existing commercial test kits ELISA specificity of staphylococcal only allow to determine the presence in the body of staph infection, not identifying specific IgE response to staphylococcal allergens. In this regard, in the present modern "in vitro"diagnosis of staphylococcal allergies specified ELISA test is missing. Perhaps this is because the longer the initial period of time the main attention of researchers was focused on studying the mechanisms of immunotoxic effects in the effect on the body staphylococcal enterotoxins, and Staphylococcus as the source of allergens that stimulate specific IgE response, was seen as a theoretical developments only isolated pieces[9, 4, 12].

In recent years there have been a series of works, confirming the participation of staphylococcal superantigens in the pathogenesis of allergic diseases, in particular to stimulate the synthesis of IgE antibodies. The proven link allergies to aureus with I (immediate type allergic reactions [13]. This, in turn, demonstrates the necessity of using these test systems ELISA during “in vitro”diagnosis of immediate type Allergy to Staphylococcus[14, 4, 6, 15, 16].

The authors are not found in the prior art analog prototype that is closest to the claimed invention, since our first task was the development of production test systems ELISA for the detection of specific IgE antibodies to Staphylococcus aureus in the blood sera of patients allergic diseases with hypersensitivity to allergens Staphylococcus, and diagnosis of Allergy to aureus using a given test system.

The use of the present invention allows the detection of specific IgE antibodies to Staphylococcus in serum of patients allergic diseases using the proposed test system, high is the setting, and improve the efficiency of diagnosis of Allergy to Staphylococcus.

In accordance with the present invention the test system ELISA for the detection of specific IgE antibodies to Staphylococcus in serum of patients allergic diseases with hypersensitivity to allergens Staphylococcus, includes tablets disposable with immobilized active allergenic substance (AAC), isolated from Staphylococcus, in strips; AAC St. aureus; positive and negative controls (serum); conjugate anti-IgE antibodies; tween-20; buffer with the addition of Twin (pH 7.0 to 7.2) to prepare the solution for cleaning; citrate buffer (pH 4,7) for the preparation of working solution; orthophenylphenol (OPD) in the form of tablets 0.0002 g and perhydrol H2O2- 37% - for the preparation of dye solution; H2SO4as a stop-solution; and instructions for using the kit. While AAC is composed of three active fractions with molecular masses of 50, 130 and 170 kDa.

The second object of the invention is a method of determination of specific IgE antibodies to Staphylococcus in serum of patients allergic diseases with hypersensitivity to allergens Staphylococcus. This method includes the following stages: preparation of the solid phase (tablet) for sorption AAC using CBS - carbonate-bicarbonate is about buffer (pH 9,5); the application of the solution AAC wells; incubation AAC on the solid phase in the cold at 2-4°C for 2 days; laundering buffer (pH 7.0 to 7.2) three times, drying; applying the control subjects and serum in the wells of the respective strips with 50 μl buffer (pH 7.0 to 7.2); incubation in an incubator at 37°C for 2.5 hours; laundering buffer (pH 7.0 to 7.2) three times, drying of the strips; the application of the conjugate solution to all wells strips; incubation in the cold at 2-4°C for 18-20 hours. applying colour OPD in citrate buffer (pH 4,7) to all wells strips, apply to all wells of stop solution; control reactions ELISA optical densities in all samples at a wavelength of 492 nm on Multiscale.

The next object of the invention is a method for the diagnosis of staphylococcal allergies, including the determination of specific IgE antibodies to Staphylococcus aureus in the blood serum of a patient using the above method, and a positive reaction is estimated 2-4 class.

1. MATERIALS AND METHODS

1. Selection and certification of the experimental strains of Staphylococcus to obtain allergenic substances was carried out on the basis of the identification of the specific characteristics of strains of Staphylococcus aureus isolated from patients with bronchial asthma and atopic dermatitis staphylococcal origin, on the basis of bacteriological laboratory GFBW Institute of immunology FMBA, From the eating of live cultures of Gisca them Lautareasca of the CPS with regard to morphological, cultural and biochemical characteristics.

1.2 the Establishment of the Bank-specific sera with high IgE-binding activity with allergens aureus was carried out on the basis of clinical and laboratory examination of patients with respiratory allergic diseases and atopic dermatitis (AD), complicated staphylococcal infection offices NGOs (chief. Professor Lowloss) and CTD. Allergology and immunopathology of the skin (head. Professor Fedenko Y.S.). Examined 47 patients with bronchial asthma and 12 people with HELL, complicated staphylococcal infection (a total of 59 people). Bank-specific sera was 15 samples with intensity ELISA in specific IgE-binding with staphylococcal allergen 2-4 class.

1.3 Getting allergenic fraction produced by the method of cultivation on nutrient media, covered with plastic disks [9] followed by treatment of the cell suspension of Staphylococcus aureus in an ultrasonic disintegrator. Crushing staphylococcal cells was performed using an ultrasonic disintegrator UD-20 by Techpan (Poland) at the operating frequency 22±1,65 kHz and output power of 180 watts. The disintegration took place over 45 minutes Intact fragments of microbial cells besieged by centrifugation, the precipitate was removed. Determined the purity and homogeneity of decantate, the protein content by Kjeldahl method, which is left to 0.5 mg/ml The separation of the protein fractions of the supernatant was performed by electrophoresis in Polyarylamide the gel using the camera for electrophoresis SE 300 mini VE company Hoefer (USA). Fractions with molecular weight of 170, 130 and 50 kDa showed the highest degree of specific IgE-binding in the immunoblot. The selection of these fractions was carried out by gel-filtration using Sephadex G-100 company Pharmacia (Sweden) column company LKB (Sweden) size 3><48 cm (V=340 ml). The elution were 0.04 M Na-phosphate buffer, the amount of the drug 1.5 ml [19]. Faction Mm - 50, 130, and 170 were considered as primary when creating the AAC for the test system.

1.4 assessment of the active allergenic fractions (AAC) was conducted on the basis of specific IgE binding with the test samples "Bank" sera methods ELISA and inhibition ELISA.

1.5 Sorption AAC on the solid phase (tablets collapsible, disposable, high sorption for immunological and biochemical studies, modified, production unitary enterprise STATE research Institute "Biomedical") was carried out in accordance with the method Vneconomy et al., 1993 [20].

1.6 Control the intensity of the specific IgE binding with samples of allergens was performed in the comparative analysis of the intensity of the reactions ELISA with commercial drug UZBEKISTAN, and enterotoxin In ELISA analyzer ImmunoCAP, Phadi and Multiscan MS.

1.7 Testing of the developed test systems ELISA was performed in the clinical laboratory for examination of patients allergic diseases and healthy individuals attending the Clinic of the fgbi "SSC Institute of immunology" FMBA of Russia.

In the framework of the present invention developed the system in-vitro diagnosis of Allergy to the aureus, based on the original allergenic substance Staphylococcus (AAC), the receipt of which is used in the test system requires separate section of the work associated with the release of active strains of Staphylococcus, certification, receive, AAC, assessing the specificity AAC, selection of the conditions of fixation allergenic substance on the solid phase and other

2. RESULTS

2.1 Selection and certification of the experimental strains of Staphylococcus to get AAC

Identification of pure cultures of Staphylococcus made on the basis of a study of the morphology of colonies, production of coagulase, hemolysin, the ability to oxidize carbohydrates under aerobic conditions, the study of their sensitivity to antibiotics [5]. The task of selecting the active experimental strains of Staphylococcus were performed by the laboratory staff No. 87 and CDL (SSC Institute of immunology FMBA of Russia) [21]. The choice of species specificity of Staphylococcus aureus was determined by the results of our previous works showing the mn is the significance given St. aureus in the processes of sensitization of patients with allergic diseases [1, 3]. Were isolated from patients with strains of Staphylococcus and sent for identification to the Department of live cultures of Gisca them Laurasia. These strains of Staphylococcus aureus on the yolk-milk-salt agar to form a homogeneous population of fine-grained, smooth, round, shiny colonies with smooth edges, pronounced Golden pigment and a characteristic accumulation zones lectularius. On blood agar fine colony of grey color with gamma-hemolysis. In the study of smear culture under the microscope discovered a typical gram-positive cocci, arranged singly, in pairs, irregular clusters in the form of bunches of grapes.

Staphylococci isolated a number of exotoxins: hemolysins, destroying human erythrocytes, exfoliatin A and B, causing the syndrome of "scalded skin"syndrome toxin TSST-1 (toxic shock syndrome), leukocidin exerting a cytotoxic effect on polymorphonuclear leukocytes, as well as enterotoxins A-F that cause food intoxication.

Among the components of the cell wall should highlight resemble teichoic acids that stimulate an inflammatory reaction of the body and enhance the adhesion of bacteria to the epithelial surface protein a (agglutinogen), activates the complement system, which results is it the manifestation of local and systemic symptoms of anaphylaxis, the inhibition of the activity of phagocytosis.

Identified by properties (morphological and cultural) samples allergictype experimental strains of Staphylococcus isolated from pathological material produced their lyophilization.

a strain No. 1 Staphylococcus aureus (patient from the Department of bronchial asthma Institute of immunology) - "Ivashkin (strain isolated from the bronchial tubes),

a strain No. 2 Staphylococcus aureus (patient from the Department of bronchial asthma Institute of immunology) - "Peter M.",

a strain No. 3 Staphylococcus hyic.

The passport sample strain "Ivashkin"

1. The number of strain GKM - 201204.

2. The name of the strain of Staphylococcus aureus.

3. Features strain - “Ivashkin”.

Molokan the fgbi “Gnestful immunology” FMBA of Russia.

5. Date received 2009

6. Conditions of cultivation of the strain (environment, temperature, etc.) - MPA, MPB, the agar of Hottinger, broth of Hottinger; t=37°C; 18-24 hours

7. Characteristic morphological and biochemical properties typical.

The selection of allergenic substances (AAC) from Staphylococcus

Immunologically active proteins of bacterial cells of Staphylococcus aureus and exogenous metabolites were identified on the basis of selection vysokoallergennyh strains and special technologies for ballastless bacterial suspensions, and their subsequent modification. The selection and modification of bacterial proteins of Staphylococcus aureus ASU is Astralis physico-chemical methods using disintegration of bacterial cells. The separation of the protein fractions of the supernatant was performed by the method of polyacrylamide gel electrophoresis using the camera for electrophoresis SE 300 mini VE company Hoefer (USA). Fractions with molecular weight of 170, 130 and 50 showed the highest degree of specific IgE-binding in the immunoblot. A further selection of these fractions was carried out by gel-filtration using Sephadex G-100 company Pharmacia (Sweden) column company LKB (Sweden) 3×48 cm (V=340 ml). The elution were 0.04 M Na-phosphate buffer, the amount of the drug 1.5 ml [19]. Fraction f-50, f-130 and f-170 was seen as a major when creating a test system.

Received three active fractions 50, 130 and 170 kDa, which are combined into one active allergenic substance - AAC.

2.2 the Creation of a “Bank” IgE-specific sera for staph

Studies were performed with samples of "Bank" serum with a high concentration of specific IgE antitotal to the allergen Staphylococcus aureus. Selection of positive samples was carried out during the examination sera of patients with hypersensitivity to staph by ELISA (in accordance with the license issued by the health Ministry of the Russian Federation state research center "Institute of immunology" FMBA Russia on clinical trials of medicines ser. FS-1, No. 99-01-002274 dated 2 August 2005, the government. register. №1037739310113) [8].

To perform the tasks of the 1st stage of studies the studies of 2009 was formed "Bank" blood sera of patients allergic diseases and sensitization to Staphylococcus aureus. Hypersensitivity to allergens Staphylococcus was established on the basis of the clinical picture of the disease and the results of skin allergic tests to the standard staphylococcal vaccine VAC-4.

2.3 Standardization AAC was carried out according to the 1st stage of the Program EAACI evaluation of heterogeneous extracts of allergenic source (EAI) [22]. In accordance with the requirements of the Program EAACI described:

the source of the allergenic substance, its authenticity, specificity,

the protein content in ml AAC,

- the degree of specific IgE-binding AAC. Characteristic fractions AAC:

strains St. (certified, see above)

the protein content in AAC was 0.5 mg/ml,

- specific IgE-binding samples "Bank" sera - 2-4 class reaction ELISA.

2.4 Comparative analysis of the specific activity of AAC with drug RUz

Comparative evaluation of specific IgE-binding AAC and Uzbekistan were carried out in ELISA sample Bank sera. To this end, polystyrene plates were applied, respectively:

- AAC Staphylococcus aureus obtained in the Institute of immunology FMBA Russia;

the allergen to Uzbekistan production Bryntsalov-A (Russia), research Institute of pulmonology MH & mi (Russia), RUz-M (Russia);

Control - zero serum that does not contain specific IgE antibodies to Staphylococcus.

Table 1
Indicators specific IgE-binding activity of AAC Staphylococcus aureus from the blood sera of patients in the "in vitro"test ELISA for detection of immediate type Allergy specific IgE-binding allergens St
The form of the allergenManufacturerIgE-antibodies
Class response (M±M)
The number of experiments
AAC Staphylococcus aureusInstitute of immunology3,2±0,27
The allergen to UzbekistanBryntsalov-A (Russia)2,1±0,27
Control∗ (serum)Neg.3
∗ serum containing specific antibodies against Staphylococcus aureus.

From table 1 it is evident that the sample AAC St. aureus obtained in the Institute of immunology, has a specific activity.

The levels of binding of specific IgE antibodies in the blood sera of patients with hypersensitivity to Stapylococcus aureus tested with AAC from Staphylococcus aureus was 3.2±0.2 (class ELISA), that confirms the specific activity of the AAC. The drug RUz - less active.

2.5 experimental Development of technological processes on the basis of the LAS test kits ELISA for determination of IgE antibodies in the blood sera of patients with hypersensitivity to allergens Staphylococcus

For the determination of allergen-specific IgE antibodies was developed optimized method of solid-phase ELISA-based conjugates labeled with horseradish peroxidase (LLC Polyglot”, St. Petersburg) testing the tablet modular, disposable, different sorption for immunological studies. The test system is modified to determine the IgE antibodies on the strips with immobilized allergens (1 strip of 8 wells) CJSC "Biohimik".

Identified optimal conditions for binding AAC Staphylococcus aureus on tablets of varying degrees of sorption allergens. Found criteria for optimal fixation of the drug and the maximum intensity of the specific IgE binding that used at different stages of execution.

The estimation of the specific activity of the developed test systems ELISA.

Requirements for the test system ELISA-based AAC:

- AAC must be able to interact with specific to St. aureus IgE-antibodies positive control sera (positive to the control). The formed complex is detected using peroxidase conjugated monoclonal anti-IgE antibody, forming a color staining with the substrate mixture. The definition of conduct enzyme-linked immunosorbent assay (ELISA) [23].

The definition considered satisfactory if the positive control serum in the interaction with participant samples Staphylococcus aureus gives color staining, optical density that is higher than the optical density of negative control serum

An example of the technological process (TP)

TP-1 - preparation of the solid phase (tablet) for sorption AAC using CBS (pH - 9,25);

TP-2 - the application of the solution AAC wells;

TA-3 - incubation AAC on the solid phase in the cold at 2-4°C for 2 days;

TP-4 - laundering buffer (pH 7.0 to 7.2), drying;

TP-5 - application control subjects and serum in the wells of the respective strips with 50 μl buffer (pH 7.0 to 7.2);

TA-6 - incubation in an incubator at 37°C for 2.5 hours;

TA-7 - laundering buffer (pH 7.0 to 7.2), drying of the strips;

TA-8 - the application of the conjugate solution to all wells strips;

TP-9 - incubation in the cold at 2-4°C for 18-20 hours;

TA-10 - laundering buffer (pH 7.0 to 7.2), drying of the strips;

TA-11 - the application of the dye OPD in citrate buffer (pH 4,7) to all wells strips;

TP-12 - applying to all wells of stop solution;

p> TA-13 - the control reaction, ELISA optical densities in all samples at a wavelength of 492 in Multiscale.

2.6 testing of the developed test systems ELISA in clinical and laboratory studies

Were collected 26 serum samples of patients with respiratory allergic diseases and atopic dermatitis complicated staphylococcal infection. It was shown that serum 81% of the patients with hypersensitivity to St.aureus showed a positive reaction with AAC in the test system ELISA (2-4 class reaction) when compared with positive and negative controls.

Based on the results of the work developed instructions for the use of test kits ELISA for the diagnosis of Allergy to Staphylococcus and layout of the test system (see illustration).

INSTRUCTIONS FOR USE of TEST kits ELISA FOR the DIAGNOSIS of ALLERGY TO STAPHYLOCOCCUS

Purpose: the test is an ELISA system based on AAC St.aureus is designed to detect specific to Staphylococcus IgE antibodies in the blood sera of patients allergic diseases, complicated staphylococcal infection.

Scope: this diagnostic system can be used to detect allergies to Staphylococcus.

The principle of determination: on the basis of the active allergenic substance Staphylococcus (AAC) is a screening ELISA for detection of specific IgE antibodies to Staphylococcus at the Aulnay allergic diseases, complicated staphylococcal infection.

Set the test system includes:

tablets disposable (test system is modified to determine the IgE antibodies on the strips with immobilized AAC (1 strip of 8 wells) CJSC "Biohimik"),

- AAC St. aureus,

- positive control (serum),

- negative control (serum),

- conjugate anti-IgE-antibodies

- tween - 20,

- the buffer with the addition of Twin (pH of 7.2) (for laundering, the working solution),

- citrate buffer (pH 4,7) - working solution,

- orthophenylphenol (OFD), tablets 0.002 g,

- perhydrol H2O2- 37%,

- H2SO4- 50% (stop solution),

- Instruction set.

In citrate buffer to completely dissolve 1 tab. orthophenylphenol, then make hydrogen peroxide 37% (perhydrol) 5 ál (1 tablet)
Table 2.
Preparation of solutions
No.Working solutionsThe composition and preparationStorage
1Wash solutionBuffer (sodium salt-tween-20) pH 7,0-7,2:Be stored at 5±3°C - 7 days
Sodium chloride, analytical grade 9.0 g
Tween-20 of 0 ml
Distilled water up to 1 l
Correction of pH to conduct a 0.2 M solution of sodium phosphate disubstituted
2Working conjugate solution12 ál of conjugate (monoclonal antibodies against Epsilon-chain of human IgE) is placed in 12 ml buffer sodium salt-tween-20 (1 tablet)Be used in the preparation day
3Citrate buffer working solutionCitrate buffer pH 4,7±0,2:Be stored at 5±3°C - 7 days
Citric acid 0,1M, 3 ml
Sodium phosphate one-deputizing 0.2 M, 1 ml
Sodium phosphate disubstituted 0.2 M 2 ml
Distilled water and 6.5 ml
Based on 1 tablet
Correction of pH to conduct a 0.2 M solution of sodium phosphate disubstituted
4Coloring solution IDUse within 1 hour after preparation
5H2SO4- 50% (stop solution)Sulphuric acid (H2SO450%Within 1 year

Equipment:

1. A set of automatic pipettes variable volume "Biohit".

2. The fridge freezer at -20°C.

3. Sterile tips.

4. Tube type "Eppendorf" 1.5 ml.

5. Centrifuge CL/3.

6. MultiScan (Multiskan EX, Thermo Labsystems).

7. Thermostat TC-80M-2.

8. Stirrer Titertek.

9. Ion meter universal EV-74.

10. Tablets collapsible, disposable, modified, high sorption (production unitary enterprise STATE research Institute "Biomedical").

Analysis

- In wells contribute 100 μl of carbonate buffer.

In each well add 20 ál of AAC.

- The tablet is placed for 2 days in the refrigerator.

- Laundering unbound AAC spend 3 times with buffer (pH 7,2).

- All wells strips make 50 ál buffer pH 7.2 and then:

- in strip No. 1 - 50 ál positive control positive serum containing IgE antibodies to Staphylococcus, with the reaction in ELISA - 2-4 class is.

- In strip No. 2 - 50 µl sample of serum containing IgE antibodies to Staphylococcus.

- In strip No. 3 50 ál serum not containing IgE antibodies to Staphylococcus,

- negative control, for 2-3 hours all strips, covered with a lid, placed in a thermostat at t=37°C.

- The tablet is removed, washed with buffer (pH=7,2) 3 times.

- Fill in all wells of each strip 100 ál of working strength conjugate and stand in the refrigerator for 18-20 hours.

- Remove from the refrigerator and washed 3-4 times with buffer (pH 7,2), dry.

- Add to all wells strips 100 ál of paint OFD (working medium), incubated in the dark for 10-15 minutes.

Reaction stopped by the addition of all wells strips 100 ál of 50% R-RA H2SO4.

The results read on Multiscale (at a wavelength of 492 nm).

The measurement results are compared with values in the positive and negative controls, positive reaction is estimated 2-4 class.

Examples of the method of diagnosis

1. The patient Maksimova IV, 33, In 4 years takes antiallergic therapy without effect. The patient spent the determination of specific IgE antibodies to Staphylococcus in the serum of the claimed method. Undecided grade 4 reactions, which was the indication of specific immunotherapy staph immunovaccine./p>

2. The patient Chudaeva EJ, 47 L. Almost all my life suffers from allergies. Accepts treatment, often without effect. The claimed method defined class 4 reaction, which was an indication for specific immunotherapy of staphylococcal immunovaccine.

3. The patient Clarke M, 13 years. Identified grade 3 reactions, which was the indication of specific immunotherapy staph immunovaccine.

4. The patient Kireev C., for 2 years. Identified class 2 response, which was an indication for specific immunotherapy of staphylococcal immunovaccine.

THE LIST OF SOURCES USED.

1. ADO A.D. “General Allergology”, M, 1978, 464 S.

2. Fradkin CENTURIES "Diagnostic and therapeutic allergens, M., Med., 1990, 256 S.

3. Beklemishev N, Suhodoeva G.S."Allergy to bacteria in clinic and experiment", M., Med., 1990, 262 S.

4. Alistina OG, Fedenko ..Staphylococcus aureus in the pathogenesis of atopic dermatitis. ROS., allergic J., 2004, No. 1, p.17-21.

5. Mokrousov M.A., "Influence of Staphylococcus aureus and yeast-like fungi in atopic dermatitis". Diss. Prof. the honey. Sciences. M., 1999

6. Fedoseyev V.N., Molotilov B.A., Larina O.N., Fedosova YEAR "Bacterial Allergy", Penza, THU Tugusheva, 2004, 214 S.

7. Houtaewa AGRICULTURAL Bronchial asthma. Nalchik, 1988, s.

8. State Pharmacopoeia of the USSR, XI 1, 2, M, 1998.

9. Fedoseyev V.N., Kamysheva, VA, OLGA Larina. "A method of obtaining a bacterial allergens Grew. GOS. Registration No. 2183970 from 27.06.2002,

10. A.Oehling, “Bacterial infection in the etiology of bronchial asthma”, Pathophys. and exp. therapy, 1999, No. 1, p.6-11.

11. Reha CM, Ebru And “Specific immunotherapy is effective in the prevention of new sensitivities.” Allergol Immunopathol (Madr) 2007; v35; N 2, p.44-51.

12. Gould H J et al. “The allergic march from St. aureus superantigens to IgE”, Allergy, 2007, 93, 106-136.

13. Gisch K, N. Gehrke “Formalin-fixed Staphylococcus aureus et al particles preven allergic sensitization of type I allergy”. Int Arch allergy Immunol, 2007, v 144 (3) p.183-196.

14. Taskapan M.J., Kumar P. "Role of gets superantigens in atopic dermatitis, Ann Allergy Asthma Immunol, 2000, V. 84(1) p 3-10; p.11-2.

15. Cardona I.D., et al. “Role of bacterial superantigens in atopic dermatis. Am J Clin Dermatol. 2006, 7(5), p.273-79.

16 Lin YT, Wang, C.T. et al "Role of bacterial pathogens in atopic Dermatitis"/ Clin Rev Allergy Immunol., 2007 v 33 (3) p.167-177.

17. Guerin In Purification ana standatdization of allergens. “Rev. Med Suisse Romande, 1994, v 114, N 3, p.251-254.

18. Rules of preclinical safety assessment of pharmacological agents (GLP), Moscow, 1992

19. Siegel LM., Monty K J. Determination of molecular weights and frictional exploration of proteins in impure systems by use of gel filtration and dtnsity gradient centrifugation. Application to crude preparations of sulfite and hidroxylamine reductases. Biochim. et biophis. acta, 1966, 112, p.346-362.

20. Vniigasa, Gvidon and other "Manual of immunological and allergological methods in health research", M, "Prometic", 1993, 319 S.

21. "Guidelines for the control of immunobiologicals. FA is marapana article" - FS-42., M, MOH, 2005

22. "The program EAACI standardization of allergens, ALLERGI, 2004, 59, 571-574.

23. Fedoseyev V.N., Kudrin G.P.(EDS). Guidelines for the assessment of the allergenic properties of pharmacological agents. M: MH, 1988, 22 S.

1. The test is an ELISA system for the detection of specific IgE antibodies to Staphylococcus in serum of patients allergic diseases with hypersensitivity to allergens Staphylococcus, including tablets, disposable with immobilized active allergenic substance (AAS), isolated from Staphylococcus, in strips; AAS St. aureus; positive and negative controls (serum); conjugate anti-IgE antibodies; tween-20; buffer with the addition of Twin (pH 7.0 to 7.2) to prepare the solution for cleaning; Straty bufer (pH 4,7) for the preparation of working solution; orthophenylphenol (OPD) in the form of tablets 0.0002 g and perhydrol H2O2- 37% - for the preparation of dye solution; H2SO4as a stop-solution; and instructions for using the kit.

2. Active allergenic substance (AAS), isolated from Staphylococcus aureus, which consists of three active fractions with molecular masses of 50, 130 and 170 kDa.

3. The method of determination of specific IgE antibodies to Staphylococcus in serum of patients allergic diseases with hypersensitivity to all is rhenum Staphylococcus, using the test system according to claim 1, including the preparation of the solid phase (tablet) for sorption AAS using CBS (pH 9,5); the coating solution in the wells; incubation AAS on the solid phase in the cold at 2-4°C for 2 days; laundering buffer (pH 7.0 to 7.2) three times, drying; applying the control subjects and serum in the wells of the respective strips with 50 μl buffer (pH 7.0 to 7.2); incubation in an incubator at 37°C for 2.5 h; the laundering buffer (pH 7.0 to 7.2) three times, drying of the strips; the application of the conjugate solution to all wells strips; incubation in the cold at 2-4°C for 18-20 h; applying colour OPD in citrate buffer (pH 4,7) to all wells strips, apply to all wells of stop solution; control reactions ELISA optical densities in all samples at a wavelength of 492 nm on Multiscale.

4. The method according to claim 3, in which the tablet is a disposable device with a high sorption.

5. The method according to claim 3, in which the AAC AAC is St. aureus.

6. The method according to claim 3, in which the wash solution contains sodium chloride, tween 20, distilled water.

7. The method according to claim 3, in which the conjugate solution is obtained by placing the conjugate representing monoclonal antibodies against Epsilon-chain of human IgE, in a buffer of sodium salt - tween-20.

8. The method according to claim 3, in which the citrate buffer contains citric acid 0.1 M, sodium FOSFA rakishly one-deputizing 0.2 M, sodium phosphate disubstituted 0.2 M, distilled water.

9. The method according to claim 3, in which the pigment solution obtained by dissolving in citrate buffer 1 tablet orthophenylphenol, with subsequent submission of perhydrol 37%.

10. The method according to claim 3, in which the stop solution is sulfuric acid (H2SO4) 50%.

11. Method for the diagnosis of staphylococcal allergies, including the determination of specific IgE antibodies to Staphylococcus aureus in the blood serum of a patient using the method according to claim 2, and a positive reaction is estimated 2-4 class.

12. The method according to claim 11, in which staphylococcal allergies is allergic immediate-type.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention describes a method for prediction of haematogenic metastasis to remote organs in breast cancer (BC) patients after anticancer treatment by determining blood values, namely immune system values in diagnosing during anticancer treatment and after termination thereof: peripheral blood CD4+ cell count, %, peripheral blood CD8+ cell count, %, peripheral blood CD56 cell count, %, peripheral blood CD22+ cell count, %, peripheral blood CD95+ cell count, %, a functional neutrophil reserve in nitro blue tetrazolium reduction test, standard units, functional neutrophil reserve in nitro blue tetrazolium reduction test, %, spontaneous neutrophil activity in nitro blue tetrazolium reduction test, standard units, spontaneous neutrophil activity in nitro blue tetrazolium reduction test, %, circulating immune complex level, standard units, blood serum immunoglobulin G (IgG) level, g/l, blood serum IgM level, g/l, blood serum IgA level, g/l, immunoregulatory index (CD4+/CD8+), level of spontaneous tumour necrosis factor α production (TNFα) by peripheral blood cells, pg/ml, level of spontaneous intreleukin-1β (IL-1β) production by peripheral blood cells, pg/ml, level of stimulated IL-1β production by peripheral blood cells, pg/ml, peripheral blood CD3+ cells count, %, activity of blood serum complement system, standard units, peripheral blood CD25+ cells count, %, a phytohemagglutinin stimulated lymphocyte proliferation index, phytohemagglutinin stimulated proliferative lymphocyte activity, spontaneous proliferative lymphocyte activity, level of peripheral blood cells with morphological apoptosis signs, %; discriminant functions Y1, Y2 are calculated by discriminant equations related to each follow-up stage; a classified case is referred to that class of prognosis for which a greater value of the calculated discriminant function is obtained.

EFFECT: method allows providing higher prediction accuracy and information value of haematogenic metastasis in the BC patients exposed to combined anticancer treatment for 3 years after diagnosing.

4 ex, 14 tbl, 1 dwg

FIELD: medicine.

SUBSTANCE: urine Bc1-2 content is determined in a patient by an immunoenzyme technique. If detecting the Bc1-2 level exceeding 2.0 ng/ml, ovarian cancer is diagnosed in the patient.

EFFECT: use of the method provides high-accuracy early detection of ovarian cancer.

15 cl, 12 dwg, 2 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention relates to method of predicting emergence of unfavourable neurologic consequences of surgical operation.

EFFECT: invention ensures adequate prediction of risk of transitory ischemic attacks or stroke with determination of biochemical marker before operation.

17 cl, 6 ex, 2 dwg, 5 tbl

FIELD: medicine.

SUBSTANCE: invention describes method of estimating severity of course of hemorrhagic fever with renal syndrome, which includes determination of marker of vessel endothelium dysfunction in blood, where in blood plasma as marker of vessel endothelium dysfunction determined is concentration of antigen of inhibitor of plasminogen 1 type (IAP-1) activators in febrile period of disease and value of IAP-1 antigen concentration from 341.2 to 570.0 ng/ml is estimated as predictor of moderate form of disease, from 240.0 to 320.1 ng/ml - as predictor of severe form of disease without complications, from 138.3 to 75.5 ng/ml value is estimated as predictor of severe form of disease with complicated course.

EFFECT: invention makes it possible to estimate severity of HFRS course in order to predict in the earliest terms development of disease complications.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: method includes determining complex of serum cytokines in period of disease beginning. In case of tick-born encephalitis level of interleukin-1 α is determined in interval 298-358 pg/ml, interferon-γ-295-350 pg/ml and interleukin-10-115-150 pg/ml; at ixodid tick-borne borreliosis - interleukin-1 α 178-270 pg/ml, interferon-γ 125-190 pg/ml and interleukin 10-11.5-18 pg/ml; in case of mixed infection, generated by virus of tick-borne encephalitis and borrelia - interleukin-1 α- 30-75 pg/ml, interferon-γ 115-130 pg/ml and interleukin-10 -22-65 pg/ml.

EFFECT: method is simple, makes it possible to determine disease causative agent reliably and accurately in short terms.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: described is method of cell analysis by means of biochip, containing immobilised molecules of substances, able of binding with molecules, which are on the surface of cells, includes incubation of biochip with suspension of cells. Then, washing of biochip from nonspecifically bound cells is carried out. After that, fixation and staining of cells, reading of results and estimation of quantity of cells, which bound in one or several parts of biochip of the given area, are performed. In conclusion, analysis of the image of bound cells is carried out. Before carrying out fixation from biochip surface excess of liquid is removed, without permitting it to dry.

EFFECT: improvement of technology.

4 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: blood serum is analysed for the contents of human tissue inhibitor of matrix metalloproteinases (hTIMP-1) by an ELISA technique. If hTIMP-1 ranges within 138 ng/ml to 183 ng/ml, the presence of early subclinical renal irritation in the patients suffering hypertensive disease with normal glomerular filtration rate with the absence of microalbuminuria is stated.

EFFECT: use of the technique allows diagnosing early subclinical renal irritation in the suffering hypertensive disease with normal glomerular filtration rate with the absence of microalbuminuria, use of the technique makes it possible to control clinical effectiveness.

2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: blood serum of a patient on her 38-40 week of pregnancy is analysed for the lactoferrin (LF) contents. If observing the LF value 4.5 mcg/ml and less, the absence of a pre-natal foetal infection and birth of a healthy child 8-9 points by Apgar score are predicted. If observing the LF value 4.5 mcg/ml and more, the presence of a pre-natal foetal infection and birth of a healthy child underevaluated by Apgar score 7 and less.

EFFECT: use of the method allows of high-accuracy prediction of a foetal condition and the presence of the pre-natal infection that allows optimising a therapeutic approach in newborns and well-timed treatment of the pre-natal infection.

2 ex

FIELD: medicine.

SUBSTANCE: method involves bacteria transfer from a sample in phosphate-buffered saline, addition of a magnetic particle suspensions with antibodies fixed thereon to certain types of bacteria, incubation with mixing. A magnetic sampler probe with a replaceable nonmagnetic tip is introduced into an incubating tank where a magnetic field generated by the magnetic sampler probe makes the complexes of magnetic particles - antibodies - bacteria to be collected on the tip; the sampler probe is transferred to a distilled water tank for washing from bacteria not bonded with antibodies. Final re-slurrying is ensured by transferring the sampler probe into the distilled water tank and separating the nonmagnetic tip from the magnetic probe; mixed magnetic particles and complexes of a magnetic particle - an antibody - bacteria are transferred in an aqueous medium which is placed in a measuring cell of an electro-optical analyser wherein a variable electric field is generated to record changes of optical properties of the suspension, in the form of a frequency dispersion of anisotropy of polarizability (FDAP) which provides a basis to state the presence or absence of target bacteria in the sample in case of the presence or absence of a FDAP peak ranging within 100 to 10000 kHz respectively.

EFFECT: invention allows simplifying and accelerating a bacteria identification process, and carrying it out in an automatic mode.

2 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: method involves DNA genome recovery of an examined woman followed by PCR analysis of site of MTHFR and PAH genes by mixing the components and adding oligoprimers, and analysis of polymorphism of restriction fragment lengths and visualisation of electrophoregram in a polyacrylamide gel. For amplification for the purpose of analysis of the site of MTHFR gene, an upstream primer CCAGTCCCTGTGGTCTCTTCAT and a downstream primer AGGGAGCTTATGGGCTCTCCT are used; for the purpose of analysis of the site of PAH gene, an upstream primer CAGAGAGAGTCTGGCCACGT and a downstream primer CGTGATTGTCTAGGTTTTGTCTGTCTAGG are used. If observing the MTHFR 677T/T and/or PAH -675 4G/4G, a risk of gestosis is predicted.

EFFECT: higher accuracy of prediction of risk of gestosis.

2 dwg, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to compound, represented by the following formula (I), where R represents hydrogen atom or P(=O)(OH)2, X represents oxygen atom or sulphur atom, Y represents CH2CH2 or CH=CH, R1 represents trifluoromethyl, difluoromethyl or cyano, R2 represents alkyl, which has 1-4 carbon atoms, and optionally substituted with hydroxyl group (groups) or halogen atom (atoms), R3 and R4 can be similar or different, and each represents hydrogen atom or alkyl, which has 1-4 carbon atoms, and n=5-8, or its pharmaceutically acceptable acid-additive salt. Invention also relates to 2-amino-2-[2-(4-heptyloxy-3-trifluoromethylphenyl)ethyl]propan-1,3-diol or its hydrochloride and pharmaceutical composition, containing said compounds.

EFFECT: elaboration of pharmaceutical composition, applied for treatment or prevention of autoimmune diseases, prevention or suppression of resistance or acute rejection or chronic rejection of organ or tissue transplant; treatment or prevention of graft-versus-host disease (GvH) resulting from transplantation of bone marrow; or treatment or prevention of allergic diseases.

16 cl, 39 ex

FIELD: chemistry.

SUBSTANCE: disclosed compounds can be used as an antipruritic agent in case of atopic disease such as atopic dermatitis when a steroid medicinal agent is ineffective. In formula R is C1-6 alkoxy, optionally substituted methyoxy, or an amine which is monosubstituted with C1-6 alkyl, where the R-C(=O)- group is bonded in the meta or para-position.

EFFECT: high efficiency of using said compounds.

21 cl, 16 dwg, 4 tbl, 30 ex

FIELD: medicine.

SUBSTANCE: invention refers to application of enterovirus in preparing a pharmaceutical composition for prevention or treatment of the diseases associated with IgE-mediated allergic sensitisation and related diseases with using an enteroviral vaccine in which enterovirus does not contain an exogenous nucleotide sequence integrated into a viral genome and coding an allergen causing said allergic sensitisation, and also to a method for prevention or treatment of said diseases.

EFFECT: effective products for treating said diseases.

10 cl, 3 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: nutritional and pharmaceutical composition in form of baby food contains fat, protein and carbohydrate components and includes milk serum and casein with weight ratio of casein to serum from 1:1 to 1:2.4. They contain, at least: 3 g of arginine per 100 g of protein, from total content of fatty acids: 10 wt % of linoleic acid, 1 wt % of alpha-linoleic acid, one long-chain polyunsaturated fatty acid, selected from group, consisting of docosahexaenic, arachidonic and eicosapentaenoic acid, to 25 wt %, at least one polyunsaturated fatty acid and 2-12 g of indigestible oligosaccharides with polymerisation degree from 2 to 100 per 100 g of dry weight of said composition, as well as neutral and acidic oligosaccharides, containing units of uronic acid. Pharmaceutical composition is applied in treatment and/or prophylaxis of inflammatory disease, diarrhea, eczema and/or atopic dermatitis. Prevention of allergy or diarrhea is performed by introduction of composition to child enterally or perorally.

EFFECT: inventions ensure stimulation of immune system maturing and development in babies of intestine and intestinal flora, similar to flora, obtained during breast feeding, optimal feeding, prevents penetration of allergens into general blood circulation and reduces risks associated with feeding with baby's formula based on milk serum.

17 cl, 4 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions relates to medicine and can be applied for treatment of hyperaemia and edema of mucous membrane of upper airways. For this purpose introduced is loratadine or proper quantity in form of its acceptable salt in combination with phenylephrine or as monomedication. Loratadine is introduced in regimen 2.5 mg four times per day, and phenylephrine is introduced in regimen 8-10 mg four times per day. Loradadine introduction in regimen 2.5 mg per day makes it possible to reach high efficiency of treatment in absence of side reactions.

EFFECT: treatment efficiency by loratadine in combination with phenylephrine in claimed regimen is conditioned by their synergetic effect as well as in absence of side reactions.

28 cl, 3 tbl, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to peptides inhibiting mucin hypersecretion. The peptides have an amino acid sequence containing up to 24 amino acid residues of the sequence GAQFSKTAAKGEAAAERPGEAAVA which can have at least one amino acid substitute in said sequence selected from a group consisting of the substitute of A by K, the substitute of F, K, G, Q, S, T and/or E for A; or the substitute of Q for E.

EFFECT: preparation of a pharmaceutical composition on the basis of the peptides for mucin hypersecretion inhibition.

28 cl, 9 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: claimed is application of solid peroral dosing composition of prolonged action, which includes (a) core, containing effective amount of pseudoephedrine or its salt, (b) first envelope, covering core and including swelling in water film-forming neutral or cationogenic copolymer ester, film modifier and lubricating substance, and (c) second envelope, covering first envelope and including effective amount of desloratadine, amount of pseudoephedrine or its salt is sufficient for ensuring maximaum of average geometrical values of pseudoephedrine concentration in plasma, from 345 to 365 ng/ml, for the time from 7.60 to 8.40 h, and amount of desloratadine is sufficient for ensuring maximum of its average geometrical values of concentration in plasma, from 2.10 to 2.45 ng/ml, for period from 4.0 to 4.5 h after intake of single dose of said composition, for preparation of medication for treatment of allergic and/or inflammatory states of upper and lower respiratory ways and skin, or urticaria and nasal and non-nasal symptoms of year-round and seasonal allergic rhinitis.

EFFECT: composition ensures necessary profile of active agents release and is efficient in treatment of allergic bronchospasm, couphing, seasonal allergic rhinites.

3 cl, 4 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to a new acid dihydrogenphosphate of 2-(3-{6-[2-(2,4-dichlorophenyl)ethylamino]-2-methoxypyrimidine-4-yl}phenyl)-2-methylpropionic acid of formula optionally in a crystalline form exhibiting cAMP inhibitor properties. Also, the invention refers to a pharmaceutical composition.

EFFECT: compound can find application for treating the diseases associated with cell expression of prostaglandin D2 in such diseases, as allergic rhinitis, bronchial asthma, allergic conjunctivitis, etc.

3 cl, 12 dwg, 1 tbl, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to chemical-pharmaceutical industry, namely to creation of medication, which possesses anti-inflammatory and regenerating action. Medication contains the following ingredients: conifer needle extract, purified oleoresin of cedar or pine, or spruce, or fir, or larch or their mixture in equal proportions, vegetable oil.

EFFECT: medication has increased effectiveness and efficiency and also extends arsenal of medications, which have anti-inflammatory and regenerating action.

7 cl, 9 ex, 2 tbl

FIELD: chemistry.

SUBSTANCE: in formula (I) Cy1 is a 6-member heterocyclyl containing N as a heteroatom, a 5,6-member monocyclic or 9,10-member bicyclic heteroaryl containing 1-3 heteroatoms selected from N, S and O, phenyl or phenyl condensed with a 5-member heterocycle containing O as a heteroatom, each optionally having 1-3 identical or different substituting Cy1 groups which are: (C1-C6)-acyl, cyano, carboxy, hydroxy, (C1-C6)alkylsulphonyl, (C3-C6)-cycloalkyl, a 6-member heterocyclyl containing 1-2 heteroatoms selected from O and N, phenyl, a 5-member heteroaryl containing 1-3 heteroatoms selected from N, S and O, Y1Y2N-, Y1Y2NC(=O)-, Y1Y2NSO2-, (C1-C6)-alkyl-SO2-N(R5)-C(=O)-, R6-C(=O)-N(R5)-, R7-NH-C(=O)-NH-; (C1-C6)-alkoxycarbonyl; (C1-C6)-alkyl, which optionally contains 1-3 identical or different substitutes which are halogen, carboxy, cyano, hydroxy, Y1Y2N-, Y1Y2N-C(=O)-, R6-C(=O)-N(R5)-, R8-SO2-N(R5)-C(=O)-, 5-member heterocyclyl, containing N as a heteroatom, 5-member heteroaryl containing 1-3 heteroatoms selected from N and O; or (C1-C6)-alkoxycarbonyl; as well as (C1-C6)-alkoxy which optionally have 1-3 identical or different substitutes which are carboxy, (C1-C6)-alkoxycarbonyl, cyano, 3-member heterocyclyl containing O as a heteroatom, or 5-member heteroaryl containing 1-3 heteroatoms selected from N and O; where phenyl or heteroaryl fragments in the substituting Cy1 groups optionally and independently have substitutes represented by hydroxy, (C1-C6)-alkyl, (C1-C6)-alkoxy, carboxy, (C1-C6)-alkoxycarbonyl or R8-SO2-N(R5)-C(=O)-; and where cycloalkyl fragments in the substituting Cy1 groups which optionally and independently have substitutes represented by (C1-C6)-alkoxy, carboxy; Cy2 is a 9-member cycloalkenyl, phenyl, 5,6-member monocyclic or 9,10-member bicyclic heteroaryl containing 1-3 heteratoms selected from N, S and O, or phenyl condensed with a 5,6-member heterocycle containing 1-2 heteroatoms selected from N and O, each independently and optionally having 1-3 identical or different substitutes represented by (C1-C6)-alkoxy, (C1-C3)-alkyl, hydroxy, halogen, halogen-(C1-C6)-alkoxy, nitro, Y1Y2N-; L1 is an alkylene with a straight or branched chain containing 1-6 carbon atoms, optionally substituted carboxy; or L1 is -CH2-(C1-C5)halogenalkylene; L2 is a bond, -O- or -CH2-O-. Other values of radicals are given in the formula of invention.

EFFECT: novel compounds have prostaglandin D2 receptor antagonist properties, can be used in treating primarily allergic disorders such as allergic rhinitis, allergic conjunctivitis, atopic dermatitis, bronchial asthma, food allergy and other diseases.

39 cl, 1 tbl, 99 ex

FIELD: medicine, immunology, nucleic acids.

SUBSTANCE: invention relates to a method for stimulation of the immune response using nucleic acids-containing immunostimulating compositions, oligonucleotide-containing composition and to a method for treatment or prophylaxis of allergy or asthma. For stimulation of the immune response thymidine-enriched nucleic acid comprising poly-T sequences and/or comprising above 60% of thymidine-containing nucleotide residues is administrated. Invention provides the development of new method for stimulation of the immune response due to administration of the proposed immunostimulating nucleic acid.

EFFECT: valuable medicinal properties of nucleic acid.

27 cl, 12 dwg, 12 ex

Up!