Method for producing protein

FIELD: medicine.

SUBSTANCE: method involves cultivation of an obligate methanol-assimilating bacterium Methylophilus methylotrophus or Methylobacillus glycogens in a fluid medium with the bacterium secreting an end protein from a bacterial cell where said bacterium has a DNA structure containing a promoter sequence functioning in the methanol-assimilating bacterium, a nucleotide sequence coding a polypeptide containing a signal sequence which functions in the methanol-assimilating bacterium, and a sequence of the end protein functionally connected with the promoter sequence.

EFFECT: method allows producing the protein effectively by means of extracellular secretion, difficult-to-produce by means of secretory production with application of Escherichia coli bacteria.

5 cl, 7 ex

 

The technical field

The present invention relates to a method of secretory protein products, including those used in industrial scale enzyme or biologically active protein, through the application of assimilating methanol bacteria.

Prior art

Methanol is an enzymatic substance, available in large quantities at low cost, which is extremely valuable as a source of carbon. A method of production of L-amino acids with the help of assimilating methanol bacteria use as a primary carbon source methanol (patent document 1) and a method of production of the polysaccharide with the use of assimilating methanol bacteria (patent document 2).

In addition, up to this time was a well-known example of products lacZ in bacterial cells using promoter gene alcoholiday (AOX) by induction with methanol in the yeastPichia(non-patent document 1) and an example of the secretion of Aprotinin (bovine pancreatic trypsin inhibitor) in the culture supernatant in the form of active forms (non-patent document 2).

In addition, a well-known example of accumulation of fluorescent protein (GFP) in the cell deobligate assimilating methanol bacteriaMethylobacterium extorquensthat is one of assimi arousih methanol bacteria (patent document 3 and non-patent document 3). However, it was not known example of secretion of the protein outside the cell obligate assimilating methanol bacteria.

Patent document 1: EP 1188822

Patent document 2: JP 11-56384 A

Patent document 3: WO 2003/046226 A1

Non-patent document 1: Nucleic Acids Res. 1987 May 11; 15(9): 3859-76.

Non-patent document 2: J Ind Environ. 1991 Apr; 7(3): 197-201.

Non-patent document 3: FEMS Environ Lett. 2000 Dec 15; 193(2): 195-200

Description of the invention

The object of the present invention is a method for the efficient secretory production of the protein, which is difficult to get through the secretory products using bacteriaEscherichia colior other

The authors of the present invention paid attention to obtained from assimilating methanol bacterial promoter and signal sequence and conducted extensive research. In the result, it was found that the secretory products of the protein can be effectively accomplished by culturing in a liquid medium containing methanol as a main carbon source, assimilating methanol bacteria with the design of DNA containing operating in assimilating methanol bacteria promoter sequence and the nucleotide sequence encoding the signal sequence and the target protein, thus accomplishing the present invention.

Thus, the present invention is tositsa the following objects.

(1) a Method of production of the protein, including the cultivation of assimilating methanol bacteria with the design of DNA containing a promoter sequence that functions in assimilating methanol bacteria, and the nucleotide sequence encoding the polypeptide comprising a signal sequence and the sequence of the target protein, is functionally linked to the promoter sequence, in a liquid medium containing methanol as a main carbon source, to ensure secretion by bacteria of the target protein and the secretion secreted target protein.

(2) the Method according to (1), where functioning in assimilating methanol bacteria promoter sequence selected from the group consisting of the promoter of metadataproperty, tac promoter, σE promoter and promoter and a ribosomal protein.

(3) the Method according to (1), where the promoter sequence is a nucleotide sequence of SEQ ID NO: 11, 12, 21 or 22.

(4) the Method according to any of (1)to(3), where the signal sequence is a signal sequence of a protein selected from metadataproperty, phytase and acid phosphatase.

(5) the Method according to any of (1)to(3), where the signal sequence has an amino acid sequence selected from SEQ ID NO: 18 and SEQ ID NO: 20.

(6) the Method according to any of (1)to(5), where a is similarbuy methanol bacterium is a bacterium, selected from the group consisting of bacteria belonging to the generaMethylophilus, Methylobacillus, Methylophaga, Achromobacter, Pseudomonas, Protaminobacter, Methanomonas, MicrocyclusandMethylobacterium.

(7) the Method according to any of (1)to(6), where the protein is selected from the group consisting of phytase, interleukin, transglutaminase, interferon, insulin, acid phosphatase and peptident.

(8) the Method according to any of (1)to(7), where assimilating methanol bacterium is an obligate assimilating methanol bacterium.

(9) the Method according to p.(8), where obligate assimilating methanol bacterium selected from the group consisting of bacteria belonging to the generaMethylophilus, MethylobacillusandMethylophaga.

Description of the preferred embodiments

The method of production according to the present invention includes the cultivation of assimilating methanol bacteria with the design of DNA containing a promoter sequence that functions in assimilating methanol bacteria, and the nucleotide sequence encoding the polypeptide comprising a signal sequence and the sequence of the target protein, is functionally linked to the promoter sequence, in a liquid medium containing methanol as a main carbon source, to ensure secretion by bacteria of the target protein; and the allocation of the secreted target protein. Here, the term "to secrete which indicates the allocation or release of the target protein from bacterial cells and does not include the accumulation of the target protein in the cells.

Thus, assimilating methanol bacterium produces containing the signal sequence and the target protein polypeptide, and then the cleavage of the signal sequence of the target protein is transferred into periplasm, indirect, thus, of bacterial cells. For product secrete the target protein secreted protein. Next, production of a protein referred to as secretory products of protein" if the opportunity for bacteria to secrete protein and isolate protein.

It is widely known that secretory protein is translated in the form of prepeptide or preprepared and developing into a Mature protein. Thus, it is well known that secretory protein is translated in the form of prepeptide or preprepared and developing into a Mature peptide or propeptide hydrolysis privalkovoj part, and propeptide additionally turn into Mature protein hydrolysis proalcool part using a protease. Such splitting of the signal peptide protease typically refer to as a signaling peptidase.

In the present invention, the target protein can secrete the Mature form of the protein or propeptide, and if the target protein is secreted in the form of propeptide, propeptide can be turned into a Mature protein during processing of propeptide appropriate protease after extraction.

In this description, the term"signal sequence" means a sequence, available on the N end of the prior type of secretory protein and determined, when the protein is secreted, and the term "signal peptide" means a peptide consisting of amino acid residues.

In this description of a protein that has priselkov sequence and proalcool part, therefore, the primary product of translation can be described as "prepublic", whereas protein without privalkovoj sequence and having proalcool part can be described as "probelec". Proalcool part of probely can be described as "probatova structural part" or simply "probatova structure", and in this description the term "probatova structural part/probatova structure of protein is equivalent to apply the term "probatova part of the protein.

Used in the method of production according to the present invention, the bacterium can be obtained by the introduction of assimilating methanol bacterium constructs containing DNA functioning in assimilating methanol bacteria promoter sequence and the nucleotide sequence encoding the polypeptide comprising a signal sequence and the sequence of the target protein, functionally associated with the promoter sequence.

In this case, the term "assimilating methanol bacterium" means a bacterium which can grow in an environment that sod is Rasa methanol as a main carbon source, and their examples include bacteria belonging to the generaMethylophilus, Methylobacillus, Methylophaga, Achromobacter, Pseudomonas(JP 45-25273 A), Protaminobacter(JP 49-125590 B), Methanomonas(JP 50-25790 A), Microcyclus(JP 52-18886 A) andMethylobacterium.Among them, preferred is an obligate assimilating methanol bacteria, which cannot grow or may grow slightly in the medium containing glucose as the only carbon source. Specific examples of such bacteria are able to grow in a medium containing methanol as a carbon source, but not capable of growing and poorly growing in the medium containing glucose as the sole carbon source, include bacteriaMethylophilus,bacteriaMethylobacillusand bacteriaMethylophaga.Example bacteriaMethylophilusincludesMethylophilus methylotrophus,examples of bacteriaMethylobacillusincludeMethylobacillus glycogenesandMethylobacillus flagellatusand examples of bacteriaMethylophagaincludeMethylophaga thalassica, Methylophaga marinaandMethylophaga alcaliphila(Biology of Methylotrophus; Edited by Israel Goldberg and J.Stefan Roken and published by Butterworth-Heinemann). In addition, also preferred are bacteria, which are able to secrete metaalbewerking (MHD) outside the bacterial cells.

Examples ofMethylophilus methylotrophusinclude strain AS1 (NCIMB 10515), W3A1 (strain NCIMB 11348) and strain ATCC 53528. Strain AS1Methylophilus methylotrophus(NCIMB 10515) and W3A1 (strain NCIMB 11348) are available in the National Collections of Industrial and arine Bacteria, address: NCIMB Lts., Torry Research Station, 135, Abbey Road, Aberdeen AB9 8DG, United Kingdom.

Examples ofMethylobacillus glycogenesinclude strain T-11 (NCIMB 11375), strain ATCC 21371, strain ATCC 29475, strain ATR80 (described in Appl. Environ. Biotechnol., (1994), vol.42, page 67-72) and strain A513 described in Appl. Environ. Biotechnol., (1994), vol.42, page 67-72). Strain NCIMB 11375Methylobacillus glycogenesavailable in the National Collections of Industrial and Marine Bacteria, address: NCIMB Lts., Torry Research Station, 135, Abbey Road, Aberdeen AB9 8DG, United Kingdom.

Examples ofMethylobacillus flagellatusinclude strain ATCC 51484, strain KT (described in N.I.Govorukhina et al., Microbiology (Russia) 56 (1987), p.849-854) and strain VKM B-1610. Strain VKM B-1610Methylobacillus flagellatusavailable in ALL-RUSSIAN COLLECTION OF MICROORGANISMS (Russia, 142290, Moscow Region, Pushchino, pr. Nauki, 5 IBMP).

Strain ATCC 53528Methylophilus methylotrophusstrain ATCC 21276Methylobacillus glycogenesstrain ATCC 21371, strain ATCC 29475, strain ATCC 51484Methylobacillus flagellatusyou can get in American Type Culture Collection (ATCC) (address ATCC, Address: P.O. Box 1549, Manassas, VA 20108, 1, United States of America).

Examples ofMethylophaga thalassicainclude strain ATCC 33145 and strain ATCC 33146. ExampleMethylophaga marinaincludes strain ATCC 35842. ExampleMethylophaga alcaliphilaincludes ATCCBAA-297™. Strain ATCC 33145 and strain ATCC 33146 can be obtained in the American Type Culture Collection (ATCC) (address ATCC, Address: P.O. Box 1549, Manassas, VA 20108, 1, United States of America).

The term "functioning in assimilating methanol bacteria promoter"contained in the structure of DNA, introduced in assimilating methanol bacterium belongs to the promoter with promoter activity in assimilating methanol bacteria, but the floor is giving promoter is not limited assimilative methanol bacteria, and can be derived from another microorganism. In addition, a "functioning in assimilating methanol bacteria promoter" includes induced by methanol promoter and pendulums promoter. Examples induced by methanol promoter include a promoter of a gene of metadataproperty, the promoter of the gene dihydroxyacetophenone and the promoter of the gene of formiatehydrogenlyase.

Specific examples of functioning in assimilating methanol bacteria promoter as a non-limiting example include induced by methanol promoter gene metadataproperty (SEQ ID NO: 11), the tac promoter, which is vysokoagressivnyh promoter derived fromEscherichia coli(SEQ ID NO: 12), σE promoter (SEQ ID NO: 21) and the promoter of the ribosomal protein (SEQ ID NO: 22).

In addition, the promoter sequence is not limited to promoter wild-type and may be a promoter obtained by modifying the sequence of the wild type so that the target gene was highly expressed. For example, the sequence can be obtained by modifying the promoter sequence of the wild type to have a substitution, deletion, insertion or insertions of a few nucleotides, provided that the promoter has promoter activity in the above bacteria. In addition, to increase the promotor asset the spine of the promoter can be modified in the -35 region and -10 region or be modified by changing the length of the spacer elements between the -35 region and -10 region. Examples of modification -35 and -10 regions include the method described in EP 1033407, and the method described in Nucleic Acids Res. 1999 Dec 15; 27(24): 4768-74.

Promoter activity is determined by the frequency of initiation of RNA synthesis. Examples of the method for assessing promoter activity and active promoters that can be used according to the present invention, are described in Goldstein et al. (Procariotic promoters in biotechnology. Biotechnol. Annu. Rev., 1995, 1, 105-128) or other in Addition, as described in WO 00/18935, the promoter can be modified to a more active promoter by introduction of nucleotide substitution of several nucleotides in the promoter region of the target gene.

In introduced in assimilating methanol bacterium design DNA nucleotide sequence encoding a polypeptide comprising a signal sequence and the target protein, functionally linked to a sequence to the right of the promoter.

"Functioning in assimilating methanol bacteria signal sequence" refers to a sequence, the focus of assimilating methanol bacteria to secrete the target protein, in those cases when it is associated with a target protein.

The signal sequence can be obtained from a protein that is different from the target protein, or contained in the protein-the predecessor of the target protein. However, preferably the signal sequence get icecreamiho protein used assimilating methanol bacteria-host. Signal sequence, which can be used according to the present invention may contain a portion of the N-terminal amino acid sequence of the target protein with the signal sequence of the protein is the precursor from which the signal sequence.

If the source signal sequence differs from the sequence of the target protein, prepublic can be described as "heterologous merged prepublic". For example, if the protein is insulin, it is designated as "heterologous flushed preproinsulin" as opposed to "preproinsulin" or "proinsulin".

The signal sequence is not specifically limited if it functions in assimilating methanol bacteria, and can be applied signal sequence derived from a protein secreted from assimilating methanol bacteria, or signal sequence derived from a protein secreted from other bacteria, yeast, plants, animals, etc. a Specific example of the signal sequence comprises a signal sequence metadataproperty (MHD), obtained fromMethylophilus methylotrophus(amino acid sequence SEQ ID NO: 18). In addition, samples obtained from other bacteria signal sequences include a serial signal is inost phytase, the encoded gene appAEscherichia coli(amino acid sequence SEQ ID NO: 20) and the signal sequence of acid phosphataseMorganella morganii(positions 1 to 20 of SEQ ID NO: 26). The nucleotide sequence encoding the amino-acid sequence shown in SEQ ID NO: 17, 19 and 25.

The nucleotide sequence encoding a signal sequence can be a nucleotide sequence encoding a signal sequence of a wild type, or the nucleotide sequence encoding the signal sequence of the wild-type, you can override so that the codons of the sequence represented codons suitable for application of assimilating methanol bacteria secreting and producing protein.

A "target protein"that can be secrete and extracted using the method of the present invention, is not specifically limited, while it is possible to secrete with the use of assimilating methanol bacteria, if it is associated with a signal sequence that functions in assimilating methanol bacteria, and includes various proteins, such as secretory proteins and intracellular proteins derived from animals, plants and microorganisms. The method according to the present invention can be applied to protein, which does not receive the ri using secretory products in gram-negative bacteria, such as the bacteriumEscherichia.A "target protein" is preferably a heterologous protein obtained from a source different from assimilating methanol bacteria-host.

When secreted protein is used as a "target protein"can be applied protein sequence obtained by removing from its predecessor privalkovoj sequence and proalcool sequence, or a protein with proalcool sequence. However, the "target protein" may be a protein obtained by removing from the precursor protein at least one amino acid, forming priselkov part and proalcool part by hydrolysis of the peptide bond, and includes a protein with N-terminal region, is fully consistent with the natural Mature protein, a protein that has at least one additional amino acids, derived from privalkovoj part or proalcool part of the N-end, compared with natural Mature protein, and a protein with amino acid sequence that is shorter than the natural sequence of the Mature protein.

Target protein to which it is possible to apply the method of production according to the present invention is not specifically limited, and examples include the Mature protein or probelly the following proteins:

Phytase [EC: 3.1.3.2.3.1.3.26]

Human interlac is n-2 (IL2: Genbank Accession No. FFL, a Mature view of IL2: amino acids in positions 21 to 153)

Protein glutaminase

Transglutaminase (Genbank Accession No. AF531437)

Interferon

Insulin (JP 07-284394 A)

Acid phosphatase

Peptisyntha (WO 2004/011653, WO 2004/065610)

Granulocyte stimulating factor (GCSF)

Among them are preferred phytase and acid phosphatase produced in the following examples.

Phytase (also referred to as phosphoanhydride-phosphorylase) is an enzyme gidrolizuemye phytin (also called Inositol hexakisphosphate or phytic acid), and is used in food, agriculture and medical fields, etc. as phytase can be applied the following. Information about the amino acid sequence of each phytase and coding each phytase nucleotide sequence can be obtained with reference to the Genbank Accession No. of each phytase.

Retrieved fromEscherichia coliphytase: Genbank Accession No. AAC74065 (SEQ ID NO: 16), the Mature protein: amino acids at positions 23 to 432.

Derived from mold phytase: Genbank Accession No. AAU93518, AAU93517 and AAG40885 and BAB40715.

Retrieved fromBacillusphytase: Genbank Accession No. AAC38573, AAG17903 and AAL59320.

Derived from yeast phytase: Genbank Accession No. CAB70441.

Retrieved fromYersiniaphytase: Genbank Accession No. YP_070934.

Retrieved fromKlebsiellaphytase: Genbank Accession No. AAM23271.

Retrieved fromXanthomonas phytase: Genbank Accession No. AAM38967.

Retrieved fromPseudomonasphytase: Genbank Accession No. AAN77879.

Derived from fungi phytase: Genbank Accession No. CAC48195, CAC48164 and CAC48234.

Derived from corn phytase: Genbank Accession No. AAB52233.

Derived from soybean phytase: Genbank Accession No. AAK49438.

Obtained from Yam phytase: Genbank Accession No. AAF60315.

Obtained from rats phytase: Genbank Accession No. AAA42305.

Acid phosphatase is an enzyme that catalyzes the hydrolysis of phosphate in acidic conditions (EC 3.1.3.2), and you can apply the following acid phosphatase derived fromMorganella morganiidescribed in WO 96/37603 acid phosphatase and their mutant forms.

Retrieved fromMorganella morganiiacid phosphatase: Genbank Accession No. AB035805 (SEQ ID NO: 25).

The Mature form of the amino acid positions 21 to 259.

Encoding each of these proteins, the gene can be modified depending on the host and/or to obtain the desired activity, and such modification includes modification with an insertion, deletion or substitution of at least one amino acid in the encoded amino acid sequence. Professionals in this field are well known such a General molecular biological technology, including methods of modification, methods of gene cloning and detection methods produced proteins. For example, the methods described in Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, Third Edition(1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, DNA cloning: A Practical Approach, Volumes I and II (D.N.Glover ed. 1985), F.M.Ausubel et al., (eds), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994), PCR Technology: Principles and Application for DNA Amplification, H. Erlich, ed., Stockton Pres., etc. In the case of heterologous proteins to the gene can be modified to replace codons codons frequently used in the microorganism for secretory products.

Encoding protein gene can be obtained by using PCR or the like using primers designed based on the known sequence. In addition, you can perform the encoding target protein gene, obtained by selection of the chromosomes of microorganisms, animals, plants, etc. by means of hybridization or the like on the basis of homology and gene, the nucleotide sequence is determined. Alternatively, you can apply obtained by chemical synthesis of a gene, based on the known nucleotide sequence. The sequence information available in the database, such as Genbank.

In addition, the target protein can be a protein with the substitution, deletion, insertion, or addition of one or several amino acids at one or several positions, provided that he possesses the activity of the target protein. In the present invention depending on the position of amino acid residues in the tertiary structure or types of protein, the term "one renesola" specifically indicates from 1 to 30, preferably from 1 to 20 and more preferably from 1 to 10.

The above substitution in the protein is a conservative substitution to preserve the activity of the protein. Replacement is a replacement using a deletion of at least one residue in the amino acid sequence and insert another residue. Examples of such replacement amino acids that are performed to replace the original amino acids of the enzyme protein and regarded as conservative substitutions include substitution of Ser or Thr for Ala; substitution of Gln, His or Lys for Arg; substitution of Glu, Gln, Lys, His or Asp for Asn; substitution of Asn, Glu or Gln for Asp; substitution of Ser or Ala for Cys; substitution of Asn, Glu, Lys, His, Asp or Arg for Gln; substitution of Gly, Asn, Gln, Lys or Asp for Glu, substitution of Pro for Gly, substitution of Asn, Lys, Gln, Arg or Tyr for His, substitution of Leu, Met, Val or Phe for Ile; substitution of Ile, Met, Val or Phe for Leu, substitution of Asn, Glu, Gln, His or Arg for Lys, substitution of Ile, Leu, Val or Phe for Met, substitution of Trp, Tyr, Met, Ile or Leu for Phe, substitution of Thr or Ala for Ser, substitution of Ser or Ala for Thr, substitution of Phe or Tyr for Trp, substitution of His, Phe or Trp for Tyr and the substitution of Met, Ile or Leu for Val.

DNA encoding a protein substantially identical to the above protein, can be obtained by modifying the coding for such a protein nucleotide sequence, for example, by using site-specific mutations so that the amino acid residue in a certain area of the substituted, deleterow, inserted, added, or rearranged. In addition, the shown above modified DNA can be obtained by traditionally known mutational effects. Examples of mutational effects include a method for processingin vitroneutrophase DNA with hydroxylamine or the like, a method of processing containing demetropoulou DNA of the microorganism, for example, bacteriaEscherichiaexposure to ultraviolet radiation or the use of usually used for mutational effects mutagen such as N-methyl-N'-nitro-N-nitrosoguanidine (NTG) or nitrous acid method, artificially causing random error in substitution relations components of deoxynucleotides in the reaction solution of PCR of peer relations (regular) on unequal relationship that is conducive to PCR errors.

DNA encoding substantially identical to the protein can be obtained by expression of DNA with this mutation in a suitable cell and to determine the activity of the product, expressed from DNA.

In addition, DNA hybridization with a nucleotide sequence complementary to the sequence of wild-type gene, or a probe comprising part of it, under strict conditions, and encoding a protein having the activity of a target protein, can be obtained from DNA that encodes a mutated protein or containing the DNA of cells. In this case, the term "stringent conditions" refers to conditions when there is a so-called specific hybrid is not formed nonspecific hybridge clearly define the conditions by means of numerical values, but their examples on hybridization include conditions where DNA with a high degree of homology, for example, DNA homology of at least 70%, preferably the degree of homology of at least 80%, more preferably the degree of homology of at least 90%, especially preferably the degree of homology of at least 95% hybridize with each other, and DNA with the degree of homology of less than 70% do not hybridize with each other; and conditions of washing in conventional southern blot hybridization, i.e. conditions of washing at 60°C and with a salt concentration of 1×SSC, 0,1% SDS, preferably OF 0.1×SSC, 0,1% SDS.

Above the target protein can be directly linked to the signal sequence of or associated with the signal sequence indirectly through a linker sequence. If the content of the linker sequence of the linker sequence may be any sequence, provided that it does not inhibit the productivity of the polypeptide or activity of the target protein, and can be applied, for example, a sequence for purification of the target protein, such as polyhistidine.

The nucleotide sequence encoding a signal containing a sequence of the polypeptide, and the target protein can accordingly be obtained by linking the coding of the signal sequence of the nucleus is IGNOU sequence encoding the target protein nucleotide sequence using a restriction enzyme or the like

In addition, in the case of the use of the signal sequence and the target protein, derived from a single protein precursor, the sequence encoding the precursor protein, including the signal sequence and the target protein, it is possible to amplify using PCR or the like Can be applied in various modified ways PCR, and among them for amplification preferably used cross-PCR.

Introduced in assimilating methanol bacterium design DNA can be obtained by functional binding to the promoter nucleotide sequence that encodes a polypeptide comprising a signal sequence and the target protein. The phrase "functional binding to the promoter nucleotide sequence that encodes a polypeptide comprising a signal sequence and the target protein" means that encodes the polypeptide mRNA transcribed using the promoter such that the polypeptide is produced by the bacterium, when the design is injected into the bacterium.

The nucleotide sequence preferably is associated with the promoter in the area directly above the codon of translation initiation in encoding the polypeptide sequence, so that it includes the 5'-noncoding region containing the region of transcription initiation. 5 netransliruemye area can be a 5'-noncoding region sequence, from which the promoter, such as, for example, 5'-noncoding region of the gene MDH in the case of the promoter of the gene MDH. In addition, the 5'-noncoding region can be a 5'-noncoding region of the gene from which the sequence encoding a signal sequence, such as 5'-noncoding region of the gene phytase in the case of the use of the signal sequence of the phytase.

It is known that the efficiency of the mRNA is significantly affected by the substitution of several nucleotides in the spacer between the binding site of the ribosome (RBS) and the initiation codon, specifically in the sequence, located directly above the initiation codon in the case of applying the 5'-noncoding region, and therefore can be used including such a modification of the 5'-noncoding region.

Operations to obtain a similar design DNA can be performed by applying the gram-negative bacteria, which is easy to genetically modify, such as the bacteriumEscherichia,or secreting the protein of the organism.

In order to modify assimilating methanol bacterium thus, to obtain the above design DNA, you can enter, for example, supporting the construction of a DNA vector. For example, assimilating methanol bacterium-host can transformera the ü obtaining recombinant DNA upon binding fragment encoding the protein of the gene from functioning in assimilating methanol bacteria vector, preferably mnogoletnim vector; and the introduction of recombinant DNA.

The target promoter, signal sequence, the protein sequence can be obtained, for example, by PCR (polymerase chain reaction; White T.J. et al., Trends Genet. 5, 185 (1989)) using as the template the chromosomal DNA of an animal, plant or microorganism having the target sequence. Chromosomal DNA can be obtained from bacteria, used as donor DNA, for example, using the method of Saito and Miura (H. Saito and K. Miura, Biochem. Biophys. Acta, 72, 619 (1963), Experiment Manual for Biotechnology, edited by The Society for Biotechnology, Japan, p.97-98, Baifukan Co., Ltd., 1992) or other Primers for PCR can be obtained on the basis of gene sequences that are listed in the known database, such as Genbank, or based on information relative to the area remaining between genes with known sequences in other bacteria or the like

Examples are capable of Autonomous replication of the vector, for example, in assimilating methanol bacteria include plasmids capable of Autonomous replication, for example, in the bacteriumMethylophilusorMethylobacillus.Their specific examples include a vector with a wide range of hosts RSF1010 and its derivative, such as pAYC32 (Chistosterdov, A.Y., Tsygankov, Y.D. Plasmid, 1986, 16, 161-167), pMFY42 (gene, 44, 53 (1990)), pRP301 or pTB70 (Nature, 287, 396, (1980)).

When employed in the examples given about what isane pAYCTER3 is the preferred vector. pAYCTER3 is a plasmid obtained by deletion of the region prior to the region of the gene of resistance to streptomycin from pAYC32 (strA and strB), and insert there the multiple cloning region of pUC19 and terminator rrnB gene ofE. coli. Thus, pAYCTER3 is vysokoagressivnyh vector, does not exhibit resistance to streptomycin, but becomes resistant to streptomycin, if in the multiple cloning region in the forward direction to strA insert DNA containing the promoter sequence.

To obtain recombinant DNA binding design DNA with a vector carrying a marker that functions in assimilating methanol bacteria, vector hydrolyzing enzyme enzyme suitable for the end of the target gene. Ligation is usually performed using a ligase such as T4 DNA ligase.

Introduction obtained as described above, recombinant DNA in assimilating methanol bacterium can be performed as described transformation. His examples include a method comprising receiving competent cells from cells at the stage of proliferation and injecting DNA (Dubunau and Davidoff-Abelson, J. Mol. Biol., 56, 209 (1971); Duncan, C.H., Wilson, G.A. and Young, F.E., Gene, 1, 153 (1977)), and the method comprising transformation of a host cell in protoplast or spheroplast, easily perceiving recombinant DNA, and the introduction of recombinante the DNA in the bacteria-recipient DNA (Chang, S. and Choen, S.N., Molec. Gen. Genet., 168, 111 (1979)).

In addition, assimilating methanol bacterium with the design DNA of the present invention can be constructed by introducing one copy or many copies of the design DNA in the chromosomal DNA of assimilating methanol bacteria. In the chromosomal DNA of assimilating methanol bacteria can enter a single copy or multiple copies of the design DNA of the present invention by homologous recombination using a target sequence present in the chromosomal DNA in multiple copies, or using random insertion into the chromosomal DNA with the use of phage or other as a sequence present in the chromosomal DNA in multiple copies, you can apply a transposon, a repeating sequence, the inverted repeat present at the end of the mobile element or the like, in Addition, amplification with vector and multiple copies on the chromosome can be combined with the above modification, regulating the expression of the sequence.

Protein can be produced by culturing obtained as described above, assimilating methanol bacteria in a liquid medium containing as a carbon source methanol to provide the bacteria the ability to secrete the target protein, and then highlight secreted the CSOs in the target protein.

In this description of the "secretion" of a protein or peptide means the transport of molecules of protein or peptide from bacterial cells, which includes not only the case where the protein or peptide in the result is in the environment in a completely free state, but also a case where only a part is on the outside of bacterial cells, as well as the case when the protein or peptide in the surface layer of the bacterial cell.

In the present invention, the target protein is preferably produced in such volume to be collected from the medium or bacterial cells.

Assimilating methanol bacterium cultured in a medium containing as a carbon source methanol. Examples of medium containing as a carbon source, methanol, include medium supplemented from 0.001 to 30% methanol. The environment may contain differing from methanol carbon source, such as sugars, including glucose, sucrose, lactose, galactose, fructose and starch hydrolysis; alcohols, such as glycerol and sorbitol; and organic acids such as fumaric acid, citric acid and succinic acid.

As different from the methanol component of the environment, you can add the environment, such as a source of nitrogen or inorganic ion, used in common culture. In order to achieve faster growth, if not bhodemon, you can add organic labeled nutrient, such as vitamin and amino acid. As the source of nitrogen can be applied gaseous ammonia, aqueous ammonia, ammonium salts, etc. as inorganic ion can accordingly be applied, if necessary, calcium ion, magnesium ion, phosphate ion, potassium ion, iron ion, etc. for Example, culturing can be carried out at a pH from 5.0 to 9.0 and from 15°C to 45°C under aerobic conditions, and the cultivation period may range from 1 to 7 days. If assimilating methanol bacterium cultured under such conditions, the target protein is produced in bacterial cells in large quantities, and then efficiently secreted.

When using induced by methanol promoter such as the promoter of the gene MDH, to increase the production of the polypeptide cultivation can be performed under inducible conditions. The induction can be carried out in accordance with the conditions typically used for the induction of the promoter of the gene MDH. Usually when assimilating methanol bacterium is cultivated in methanol, MDH promoter can function without the need for specific induction.

After cultivation secreted into the medium protein using the method of the present invention it is possible to allocate and clean up of the environment in accordance with the good of the local expert in this field by the way. For example, the protein can be extracted and cleaned by removing the bacterial cells by centrifugation or the like and perform a known appropriate method such as salting out, precipitation with ethanol, ultrafiltration, chromatography gel-filtration, ion-exchange column chromatography, affinity chromatography, liquid chromatography high and medium pressure chromatography with reversed phase or hydrophobic chromatography; or a combination of these methods. Cleaning can be performed by applying a sequence, if the polypeptide contains the sequence for cleaning.

Secreted into the surface layer of the bacterial cell protein using the method of the present invention it is possible to isolate and purify by dissolving the protein in a way known to the person skilled in the art, for example, the increase in salt content, use of surfactant, etc.; and perform the same procedures as in the case when the protein is secreted into the environment. In addition, in some cases, secreted into the surface layer of the bacterial cell protein can be used as, for example, immobilized enzyme without dissolution of the protein.

Examples

The present invention will be described in more detail using the following examples, but is not limited in any sense.

the example 1: Secretory expression derived from strain K-12 Escherichia colibeta-lactamase inMethylophilus methylotrophusATCC 53528

(1) Construction of expression plasmids functioning in assimilating methanol bacteria pAYCTER3

Shown in SEQ ID NO: 3 and 4 synthetic DNA designed with the contents of the sequence region of pUC19 multiple cloning, annealed in a known manner to obtain polylinker. Polylinker designed with the formation of the same end positions as obtained by cleavage with restriction enzymes EcoRI and BglII. In addition, synthesized is shown in SEQ ID NO: 5 and 6 primers, and encoding a termination sequence rrnB region amplified by PCR with chromosomal DNA of K-12Escherichia coliobtained in the usual way (using the method of Saito and Miura [Biochem. Biophys. Acta, 72, 619 (1963)]). Recognized by the restriction enzyme BglII sequence was inserted in the primer of SEQ ID NO: 3, and recognized by the restriction enzyme BclI sequence was inserted in the primer of SEQ ID NO: 4. PCR was performed using DNA polymerase, Pyrobest (TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol. After cleavage of the PCR fragments with restriction enzymes BglII and BclI fragments PCR and above polylinker were sewn together to produce a PCR fragment of approximately 400 BP For the ligation reaction was used, set the "DNA Ligation Kit Ver." (produced by TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol. Then received fragments of approximately 9,2 TPN cut from known plasmids pAYC32 (J. Gen. Environ., 137, 169-178 (1991)) with the restriction enzymes EcoRI and BamHI, and the above DNA fragment was inserted in the construction of expression plasmids pAYCTER3 functioning in theM. methylotrophusATCC 53528. In the structure pAYCTER3 missing the 5'region sequence of the gene strA included in pAYC32, but instead, it has an area of pUC19 multiple cloning, and the rrnB terminator and includes obtained fromE. coligene beta lactamase.

(2) Secretory expression of beta-lactamase inMethylophilus methylotrophusATCC 53528

Methylophilus methylotrophusATCC 53528 transformed constructed as described above (1) pAYCTER3 and allocated strain growing in containing 25 mg/l ampicillin and 1% methanol medium with agar SEIIA (5 g ammonium sulfate, 1,9 g K2HPO4, 1.56 g NaH2PO4·2H2O, 200 mg of magnesium sulfate, 72 mg of calcium chloride, 5 g of copper sulfate, 25 μg manganese sulfate, 23 mg of zinc sulfate, and 9.7 mg of iron trichloride and 15 g of agar were dissolved in water to 1 liter, and the pH was brought to 7.0).

Then selectedM.methylotrophusATCC 53528 with pAYCTER3 were cultured in liquid medium SEIIA containing 25 mg/l of ampicillin and 2% methanol at 37°C for 48 hours. After completion of the cultivation of crops the local supernatant of bacterial cells M.methylotrophusATCC 53528 with pAYCTER3 were subjected to SDS-PAGE, in order thus to determine in the culture supernatant protein with the same molecular weight as that of the beta-lactamase.

Determination of N-terminal sequence of the protein using protein sequencing machine PPSQ-21A (produced by Shimadzu Corporation) showed that the sequence was a Mature sequence of beta-lactamase, and it was confirmed that beta lactamase secretarials in the culture supernatant.

Example 2: Secretory expression derived from strain K-12Escherichia coliphytase inMethylophilus methylotrophusATCC 53528

(1) Isolation of the gene of metadataproperty derived fromMethylophilus methylotrophusATCC 53528

The gene sequence metadataproperty obtained from strain W3A1M.Methylotrophusalready defined previously [Genbank Accession No. U41040]. On the basis of sequence synthesized is shown in SEQ ID NO: 1 and 2 primers, and by way of PCR amplified coding sequence of metadataproperty region of chromosomal DNAM.MethylotrophusATCC 53528, obtained according to the method of Saito and Miura. PCR was performed using DNA polymerase, Pyrobest (TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol.

Then amplificatory DNA fragment of approximately 1 TPN were subjected to interaction with what emeniem Random Primer DNA Labeling Kit Ver.2 (manufactured by TAKARA BIO INC.) and [α-32P]dCTP according to attached to the kit Protocol, in order to obtain a DNA probe. Southern blot hybridization using the probe and chromosomal DNAM. MethylotrophusATCC 53528 by the usual method described in Molecular Cloning 2nd edition [J.Sambrook, E.F.Fritsch and T.Maniatis, Cold Spring Harbor Laboratory Press, p9.31 (1989)] have shown that a fragment of approximately 5.5 TPN cut with restriction enzyme PvuII, included gene metadataproperty. Then, to obtain library obtained by cleavage of chromosomal DNA PvuII fragments of approximately 5.5 TPN collected after agarose gel electrophoresis using EASYTRAP Ver.2 (manufactured by TAKARA BIO INC.) and inserted into the SmaI region in pUC18 (produced by TAKARA BIO INC.), and the resulting plasmid was introduced into competent cells ofEscherichia coliJM109 (produced by TAKARA BIO INC.).

Screening of the library was performed by hybridization of colonies, described in Molecular Cloning 2nd edition [J.Sambrook, E.F.Fritsch and T.Maniatis, Cold Spring Harbor Laboratory Press, p1.90 (1989)] using obtained as described above, DNA probe metadataproperty, so as to isolate a strain with a plasmid in which the cloned gene fragment metadataproperty. After this plasmid was isolated from strain and meant it pUMDH. Determination of the nucleotide sequence cloned in pUMDH fragment showed that the homology of the nucleotide sequence of the gene of metadatapropertyM. MethylotrophusATCC 53528 is 9% or more with the gene of metadataproperty strain W3A1 M.Methylotrophus(SEQ ID NO: 13). Determination of the nucleotide sequence showed that the PvuII fragment of approximately 5.5 TPN included full length gene metadataproperty and area of approximately 2.5 TPN above the 5'region of the gene. The nucleotide sequence was determined with the use of the kit for sequencing A dye terminator cycle sequencing kit (PE Applied Biosystems) and DNA sequencing machine 373A (PE Applied Biosystems).

(2) Isolation of the gene phytase derived from strain K-12Escherichia coliand construction of secretory expression plasmid

The sequence of the phytase gene derived from strain K-12Escherichia colialready defined previously (Genbank Accession No. AE000200 SEQ ID NO: 15). On the basis of sequence synthesized is shown in SEQ ID NO: 7 and 8 primers, and by way of PCR amplified region encoding the sequence (Mature) phytase from chromosomal DNA of strain K-12Escherichia coliobtained according to the method of Saito and Miura. PCR was performed using DNA polymerase, Pyrobest (TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol.

After that, the promotor region and the region of the signal sequence metadataproperty amplified using primers shown in SEQ ID NO: 9 and 10 from the chromosomal DNA ofM.MethylotrophusATCC 53528, obtained according to the method of Saito and Miura. PCR p is bodily using DNA polymerase, Pyrobest (TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol. In order to construct a fused gene with phytase shown in SEQ ID NO: 10 primer contains a sequence encoding a N-terminal amino acid sequence of the phytase.

Then, to obtain the matrix was mixed in 1 μl of PCR solutions region, the coding sequence of the phytase (Mature type) from strain K-12Escherichia coliamplified as described above, and the promoter region and the signal sequence ofMethylophilus methylotrophusATCC 53528, amplified as described above, and conducted cross-PCR using primers of SEQ ID NO: 9 and 8 for amplification merged phytase gene associated with the promoter and signal sequence of a gene of metadataproperty fromMethylophilus methylotrophusATCC 53528. When agarose gel electrophoresis were detected amplificatoare fragments of approximately 2.4 TPN To get pHSGMappA from agarose gel was collected fragments using EASYTRAP Ver.2 (manufactured by TAKARA BIO INC.) and inserted into the SmaI region in pHSG398 (TAKARA BIO INC.). Determination of the nucleotide sequence of the inserted fragment was confirmed by the expected design fused gene. Then from agarose gel were isolated fragment BamHI-kpni restriction sites of pHSGMappA using EASYTRAP Ver.2 (manufactured by TAKARA BIO INC.) and the ends of the fragment which was fosforilirovanii with a set of "blunted DNA kit (produced by TAKARA BIO INC.). Then to get pAYCMappA EcoRI fragment from a constructed in example 1 (1) pAYCTER3 was isolated from agarose gel using EASYTRAP Ver.2 (manufactured by TAKARA BIO INC.) and dephosphorylate the ends of the fragment with a set of "blunted DNA kit (produced by TAKARA BIO INC.) followed by an insert fragment BamHI-kpni restriction sites with blunt ends. Determination of the nucleotide sequence of the inserted fragment was confirmed by construction the expected heterogeneous fused gene.

(3) Expression of phytase inMethylophilus methylotrophusATCC 53528

Methylophilus methylotrophusATCC 53528 transformed pAYCMappA (obtained by linking the promoter sequence and signal sequence metadataproperty fromMethylophilus methylotrophusATCC 53528 with phytase gene derived from strain K-12Escherichia colidesigned as described above (2) and pAYCTER3 (control), respectively, and were isolated strains growing in containing 25 mg/l ampicillin and 1% methanol medium with agar SEIIA (5 g ammonium sulfate, 1,9 g K2HPO4, 1.56 g NaH2PO4·2H2O, 200 mg of magnesium sulfate, 72 mg of calcium chloride, 5 g of copper sulfate, 25 μg manganese sulfate, 23 mg of zinc sulfate, and 9.7 mg of iron trichloride and 15 g of agar were dissolved in water to 1 liter, and the pH was brought to 7.0). The selected strains ofM. methylotrophusATCC 53528 with pAYCMappA or pAYCTER3 were cultured in liquid medium SEIIA, sod is Rasa 25 mg/l of ampicillin and 2% methanol, at 37°C for 48 hours. After completion of the cultivation, the culture supernatant strains with pAYCMappA and pAYCTER3 bacterial cellsM. methylotrophusATCC 53528 were subjected to SDS-PAGE and the protein with a target molecular weight was determined only in the culture supernatant of strain with pAYCMappA. Then the culture supernatant strains was used as the source of enzyme solutions to determine Fitzroy activity. Enzymatic activity was determined according to published description (J AOAC Int. 1994 May-Jun; 77(3): 760-4.). As a result, in caseM.methylotrophusATCC 53528 with pAYCTER3 enzymatic activity in the culture supernatant was not determined, whereas in the case ofM.methylotrophusATCC 53528 with pAYCMappA enzymatic activity in the culture supernatant was determined (60 FTU/ml, 37°C, pH 5.5), which proved that the strain secreterial the phytase in the culture supernatant.

Example 3: Secretory expression obtained from a strain ofMorganella morganiiacid phosphatase inMethylophilus methylotrophusATCC 53528

(1) the Allocation obtained from a strain ofMorganella morganiigene, acid phosphatase and construction of plasmids for secretory expression

The sequence obtained from a strain ofMorganella morganiigene, acid phosphatase already defined previously (Genbank Accession No. 035805: SEQ ID NO: 25). On the basis of sequence synthesized is shown in SEQ ID NO: 27 and 28 primers, posrednictwem method PCR amplified region, the coding sequence (Mature type) acid phosphatase from chromosomal DNA of strainMorganella morganiiobtained according to the method of Saito and Miura. PCR was performed using DNA polymerase, Pyrobest (TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol. In order to construct a fused gene with metadataproperty fromM.Methylotrophus,shown in SEQ ID NO: 27 primer contains a sequence encoding a C-terminal region amino acid sequence in the signal sequence metadataproperty.

Then the promotor region and the region of the signal sequence metadataproperty amplified using the PCR method with the use shown in SEQ ID NO: 9 and 29 primers from chromosome DNAM.methylotrophusATCC 53528, obtained according to the method of Saito and Miura. PCR was performed using DNA polymerase, Pyrobest (TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol.

After that to obtain the matrix was mixed in 1 μl of PCR reaction mixture region, the coding sequence of acid phosphatase (Mature type) from a strain ofMorganella morganiiamplified, as described above, and the promoter region and the signal sequence ofMethylophilus methylotrophusATCC 53528, amplified, as described above, and p is bodily cross-PCR using primers of SEQ ID NO: 9 and 28 for amplifying the fused gene of acid phosphatase, associated with the promoter and signal sequence of a gene of metadataproperty fromMethylophilus methylotrophusATCC 53528. When agarose gel electrophoresis were detected amplificatory fragment of approximately 1.8 TPN To get pHSGMphoC from agarose gel, the fragment was collected using EASYTRAP Ver.2 (manufactured by TAKARA BIO INC.) and inserted into the SmaI region in pHSG398 (TAKARA BIO INC.). Determination of the nucleotide sequence of the inserted fragment was confirmed by the expected design fused gene. The nucleotide sequence was determined with the use of the kit for sequencing A dye terminator cycle sequencing kit (PE Applied Biosystems) and DNA sequencing machine 373A (PE Applied Biosystems). Then from agarose gel were isolated fragment BamHI-kpni restriction sites of pHSGMphoC using EASYTRAP Ver.2 (manufactured by TAKARA BIO INC.), and the ends of the fragment were dephosphorylated with a set of "blunted DNA kit (produced by TAKARA BIO INC.). Then, to obtain pAYCMphoC SmaI fragment from a constructed in example 1 (1) pAYCTER3 was isolated from agarose gel using EASYTRAP Ver.2 (manufactured by TAKARA BIO INC.) followed by an insert fragment BamHI-kpni restriction sites with blunt ends. Determination of the nucleotide sequence of the inserted fragment was confirmed by construction the expected heterogeneous fused gene.

(2) the gene Expression of acid phosphatase inMethylophilus methylotrophusATCC53528

Methylophilus methylotrophusATCC 53528 transformed pAYCMphoC (obtained by linking the promoter sequence and signal sequence metadataproperty isolated fromMethylophilus methylotrophusATCC 53528 with acid phosphatase gene derived from a strain ofMorganella morganiidesigned as described above (1) and pAYCTER3 (control), and were isolated strains growing in medium with agar SEIIA containing 25 mg/l ampicillin and 1% methanol. The selected strains ofM.methylotrophusATCC 53528 with pAYCMphoC or pAYCTER3 were cultured in liquid medium SEIIA containing 25 mg/l of ampicillin and 2% methanol at 37°C for 48 hours. After completion of the cultivation, the culture supernatant strains with pAYCMphoC and pAYCTER3 bacterial cellsM.methylotrophusATCC 53528 were subjected to SDS-PAGE and the protein with a target molecular weight of approximately 25 kDa was identified in the culture supernatant of strain with pAYCMphoC. Then to determine phosphatase activity cultural supernatant strains was used as the source of enzyme solutions by the use of substrate pNPP. As a result, in caseM.methylotrophusATCC 53528 with pAYCTER3 enzymatic activity in the culture supernatant was not determined, whereas in the case ofM.methylotrophusATCC 53528 with pAYCMphoC enzymatic activity in the culture supernatant was determined, which showed that the strain secretarial acid is Yu phosphatase in the culture supernatant.

Example 4: Secretory expression derived from the signal sequence with the replacement of strain K-12Escherichia coliphytase inMethylophilus methylotrophusATCC 53528

(1) Construction of secretory expression plasmid for phytase derived from the signal sequence with the replacement of strain K-12Escherichia coli

By way of PCR promotor region of metadataproperty amplified using primers shown in SEQ ID NO: 30 and 31, from chromosomal DNAM.methylotrophusATCC 53528, obtained according to the method of Saito and Miura. PCR was performed using DNA polymerase, Pyrobest (TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol. Shown in SEQ ID NO: 30 primer contains recognized by the restriction enzyme Hind III sequence.

In order to use data obtained from strain K-12E. colithe signal sequence of the phytase comprising the signal sequence of the phytase gene amplified by PCR method using the primers shown in SEQ ID NO: 32 and 33, from chromosomal DNA of strain K-12E. coliobtained according to the method of Saito and Miura. PCR was performed using DNA polymerase, Pyrobest (TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol. In order to construct a fused gene with metaalbewerking the th of M.methylotrophusshown in SEQ ID NO: 32 primer contains a sequence encoding a C-terminal region amino acid sequences in their promoter sequence metadataproperty, as shown in SEQ ID NO: 33 primer contains recognized by the restriction enzyme kpni restriction sites sequence.

Then, to obtain the matrix was mixed 1 ál PCR reaction mixtures region, the coding sequence of the phytase from strain K-12Escherichia coliamplified as described above, and the promoter region of theMethylophilus methylotrophusATCC 53528 amplified as described above, and conducted cross-PCR using primers of SEQ ID NO: 30 and 33 for amplification fused gene from the signal sequence and the Mature phytase geneE. coliassociated with the promoter of the gene of metadataproperty fromMethylophilus methylotrophusATCC 53528. When agarose gel electrophoresis were detected amplificatory fragment of approximately 2.4 TPN To get pAYCAappA from agarose gel was collected fragment HindIII-kpni restriction sites with the use of EASYTRAP Ver.2 (manufactured by TAKARA BIO INC.) and inserted into the region of the HindIII-kpni restriction sites in pAYCTER3 example 1 (1). Determination of the nucleotide sequence of the inserted fragment was confirmed by the expected design fused gene. The nucleotide sequence was determined with the use of the kit for sequencing A dye terminator cycle sequencing kit" (p. the first PE Applied Biosystems) and DNA sequencing machine 373A (PE Applied Biosystems).

On the other hand, in order to use the signal sequence of acid phosphatase from the strain ofMorganella morganii, acid phosphatase gene, including the signal sequence, was amplified by PCR method using the primers shown in SEQ ID NO: 34 and 28, from the chromosomal DNA of the strain ofM.Morganiiobtained according to the method of Saito and Miura. PCR was performed using DNA polymerase, Pyrobest (TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol. In order to construct a fused gene with metadataelementM.Methylotrophusshown in SEQ ID NO: 34 primer contains a sequence encoding a C-terminal region amino acid sequences in their promoter sequence metadataproperty.

To obtain the matrix was mixed in 1 ml reaction mixtures PCR amplified as described previously, gene, acid phosphatase and above the promotor region of metadataproperty, and conducted cross-PCR using primers of SEQ ID NO: 30 and 28 for amplifying the fused gene from the signal sequence and the Mature acid phosphatase geneM.Morganiiassociated with the promoter of the gene of metadataproperty fromM.methylotrophusATCC 53528. In addition, the promoter of the gene of metadataproperty fromM.methylotrophusATCC 53528 and signal follower is ity of acid phosphatase from M.Morganiiamplified using as the matrix of the fused gene and application shown in SEQ ID NO: 30, and 35 primers. In order to construct a fused gene with phytase fromE. colishown in SEQ ID NO: 35 primer contains the sequence encoding the N-terminal region amino acid sequence in the Mature sequence of the phytase.

To obtain the matrix was mixed 1 ál PCR reaction mixtures fused gene promotor region of metadataproperty and signal sequence of acid phosphatase, amplified as described previously, and phytase gene, amplified in example 2 (2), and conducted cross-PCR using primers of SEQ ID NO: 30 and 33 for amplification fused gene from the signal sequence of acid phosphatase fromM.Morganiiand Mature phytase gene ofE. coliassociated with the promoter of the gene of metadataproperty fromM.methylotrophusATCC 53528. When agarose gel electrophoresis were detected amplificatory fragment of approximately 2.4 TPN To get pAYCCappA amplificatory fragment was treated with restriction enzymes HindIII and kpni restriction sites and were collected from the agarose gel, the fragment HindIII-kpni restriction sites with the use of EASYTRAP Ver.2 (manufactured by TAKARA BIO INC.) and inserted into the region of the HindIII-kpni restriction sites in pAYCTER3 obtained in example 1 (1). The nucleotide sequence was determined with the use of the kit for secv the treatment of A dye terminator cycle sequencing kit (PE Applied Biosystems) and DNA sequencing machine 373A (PE Applied Biosystems).

(2) the Expression inMethylophilus methylotrophusATCC 53528 Mature phytaseE. coliassociated with the signal sequence of the phytaseE. coliand the signal sequence of acid phosphataseM.Morganii

M.methylotrophusATCC 53528 transformed constructed above (1) pAYCAappA (obtained by linking the promoter sequence metadataproperty isolated fromM.methylotrophusATCC 53528 and signal sequence of the phytase derived fromE. coliwith Mature sequence of a gene) and pAYCCappA (obtained by linking the promoter sequence metadataproperty isolated fromM.methylotrophusATCC 53528, and the signal sequence of acid phosphatase derived fromM.morganiiwith Mature sequence of the phytase gene derived fromE. coliand pAYCTER3 (control), and were isolated strains growing in medium with agar SEIIA containing 25 mg/l ampicillin and 1% methanol. Then the selected strains ofM.methylotrophusATCC 53528 with pAYCAappA, pAYCCappA or pAYCTER3 were cultured in liquid medium SEIIA containing 25 mg/l of ampicillin and 2% methanol at 37°C for 48 hours. After completion of the cultivation, the culture supernatant strains with pAYCAappA, pAYCCappA or pAYCTER3 bacterial cellsM.methylotrophusATCC 53528 were subjected to SDS-PAGE and the protein with a target molecular weight was determined only in the culture supernatant strain with pAYCAappA and strain with pAYCCappA. Salemquarterly supernatant strains was used as the source of enzyme solutions to determine Fitzroy activity. As a result, in caseM. methylotrophusATCC 53528 with pAYCTER3 enzymatic activity in the culture supernatant was not determined, whereas in cases ofM.methylotrophusATCC 53528 with pAYCAappA and pAYCCappA enzymatic activity in the culture supernatant was determined, which showed that the strains secretively the phytase into the culture supernatant. Enzymatic activity was determined by the same method as described above in example 2.

Example 5: the Secretory expression of the promoter-substituted phytase derived from strain K-12Escherichia coliinMethylophilus methylotrophusATCC 53528

(1) Construction of secretory expression plasmids for promoter-substituted phytase derived from strain K-12Escherichia coli

In order to use the tac promoter, the scope of the tac promoter amplified by PCR method using as a matrix pKK223-3 (Pharmacia) and the application shown in SEQ ID NO: 36 and 37 of the primers. The sequence of the tac promoter shown in SEQ ID NO: 12. PCR was performed using DNA polymerase, Pyrobest (TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol. Shown in SEQ ID NO: 36 primer contains recognized by the restriction enzyme EcoRI sequence.

Fused gene from derived fromM.Methylotrophusthe signal sequence metadataproperty and receiving the Noi from E. coliphytase (Mature) amplified by the PCR method using as a matrix pAYCMappA obtained in example 2 (2) and using the primers shown in SEQ ID NO: 38 and 39. PCR was performed using DNA polymerase, Pyrobest (TAKARA BIO INC.), and reaction conditions were consistent with the manufacturer's recommended Protocol. In order to construct a fused gene from the tac promoter shown in SEQ ID NO: 38 primer contains a specific sequence of the tac promoter, then as shown in SEQ ID NO: 39 primer contains recognized by the restriction enzyme EcoRI specific sequence.

Then, to obtain the matrix was mixed 1 ál PCR reaction mixtures region, the coding sequence of the tac promoter, amplified as described above, and the region that encodes a fused gene signal sequence metadataproperty derived fromM.methylotrophusand phytase (Mature), obtained fromE. coliamplified as described above, and conducted cross-PCR using primers of SEQ ID NO: 36 and 39 for amplification of the gene, obtained by fusion of a signal sequence derived fromM.Methylotrophusmetadataproperty associated with the tac promoter and is derived fromE. coliMature phytase gene.When agarose gel electrophoresis were detected amplificatory fragment approx the positive 1,6 TPN To obtain pAYCPtacMappA amplificatory fragment was treated with EcoRI and collected from the agarose gel, the fragment EcoRI using EASYTRAP Ver.2 (manufactured by TAKARA BIO INC.) and inserted into the EcoRI region in pAYCTER3 obtained in example 1 (1). The nucleotide sequence was determined with the use of the kit for sequencing A dye terminator cycle sequencing kit (PE Applied Biosystems) and DNA sequencing machine 373A (PE Applied Biosystems).

(2) the Expression inMethylophilus methylotrophusATCC 53528 derived fromE. coliphytase associated with the tac promoter

M.methylotrophusATCC 53528 transformed constructed above (1) pAYCPtacMappA (obtained by linking the promoter sequence of the tac and the signal sequence metadataproperty derived fromMethylophilus methylotrophusATCC 53528 with Mature sequence of the phytase gene derived fromE. coliand pAYCTER3 (control), and were isolated strains growing in medium with agar SEIIA containing 25 mg/l ampicillin and 1% methanol. Then the selected strains ofM. methylotrophusATCC 53528 with pAYCPtacMappA or pAYCTER3 were cultured in liquid medium SEIIA containing 25 mg/l of ampicillin and 2% methanol at 37°C for 48 hours. After completion of the cultivation, the culture supernatant strains with pAYCPtacMappA or pAYCTER3 bacterial cellsM.methylotrophusATCC 53528 were subjected to SDS-PAGE and the protein with a target molecular weight was determined only in the culture of lnom the supernatant of strain with pAYCPtacMappA. Then the culture supernatant strains was used as the source of enzyme solutions to determine Fitzroy activity. As a result, in caseM.methylotrophusATCC 53528 with pAYCTER3 enzymatic activity in the culture supernatant was not determined, whereas in the case ofM.methylotrophusATCC 53528 with pAYCPtacMappA enzymatic activity in the culture supernatant was determined, which showed that the strain secreterial the phytase in the culture supernatant. Enzymatic activity was determined by the same method as described above in example 2.

Example 6: Secretory expression obtained from strain K-12Escherichia colibeta-lactamase inMethylobacillus glycogenesATCC 29475

(1) Constructing functioning in theMethylobacillus glycogenesATCC 29475, pAYCTER-tet expression plasmids

The strain ofM. glycogenesATCC 29475 resistant to ampicillin and sensitive to streptomycin and tetracycline, therefore, obtained in example 1 (1) secretory expression plasmid pAYCTER3 inserted the gene for resistance to tetracycline. Thus, the amplified gene of resistance to tetracycline by PCR using as template pKR310 (described in the Plasmid. 1985 Mar; 13(2): 149-53) and using primers of SEQ ID nos: 23 and 24. When agarose gel electrophoresis were detected amplificatory fragment of approximately 1.5 TPN To get pAYCTER-tet, amplify the new fragment was treated with restriction enzyme BamHI and collected from agarose gel using EASYTRAP Ver.2 (manufactured by TAKARA BIO INC.) and inserted into the BamHI region in pAYCTER3, obtained in example 1 (1). Determination of the nucleotide sequence of the inserted fragment was confirmed by the expected design fused gene. Shown in SEQ ID NO: 23 and 24 primers include recognized by the restriction enzyme BamHI sequence, and the nucleotide sequence was determined with the use of the kit for sequencing A dye terminator cycle sequencing kit (PE Applied Biosystems) and DNA sequencing machine 373A (PE Applied Biosystems).

(2) Secretory expression of beta-lactamase inMethylobacillus glycogenesATCC 29475

Methylobacillus glycogenesATCC 29475 transformed constructed as described above (1), pAYCTER-tet and were isolated strain growing in containing 5 mg/l tetracycline and 1% methanol medium with agar SEIIA (5 g ammonium sulfate, 1,9 g K2HPO4, 1.56 g NaH2PO4·2H2O, 200 mg of magnesium sulfate, 72 mg of calcium chloride, 5 g of copper sulfate, 25 μg manganese sulfate, 23 mg of zinc sulfate, and 9.7 mg of iron trichloride and 15 g of agar were dissolved in water to 1 liter, and the pH was brought to 7.0).

Then selectedM. glycogenesATCC 29475 with pAYCTER-tet were cultured in liquid medium SEIIA containing 5 mg/l tetracycline and 2% methanol, at 30°C for 48 hours. After completion of the cultivation, the culture supernatant of bacterial cellsM.glycogenesATCC 29475 with pAYCTER-tet were subjected to SDS-PAGE, to thereby determine a culturally-su is entante protein with the same molecular weight, as the beta-lactamase.

Determination of N-terminal sequence of the protein using protein sequencing machine PPSQ-21A (produced by Shimadzu Corporation) showed that the sequence was a Mature sequence of beta-lactamase, and it was confirmed that beta lactamase secretarials in the culture supernatant.

Example 7: Secretory expression obtained from strain K-12Escherichia coliphytase inMethylobacillus glycogenesATCC 29475

(1) Construction of secretory expression plasmid derived from strain K-12Escherichia coliphytase inMethylobacillus glycogenesATCC 29475

In order to get the secretory expression obtained from strain K-12E. coliphytase in strainM. glycogenesATCC 29475 treated with BamHI fragment of the gene of resistance to tetracycline, produced in example 6 (1), was inserted into the BamHI region in secretory expression plasmid phytase pAYCPtacMappA produced in example 5 (1), to thereby obtain pAYCPtacMappA-tet. Determination of the nucleotide sequence of the inserted fragment was confirmed by the expected design fused gene. The nucleotide sequence was determined with the use of the kit for sequencing A dye terminator cycle sequencing kit (PE Applied Biosystems) and DNA sequencing machine 373A (PE Applied Biosystems).

The expression is derived fromE. coliphytase in strainMethylobacillus glycogenes ATCC 29475

Methylobacillus glycogenesATCC 29475 transformed constructed above (1) pAYCPtacMappA-tet or obtained in example 6 (2) pAYCTER-tet (control), and were isolated strains growing in medium with agar SEIIA containing 5 mg/l tetracycline and 1% methanol. Then the selected strains ofM.glycogenesATCC 29475 with pAYCPtacMappA-tet or pAYCTER-tet were cultured in liquid medium SEIIA containing 5 mg/l tetracycline and 2% methanol at 37°C for 48 hours. After completion of the cultivation, the culture supernatant strains with pAYCPtacMappA-tet or pAYCTER-tet bacterial cellsM.glycogenesATCC 29475 were subjected to SDS-PAGE and the protein with a target molecular weight was determined only in the culture supernatant of strain with pAYCPtacMappA-tet. After this cultural supernatant strains was used as the source of enzyme solutions to determine Fitzroy activity. As a result, in caseM.glycogenesATCC 29475 with pAYCTER-tet enzyme activity in the culture supernatant was not determined, whereas in the case ofM.glycogenesATCC 29475 with pAYCPtacMappA-tet enzyme activity in the culture supernatant was determined, which showed that the strain secreterial the phytase in the culture supernatant. Enzymatic activity was determined by the same method as described above in example 2.

Industrial application

According to the present invention can effectively and inexpensively carried the ü secretory products of protein. Specifically, it is possible to implement secretory products used in the industrial scale protein, for example, phytase or other

1. Method of production of a protein, comprising culturing obligate assimilating methanol bacteria in a liquid medium containing methanol as a main carbon source, to ensure secretion by bacteria of the target protein from the bacterial cells, and isolation of secreted target protein, where this bacterium has the design of DNA containing a promoter sequence that functions in assimilating methanol bacteria, and the nucleotide sequence encoding the polypeptide containing a signal sequence that functions in assimilating methanol bacteria, and the sequence of the target protein, is functionally linked to the promoter sequence, where this obligate assimilating methanol bacterium selected from the group consisting of Methylophilus methylotrophus or Methylobacillus glycogens, and where the signal sequence has an amino acid sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 20.

2. The method according to claim 1, where operating in assimilating methanol bacteria promoter sequence selected from the group consisting of the promoter of metadataproperty, tac promoter, promoter σ and promoter and a ribosome is a high protein.

3. The method according to claim 1, where the promoter sequence is a nucleotide sequence of SEQ ID NO: 11, 12, 21 or 22.

4. The method according to claim 1, where the signal sequence is a signal sequence of a protein selected from the group consisting of metadataproperty, phytase and acid phosphatase.

5. The method according to claim 1, where the protein is selected from the group consisting of phytase, interleukin, transglutaminase, interferon, insulin, acid phosphatase and peptident.



 

Same patents:

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method provides test inoculation of a nutrient medium containing pancreatic fish flour hydolyzate, fermentative meat peptone, NaCl, Tween-80, CaCl2, sodium thiosulphate (Na2S2O3 × 5H2O), ferrous ammonium sulphate ((NH4)2SO4 × FeSO4 × 6H2O), sorbite, bromthymol blue, irgasan (DP-300), rifampicin, NaOH, agar and distilled water in the preset proportions. Pancreatic fish flour hydolyzate, peptone, NaCl, agar are dissolved with heating, sterilised at 121°C for 20 min and thereafter added in a hot medium of the other components specified above. The inoculations are incubated on the nutrient medium in aerobic conditions at temperature 37°C and/or 28°C for 24-48 h and assessed by the presence of black-centre green or dark grey colonies surrounded by a cloudy precipitate zone in the nutrient medium.

EFFECT: invention allows simplifying and providing higher specificity of Shewanella bacteria recovery and identification.

2 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains yeast water, beef hydrolyzate, sodium chloride, glucose, glycerin, sodium citrate, sodium metabisulphite and distilled water.

EFFECT: invention allows providing optimum conditions for brucellous microbe growth, replication in a transport nutrient medium at any distances.

3 ex

FIELD: medicine.

SUBSTANCE: strain of bacteria Bacillus thuringiensis BIOS-1 VKPM B-10709, possessing insectoacaricidal activity against representatives of leaf-eating and sucking pests, such as representatives of orders Lepidoptera, Coleoptera, Homoptera, Thysanoptera and Acariformes, doing harm to crops, is deposited in All-Russian collection of industrial microorganisms (VKPM), Federal State Unitary Enterprise GosNIIgenetika under number B-10709.

EFFECT: invention makes it possible to increase mortality of representatives of leaf-eating and sucking pests, doing harm to crops.

6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: there is offered a method of preparing the antibiotic Cephalosporin C. A new antibiotic producer Acremonium chrysogenum strain, RNCM No. F-4081D is used. Acremonium chrysogenum, RNCM No.F-4081D is cultivated on an enzymatic nutrient medium containing carbohydrate sources - glucose, corn starch, dextrin, nitrogen sources - a corn extract, Pharmamedia, ammonium sulphate, and also inorganic salts - potassium phosphate, potassium sulphate, chalk, copper sulphate, zinc sulphate, manganese sulphate, ferrous sulphate, and as vegetable fat - rapeseed oil and in addition a phosphatidylcholine and/or sitosterol.

EFFECT: twice increased antibiotic production level, reduced fermentation time.

1 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention can be used in producing nutrient mediums which create the optimum conditions of legionella activity. The nutrient medium contains a enzymatic hydrolyzate of a pig's lung, a enzymatic hydrolyzate of peanut, 1-substituted potassium phosphate, 2-substituted 3-aqueous potassium phosphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water.

EFFECT: invention allows reducing time for legionella detection.

3 ex

FIELD: medicine.

SUBSTANCE: avirulent Vibrio cholerae strain of biovar eltor of serovar Ogawa - a producer of a major protective O1 antigen of serovar Ogawa is produced in a simulation experiment of virulent natural V.cholerae M569 Ogawa strain by spontaneous loss of "СТХφ" prophage at cholera agent continuance in sterile river water. The strain is deposited in the State Collection of pathogenic bacteria "Microbe" Registration No. 262 of the Collection of Miscroorganisms. A feature of the strain is the absence of genes of a core region of "СТХφ" prophage. The strain is avirulent for suckling rabbits, agglutinated by cholera serums O1 and Ogawa in dilution exceeding a diagnostic titre.

EFFECT: use of the invention allows producing a vaccine of O1 protective antigen of serovar Ogawa providing immunity formation in cholera.

5 ex

FIELD: medicine.

SUBSTANCE: avirulent Vibrio cholerae KM 263 strain of biovar eltor of serovar Inaba - a producer of a protective O1 antigen is produced in a simulation experiment of virulent natural V.cholerae M569 Inaba strain by spontaneous loss of "СТХφ" prophage at cholera agent continuance in sterile river water. The strain is characterised by a high production level of the major protective O1 antigen of serovar Inaba.

EFFECT: invention aims at preparing chemical cholera vaccines by formation of antibacterial cholera immunity, and producing purified preparation of the O1 antigen of serovar Inaba for a diagnostic serum preparation .

5 ex

FIELD: medicine.

SUBSTANCE: blood serum is diluted with physiologic saline in the ratio 1:2, 1:5, 1:10, 1:20 and 1:50, and tracheobronchial aspirates are diluted with physiologic saline in the ratio 1:2, 1:4, 1:8, 1:16 and 1:32. A solid nutrient medium of the following composition is prepared: a nutrient microbiological dry agar 26.5 g, a nutrient yeast extract 1.22 g, lactose 10.7 g, disodium phosphate 0.48 g, anhydrous sodium sulphite 0.83 g, sodium carbonate 0.03 g, sodium hydroxide 5.0 g, distilled water 1000 ml, pH 8.0 which contains the test strain Micrococcus lysodeiktikus 2665 in the concentration 50 million microbial cells in 1 ml of the medium. Simultaneously with the material being analysed, a reference concentration 5 mcg/ml is introduced in the wells of the diameter 8 mm on each Petri dish. In 18 hours of the incubation procedure at 37°C, a diameter of test strain growth retardation zone surrounding the wells are measured. The vancomycin concentration, mcg/ml is determined by a calibration curve of growth retardation zone diameter to the reference vancomycin concentration.

EFFECT: use of the declared method allows determining the vancomycin concentration in the biological fluids and ensuring higher clinical effectiveness.

2 ex

FIELD: medicine.

SUBSTANCE: method involves cultivation of recombinant koji mycelial fungi in a fluid medium, collection of recombinant protein from the prepared product. The culture medium contains as a raw substance, at least one selected from a group consisting of barley and wheat surface of which is completely or partially coated at least in the concentration 1 to 20% (weight/volume) and as nutrients, at least one inorganic salt. Recombinant koji mycelial fungi is produced by a procedure consisting in the fact that a gene coding a target protein is ligatured below a promotor of a gene coding an enzyme exposed to catabolite repression due to concentration of the nutrients, such as saccharides and amino acids, for preparing thereby the ligation product, and the ligation product is introduced in koji mycelial fungi as a host.

EFFECT: invention allows higher yield protein.

4 cl, 3 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: by recombinant method obtained is fused protein, which contains natural molecule of human erythropoetine with cysteine residue near its C-end and Fc fragment of humal IgG, containing hinge region, N-end of said Fc fragment is connected to said C-end of said erythropoetine molecule, and said Fc fragment is natural, excluding mutation, consisting in substitution of cysteine residue in said hinge region, located the nearest of all to said erythropoetine molecule, with non-cysteine residue, which resulted in the fact that first cysteine residue of said hinge region, located the nearest of all to said N-end, is separated, by, at least, 12 or 17 amino acids from said cysteine residue of said erythropoetine molecule. Obtained peptide is used for stimulation of erythropoesis in mammal.

EFFECT: invention makes it possible to obtain fused protein, which possesses erythropoetine activity, has prolonged time of half-life in vivo in comparison with native human erythropoetine.

43 cl, 20 dwg, 10 ex

FIELD: medicine.

SUBSTANCE: in order to obtain protein PS-CFP2/TurboYFP_MBP7, constructed is recombinant plasmid DNA PS-CFP2/TurboYFP_MBP7 with size 4916 bp, coding hybrid protein, containing sequence of proteins PS-CFP2 and Turbo YFP, bound with fragment of myelin basic protein 80-104. Composition of plasmid DNA also includes promoter of T5 PHK-polymerase transcription, site of ribosome binding; fragment of DNA plasmid gen of β-lactamase, determining stability of Escherichia coli cells to ampicillin, as genetic marker. Obtained plasmid DNA is used to transform cells of Escherichia coli strain BL21(DE3) to obtain strain-producent of hybrid protein PS-CFP2/TurboYFP_MBP7. In order to obtain protein PS-CFP2/TurboYFP_MBP7 cultivation of strain-producent of Escherichia coli BL21 (DE3)/pQe30_PS-CFP2/TurboYFP_MBP7 is performed, cells are destroyed and target protein is purified by method of affine and gel-filtration chromatography.

EFFECT: invention makes it possible to increase biosensor sensitivity and stability and extend its specificity in respect to pool of catalytic antibodies.

3 cl, 7 dwg, 1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: method of microbiological synthesis of mature human interferon alpha-2 is implemented by cultivation of Saccharomyces cerevisiae yeast containing inactivating mutation in a structural gene of proteinase YPS1 and/or additional genes of proteinase KEX2. A recombinant method is used to produce Saccharomyces cerevisiae yeast strains capable to secrete mature human interferon alpha-2 in a culture medium.

EFFECT: invention allows increasing production of mature human interferon alpha-2 ensured by reduced degradation of secreted interferon by yeast proteinase YPS1 gene inactivation, and by improved effectiveness of processing of secreted interferon precursor by increasing native or secreted proteinase KEX2 expression.

9 cl, 1 tbl, 33 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention concerns area of molecular biology and biochemistry, and can be used in medicine. There is offered mutein conjugate of the blood coagulation factor VIII (FVIII) wherein a residue not being cysteine in position 41, 129, 377, 388, 468, 491, 556, 1804, 1808, 1810, 1812, 1813, 1815 and/or 2118 is substituted by a cysteine residue with polyethylene glycol (PEG) where a PEG molecule is bound with a polypeptide in a mutant cysteine residue.

EFFECT: improved pharmacokinetic properties of the FVIII as an ingredient of the conjugate under the invention with preserved a procoagulant factor activity allows presenting new FVIII PEG-muteins for producing of a pharmaceutical compositions for treating hemophilia.

12 cl, 38 dwg, 8 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: polypeptides exhibit antimicrobial activity and recovered polynucleotides coding these polypeptides. Nucleic acid constructs, vectors and host cells contain said polynucleotides.

EFFECT: applicability of polypeptides in veterinary science and medicine, as well as in forage production.

16 cl, 6 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: plasmid vector pE-Trx-Aur is constructed for expression of aurelin in cells of Escherichia coli in composition of hybrid protein Trx-Aur, consisting of two DNA fragments, whose nucleotide sequence is given in description. By means of said vector parent strain of Escherichia coli is transformed, obtaining strain-producent of hybrid protein Trx-Aur. In order to obtain peptide aurilin cultivation of cells of obtained strain-producent is carried out, after that, performed are: cell lysis, affine purification of hybrid protein Trx-Aur on metal-chelate carrier, decomposition of hybrid protein Trx-Aur with bromine cyan by residue of methionine, introduced between sequences of aurelin and thioredoxin, and purification of target peptide by method of reversed-phase HPLC.

EFFECT: invention makes it possible to obtain biologically active aurelin by simplified technology and without application of hard-to-obtain natural raw material.

3 cl, 4 dwg, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: invention refers to producing versions of group I Poaceae (holy grass) allergen, also can be used either for specific immunotherapy (hyposensitisation) of patients with grass pollen allergy, or for preventive immunotherapy of grass pollen allergies. The produced versions are characterised by Cys41 Ser, Cys57Ser, Cys69Ser, Cys72Ser, Cys77Ser, Cys83Ser and Cysl39Ser substitutes in a Phi p1 mature protein sequence. Also, a structure of the allergen versions can be presented with no fragments relevant to amino acid residues 1-6, 1-30, 92-104, 115-119, 175-185 and 213-220 or 1-6, 115-119 and 213-220 as a part of a primary sequence of Phi p1 mature protein.

EFFECT: invention allows producing a version of group I Poaceae allergen characterised lower IgE responsiveness as compared with common wild allergen and substantially maintained responsiveness to T-lymphocytes.

8 cl, 9 dwg, 2 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: biologically active peptide is proposed with the common formula: , where OBu - residue of 2-oxobutyric acid, Abu - residue of 2-aminobutyric acid, Dha - residue of 2,3-didehydroalanine, Dhb - residue of 2,3-didehydroaminobutyric acid, besides residues are in sequence linked with amide links, residues Abu3-Ala7, Abu22-Ala27 and Abu24-Ala31 are also linked pairwise with thioether links with formation of three residues of 3-methyllanthionine, residues Ala11-Ala21 are linked with thioether link to form residue of lanthionine. This peptide has antimicrobial effect at gram-positive bacteria Bacillus subtilis, strains L1 and 1621; Bacillus pumilus, strain 2001; Bacillus globigii, strain I; Bacillus amyloliquefaciens, strain I; Bacillus megaterium, strain VKM41; Mycobacterium smegmatis, strain 1171; Mycobacterium phlei, strain 1291; Micrococcus luteus, strain B 1314; Staphylococcus aureus, strain 209p; Rhodococcus sp., strain SSI.

EFFECT: increased efficiency of peptide antimicrobial action.

4 dwg, 1 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: as feedstock for fractioning used is anticytomegalovirus plasma with activity index not less than 70%. Process of production includes: ultrafiltration of immunoglobulin at ion force not higher than 0.02 and pH value 4.0-5.7 with further diafiltration against distilled water with pH value 3.5-6.0. Immunoglobulin is incubated with maltose of 2-11% concentration at temperature 32-40°C and pH value 4.0-4.8 for 10-36 hours, or with pepsin in dose 1:10-6-1:10-5 in presence of 2-11% maltose. After that inactivation/removal of viruses is carried out by immunoglobulin incubation at pH value 4.0-4.4 and/or with application of depth filtration, and/or nanofiltration. Afterpurification of immunoglobulin is performed by methods of: ultrafiltration and/or depth filtration, and/or nanofiltration, and/or anion-exchange chromatography, and/or dialysis. Immunoglobulin stabilisation is carried out with application of sodium chloride and/or maltose, and/or proline, and/or glucose and/or glycerol, whose content provides preparation osmolarity within 270-400 mOcm/kg. In obtained immunoglobulin preparation pH value 5.0-7.5 and protein content 4.5-10.5% are installed.

EFFECT: invention allows to obtain highly avid immunoglobulin preparation against cytomegalovirus for intravenous introduction with improved and stable qualitative quaracteristics.

7 cl, 5 tbl, 4 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and specifically to obtaining versions of glycoprotein IV alpha polypeptide of human thrombocytes (GPIbalpha) and can be used in medicine to treat vascular disorders. Using a recombinant technique, a polypeptide is obtained, which contains substitutes in SEQ ID NO:2 selected from: Y276F K237V C65S; K237V C65S; Y276F C65S; or Y276F Y278F Y279F K237V C65S. The obtained polypeptide is used to inhibit bonding of leucocytes to biological tissue or for treating disorders associated with activation of thrombocytes.

EFFECT: invention enables to obtain GPIbalpha polypeptide which bonds with von Willebrand factor with affinity which is at least 10 times higher than in natural GPIbα polypeptide, and also has low affinity for bonding with alpha-thrombin, lower aggregation and/or high resistance to proteolysis relative the polypeptide with SEQ ID NO:2.

41 cl, 3 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: invention refers to recombinant plasmid DNA pER-Hir coding a hybrid protein capable to autocatalytic breakdown to form [Leul, Thr2]-63-desulphatohirudin, to Escherichia coli to an ER2566/pER-Hir strain - a producer of said protein and a method for producing genetically engineered [Leu 1, Thr2]-63-desulphatohirudin. The presented recombinant plasmid DNA consists of the SapI/BamHI fragment of DNA plasmid pTWIN-1 containing a promoter and a terminator of T7-RNA-polymerase transcription, an amplifier of phages T7 gene 10 translation, β-laktamase (Ap) gene, modified mini-intein Ssp DnaB gene, with an integrated sequence of a chitin-binding domain, and the SapI/BamHI-fragment of DNA containing a sequence of a gene of recombinant [Leul, Thr2]-63-desulphatohirudin-1 containing β-laktamase (Ap) gene as a genetic marker, and unique recognition sites of restriction endonucleases located at the following distance to the left from the site BamHI: Nrul - 186 base pairs, Ndel - 594 base pairs, Xbal - 882 base pairs, EcoRV - 2913 base pairs, Hpal - 2966 base pairs.

EFFECT: inventions allow producing said compound which is used as a drug applied to prevent blood hypercoagulation.

3 cl, 1 dwg, 4 ex

Up!