Immunogenic compositions pcv2 and methods for producing such compositions

FIELD: medicine.

SUBSTANCE: there is offered an improved method for recovery of protein expressed from an open reading frame 2 of porcine circovirus type 2. The method involves the stages of introduction of recombinant baculovirus containing coding sequences of the open reading frame 2, in an insect cell contained in a culture medium. It is followed by expression of the open reading frame 2 by baculovirus and recovery of the expressed protein from a supernatant. Recovery is carried out approximately from the 5th day following cell infection to enable significant amounts of the recombinant protein to be expressed and secreted from the cells in the culture medium.

EFFECT: such methods avoid expensive and labour-intensive recovery procedures requiring separation and recovery of the recombinant protein from an internal cell space.

32 cl, 3 dwg, 24 tbl, 5 ex

 

RELATED APPLICATIONS

This application claims the priority of provisional application number 60/640510, filed December 30, 2004, and claims the number 11/034737, filed January 13, 2005, the disclosure and contents of which are hereby incorporated by reference.

The LIST of SEQUENCES

The application contains a list of sequences in paper format and in machine-readable format, explanations and contents of which are hereby incorporated by reference.

BACKGROUND of the INVENTION

The scope of the invention

In one aspect the present invention relates to the separation of a protein expressed by open reading frame 2 (ORF2) of swine circovirus type 2 (PCV2). More specifically, the protein is a recombinant protein expressed transfitsirovannykh virus containing the recombinant coding sequences for swine circovirus type 2, open reading frame 2. More specifically transfetsirovannyh allow the virus to infect cells in culture medium, and the protein expressed by open reading frame 2, are separated from the supernatant, and not from the interior of the cells. More specifically, the method includes a stage of amplification of the gene open reading frame 2 from swine circovirus type 2 clone this amplified parts per the initial vector, cutting out the pieces with an open reading frame 2 from this vector and cloned in the vector-vector, cotransfection cells in culture medium vector-vector with the viral vector, the possibility of infection of cells by a viral vector, and thus, the expression of open reading frame 2, and the allocation of expressed recombinant protein encoded an open reading frame 2 from the supernatant.

In another aspect, the present invention relates to immunogenic compositions effective for the induction of an immune response against PCV2, and methods of obtaining data immunogenic compositions. More specifically the present invention relates to an immunological composition that is effective to provide an immune response that protects the animal, which introduced the song, and reducing or diminishing the severity of clinical symptoms associated with PCV2 infection. More specifically the present invention relates to an immunological composition based protein, providing effective protection against PCV2 infection. More specifically the present invention relates to an immunological composition containing ORF2 of PCV2, where the introduction of PCV2-ORF2 leads to protection against PCV2 infection. Most specifically, the present invention relates to an immunological composition that is effective to provide EF the objective of immunity in pigs, which introduce an immunological composition, where the composition comprises a protein expressed from ORF2 of PCV2.

Description of the prior art

The swine circovirus type 2 (PCV2) is a small (17-22 nm in diameter), icosahedral DNA virus without the outer shell, containing single-stranded circular genome. PCV2 shares approximately 80% identical to sequence swine circovirus type 1 (PCV1). However, unlike PCV1, which usually is not virulent in pigs infected with PCV2, discover syndrome with generally accepted designation of multi-systemic wasting syndrome after weaning from sows (PMWS). PMWS is clinically characterized by emaciation, pallor, kilotlu, respiratory disorders, diarrhea, jaundice and jaundice. Some of the affected pigs see a combination of all symptoms, while other pigs see only one or two of these symptoms. At autopsy detect damage in many tissues and organs, where the predominant sites of lesions are lymphoid organs. Found a strong correlation between the amount of nucleic acid or antigen of PCV2 and severity of microscopic lymphoid lesions. The percentage of mortality for pigs infected with PCV2, can reach 80%. In addition to PMWS PCV2 is associated with several other infections, the key pseudoselector, porcine respiratory reproductive syndrome (PRRS), Glasser's disease, streptococcal meningitis, salmonellosis, colibacillus after weaning on sow diet steatosis and purulent bronchopneumonia.

A protein with an open reading frame 2 (ORF2) PCV2, having an approximate molecular weight of 30 kDa when passing gel for SDS-PAGE, last used as the antigenic component of the vaccine against PCV2. Conventional methods of obtaining ORF2 for use in such vaccines usually consist of PCV2 DNA amplification, the coding ORF2, transfection of viral vector DNA ORF2, infection of cells by a viral vector containing a DNA ORF2, provide opportunities for the virus to Express the protein ORF2 in the cell and the allocation of ORF2 protein from the cells by lysis of the cells. These methods generally take up to approximately four days after infection of cells by a viral vector. However, these methods have the disadvantage that the cues are both costly and time-consuming. In addition, the number of ORF2, was isolated from the cells, is not very large; therefore, it is necessary to infect a large number of cells a large number of viral vectors, to obtain a sufficient number of expressed recombinant protein for use in vaccines, etc.

Modern methods of immunization PCV2 including the act itself vaccines based on DNA such as described in U.S. patent No. 6703023. However, such vaccines were ineffective to provide protective immunity against PCV2 infection and associated clinical signs.

Accordingly, in this area there was a need for a method of obtaining protein ORF2, not requiring the allocation of ORF2 protein from the inner space of infected cells. In addition, there was a need for methods of obtaining recombinant ORF2 protein in quantities sufficient to effectively produce the composition of the vaccine. In addition, there was still a need for methods of obtaining ORF2 protein that does not require complicated and time-consuming methods for existing cues ORF2 protein. Finally, in regard to the compositions, in this area there was a need for immunogenic compositions, providing protective immunity against PCV2 infection and reduce the severity of associated clinical signs or prevent them.

The INVENTION

The present invention overcomes the problems inherent in the prior art, and provides a definite advantage in this field of knowledge. Specifically, in one aspect the present invention relates to improved methods of obtaining and/or isolation of recombinant protein ORF2 PCV2,i)by providing the possibility of infection is rustically cells in culture with recombinant viral vector, containing the coding DNA sequence of the ORF2 PCV2, where ORF2 protein expressed by the recombinant viral vector, andii)subsequent allocation of ORF2 from the supernatant. Suddenly discovered that ORF2 is released into the supernatant in large quantities, if you let the infection and subsequent incubation of infected cells to take longer than usual the previous way of obtaining ORF2 PCV2 in which PCV2 ORF2 separated from the internal space of the cells. Moreover, surprisingly, found that the protein PCV ORF2 is resistant to prototypical degradation outside of the producing cells. Both open together allow for the allocation of large amounts of protein ORF2 PCV2 from the supernatant of cell cultures infected with recombinant viral vectors containing the DNA of PCV2 ORF2 and expressing the protein of PCV2 ORF2. Large quantities of protein ORF2 PCV2 mean more than approximately 20 μg/ml of the supernatant, preferably more than about 25 μg/ml, even more preferably more than about 30 μg/ml, even more preferably more than about 40 μg/ml, even more preferably more than about 50 μg/ml, even more preferably more than about 60 μg/ml, even more preferably more than about 80 μg/ml, even more preferably more than approximately is about 100 μg/ml, even more preferably more than about 150 μg/ml, most preferably more than about 190 μg/ml. Such levels of expression can also be achieved, for example, by methods as described in examples 1-3.

Preferred cell culture have the number of cells is approximately between 0.3 and 2.0 × 106cells/ml, more preferably from around 0.35 to 1.9 × 106cells/ml, even more preferably from about 0.4 to 1.8 × 106cells/ml, even more preferably from approximately 0,45-1,7 × 106cells/ml and most preferably from about 0.5 to 1.5 × 106cells/ml, the person skilled in the art can determine the preferred cells. Preferred cells are susceptible to infection with a suitable recombinant viral vector containing a DNA of PCV2 ORF2, and expressing the protein of PCV2 ORF2. Preferably the cells are insect cells, and more preferably they include insect cells, sold under the trade name cell insects Sf+ (Protein Sciences Corporation, Meriden, CT).

Specialists in this field can also determine a suitable culture medium, where the preferred culture medium is a serum-free medium for insect cells, such as Excell 420 (JRH Biosciences, Inc., Lenexa, KS) and the like. Preferred VIR the red vectors include baculovirus, such as BaculoGold (BD Biosciences Pharmingen, San Diego, CA), especially if producing cells are insect cells. Although baculovirus expressing system is preferred, specialists in this field it is clear that other expressing systems are suitable for the purposes of the present invention, namely the expression of ORF2 PCV2 in the supernatant of cell culture. Such other expressing the system may require use of a signal sequence to induce the expression of ORF2 in the environment. Suddenly discovered that when ORF2 get in baculovirus expressing the system requires no signal sequence or additional modifications to induce the expression of ORF2 in the environment. Consider that this protein can independently form virus-like particles (Journal of General Virology Vol.81, p.2281-2287 (2000)) and secretariats in the culture supernatant. Recombinant viral vector containing the DNA sequence of ORF2 PCV2 has preferred multiplicity of infection (MOI) of approximately between 0.03 to 1.5, more preferably from about 0.05 to 1.3, more preferably from about 0.09 to 1,1, and most preferably from about 0.1 to 1.0 when used for infection of susceptible cells. Preferably the aforementioned MOI belong to one ml of cultural the second fluid. Preferably the described method involves infection of 0.35 to 1.9×106cells/ml, even more preferably about 0.4 to 1.8×106cells/ml, even more preferably approximately equal to 0.45 to 1.7×106cells/ml and most preferably about 0.5 to 1.5×106cells/ml recombinant viral vector containing a DNA ORF2 PCV2 and expressing the protein of PCV2 ORF with MOI (multiplicity of infection) of approximately between 0.03 to 1.5, more preferably from about 0.05 to 1.3, more preferably from about 0.09 to 1.1, and most preferably from about 0.1 to 1.0.

Then the infected cells are incubated for a period of up to ten days, more preferably from about two days to about ten days, even more preferably from about four days to about nine days, and most preferably from about five days to about eight days. The preferred incubation conditions include a temperature of approximately between 22-32°C, more preferably from about 24 to 30°C, even more preferably from about 25 to 29°C, even more preferably from about 26 to 28°C and most preferably about 27°C., Preferably in the cells of Sf+ after inoculation survey and induced by baculovirus characteristic changes. Such surveys may include the dynamics of cell density and decreased viability during the period after infection. Found that the peak viral titer observed 3-5 days after infection and peak release of ORF2 of the cells in the supernatant get between 5 and 8 days, and/or when the cell viability decreases to less than 10%.

Thus, in one aspect the present invention relates to an improved process for the preparation and/or isolation of recombinant protein ORF2 PCV2, preferably in the above-described quantities byi)allow infection of a number of sensitive cells (see above) in the culture of the recombinant viral vector with MOI, as defined above,ii)expression of protein ORF2 PCV2 by the recombinant viral vector andiii)subsequent allocation of PCV2 ORF2 from the supernatant of cells obtained between days 5 and 8 after infection, and/or when the cell viability decreases to less than 10%. Preferably, the recombinant viral vector is a recombinant baculovirus containing the coding DNA sequence of the ORF2 PCV2, and cells are cells Sf+. In addition, it is preferable to periodically examine the culture of macroscopic and microscopic manifestation of contamination or atypical changes in the morphology of the notches in the period after infection. Any culture any signs of contamination should be reject. Preferably expressed recombinant ORF2 protein is secreted by cells into the culture medium that supports cell viability. Then ORF2 are separated from the supernatant, the surrounding cells, and not in fact from cells.

The allocation process preferably begins with the separation of cell debris from downregulation on Wednesday ORF2 via phase separation. The preferred phase separation include filtration, centrifugation at a speed of up to approximately 20,000 × g centrifugation in a continuous mode, a chromatographic separation using ion exchange or gel filtration and conventional immunoaffinity ways. These methods are well-known experts in this field, for example, (Harris and Angel (eds.), Protein purification methods - a practical approach, IRL press, Oxford 1995). The most preferred methods of separation include centrifugation at speeds up to approximately 20,000 × g and filtered. Preferred methods of filtration include dead-end micro filtration and filtration tangential flow or cross-flow), including an impasse microfiltration on hollow fibers. This is preferable to a dead-end microfiltration. The preferred pore size for the Tupi the new microfiltration represents between approximately between 0.30 to 1.35 μm, more preferably between about 0.35 to 1,25 μm, even more preferably between about 0.40 to-1,10 μm and most preferably between approximately of 0.45 to 1.0 μm. Consider that any conventional filtration membrane suitable for the purposes of the present invention, and polyethersulfone membranes are preferred. During stage filtration removes all molecules of the nucleic acid with low weight.

Thus, in one additional aspect of the present invention relates to an improved process for the preparation and/or isolation of recombinant protein ORF2 PCV2, preferably in amounts described above, byi)allow infection of a number of sensitive cells (see above) in the culture of the recombinant viral vector with MOI, as defined above,ii)expression of protein ORF2 PCV2 by recombinant viral vectoriii)selection PCV2 ORF2 from the supernatant of cells obtained between days 5 and 8 after infection, and/or when the cell viability decreases to less than 10%, andiv)separating cellular debris from the expressed PCV2 ORF2 via phase separation. Preferably, the recombinant viral vector is a baculovirus containing the coding sequences of ORF2 DNA and cells are cells SF+. Preferred is the preliminary stages of centrifugation are described above. Most preferred is a dead-end microfiltration using a membrane with a pore size of between approximately between 0.30 to 1.35 μm, more preferably between about 0.35 to 1,25 μm, even more preferably between about 0.40 to-1,10 μm and most preferably between approximately of 0.45 to 1.0 μm.

To highlight the PCV2 ORF2, which will be used in immunogenic or immunological compositions, such as vaccine is the preferred inclusion stage of inactivation for inactivation of viral vector. "Immunogenic or immunological composition" refers to compositions containing at least one antigen that causes the host immunological response of the cell and/or mediate antibody immune response to consider the composition or vaccine. As a rule, "immunological response" includes, as non-limiting examples of one or more of the following effects: the production or activation of antibodies, B-cells, helper T cells, suppressor T-cells and/or cytotoxic T-cells and/or γδ T-cells directed specifically against the antigen or antigens included in the composition or vaccine. Preferably, the master and discover therapeutic or protective immunological response, so that the resistance to new infection will took the Chena and/or the clinical severity of the disease reduced. Such protection can be demonstrated or reduction, or absence of symptoms, normally detectable to the infected host, fast recovery time and/or low viral titer in the infected host. Thus, the present invention also relates to a method for obtaining and/or isolation of recombinant protein ORF2 PCV2 preferably in the above-described quantities byi)allow infection of a number of sensitive cells (see above) in the culture of the recombinant viral vector with MOI, as defined above,ii)expression of protein ORF2 PCV2 by recombinant viral vectoriii)selection PCV2 ORF2 from the supernatant of cells obtained between days 5 and 8 after infection, and/or when the cell viability decreases to less than 10%,iv)separating cellular debris from the expressed PCV2 ORF2 via phase separation andv)inactivate the recombinant viral vector.

Preferably this inactivation performed immediately before or after the stage of filtering, where the preferred time for inactivation is time after stage filtration. For the purposes of the present invention can use any generally accepted method of inactivation. So inactivation can be performed by chemical and/or physical in which deistvii. In preferred forms, determine the volume of liquid collected and bring the temperature to approximately 32-42°C, more preferably approximately 34-40°C and most preferably approximately 35-39°C. the Preferred methods of inactivation include adding cyklinowanie binary ethylenimine (BEI), preferably in a concentration from approximately 1 to approximately 20 mm, preferably from about 2 to about 10 mm, even more preferably from about 2 to about 8 mm, still more preferably from about 3 to about 7 mm, most preferably approximately 5 mm. For example, inactivation involves the addition of a solution of the hydrobromide of 2-bromadiolone, preferably about 0.4 M, cyklinowanie to 0.2 M binary ethylenimine (BEI) in 0.3 n NaOH, for fluids up to a final concentration of about 5 mm BEI. Preferably then, the liquid is continuously stirred for 72-96 hours and inactivated collected liquid can be stored frozen at -40°C or below or between about 1-7°C. After inactivation add a solution of sodium thiosulfate, preferably 1.0 M, to neutralize all residual BEI. Preferably sodium thiosulfate is added in an equivalent amount in comparison with BEI, pre-d is bavendam for inactivation. For example, if BEI added to a final concentration of 5 mm, add 1.0 M solution of sodium thiosulfate to the minimum final concentration of 5 mm to neutralize all residual BEI.

Thus, in one additional aspect of the present invention relates to a method for producing a recombinant protein ORF2 PCV2, preferably in the above-described quantities byi)allow infection of a number of sensitive cells (see above) in the culture of the recombinant viral vector with MOI, as defined above,ii)expression of protein ORF2 PCV2 by recombinant viral vectoriii)allocation of PCV2 ORF2 from the supernatant of cells obtained between 5 and 8 days after infection, and/or when the cell viability decreases to less than 10%,iv)separating cellular debris from the expressed PCV2 ORF2 via phase separation andv)inactivate the recombinant viral vector. Preferably, the recombinant viral vector is a baculovirus containing the coding sequences of ORF2 DNA and cells are cells SF+. The preferred methods of separation are described above, and the most preferred is the stage filtration. Preferred stages of inactivation are described above. Preferably inactive the Oia spend approximately between 35-39°C and in the presence of 2 to 8 mm BEI, even more preferably in the presence of about 5 mm BEI. Suddenly discovered that higher concentrations BEI adversely affect protein ORF2 PCV2.

One of the additional aspects of the present invention described above, the method also includes the stage of neutralization stage afterv). This stagevi)involves adding an equivalent amount of a substance that neutralizes the inactivating substance in solution. Preferably, if the inactivating substance is BEI, it is preferable to add sodium thiosulfate to an equivalent amount. Thus, in an additional aspect of the stagevi)includes adding sodium thiosulfate solution to a final concentration of from about 1 to about 20 mm, preferably from about 2 to about 10 mm, even more preferably from about 2 to about 8 mm, still more preferably from about 3 to about 7 mm, most preferably about 5 mm, where the inactivating substance is BEI.

In preferred forms, and especially in the forms with the use of recombinant protein ORF2 PCV2 in immunogenic compositions, such as vaccine, each batch of harvested ORF2 will be tested for inactivation by passage in dependent PR is mounting susceptible to baculovirus cells Sf+. In the preferred form of this testing 150 cm2the corresponding monolayer cell culture inoculant 1.0 ml of inactivated fluids with PCV2 and support at 25-29°C for 14 days in at least two passages. At the end of the period of maintenance in monolayers of cells check cytopathogenicity effect (CPE)typical of baculovirus with PCV2 ORF2. Preferably used as the virus for the positive control. Such controls may consist of cell culture Sf+inoculated did not undergo inactivation control baculovirus with PCV2 ORF2, and one vial of cells Sf+left without inoculation. After incubation and passage of the absence of virus-infected cells treated BEI liquids with the virus will be a satisfactory test of inactivation. Control cells inoculated with the control virus must have CPE typical of baculovirus with PCV2 ORF2, and in the vial without inoculation should not observe any signs of CPE baculovirus with PCV2 ORF2.

The alternative at the end of the period of maintenance, you can collect samples of the supernatant and inoculate in Sf+ in 96-well plate, which fill the cells Sf+ and then support at 25-29°C for 5-6 days. The tablet then fixed and stained with antibody against PCV2 ORF2, conjugated with FITC. The absence of CPE and the expression of ORF2, ka is detected IFA microscopy, for processed BEI liquids virus is a satisfactory test of inactivation. For control cells, inoculated control the virus must observe CPE and activity in the IFA, and the vial without inoculation should not have any signs of CPE baculovirus with PCV2 ORF2 and should not have activity in the IFA.

Thus, an additional aspect of the present invention refers to the test of inactivation to determine the effectiveness of inactivation of recombinant viral vector comprising the stage of:i)contacting at least part of the culture fluid containing the recombinant viral vector, with the inactivating agent, preferably, as described above,ii)adding a neutralizing substance to neutralize the inactivating substance, preferably as described above, andiii)determination of residual infectivity in the analyses as described above.

After inactivation of the relative amount of recombinant protein ORF2 PCV2 in the sample can be determined in a number of ways. The preferred methods of quantitative determination include densitometry after SDS-PAGE, ELISA and study vaccination of animals, establishing a correlation of the known quantities of the vaccine to clinical outcomes (serology and so on). When used for the quantitative evaluation of the SDS-PAG sample material, containing an unknown quantity of recombinant protein ORF2 PCV2 share in the gel with samples containing different known amounts of recombinant protein ORF2 PCV2. You can then obtain a standard curve based on known samples, and the number of recombinant PCV2 ORF2 in an unknown sample can be determined by comparison with this standard curve. Because the ELISA assays, as a rule, are generally accepted as industry standard to determine the amount of antigen, they are preferred for quantitative evaluation.

Thus, in an additional aspect, the present invention also relates to ELISA for the quantitative evaluation of recombinant protein ORF2 PCV2. The preferred ELISA, as presented here, as a rule, start with a dilution of antibodies for capture of 1:6000 or until the optimum working dilution in covering the buffer. The preferred antibody for capture is swine anti-PCV2 PAb, purified by protein G and the preferred covering the buffer is 0.05 M carbonate buffer, which can be obtained by the Association of 2.93 g NaHCO3(Sigma Cat # S-6014 or equivalent) and 1.59 g NaCO3(Sigma Cat. No.. S-6139 or equivalent). The mixture is combined with distilled water or equivalent to obtain one liter at a pH of 9.6±0,1. Then the antibody for capture diluted 1:6000 or to any other operating cultivation in covering the buffer. For example, for the four tablets need 42 ml covering the buffer and seven µl of antibody to capture. Using the method of reverse pipetting 100 μl of diluted antibody for capture was added to all wells. To get a smooth surface, it is necessary to gently tap on the sides of each tablet. Then the tablets were sealed tapes for sealing prior to being stacked and covered with a stack of empty 96-well plate. The plates were incubated over night (14-24 hours) at 35-39°C. Then each plate was washed three times with buffer for washing using the system for flushing titration of the microplate ultraplus at 250 μl/wash with three leaching and without time soaking. After the last washing tablets should knock on paper towel. Again using the method of reverse pipetting into each well, add 250 ál of blocking solution. Test tablets should seal and incubate for approximately one hour (± five minutes) at 35-37°C. Preferably, after this stage, the tablets do not stack. During the stage of blocking all samples should be grasped and thaw at room temperature. Then you should prepare four separate tablet for cultivation by adding 200 ál of dilution solution to all the remaining is MSA holes, except row A and row H, columns 1-3. Then six tubes should be marked as follows, low titer, the average titer, high titer, inactivated/filtered (1:240), inactivated/filtered (1:480) and internal control. In labeled test tubes should prepare the appropriate dilution for the following test samples. The thawed samples before use to mix with shaking. For the four tablets should perform the following breeding: A) low titer should not be diluted: 3.0 ml with a low titer; B) negative control with dilution 1:30 (cells SF+): 3.77 ml diluent + 130 µl of negative control; (C) the average title with a dilution of 1:30 (8 µg/ml): 3.77 ml diluent + 130 µl with an average titer; (D) high titer with a dilution of 1:90 (16 µg/ml): 2,967 ml diluent + 33 μl with high titer; (E) inactivated/filtered with a dilution of 1:240: 2,39 ml diluent + 10 μl of inactivated/filtered sample; (F) an inactivated/filtered with a dilution of 1:480: 1.0 ml diluent + 1.0 ml inactivated/filtered prepared sample (1:240) from E above; (G) internal control with dilution 1:30: 3.77 ml diluent + 130 ál of internal control. Then add 300 ál of prepared samples to the corresponding empty holes in tablets for cultivation for tablets 1-4. C is the set a multichannel pipette 100 ál, the contents of a number of A mix by pipetting up and down at least 5 times and then 100 μl transferred to the number B, using the method of reverse pipetting. Tips should be changed and the same procedure is repeated on the tablet to the number of G. the Samples in these tablets for cultivation is now ready for transfer to the test tablets as soon as the test tablets washed 3 times with buffer for washing using the system for flushing titration of the microplate ultraplus (set at 250 μl/wash, 3 washing, without time soaking). After the last washing tablets should knock on paper towel. Then the contents of the tablets for cultivation transferred into a test tablet using a simple transfer method. More specifically, since the number of H, 100 μl/well was transferred from the tablet(tablets) for cultivation in appropriate wells of the test tablet(tablets) using the method of reverse pipetting. After each transfer the pipette tips should be changed. From a number G tablet(tablets) for cultivation transfer 100 µl/well into appropriate wells of the test tablet(tablets) using the method of reverse pipetting. The same set of pipette tips for pipettes can be used for the rest of the transfer. To ensure homogeneity of the solution lapertosa, the solution should pipette up and down at least 3 times before the transfer. Then test the tablet(s) stick and incubated for 1.0 hour ± 5 minutes at 37°C±2,0°C. is preferred not to stack the plates. Then the tablets are washed 3 times with buffer for washing using the system for flushing titration of the microplate ultraplus (set at 250 μl/wash, 3 washing and without time soaking). After the last washing tablets tapping on a paper towel. Using the method of reverse pipetting 100 µl of the antibody for detection, diluted 1:300, or in respective dilution in diluent added to all wells of the test tablet(tablets). For example, for the four tablets need 42 ml of reconstitution solution with 140 ál of antibody to capture. Then test the tablet(s) stick and incubated for 1.0 hour ± 5 minutes at 37°C±2,0°C. Then the tablets again washed 3 times with buffer for washing using the system for flushing titration of the microplate ultraplus (set at 250 μl/wash, 3 washing and without time soaking). After the last washing tablets tapping on a paper towel. Then get a diluent for the conjugate addition of 1% normal rabbit serum to the diluent. For example, to couple the ex tablets 420 µl of normal rabbit serum is added to 42 ml of diluent. Conjugated antibody diluted 1:10000 or any other appropriate working dilution prepared diluent conjugate to all wells of the test tablet(tablets). Using the method of reverse pipetting 100 ál of this diluted conjugate antibody is added to all wells. Then test the tablet(s) stick and incubated for 45±5 minutes at 37°C±2,0°C. Preferably the tablets do not stack. Then the tablets are washed 3 times with buffer for washing using the system for flushing titration microplate (set at 250 μl/wash, 3 washing and without time soaking). After the last washing tablets tapping on a paper towel. Then just before use, mix equal volumes of substrate for peroxidase TMB (reagent A) with peroxidase solution B (reagent B). Mix the amount will vary depending on the number of tablets, but for each tablet will need 10 ml/tablet + 2 ml. Thus, for 4 tablets it will be 21 ml reagent A + 21 ml of reagent B. using the method of reverse pipetting 100 μl of substrate is added to all wells of the test tablet(tablets). Then the tablets incubated at room temperature for 15 minutes ± 15 seconds. The reaction is stopped by adding the 100 ál of 1 n HCl solution to all wells using the method of reverse pipetting. Then include the spectrophotometer to read the tablets after ELISA and allow it to pass his usual phases of diagnosis and testing in a conventional manner.

In an additional aspect, the invention relates to a method of constructing recombinant viral vector containing a DNA ORF2 PCV2 and expressing the protein of PCV2 ORF2 in large quantities during infection of sensitive cells. Suddenly discovered that the recombinant viral vector presented here expresses large quantities, as defined above, ORF2 PCV2 after infection of susceptible cells. Thus, the present invention also relates to an improved method for producing and/or releasing protein ORF2 PCV2, preferably comprising a stage of constructing recombinant viral vector containing a DNA ORF2 PCV2 and expressing the protein of PCV2 ORF2. Preferably the viral vector is a recombinant baculovirus. Details of how to construct recombinant viral vectors containing the DNA of PCV2 ORF2 and expressing the protein of PCV2 ORF2, as presented here, is described as follows: in the preferred forms of the recombinant viral vector containing a DNA ORF2 PCV2 and expressing the protein of PCV2 ORF2 used for infection of cells obtained by transfection of the vector-vector with the cloned gene in it is m ORF2, in a viral vector. Preferably the viral vector transferout only part of the vector-vector containing DNA ORF2. The term "transferout in the viral vector" means and used as a synonym for "insert" or "clone" heterologous DNA in a viral vector such as baculovirus vector. The viral vector is preferably, but not necessarily a baculovirus.

Thus, according to an additional aspect of the present invention the recombinant viral vector is produced by recombination between the vector-vector containing heterologous DNA PCV2 ORF2, and a viral vector, preferably a baculovirus, even more preferably linearized replication defective baculovirus (such as Baculo Gold DNA). "Vector-vector" means a DNA molecule that contains at least one replication origin heterologous gene, in this case PCV2 ORF2, and the DNA sequence that allows you to clone the specified heterologous gene in a viral vector. Preferably the sequence, allowing the cloning of heterologous gene into the viral vector, flank the heterologous gene. Even more preferably, these sequences are at least partially homologous to sequences of the viral vector. Homology sequence is ATEM allows recombination of both molecules, viral vector and vector-vector to obtain a recombinant viral vector containing a heterologous gene. One of the preferred vectors of vectors is the vector pVL1392 (BD Biosciences Pharmingen), designed to cotransfected with BaculoGold DNA in a preferred cell line Sf+. Preferably the specified vector-vector contains the DNA of PCV2 ORF2. Design for cotransfection is in length about 10387 base pairs.

In more preferred forms, the methods of the present invention starting from the DNA extraction PCV2 ORF2. Typically, this can be done from a known or an unknown strain, as ORF2 DNA, apparently, is highly conserved with at least about 95% sequence identity between the different isolates. Any gene ORF2 PCV2 known in this field can be used for the purposes of the present invention, since each will be expressed in the supernatant. DNA PCV ORF2 preferably amplified using PCR, even more preferably together with the introduction of 5'-flanking consensus Kozak sequence (CCGCCAUG) (SEQ ID NO 1) and/or 3'-flanking EcoR1 site (GAATTC) (SEQ ID NO 2). This introduction of 5'-consensus Kozak preferably removes the natural start codon AUG of the PCV2 ORF2. 3'EcoR1 site is preferably introduced below stopcodon PCV2 ORF2. More preferably it is introduced below the poly A sequences termination of transcription, which is localized below the stop codon PCV2 ORF2. Found that the use of a consensus Kozak sequence, in particular, as described above, increases the level of expression subsequent protein ORF2 PCV2. Amplified DNA ORF2 PCV2 these additional sequences clone in the vector. The preferred vector for the initial cloning is the vector pGEM-T-Easy (Promega, Madison, WI). DNA ORF2 PCV2, including some sequences of the vector pGEM (SEQ ID NO: 7), preferably cut out from the vector by restriction site Not1. The resulting DNA is then clone in the vector-vector.

Thus, in one aspect the present invention relates to a method of constructing recombinant viral vector containing a DNA of PCV2 ORF2. This method includes the stage ofi)cloning of recombinant PCV2 ORF2 in the vector-vector; andii)transfer part of the vector-vector containing the recombinant PCV2 ORF2 in the viral vector to obtain a recombinant viral vector. Preferably the vector-a vector is a vector described above or designed, as described above or as in the example shown in figure 1. Thus, in an additional aspect, the vector-vector, p is isenemy for constructing recombinant viral vector, as described here, contains the sequence of SEQ ID NO: 7.

In an additional aspect, the method further includes, before the stage ofi)next stage: amplification of DNA of PCV2 ORF2in vitrowhere flanking DNA sequence of the ORF2 PCV2 modify, as described above. Methods DNA amplification ORF2 PCV2 and modification of flanking sequencesin vitrocloningin vitroamplified DNA PCV2 ORF2 in the vector-vector and suitable vectors-vectors described above, in the example shown in figure 1, or well-known experts in this field. Thus, in an additional aspect, the present invention relates to a method of constructing recombinant viral vector containing a DNA ORF2 PCV2 and expressing the protein ORF2 PCV2, comprising the stage ofi)DNA amplification ORF2 PCV2in vitrowhere flanking sequences of the indicated DNA ORF2 PCV2 modify,ii)cloning of amplified DNA PCV2 ORF2 in the vector-vector; andiii)transfection of the vector-vector or part thereof, containing the recombinant DNA of PCV2 ORF2 in the viral vector to obtain a recombinant viral vector. Preferably the modification of flanking DNA sequences of ORF2 PCV2 were carried out as described above, for example, the introduction of 5'Kozak sequence and/or EcoR1 site, prefer the Ino, as explained above.

In an additional aspect, provided is a method of obtaining and/or isolation of recombinant protein expressed by open reading frame 2 of PCV2. The method generally includes the steps:i)cloning of recombinant PCV2 ORF2 in the vector-vector;ii)transfection part of the vector-vector containing the recombinant PCV2 ORF2 in the virus;iii)infection of cells in the environment transfitsirovannykh virus;iv)allow expression of the recombinant protein from PCV2 ORF2 recombinant virus;v)separation of the cells from the supernatant andvi)selection downregulation of protein ORF2 PCV2 from the supernatant.

Methods cloning of recombinant DNA PCV2 ORF2 in the vector-vector described above. Preferably the vector is the vector contains the sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7. However, vector-vector can contain any DNA ORF2 PCV2, unmodified or modified, provided that the DNA of PCV2 ORF2 by transfection in recombinant viral vector is expressed in cell culture. Preferably, the recombinant viral vector contains the sequence of SEQ ID NO: 8. Moreover, ways of infection of the cells, preferably the infection of insect cells by a certain number of recombinant baculoviruses containing the DNA of PCV2 ORF2 and expressing the protein of PCV2 ORF2, described in detail above. Bole is also the stage of separation of the cells from the supernatant, as well as the stage of selection downregulation of protein ORF2 PCV2, also described in detail above. Any of these specific stages of the method, as described here, are part of the method of preparation and/or isolation of recombinant protein expressed by open reading frame 2 of PCV2, as described above. Preferably, the cells are cells SF+. Even more preferably, the culture cells have the cell number of approximately between 0.3 to 2.0×106cells/ml, more preferably approximately between 0.35 to 1.9×106cells/ml, even more preferably approximately between 0.4 and 1.8×106cells/ml, even more preferably between about 0.45 and is 1.7×106cells/ml and most preferably between approximately 0.5 to 1.5×106cells/ml, Preferably recombinant viral vector containing a DNA of PCV2 ORF2 has preferred multiplicity of infection (MOI) of approximately between 0.03 to 1.5, more preferably between approximately from 0.05 to 1.3, more preferably approximately between 0,09 and 1.1, more preferably between about 0.1 to 1.0 and most preferably about 0.5, when used for infection of susceptible cells. Preferably the selection of protein ORF2 PCV2 from the supernatant of cells obtained between days 5 and 8 after which Peccei, and/or by reducing cell viability to less than 10%. It is preferable to obtain protein ORF2 PCV2 cells cultivated at 25-29°C. Preferably the separation stage is a stage of centrifugation or stage filter.

Optionally the method may include phase DNA amplification PCV2 ORF2 of PCV2 strain before cloning the DNA of PCV2 ORF2 in the vector-vector. In preferred forms, the amplified sequences can be added also 5'Kozak sequence, a 3'EcoR1 site, and combinations thereof preferably before amplification or during it. Preferred 5'Kozak sequence contains SEQ ID NO: 1. Preferred 3'EcoR1 site contains SEQ ID NO: 2. Preferred DNA PCV2 ORF2 contains the nucleotide sequence with the inventory number in Genbank AF086834 (SEQ ID NO: 3) and SEQ ID NO: 4. Preferred recombinant protein of PCV2 ORF2 contains the amino acid sequence of SEQ ID NO: 5, which is a protein encoded by SEQ ID NO: 3 (Genbank Accession No. AF086834) and SEQ ID No: 6, which is a protein encoded by SEQ ID NO: 4. The preferred medium contains serum-free medium for insect cells, even more preferably medium Excell 420. When conducting an optional stage of amplification is preferred to first clone the amplified open frame of read is of 2 in the first vector, cut open reading frame 2 of the first vector, and use the cut out open-reading frames for cloning in the vector-vector. The preferred cell line for cotransfection is a cell line SF+. Preferred virus for cotransfection is a baculovirus. In the preferred form of this method transfusiona part of the vector-vector contains SEQ ID NO: 8. Finally, this method is preferable to select a protein with an open reading frame 2 (ORF2) of PCV2 supernatant of the cell culture at least 5 days after infection of cells with virus.

Thus, in an additional aspect, the invention relates to a method for producing and/or releasing open reading frame 2 of PCV2, comprising the stage of:i)DNA amplification ORF2 PCV2in vitropreferably by adding the 5'Kozak sequence and/or the addition of 3'-phase enzyme EcoR1,ii)cloning the amplified PCV2 ORF2 in the vector-vector;iii)transfection part of the vector-vector containing the recombinant PCV2 ORF2 in the virus;iv)infection of cells in the environment transfitsirovannykh virus;v)the implementation of the expression transfitsirovannykh virus recombinant protein from PCV2 ORF2;vi)separation of the cells from the supernatant andvii)selection downregulation of protein ORF2 of PCV2 soup is natant.

In an additional aspect, the present invention relates to a method of obtaining a composition containing protein ORF2 PCV2 and an inactivated viral vector. This method includes the stages of:i)cloning the amplified PCV2 ORF2 in the vector-vector;ii)transfection part of the vector-vector containing the recombinant PCV2 ORF2 in the virus;iii)infection of cells in the environment transfitsirovannykh viral vector;iv)the implementation of the expression transfitsirovannykh virus recombinant protein from PCV2 ORF2;v)separation of the cells from the supernatant;vi)selection downregulation of protein ORF2 PCV2 from the supernatant andvii)inactivate the recombinant viral vector. Preferably, the recombinant viral vector is a baculovirus containing the coding sequences of ORF2 DNA and cells are cells SF+. Preferred stages of separation are described above stage, where the most preferred is the stage filtration. Preferred stages of inactivation are described above stage. Preferably inactivation spend approximately between 35-39°C and in the presence of 2 to 8 mm BEI, even more preferably in the presence of about 5 mm BEI. Suddenly discovered that higher concentrations BEI adversely affect protein ORF2 PCV2, and a lower concentration is tion are not effective for the inactivation of viral vector within 24-72 hours inactivation. Preferably inactivation spend at least 24 hours, even more preferably from 24 to 72 hours.

In an additional aspect, a method of obtaining a composition containing protein ORF2 PCV2 and an inactivated viral vector, as described above, also includes the stage of neutralization stage aftervii). This stageviii)involves adding an equivalent amount of a substance that neutralizes the inactivating substance in solution. Preferably, if the inactivating substance is BEI, it is preferable to add sodium thiosulfate to an equivalent amount. Thus, according to an additional aspect of the stageviii)includes adding sodium thiosulfate solution to a final concentration of from about 1 to about 20 mm, preferably from about 2 to about 10 mm, even more preferably from about 2 to about 8 mm, still more preferably from about 3 to about 7 mm, most preferably about 5 mm, where the inactivating substance is BEI.

In an additional aspect, a method of obtaining a composition containing protein ORF2 PCV2 and an inactivated viral vector, as described above, includes a front stagei)next stage: amplification of DNA of PCV2 ORF2in vitrowhere flanking last the sequences of the DNA of PCV2 ORF2 modify, as explained above. Methods DNA amplification ORF2 PCV2 and modification of flanking sequencesin vitrocloningin vitroamplified DNA PCV2 ORF2 in the vector-vector and suitable vectors-vectors described above, in the example shown in figure 1, or well-known experts in this field. Thus, in an additional aspect, the method includes the stages of:i)DNA amplification ORF2 PCV2in vitrowhere flanking sequences of the indicated DNA ORF2 PCV2 modify,ii)cloning of amplified DNA PCV2 ORF2 in the vector-vector; andiii)transfection of the vector-vector or part thereof, containing the recombinant DNA of PCV2 ORF2 in the viral vector to obtain a recombinant viral vectoriv)infection of cells in the environment transfitsirovannykh virus;v)the implementation of the expression of recombinant protein ORF2 PCV2 transfitsirovannykh virus;vi)separation of the cells from the supernatant;vii)selection downregulation of protein ORF2 PCV2 from the supernatant;viii)inactivate the recombinant viral vector, preferably in the presence of from about 1 to about 20 mm BEI, most preferably, in the presence of about 5 mm BEI; andix)add an equivalent amount of a substance that neutralizes the inactivating substance in the solution, preferably after the separation of sodium thiosulfate solution to a final concentration of from approximately 1 to approximately 20 mm, preferably about 5 mm, if the inactivating substance is a BEI.

In another aspect, the present invention relates to a method for producing the composition, preferably antigenic composition such as a vaccine to induce an immune response against PCV2. Generally, this method includes the stage of transfection constructs, virus, where the structure containsi)recombinant DNA of PCV2 ORF2,ii)infection of cells in culture medium transfitsirovannykh virus,iii)the implementation of the expression of recombinant protein ORF2 PCV2 virus,iv)allocation expressed ORF2 protein from the supernatant,v)and obtaining a composition by combining the selected protein with a suitable adjuvant and/or other pharmaceutically acceptable carrier.

"Adjuvants"as used herein may include aluminum hydroxide and aluminum phosphate, saponins, for example, Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), emulsion-type water-in-oil"emulsion of the type oil-in-water, emulsion type water in oil in water". The emulsion may be based in particular on light liquid paraffin oil (European Pharmacopoeia); isoprenoid oil such as squalane or squalene; oil resulting from the oligomerization of alkenes, in particular, isobutene or de is s; esters of acids or of alcohols containing a linear alkyl group, more particularly vegetable oils, atiloleate, di-(kaprilat/caprate) propylene glycol, tri-(kaprilat/caprate) glyceryl or dioleate propylene glycol; esters of branched fatty acids or alcohols, in particular, esters ezoterikovou acid. To obtain the emulsion oil is used in combination with emulsifiers. The emulsifiers preferably represent nonionic surfactants, in particular, esters sorbitan, manned (e.g., oleate of anhydromannitol), glycol, polyglycerol, propylene glycol and oil, ezoterikovou, ricinoleic or hydroxystearates acid, which are optionally ethoxylated, and block copolymers of polyoxypropylene-polyoxyethylene, in particular, products pluronic, especially L121. See Hunter et al., theory and Practical Application of Adjuvants (Ed.Stewart-Tull, D. E. S.). JohnWiley and Sons, NY, p.51-94 (1995) and Todd et al., Vaccine 15:564-570 (1997).

For example, you can use the SPT emulsion described on page 147 of "Vaccine Design, The Subunit and Adjuvant Approach" edited by M.Powell and M.Newman, Plenum Press, 1995, and the emulsion MF59 described on page 183 of the same book.

An additional example of an adjuvant is a compound selected from polymers of acrylic or methacrylic acid and copolymers of maleic anhydride and a derivative of alkenyl. Preferred hell is antimi compounds are the polymers of acrylic or methacrylic acid, which is cross-linked, especially with esters polyalkene with sugars or polyalcohol. These compounds are known as carbomer (Phameuropa Vol.8, No. 2, June 1996). Specialists in this field can also apply to U.S. patent No. .2909462, which describes such acrylic polymers cross-linked with polyhydroxylated compound having at least 3 hydroxyl groups, preferably not more than 8, where the hydrogen atoms of at least three hydroxyl substituted unsaturated aliphatic radicals having at least 2 carbon atoms. The preferred radicals are radicals containing from 2 to 4 carbon atoms, for example vinyl, allili and other unsaturated ethylene group. Unsaturated radicals may themselves contain other substituents, such as methyl. Particularly suitable products are sold under the name carbopol; (BF Goodrich, Ohio, USA). They are cross-linked with allilohreos or allinterracial. Among them mention may be made of carbopol 974P, 934P and 971P. Most preferred is the use of carbopol 971P. Among the copolymers of maleic anhydride and a derivative of alkenyl copolymers EMA (Monsanto), which are copolymers of maleic anhydride and ethylene. The dissolution of these polymers in water get acidic solution, which is italist preferably to a physiological pH, to obtain a solution adjuvant, in which you can enter the actual immunogenic, immunological or vaccine composition.

Additional suitable adjuvants include as non-limiting examples among many other adjuvant system RIBI (Ribi Inc.), the block copolymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville, CA), monophosphoryl lipid A, lipid-amine adjuvant avidin, thermolabile enterotoxin fromE. coli(recombinant or otherwise), cholera exotoxin, IMS 1314 or muramyl-dipeptide.

Preferably the adjuvant is added in an amount of from about 100 μg to about 10 mg per dose. Even more preferably, the adjuvant is added in an amount of from about 100 μg to about 10 mg per dose. Even more preferably, the adjuvant is added in an amount of from about 500 μg to about 5 mg per dose. Even more preferably, the adjuvant is added in an amount of from about 750 μg to about 2.5 mg per dose. Most preferably the adjuvant is added in amount of about 1 mg per dose.

Thus, in an additional aspect, a method of obtaining antigenic composition such as a vaccine to produce an immune response against PCV2, includesi)receipt and allocation of protein ORF2 PCV2 andii)mixing it with a suitable adjuvant. Preferably the hell is uwant represents carbopol 971P. Even more preferably carbopol 971 P is added in an amount of from about 500 μg to about 5 mg per dose, even more preferably in an amount of about 750 μg to about 2.5 mg per dose and most preferably in amount of about 1 mg per dose. Preferably stage of the methodi)includes a stage of the method as described for the acquisition and allocation PCV2 ORF2. For example, in preferred forms of this method of construction, comprising the DNA of PCV2 ORF2, get in the vector-vector. Suitable vectors-vectors and methods for their preparation are described above. Optional method may include the stage of amplification ORF2 of PCV2 strain by PCR prior to cloning ORF2 in vector-vector. The preferred open reading frame sequence, Kozak sequence, the sequence of the 3'EcoR1 site, the sequence of the recombinant protein, the sequence of the transfected constructs, environment, cells and viruses are as described in the previous methods. Another optional step of this method involves cloning of amplified DNA PCV2 ORF2 in the first vector, cut ORF2 DNA from the first vector and the use of this cut PCV2 DNA ORP2 for cloning in the vector-vector. As in the case of other methods, is predpochtite is determined as being to wait at least 5 days after infection cells transfitsirovannykh baculovirus before allocating recombinant ORF2 protein from the supernatant. Preferably stage of selection used in this method includes a stage of separation of the medium from the cells and cellular debris. This can be done many ways, but for simplicity and convenience, it is preferable to filter cells, cellular debris, and the culture medium through a filter with pore size in the range from about 0.45 μm to approximately 1.0 μm. Finally, this method is preferable to include the stage of virus inactivation before combining the selected recombinant protein ORF2 PCV2 in the composition. This can be done many ways, but in implementing the present invention in practice, it is preferable to apply BEI.

Thus, in an additional aspect, the method includes the stage ofi)DNA amplification ORF2 PCV2in vitrowhere flanking sequences of the indicated DNA ORF2 PCV2 modify,ii)cloning of amplified DNA PCV2 ORF2 in the vector-vector; andiii)transfection of the vector-vector or part thereof, containing the recombinant DNA of PCV2 ORF2 in the viral vector to obtain a recombinant viral vectoriv)infection of cells in the environment transfitsirovannykh vector; v) implementation of the expression of the recombinant protein from PCV2 ORF2 transfitsirovannykh virus;vi)separation of the cells from the supernatant;vii)selection expressio the data protein ORF2 PCV2 from the supernatant; viii)inactivate the recombinant viral vector, preferably in the presence of from about 1 to about 20 mm BEI, most preferably in the presence of about 5 mm BEI;ix)add an equivalent amount of a substance that neutralizes the inactivating substance in solution, preferably adding sodium thiosulfate solution to a final concentration of from about 1 to about 20 mm, preferably approximately 5 mm, if the inactivating substance is a BEI, andx)add the appropriate amount of adjuvant, preferably adding carbopol, more preferably carbopol 971P, even more preferably in quantities as described above (for example, from about 500 μg to about 5 mg per dose, even more preferably in an amount of about 750 μg to about 2.5 mg per dose and most preferably in amount of about 1 mg per dose).

In addition, the composition may include one or more pharmaceutical acceptable carriers. As used here, "pharmaceutical acceptable carrier" includes any and all solvents, dispersants, coatings, stabilizers, diluents, preservatives, antibacterial and antifungal substances, isotonic means delaying ogladanie tools, etc. Most preferably the composition is provided here contains protein ORF2 PCV2 isolated from the supernatant of culturedin vitrocells, where cells infect recombinant viral vector containing a DNA ORF2 PCV2 and expressing the protein of PCV2 ORF2, and where the specified cell culture is treated with from about 2 to about 8 mm BEI, preferably about 5 mm BEI to inactivate viral vector, and an equivalent concentration of the neutralizing substance is preferably a sodium thiosulfate solution to a final concentration of from about 2 to about 8 mm, preferably approximately 5 mm, carbopol, more preferably carbopol 971P, preferably in quantities of from about 500 μg to about 5 mg per dose, even more preferably in quantities of from about 750 mcg to about 2.5 mg per dose and most preferably in amount of about 1 mg per dose and saline solution preferably in an amount of from about 50 to about 90% (about./vol.), more preferably between approximately 60-80% (vol./vol.), even more preferably approximately 70% (vol./vol.).

Thus, an additional aspect relates to a method for producing an antigenic composition such as a vaccine to induce an immune from the et against PCV2, includes stagei)DNA amplification ORF2 PCV2in vitrowhere flanking sequences of the indicated DNA ORF2 PCV2 modify,ii)cloning of amplified DNA PCV2 ORF2 in the vector-vector andiii)transfection of the vector-vector or part thereof, containing the recombinant DNA of PCV2 ORF2 in the viral vector to obtain a recombinant viral vectoriv)infection of cells in the environment transfitsirovannykh virus;v)the implementation of the expression of the recombinant protein from PCV2 ORF2 transfitsirovannykh virus;vi)separation of the cells from the supernatant;vii)selection downregulation of protein ORF2 PCV2 from the supernatant;viii)inactivate the recombinant viral vector preferably in the presence of from about 1 to about 20 mm BEI, most preferably in the presence of about 5 mm BEI;ix)add an equivalent amount of a substance that neutralizes the inactivating substance in solution, preferably adding sodium thiosulfate solution to a final concentration of from about 1 to about 20 mm, preferably approximately 5 mm, if the inactivating substance is a BEI,x)add the appropriate number of adjuvants, preferably adding carbopol, more preferably carbopol 971P, even more preferably in amounts as described above (for example, from about 500 μg to about 5 mg per dose, even more preferably in an amount of about 750 μg to about 2.5 mg per dose and most preferably in amount of about 1 mg per dose); andxi)add saline, preferably in an amount of from about 50 to about 90% (about./vol.), more preferably between approximately 60-80% (vol./vol.), even more preferably approximately 70% (vol./vol.). Optional this method can also include adding stabilizer. Stabilizer, as used here, refers to the antimicrobial active agent, for example, such as gentamicin, merthiolate, etc. In particular, adding a stabilizer is preferred to obtain a composition for multiple doses. These antimicrobial active funds added in concentrations effective to prevent any microbiological contaminants of interest composition or for the inhibition of any microbial growth in an interesting composition.

Moreover, this method can also include adding any stabilizer, such as sugars, trehalose, mannitol, sucrose and the like, to increase and/or maintain shelf-life. But suddenly discovered that obtained with the becoming is immunologically effective for a period of at least 24 months without adding any additional stabilizer.

In an additional aspect, the present invention relates to products obtained by the methods described above. In particular, the present invention relates to compositions containing the expressed recombinant method protein ORF2 PCV2. Moreover, the present invention also relates to compositions containing the expressed recombinant method protein ORF2 PCV2 isolated from the culture supernatant of the insect cells. Moreover, the present invention also relates to compositions containing the expressed recombinant method protein ORF2 PCV2 isolated from the culture supernatant of the insect cells. Preferably, the composition also contains a means for inactivation of viral vectors. Preferably the tool for inactivation is a BEI. Moreover, the present invention also relates to compositions containing the expressed recombinant method protein ORF2 PCV2 isolated from the culture supernatant of the insect cells, and contains a tool suitable for the inactivation of viral vector preferably BEI, and neutralizing means for neutralizing the inactivating means. It is preferable that the neutralizing agent is a sodium thiosulfate using BEI as the inactivating means.

In another aspect of the present image is the buy relates to immunogenic compositions calling immune response and more preferably provides protective immunity against clinical signs of infection with PCV2. The composition usually contains a polypeptide or its fragment expressed from an open reading frame 2 (ORF2) of PCV2 as the antigenic component of the composition.

DNA and protein ORF2 PCV2, as applied here to obtain a composition, as used in the methods presented here is a highly conserved domain in the PCV2 isolates and as a consequence, any ORF2 PCV2 will be effective as a source of DNA and/or polypeptide PCV ORF2, as used here. A preferred protein of PCV2 ORF2 protein is SEQ ID NO. 11. Preferred polypeptide PCV ORF2 is here presented as SEQ ID NO. 5, however, experts in this field it is clear that this sequence may vary as much as 6-10% homology sequence, and still save antigenic characteristics that make it applicable in immunogenic compositions. Antigenic characteristics of immunological compositions can, for example, be determined by experiment intrusion, as shown in example 4. Moreover, the antigenic characteristics of the modified antigen is still saved when modified antigen provides at least 70%, preferably 80%, more preferably 90% protection of the aqueous immunity compared with protein ORF2 PCV2, encoded by polynucleotide sequence SEQ ID NO: 3 or SEQ ID NO: 4. "Immunogenic composition", as used here, refers to a protein ORF2 PCV2, which causes the host immunological response of the cell and/or mediate antibody immune response to a protein ORF2 PCV2. Preferably, this immunogenic composition capable of providing protective immunity against PCV2 infection and associated clinical signs. In some forms immunogenic portion of the protein ORF2 PCV2 is used as the antigenic component of the composition. The term "immunogenic portion", as used here, refers to a truncated and/or substituted forms, or fragments of the protein ORF2 PCV2 and/or polynucleotide, respectively. Preferably such truncated and/or substituted forms, or fragments contain at least 6 continuous amino acids of the full-length ORF2 polypeptide. More preferably, the truncated or substituted forms, or fragments will be at least 10, more preferably at least 15, and even more preferably at least 19 contiguous amino acids of a full length ORF2 polypeptide. Two preferable in this respect to the sequence presented here as SEQ ID NO. 9 and 10. In addition, it is clear that such sequences can be part of a larger fragments or be trimmed the forms. Additional preferred polypeptide ORF2 PCV2 presented here encodes the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 4. However, experts in this field it is clear that this sequence may vary as much as 6-20% homology sequence and keep antigenic characteristics, applicable in immunogenic compositions. In some forms truncated or substituted form or fragment of ORF2 is used as the antigenic component of the composition. Preferably such truncated or substituted forms, or fragments will contain at least 18 contiguous nucleotides of the full nucleotide sequence of ORF2, for example, SEQ ID NO: 3 or SEQ ID NO: 4. More preferably truncated or substituted forms, or fragments will be of at least 30, more preferably at least 45, and more preferably at least 57 contiguous nucleotides of the full nucleotide sequence of ORF2, for example, SEQ ID NO: 3 or SEQ ID NO: 4.

"Sequence identity", as known in this field, refers to communication between two or more polypeptide sequences or two or more polynucleotide sequences, namely the control sequence and the sequence to be compared the structure with the control sequence. The sequence identity is determined by comparing the sequence with the control sequence after optimal alignment of sequences for obtaining the highest degree of similarity of the sequences, as determined by the match between the threads of such sequences. This alignment sequence identity is determined on the basis of the position for position, for example, sequences are "identical" in a particular position, if in this position, the nucleotides or amino acid residues are identical. Then the total number of such identical provisions divided by the total number of nucleotides or residues in the control sequence to obtain the % sequence identity. The sequence identity can be easily calculated by known methods, including, as non-limiting examples, the methods described in Computational Molecular Biology, Lesk, A. N., ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988), the contents of which are hereby incorporated by reference. Preferred methods definition wide-angle the identity sequence is designed to get the best match between the tested sequences. Methods for determining sequence identity are encoded in publicly available computer programs that determine the sequence identity between these sequences. Examples of such programs include as non-limiting examples of the GCG software package (Devereux, J., et al., Nucleic acids Research, 12(1):387 (1984)), BLASTP, BLASTN and FASTA (Altschul, S. F. et al., J. Molec. Biol., 215:403-410 (1990)). The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCVI NLM NIH Bethesda, MD 20894, Altschul, S. F. et al., J. Molec. Biol., 215: 403-410 (1990), the contents of which are hereby incorporated by reference). These programs are optimally aligned sequences using weights passes by default to obtain the highest level of sequence identity between this and the control sequence. As the illustration polynucleotides with nucleotide sequence having, for example, at least 85%, preferably 90%, even more preferably 95% "sequence identity" with a control nucleotide sequence understand that the nucleotide sequence of this polynucleotide is identical to the reference sequence except that the sequence of this polynucleotide can contain up to 15, preferably up to 10, e is more preferably up to 5 point mutations per each 100 nucleotides of the control sequence. In other words, in polynucleotide with nucleotide sequence having at least 85%, preferably 90%, even more preferably 95% identity to a reference nucleotide sequence, up to 15%, preferably 10%, even more preferably 5% of the nucleotides in the control sequence can be deleteroute or replaced by other nucleotides, or a number of nucleotides up to 15%, preferably 10%, even more preferably 5% of all nucleotides in the control sequence can be inserted into the reference sequence. These mutations in the control sequence may be present in the 5'- or 3'-terminal positions of the control nucleotide sequence or anywhere between those terminal positions, divided either individually among nucleotides in the control sequence or in one or more contiguous groups in the control sequence. Similarly, under the polypeptide with the amino acid sequence having at least, for example, 85%, preferably 90%, even more preferably 95% sequence identity with reference amino acid sequence, understand that this amino acid sequence of the polypeptide is identical to control the placenta is successive, except that this sequence polypeptide can contain up to 15, preferably up to 10, even more preferably up to 5 amino acid substitutions per 100 amino acids amino acid control sequence. In other words, to obtain a given polypeptide sequence having at least 85%, preferably 90%, even more preferably 95% sequence identity with reference amino acid sequence, up to 15%, preferably up to 10%, even more preferably up to 5% of amino acid residues in the control sequence can be deleteroute or replaced by other amino acids, or the number of amino acids up to 15%, preferably up to 10%, even more preferably up to 5% of the total number of amino acid residues in the control sequence can be inserted into the reference sequence. These changes in the control sequence may be present in the N - or C-terminal positions of the control amino acid sequence or anywhere between those terminal positions, divided either individually among residues in the control sequence or in one or more contiguous groups in the control sequence. Preferably p is the position of the residues, which are not identical differ by conservative amino acid substitutions. However, conservative substitutions do not include matches with the identity of the sequence.

"Sequence homology", as used here, refers to a method of determining the relatedness of two sequences. To determine the homology sequence of two or more sequences are optimally aligned and, if necessary, make the passes. However, unlike "identity sequence" conservative amino acid substitution is considered a match when determining homology sequence. In other words, to obtain a polypeptide or polynucleotide having 95% sequence homology with the control sequence 85%, preferably 90%, even more preferably 95% amino acid residues or nucleotides in the control sequence must be the same with another amino acid or nucleotide or contain conservative substitutions or a number of amino acids or nucleotides up to 15%, preferably up to 10%, even more preferably up to 5% of the total number of amino acid residues or nucleotides in the control sequence, not including conservative substitutions can be inserted into the reference sequence. Preferably Homo is ulicna sequence contains at least a segment of 50, even more preferably from 100, even more preferably from 250, even more preferably from 500 nucleotides.

"Conservative substitution" refers to substitution of amino acid residue or nucleotide another amino acid residue or nucleotide having similar characteristics or properties, including size, hydrophobicity, etc. so that the functionality has not changed.

"Isolated" means altered "by the hand of man" compared with the natural state, i.e. if it exists in nature, it changed or removed from its natural environment or both. For example, polynucleotide or a polypeptide naturally present in a living organism is not "isolated", but the same polynucleotide or polypeptide, separated from substances, coexisting with it in its natural state is "isolated", as the term is used here.

Thus, in an additional aspect, the present invention relates to immunogenic compositions effective to decrease the severity of clinical symptoms associated with PCV2 infection containing protein ORF2 PCV2. Preferably the protein of PCV2 ORF2 is one of the proteins described above. Preferably, this protein ORF2 PCV2 is a

i)the polypeptide containing the sequence of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 9,SEQ ID NO: 10 or SEQ ID NO: 11;

ii)any polypeptide that is at least 80% homologous to the polypeptide of i);

iii)any immunogenic portion of the polypeptides of i) and/or (ii);

iv)the immunogenic portion of iii), containing at least 10 contiguous amino acids included in the sequences SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 10 or SEQ ID NO: 11;

v)the polypeptide encoded DNA containing the sequence of SEQ ID NO: 3 or SEQ ID NO: 4;

vi)any polypeptide encoded by polynucleotides, at least 80% homologous to polynucleotide from v);

vii)any immunogenic portion of the polypeptides encoded by polynucleotides of v and/or vi);

viii)the immunogenic portion of vii), where polynucleotide encoding specified immunogenic portion comprises at least 30 contiguous nucleotides included in the sequences SEQ ID NO: 3 or SEQ ID NO: 4.

Preferably, any of these immunogenic parts has immunogenic characteristics of the protein of PCV2 ORF2 encoded by the sequence SEQ ID NO: 3 or SEQ ID NO: 4.

In an additional aspect, the protein of PCV2 ORF2 presented in immunological composition at the level of antigen content, effective to induce the desired immune response, namely reducing the frequency of occurrence or reduce the severity of clinical signs caused by infection with PCV2. Preferably the level of protein ORF2 PCV2 at least 0.2 ug antigen/ml final immunogenic composition (μg/ml), more preferably from about 0.2 to about 400 μg/ml, even more preferably from about 0.3 to about 200 μg/ml, even more preferably from about 0.35 to about 100 μg/ml, even more preferably from about 0.4 to about 50 μg/ml, even more preferably from about 0.45 to about 30 μg/ml, even more preferably from about 0.6 to about 15 μg/ml, even more preferably from about 0.75 to about 8 μg/ml, even more preferably from about 1.0 to about 6 μg/ml, even more preferably from approximately 1.3 to approximately 3.0 μg/ml, even more preferably from about 1.4 to about 2.5 μg/ml, even more preferably from about 1.5 to about 2.0 µg/ml and most preferably about 1.6 ĩg/ml

In an additional aspect, the amount of ORF2 antigen is at least 0.2 ág protein ORF2 PCV2, as described above, the final dose of the antigenic composition (μg/dose), more preferably from about 0.2 to about 400 μg/dose, even more preferably from about 0.3 to about 200 μg/dose, even more preferably from about 0.35 to about 100 μg/dose, even more predpochtitel is about from about 0.4 to about 50 μg/dose, even more preferably from about 0.45 to about 30 μg/dose, even more preferably from about 0.6 to about 15 μg/dose, even more preferably from about 0.75 to about 8 μg/dose, even more preferably from about 1.0 to about 6 μg/dose, even more preferably from approximately 1.3 to approximately 3.0 μg/dose, even more preferably from about 1.4 to about 2.5 μg/dose, even more preferably from about 1.5 to about 2.0 µg/dose, and most preferably about 1.6 ĩg/dose.

Polypeptide ORF2 PCV2 used in the immunogenic compositions of the present invention, can be obtained by any method, including the selection and cleaning of the PCV2 ORF2, a common protein synthesis and recombinant methods. Preferred methods for producing polypeptide ORF2 PCV2 described in this document above and presented in the patent application U.S. serial no.11/034797, explanations and contents of which are hereby incorporated by reference. Briefly sensitive cells infect recombinant viral vector containing a coding sequence of DNA of PCV2 ORF2, ORF2 polypeptide PCV2 Express through recombinant virus expressed polypeptide PCV2 ORF2 are separated from the supernatant by filtration and inactivate Liu is a diversified accepted way, preferably using a binary etilenimina, which is then neutralized to stop the inactivation process.

Thus, in an additional aspect, the immunogenic composition containsi)any of the above protein ORF2 PCV2 preferably in concentrations described above, andii)at least a portion of the viral vector expressing the indicated protein ORF2 PCV2, preferably recombinant baculovirus. Moreover, in an additional aspect, the immunogenic composition containsi)any of the above protein ORF2 PCV2 preferably in concentrations described above,ii)at least a portion of the viral vector expressing the indicated protein ORF2 PCV2, preferably recombinant baculovirus, andiii)part of the supernatant of cell culture.

In a specific embodiment, the method of preparation and selection of protein ORF2 PCV2 supernatant of the cell culture was filtered through a membrane with a pore size preferably between approximately 0,45-1 μm. Thus, an additional aspect relates to immunogenic compositions containingi)any of the above protein ORF2 PCV2, preferably in concentrations described above,ii)at least a portion of the viral vector expressing the indicated protein ORF2 PCV2, preferably recombinant baculovirus, andiii)part of the cult of the s cells; where approximately 90% of the components have a size less than 1 micron.

In an additional aspect, the present invention relates to immunogenic compositions containingi)any of the above protein ORF2 PCV2, preferably in concentrations described above,ii)at least a portion of the viral vector expressing the indicated protein ORF2 PCV2,iii)part of the culture of cells,iv)and inactivating the agent to inactivate the recombinant viral vector preferably BEI, where approximately 90% of the components i)to iii) have a size less than 1 micron. Preferably BEI is present in concentrations effective for inactivation of baculovirus. Effective concentrations described above.

In an additional aspect, the present invention relates to immunogenic compositions containingi)any of the above protein ORF2 PCV2, preferably in concentrations described above,ii)at least a portion of the viral vector expressing the indicated protein ORF2 PCV2,iii)part of the culture of cells,iv)inactivating the agent to inactivate the recombinant viral vector preferably BEI, andv)the neutralizing agent to stop the inactivation mediated by the inactivating agent, where approximately 90% of the components i)to iii) have a size less than 1 micron. Preferably, if the inactivating among the STV is a BEI, this composition contains sodium thiosulfate in equivalent BEI quantities.

The polypeptide is administered in a composition that can enter the animal susceptible to PCV2 infection. In preferred forms of the composition may also contain additional components, known to specialists in this field (see also Remington''s Pharmaceutical Sciences. (1990). 18th ed. Mack Publ., Easton). In addition, the composition may contain one or more acceptable in the veterinary carriers. As used here, "acceptable in the veterinary carrier" includes any and all solvents, dispersants, coatings, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal substances, isotonic means delaying the absorption of funds, etc.

In a preferred embodiment, the immunogenic composition comprises a protein ORF2 PCV2, as shown here, preferably in concentrations described above, as the antigenic component that is mixed with adjuvant, preferably carbopol, and saline solution.

Specialists in this field will be clear that the composition can contain known suitable for injection physiologically acceptable sterile solutions. To obtain ready-to-use solution for parenteral injection or infusion easy is available aqueous isotonic solutions, for example, such as saline solution or solutions of the corresponding plasma protein. In addition, the immunogenic and vaccine compositions of the present invention may contain solvents, isotonic tools, stabilizers, or adjuvants. Solvents may include water, saline, glucose, ethanol, glycerol, etc. Isotonic means may include, among others, sodium chloride, glucose, mannitol, sorbitol and lactose. Stabilizers include, among others, albumin and salts of alkaline metal and ethylenediaminetetraacetic acid. Suitable adjuvants are described here. Most preferred is the use of carbopol, in particular the use of carbopol 971P, preferably in amounts as described above (for example, from about 500 μg to about 5 mg per dose, even more preferably in an amount of about 750 μg to about 2.5 mg per dose and most preferably in amount of about 1 mg per dose).

Thus, the present invention also relates to immunogenic compositions containingi)any of the above protein ORF2 PCV2, preferably in concentrations described above,ii)at least a portion of the viral vector expressing the indicated protein ORF2 PCV2,iii)part of the culture of cells,iv)inaktiverad the e means to inactivate the recombinant viral vector preferably BEI, and v)the neutralizing agent to stop the inactivation mediated by the inactivating agent, preferably sodium thiosulfate in amounts equivalent to the amounts of BEI; andvi)suitable adjuvant preferably carbopol 971 in the above amounts; where approximately 90% of the components i)to iii) have a size less than 1 micron. In an additional aspect of this immunogenic composition further comprises a pharmaceutically acceptable salt, preferably a phosphate salt in a physiologically acceptable concentration. Preferably the pH of the specified immunogenic composition is brought to a physiological pH, which means approximately between 6.5 and 7.5.

Thus, the present invention also relates to immunogenic compositions containing one mli)at least 1.6 ĩg described above protein ORF2 PCV2,ii)at least part of baculovirus expressing this protein ORF2 PCV2,iii)part of the culture of cells,iv)approximately 2-8 mm BEI,v)sodium thiosulfate in amounts equivalent to the amounts of BEI; andvi)approximately 1 mg of carbopol 971, andvii)phosphate salt in a physiologically acceptable concentration; where approximately 90% of the components i)to iii) have a size less than 1 μm, and the pH of the specified immunogenic composition is adjusted to about 6.5 and 7.5.

Immunogenic compositions can stage niteline contain one or more other immunomodulatory substances, for example, such as interleukins, interferon or other cytokines. Immunogenic compositions can also contain gentamicin and merthiolate. While the person skilled in the art can easily determine the quantities and concentrations of adjuvants and additives that are applicable in the context of the present invention, the present invention relates to compositions containing from about 50 μg to about 2000 μg adjuvant and preferably about 250 μg/ml dose of vaccine compositions. In another preferred embodiment, the present invention relates to vaccine compositions containing from about 1 μg/ml to about 60 μg/ml of antibiotics and more preferably less than about 30 μg/ml of antibiotics.

Thus, the present invention also relates to immunogenic compositions containingi)any of the above protein ORF2 PCV2, preferably in concentrations described above,ii)at least a portion of the viral vector expressing the indicated protein ORF2 PCV2,iii)part of the culture of cells,iv)inactivating the agent to inactivate the recombinant viral vector preferably BEI, andv)the neutralizing agent to stop the inactivation mediated by the inactivating agent, preferably sodium thiosulfate in the number is Oh, equivalent amounts of BEI;vi)suitable adjuvant, preferably, carbopol 971 in the above amounts;vii)pharmaceutically acceptable concentration of the buffer salt solution, preferably salts of phosphate, andviii)antimicrobial active agent; where approximately 90% of the components i)to iii) have a size less than 1 micron.

Suddenly discovered that immunogenic composition, presented here, was highly stable over a period of 24 months. It was also discovered that presented here immunogenic compositions containing recombinant, expressed in baculovirus protein ORF2 PCV2, as presented here, are very effective in reducing the clinical symptoms associated with PCV2 infections. Suddenly discovered that immunogenic composition comprising the recombinant protein of PCV2 ORF2 expressed in baculovirus, as presented here, are more effective than immunogenic composition comprising a PCV2 virus in mainactivity form, or selected viral antigen PCV2 ORF2. In particular, it was unexpectedly found that the recombinant protein of PCV2 ORF2 expressed in baculovirus, is effective in very low concentrations, which means that at concentrations up to 0.25 microgram/dose. This unexpectedly high immunogenic potential protein ORF2 PCV2 mo is but additionally to increase the addition of carbopol.

An additional aspect relates to a container containing at least one dose of the immunogenic composition of protein ORF2 PCV2, as presented here, where a single dose contains at least 2 μg protein ORF2 PCV2, preferably 2-16 µg protein ORF2 PCV2. The specified container may contain 1-250 doses of the immunogenic composition, preferably it contains 1, 10, 25, 50, 100, 150, 200 or 250 doses of the immunogenic composition of protein ORF2 PCV2. Preferably each of the containers containing more than one dose of the immunogenic composition of protein ORF2 PCV2, further comprises an antimicrobial active agent. These means are, for example, antibiotics, including antibiotics gentamicin and merthiolate etc. Thus, in one aspect the present invention relates to a container containing 1-250 doses of the immunogenic composition of protein ORF2 PCV2 one dose contains at least 2 μg protein ORF2 PCV2 and gentamicin and/or merthiolate, preferably from about 1 μg/ml to about 60 μg/ml of antibiotics and more preferably less than about 30 μg/ml.

An additional aspect relates to a kit containing any of the containers described above, and the statement that contains the information for intramuscular use at least one dose of the immunogenic composition of protein ORF2 PCV2 in pigs to reduce the severity of klinicheskaia, associated with PCV2 infection. Moreover, in an additional aspect this manual contains information for the second or subsequent introduction(introductions) at least one dose of the immunogenic composition of PCV2 ORF2, where the second introduction or any subsequent introduction occurs at least 14 days after the initial or any other previous administration. Preferably this manual also contains information on the introduction of immunostimulant. Preferably the adjuvant should be entered at least twice. Preferably at least 3, more preferably at least 5, even more preferably at least 7 days passes between the first and second or any subsequent introduction of immunostimulant. Preferably the adjuvant is administered at least 10 days, preferably 15, even more preferably 20, even more preferably at least 22 days after the initial introduction of the immunogenic composition of protein ORF2 PCV2. The preferred immunostimulant is, for example, hemocyanin sea plate (KLH), more preferably emulsified with incomplete adjuvant's adjuvant (KLH/ICFA). However, it is clear that you can also use any other adjuvant known to the person skilled in the art. "Adjuvant", as note the following here means any substance or composition that can launch an immune response, preferably without initiation or increase specific immune response, for example, an immune response against a particular pathogen. There are additional instructions for the introduction of immunostimulant in a suitable dose. Moreover, the kit may also contain a container containing at least one dose of immune stimulator, preferably one dose of KLH or KLH/ICFA.

Moreover, unexpectedly also found that the immunogenic potential immunogenic composition comprising the recombinant protein of PCV2 ORF2 expressed in baculovirus, preferably in combination with carbopol, will be strengthened by the introduction of the vaccine IngelVac PRRS MLV (see example 5). Clinical signs of PCV2 and manifestations of the disease are greatly enhanced in the presence of PRRS infection. However, immunogenic compositions and methods of vaccination, as shown here, significantly reduced this effect and more than expected. In other words, encountered an unexpected synergistic effect when animals, preferably pigs were treated with any of the immunogenic compositions of the PCV2 ORF2, as presented here, and vaccine Ingelvac PRRS MLV (Boehringer Ihgelheim).

Thus, in an additional aspect, the present invention relates to a kit as described above containing immune the genetic composition of PCV2 ORF2, as shown here, and instructions, where the instructions further comprises information on the introduction of the immunogenic composition of PCV2 ORF2 together with immunogenic composition comprising the antigen of PRRS, preferably PRRS antigen with adjuvant. Preferably the antigen of PRRS is a IngelVac® PRRS MLV (Boehringer Ingelheim).

In an additional aspect, the present invention relates also to a set containing thei)a container containing at least one dose of the immunogenic composition of PCV2 ORF2, as presented here, andii)the container containing the immunogenic composition comprising the antigen of PRRS, preferably PRRS antigen with adjuvant. Preferably the antigen of PRRS is a IngelVac® PRRS MLV (Boehringer Ingelheim). More preferably, the kit further comprises instructions containing information on the introduction of both pharmaceutical compositions. Preferably it contains information that a composition comprising PCV2 ORF2, introduced earlier in time than the composition containing PRRS.

An additional aspect relates to the use of any of the compositions presented here as a medicinal product, preferably as a medicinal product for veterinary use, even more preferably as a vaccine. Moreover, the present invention also relates to the use of any of the compositions described herein for the Holocene drugs to decrease the severity of clinical symptoms, associated with PCV2 infection. Preferably the drug is intended for the prevention of PCV2 infection, even more preferably in piglets.

An additional aspect relates to a method for(i)prevent infection or re-infection of PCV2 or(ii)reduction or cessation of clinical symptoms caused by PCV2, the subject, including the introduction of any of the immunogenic compositions presented here, the needy in this subject. Preferably the subject is a pig. Preferably the immunogenic composition is administered intramuscularly. Preferably administered one dose or two doses of the immunogenic composition, where a single dose preferably contains at least about 2 μg of protein ORF2 PCV2, even more preferably from about 2 to about 16 μg and at least from about 0.1 to about 5 mg of carbopol, preferably about 1 mg of carbopol. An additional aspect relates to a method of treatment as described above, which include the second use of the immunogenic composition. Preferably carry out a second injection of the same immunogenic composition, preferably with the same amount of protein ORF2 PCV2. Preferably the second introduction is also carried out intramuscularly. Preferably the second introduction of the implementation is given at least 14 days after the initial introduction, even more preferably at least 4 weeks after the initial injection.

In an additional aspect, the method of treatment also includes the introduction of immunostimulant. Preferably the adjuvant is administered at least twice. Preferably at least 3, more preferably at least 5 days, even more preferably at least 7 days passes between the first and second introduction immunostimulant. Preferably the adjuvant is administered at least 10 days, preferably 15, even more preferably 20, even more preferably at least 22 days after the initial introduction of the immunogenic composition of PCV2 ORF2. The preferred adjuvant is, for example, hemocyanin sea plate (KLH), more preferably emulsified with incomplete adjuvant's adjuvant (KLH/ICFA). However, it is clear that you can also use any other adjuvant known to the person skilled in the art. Introduction immunostimulant in a suitable dose lies within the normal competence of a specialist in this field.

In an additional aspect, the method of treatment described above, also includes the introduction of PRRS antigen. Preferably the antigen of PRRS is a IngelVac® PRRS MLV (Boehringer Ingelheim). Preferably specified PRRS antigen injected postipo time than the introduction of the immunogenic composition of protein ORF2 PCV2.

BRIEF DESCRIPTION of DRAWINGS

Figure 1 represents a precedence diagram for the preferred construction of recombinant baculovirus with PCV2 ORF2 and

Figa and 2b are a diagram of a sequence of operations for obtaining the compositions of the present invention.

A DETAILED DESCRIPTION of the PREFERRED embodiments

The following examples outline the preferred materials and methods of the present invention. However, it should be understood that these examples are given only as illustrations and anything there should not be regarded as limiting the overall scope of the invention.

EXAMPLE 1

In this example, compare the relative outputs ORF2 using the methods of the present invention and using methods known in the prior art. In each of the four rotating flasks 1000 ml were seeded at 1.0×106cells Sf+/ml in 300 ml serum-free medium for insect cells Excell 420 (JRH Biosciences, Inc., Lenexa, KS). The original cell culture is identified as the source cell strain SF+ (Spodoptera frugiperda), the passage 19, Lot#N112-095W. The cells used to obtain the original strain cells SF+, obtained from Protein Sciences Corporation, Inc., Meriden, CT. Cell line SF+ for this example, restricted passages 19 and 9. For the purposes of the present invention can work with other passages, however, to scale the way up to large-scale production, it may be necessary at least 19 passages, and passages after 59 can influence the expression, although this was not investigated. In more detail, the original cell culture SF+ after storage in liquid nitrogen were grown in medium Excell 420 in suspension in sterile rotating flasks with constant shaking. The cultures were grown in rotating flasks from 100 ml to 250 ml with 25-150 ml serum-free medium Excell 420. When cells multiply to the density of cells of 1.0 to 8.0×106cells/ml, they were split into new flasks with density sieving of 0.5-1.5×106cells/ml extended follow-up cultures were grown in rotating flasks up to 36 liters or in bioreactors stainless steel up to 300 litres during the period 2-7 days at 25-29°C.

After sieving the flasks were incubated at 27°C for four hours. Then each flask was seeded with recombinant baculovirus containing the gene of PCV2 ORF2 (SEQ ID NO: 4). Recombinant baculovirus containing the gene of PCV2 ORF2, was prepared as follows: ORF2 gene of PCV2 North American strain of PCV2 PCR amplified to contain a 5'Kozak sequence (SEQ ID NO: 1) and 3'EcoR1 site (SEQ ID NO: 2), cloned in the vector pGEM-T-Easy (Promega, Madison, WI). Then his pic is edutella cut and was subcloned into the vector-vector pVL1392 (BD Biosciences Pharmingen, San Diego, CA). Subcloned part is here presented as SEQ ID NO: 7. Plasmid pVL1392, containing the gene ORF2 PCV2, outlined N47-064Y and then cotranslationally with DNA (BaculoGold baculovirus® (BD Biosciences Pharmingen) in cells insects Sf+ (Protein Sciences, Meriden, CT) to obtain a recombinant baculovirus containing the gene of PCV2 ORF2. New design presented here as SEQ ID NO: 8. Recombinant baculovirus containing the gene of PCV2 ORF2, was purified by sieving to separate plaques, and the original vaccine virus (MSV) were propagated in cell line SF+, was divided into aliquots and stored at -70°C. MSV positively identified as baculovirus with ORF2 PCV2 by PCR-RFLP using specific baculovirus primers. Based on insect cells infected with baculovirus with PCV2 ORF2 to obtain MSV or working vaccinia virus that expressed the antigen of PCV2 ORF2, and then were detected by polyclonal serum or monoclonal antibodies in an indirect analysis with fluorescent antibody. In addition, the identity of baculovirus with PCV2 ORF2 was confirmed by sequencing the N-terminal amino acids. MSV baculovirus with PCV2 ORF2 were also tested for purity under 9 C.F.R. 113.27 (c), 113.28 and 113.55. All recombinant baculoviruses, sown in a rotating flask, had a different multiplicity of infection (MOI). In flask 1 was seeded 7,52 ml seeding with MOI 0,088; in flask 2 was seeded 3,01 ml seeding with MOI 0,36; kolbo were seeded at 1.5 ml seeding with MOI 0.18 and in flask 4 seeded 0.75 ml seeding with MOI 0,09. The precedence diagram illustrating the main stages used to construct a recombinant baculovirus with PCV2 ORF2, shown here as figure 1.

After planting the baculovirus flasks are then incubated at 27±2°C for 7 days and during this time was also shaking at 100 rpm was Used vented cover for Kolb to provide airflow. From each flask was sampled every 24 hours over the next 7 days. After extraction, each sample was centrifuged, separated precipitate and supernatant, and then subjected to microfiltration through a membrane with pore size of 0.45 to 1.0 μm.

Then in the obtained samples were required to estimate the number present in them ORF2 by ELISA. The ELISA analysis was performed with antibody for capture - anti-PCV2 IgG pig Pab, purified using a protein G (diluted 1:250 in PBS)diluted to 1:6000 in 0.05 M carbonate buffer (pH 9,6). Then 100 μl of antibody was placed in the wells tiralongo microplate was sealed and incubated overnight at 37°C. the tablet Then washed three times with rinse solution containing 0.5 ml of Tween 20 (Sigma, St. Louis, MO), 100 ml 10X D-PBS (Gibco Invitrogen, Carlsbad, CA) and 899,5 ml of distilled water. To each well was sequentially added 250 μl of a blocking solution (5 g nonfat dry milk Carnation (Nestle, Glendale, CA) in 10 ml of D-BS QS to 100 ml of distilled water). The next stage was a leaching test tablet and then add pre-diluted antigen. Pre-diluted antigen was obtained by adding 200 ál of dilution solution (0.5 ml Tween 20 in 999,5 ml D-PBS) to each well of the tablet for cultivation. Then the sample was diluted in a ratio of 1:240 and in the ratio of 1:480, and 100 μl of each of these diluted samples were then added to one of the upper holes tablet for cultivation (i.e. one upper well was added 100 μl of a dilution of 1:240), and in another was added 100 ál of dilution 1:480). Then perform a serial dilution for the rest of the tablet through a selection of 100 µl of each subsequent hole and moving to the next hole in the tablet. Each well was mixed before performing the next transfer. Leaching test tablet included washing tablet three times a buffer for washing. Then the tablet was sealed and incubated for one hour at 37°C before washing three times with buffer for washing. Used antibody for detection was a monoclonal antibody to PCV ORF2. It was diluted to 1:300 dilution in solution, and then 100 μl of the diluted antibody for detection was added to the wells. Then the tablet was sealed and incubated for one hour at 37°C before washing three times with buffer for washing. Then got the thinner conjugate by adding normal rabbit serum (Jackson Immunoresearch, West Grove, PA) for diluting the solution to a concentration of 1%. Conjugated antibody goat against mouse (H+1)-HRP (Jackson Immunoresearch) were diluted in diluent for conjugate to 1:10000. Then 100 μl of the diluted conjugated antibody was added to each well. Then the tablet was sealed and incubated for 45 minutes at 37°C before washing three times with buffer for washing. 100 μl of substrate (substrate for peroxidase TMB, Kirkgaard and Perry Laboratories (KPL), Gaithersberg, MD), mixed with an equal volume of substrate for peroxidase B (KPL)was added to each well. Tablet incubated at room temperature for 15 minutes. Then all wells were added 100 μl of 1 n HCl solution to stop reaction. The tablet then scanned on a spectrophotometer to read the tablets after ELISA. The results of this analysis are presented in table 1 below:

Table 1
DayBulbORF2 in the sediment (µg)ORF2 in supernatant (g)
3147,5312
3257,46 22
3353,4414
3458,6412
4143,0144
4265,6162
4370,5632
4464,9724
5131,74100
5234,93142
5347,8490
5455,1486
6114,7 158
6218,13182
6334,78140
6436,88146
716,54176
7212,09190
7315,84158
7415,19152

These results indicate that extending the incubation time the expression of ORF2 in the supernatant was centrifuged cells and the environment is greater than the expression in the sediment was centrifuged cells and environment. Accordingly, enabling the expression of ORF2 at least for 5 days and released from the supernatant compared with the possibility of expression of less than 5 days and allocation of ORF2 of cells leads to a large expansion of the output ORF2 and a significant improvement over previous methods.

EXAMPLE 2

This example presents data on the effectiveness of the invention claimed in the claims in this document. In 1000 ml of rotating the flask were seeded at 1.0×106cells Sf+/ml in 300 ml of medium Excell 420. Then the flask is incubated at 27°C and shaking at 100 rpm Then the flask was seeded with 10 ml of the inoculation of the virus ORF2 PCV2/Bac p+6 (recombinant baculovirus containing the gene of PCV2 ORF2, passaged 6 times in insect cells Sf9) with 0.1 MOI after 24 hours of incubation.

Then the flask is incubated at 27°C for a total of 6 days. After incubation, the flask was centrifuged, and three samples of the resulting supernatant was collected and iactiveaware. The supernatant iactiveaware bringing its temperature to 37±2°C. the first sample of the supernatant was added a 0.4 M solution of the hydrobromide of 2-bromadiolone, cyklinowanie to 0.2 M binary ethylenimine (BEI) in 0.3 n NaOH to obtain a final concentration of 5 mm BEI. To the second sample of the supernatant was added to 10 mm BEI. To the third sample supernatant BEI was added. The sample was continuously stirred for 48 hours. To neutralize all residual BEI was added 1.0 M solution of sodium thiosulfate to obtain the final minimum concentration of 5 mm. Then the number of ORF2 in each sample was estimated using the same ELISA as described in example 1. The results of this is th can be seen in table 2 below:

Table 2
SampleORF2 in supernatant (g)
178,71
268.75 kilopascals
383,33

In this example showed that neutralization using BEI not remove or degrade significant amounts of the protein product of recombinant PCV2 ORF2. This confirms the absence of large losses ORF2 in the supernatant due to the BEI or elevated temperatures. Specialists in this field will be clear that the selected ORF2 is a stable protein product.

EXAMPLE 3

This example shows that the present invention can be scaled from small-scale production of recombinant PCV2 ORF2 to large-scale production of recombinant PCV2 ORF2. 5,0×105cells/ml cells SF+/ml in 7000 ml of medium ExCell 420 were seeded at 20,000 ml Applikon bioreactor. Then, cells and medium were incubated at 27°C and shaking at 100 rpm in the next 68 hours. On the 68th hour to 7000 ml of medium ExCell 420 added to 41.3 ml MSV+3 baculovirus with PCV2 ORF2. Then the resulting mixture was added to the bioreactor. Over the next seven suto the mixture incubated at 27°C and shaking at 100 rpm Samples from the bioreactor were taken every 24 hours, starting from day 4 after infection, and each sample was centrifuged. The supernatant of the samples was kept, and then estimated the number of ORF2 using densitometry after SDS-PAGE. The results of this can be seen in table 3 below:

Table 3
Day after infectionORF2 in the supernatant (mg/ml)
429,33
541,33
631,33
760,67

EXAMPLE 4

In this example tested the effectiveness of the seven vaccine candidates and additionally defined performance parameters after exposure to virulent strain of PCV2. One hundred and eight (108) extracted caesarean section, not receiving colostrum (CDCD) piglets at the age of 9-14 days was randomly divided into 9 groups of equal size. Table 4 describes the overall structure of the research for this example.

Table 4. The General structure of research
GroupThe number of pigsProcessingDay processingKLH/ICFA on day 21 or day 27Infection with virulent PCV2 on day 24An autopsy on day 49
112PCV2 vaccine No. 1 - (vORF2 16 µg)0+++
212PCV2 vaccine No. 2 (vORF2 8 µg)0+++
312PCV2 vaccine No. 3 - (vORF2 4 µg)0+++
412PCV2 vaccine No. 4 - (rORF2 16 µg)0+++
512PCV2 vaccine No. 5 - (rORF2 8 µg) 0+++
612PCV2 vaccine No. 6 - (4 μg rORF2)0+++
712PCV2 vaccine No. 7 - (killed virus with whole cells)0+++
812No Controls infectionN/A+++
912No - Group strict
negative control
N/A+-+
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; the killed virus with whole cells = PCV2 virus grown in suitable cell culture

In seven of the groups (groups 1-7) was administered doses is of peptide ORF2 PCV2, one group served as a control infection and had not received PCV2 ORF2, and the other group was a group of strict negative control and received PCV2 ORF2. On day 0 group 1 through 7 were treated appointed by the vaccines. Pigs in group 7 were performed for secondary treatment to 14 days. Pigs were examined for the presence of adverse events and reactions at the injection site after vaccination, and on the 19th day of pigs were transferred to the second center study. The second Central research groups 1-8 were groups contained in one building, while group 9 contained in a separate building. All pigs entered hemocyanin sea plate (KLH)/incomplete adjuvant's adjuvant (ICFA) on 21 and 27 days, and on the 24 day group 1-8 infected virulent PCV2.

Before and after infection were collected blood samples for serological studies of PCV2. After infection collected data on body weight to determine the average daily weight gain (ADWG), data on clinical symptoms, as well as samples of nasal smears to determine nasal selection PCV2. 49 days all surviving pigs were subjected to autopsy, was evaluated lesions in the lungs and selected tissues were fixed in formalin for immunohistochemical (IHC) testing later.

Materials and methods

This was partially blind analysis done by the wimote vaccination infection held on CDCD piglets at the age of 9-14 days on day 0. The PCV2 titers by IFA in sows for inclusion in the study was ≤1:1000. In addition, the serological status of the sows was known PRRS-negative herds. At twenty-eight (28) sows tested serological status for PCV2. For fourteen (14) showed that PCV2 titer ≤1000 and converted them in the first research center. One hundred and ten (110) piglets were removed by caesarean section, and they were available for this study on day-4. 108 CDCD piglets on day -3 in the first research center weighed, marked ear tags, were grouped by weight and randomly distributed in groups 1-9, as indicated above in table 4. If any animal that meet the inclusion criteria, were registered for the study, and then excluded for any reason, the researcher and supervisor consulted to determine the applicability of the data collected for this animal, in the final analysis. Date exclusions registered piglets and the cause of the exceptions documented. In the initial stage of any of the sows did not exclude. Only 108 of the available 110 piglets randomly recorded in one of the 9 groups in day-3. The two smallest piglets (No. 17 and 19) were not recorded in the group, and they were available as an extra when neo is needed. During the study excluded several animals. Pig 82 (group 9) on day -1, pig No. 56 (group 6) on day 3, pig No. 53 (group 9) on day 4, pig No. 28 (group 8) on day 8, pig No. 69 (group 8) on day 7 and the pig No. 93 (group 4) on day 9, all found dead before infection. These six pigs were not included in the final results of the study. Pig No. 17 (one of the more piglets) was recorded in group 9. The remaining additional pig No. 19 was excluded from the study.

The compositions entered in each group, were as follows: Group 1 was intended for the introduction of 1 ml of viral ORF2 (vORF2)containing 16 μg ORF2/ml Is carried out by mixing 10,24 ml viral ORF2 (256 mcg/25 mcg/ml = 10,24 ml vORF2) with 3.2 ml of 0.5% carbopol and of 2.56 ml of phosphate-saline buffer solution with a pH of 7.4. Received 16 ml of the composition for group 1. Group 2 was intended for the introduction of 1 ml of vORF2 containing 8 ug vORF2/ml Is carried out by mixing 5,12 ml vORF2 (128 mcg/25 mcg/ml = 5,12 ml vORF2) with 3.2 ml of 0.5% carbopol and 7.68 per ml of phosphate-saline buffer solution with a pH of 7.4. Received 16 ml of the composition for group 2. Group 3 was intended for the introduction of 1 ml of vORF2 containing 4 ug vORF2/ml Is carried out by mixing of 2.56 ml vORF2 (64 μg/25 μg/ml = 2,56 ml vORF2) with 3.2 ml of 0.5% carbopol and 10,24 ml of phosphate-saline buffer solution with a pH of 7.4. Thus p is received 16 ml of the composition for group 3. Group 4 was intended for the introduction of 1 ml recombinant ORF2 (rORF2)containing 16 ug rORF2/ml Is carried out by mixing of 2.23 ml rORF2 (512 µg/230 µg/ml = 2,23 ml rORF2) with 6.4 ml of 0.5% carbopol and 23,37 ml of phosphate-saline buffer solution with a pH of 7.4. So got 32 ml of the composition for a group of 4. Group 5 was intended for the introduction of 1 ml of rORF2 containing 8 μg rORF2/ml Is carried out by mixing of 1.11 ml rORF2 (256 µg/230 µg/ml = 1,11 ml rORF2) with 6.4 ml of 0.5% carbopol and 24,49 ml of phosphate-saline buffer solution with a pH of 7.4. So got 32 ml of the composition for a group of 5. Group 6 was intended for the introduction of 1 ml of rORF2 containing 8 μg rORF2/ml Is carried out by mixing of 0.56 ml of rORF2 (128 µg/230 µg/ml = 0,56 ml rORF2) with 6.4 ml of 0.5% carbopol and 25,04 ml of phosphate-saline buffer solution with a pH of 7.4. So got 32 ml of the composition for a group of 6. Group 7 was intended to introduce 2 ml of killed whole cell PCV2 vaccine (PCV2 KV)containing MAX PCV2 KV. This was carried out by mixing 56 ml of PCV2 KV with 14 ml of 0.5% carbopol. So I got 70 ml of the composition for a group of 7. Finally, the group of 8 was intended for the introduction of a 0.5 μg/ml or 1.0 μg/ml KLH at a dose of 2 ml Is carried out by mixing 40,71 ml KLH (7,0 µg protein/ml at 0.5 mg/ml = 570 ml of 7.0 μg/ml)(x) = (0,5)(570 ml)), 244,29 ml of phosphate-saline buffer solution with a pH of 7.4 and 285 ml of adjuvant's adjuvant. Table 5 describes the time frame for key operations and is this example.

Table 5. Operations research
Day researchOperations research
-4, 0-49General survey the General state of health and clinical signs
-3Weighed; Randomly distributed in groups; Collected blood samples from all pigs
0The health examination; Introduced IVP No. 1-7 groups 1-7, respectively
0-7Examined pigs in a reaction at the site of infection
14Conducted secondary introduction of PCV2 vaccine No. 7 group 7; blood Samples from all pigs
14-21Examined a group of 7 and reactions at the site of infection
16-19Processed all pigs with antibiotics (data not available)
19Piglets transported from the first testing second testing center
21Treated group 1-9 KLH/ICFA
24Collected blood samples and nasal smears from all piglets; weighed with all piglets; infected groups 1-8 material for the infection of PCV2
25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47Collected samples of nasal smears from all pigs
27Treated group 1-9 KLH/ICFA
31Collected blood samples from all pigs
49Collected blood samples and nasal smears from all piglets; Weighed with all piglets; Conducted the autopsy of all piglets; Noted macroscopic damage with greater severity of jaundice and stomach ulcers; Assessed the damage in the lungs; Kept fresh and formalin fixed samples; Completed the in vivo phase of the study

After completion of the in vivo phase of the study, formalin fixed tissues were evaluated by a pathologist by immunohistochemistry (IHC) for detection of PCV2 antigen, PCV2 in blood samples was evaluated serologically evaluated the allocation of PCV2 in samples of nasal smears and determined the average weight gain (ADWG) from 24 days to 49 days.

<> In the first research center animals were kept in individual cages in five rooms from birth until the age of approximately 11 days (approximately 0 day of the study). All the rooms were identical in layout and contained racks with individual cells from stainless steel with heated and filtered air is supplied separately to each individual unit. Each room had a separate heating and ventilation, thus warned of cross-contamination of air between rooms. In the second centre of the study animals were kept in two different buildings. Group 9 (group a strict negative control) were kept separately in a converted butcher building and group 1-8 contained in a converted room for the young. Each group contained in a separate enclosure (11-12 piglets per pen), and each pen was provided approximately 3.0 square feet of a pig. Each pen was raised flooring with flooring from plastic plates. Deepening under the pens served as a reservoir for feces and garbage. Each building had its own heating and ventilation, with a small probability of cross contamination of air between the buildings.

In the first research center of piglets fed specially prepared milk is acinom from birth until the age of about 3 weeks. To 19 days (approximately age 41/2weeks) all pigs consumed solid, specially mixed diet. In the second research centre of all piglets were fed prepared to order, not containing medicinal substances commercial mixed diet appropriate for their age and weight, as desired. The water in both research centres were also available on request.

All test pigs were injected vitamin E on day -2, with iron injections on day -1, and with NAXCEL® (1.0 ml, IM in a changing hip) on day 16, 17, 18 and 19. In addition, pig No. 52 (group 9) was administered an injection of iron on day 3, the pig 45 (group 6) was administered an injection of iron on day 11, the pig No. 69 (group 8) was administered NAXCEL® on day 6, the pig No. 74 (group 3) was administered dexamethasone and penicillin at day 14 and pig No. 51 (group 1) was administered dexamethasone and penicillin at day 13 and NAXCEL® on day 14 for various medical reasons.

At this time, in both research centres piglets were under the supervision of a veterinarian. Examination of the health status of the animals was carried out on day 0 and documented in the form of a record of health status. All animals had good health and nutritional status, as determined by examination on day 0. All test animals, as surveyed, were in good health and condition the power before infection. Skeletons and fabrics utilized in selotape. The last placement of the studied animals was recorded in the minutes of the animals.

On day 0 the piglets recorded in groups 1-6, were injected with 1.0 ml of PCV2 vaccine 1-6, respectively, IM in the neck area to the left using a sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x1/2". The piglets recorded in group 7, was introduced in 2.0 ml of PCV2 vaccine NO. 7 IM in the neck area to the left using a sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x1/2". On day 14 piglets recorded in group 7, was introduced in 2.0 ml of PCV2 vaccine NO. 7 IM in the neck area to the right using a sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x1/2".

On day 21 all test pigs were injected 2.0 ml KLH/ICFA IM in the region of the right femur using a sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x 1". On day 27 all test pigs were injected 2.0 ml of KLH/ICFA in the region of the left femur using a sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x 1".

On day 24 piglets recorded in groups 1-8, were injected with 1.0 ml of the material to PCV2 infection ISUVDL (5,11 log10TCID50/ml) IM in the neck area to the left using a sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x 1". Additional 1,ml same material was injected IN each pig (0.5 ml per nostril) using a sterile 3.0 ml syringe with Luer lock and nasal cannula.

The test animals are examined daily for General health status and presence of adverse events on day -4 and from 0 to 19 days. Surveys documented in the Protocol of the clinical investigations. All tested pigs were examined from 0 to 7 days, and in group 7 on day 14-21 additionally examined the reactions at the injection site. The average weight gain was determined by weighing each pig in the calibration scale on day -3, 24 and 49, or on the day on which the pig found dead after infection. Body weight was recorded in the form of body weight. Body weight on day -3 used for separation of piglets in groups before randomization. These masses for 24 days and 49 days used to determine the average daily weight gain (ADWG) for each pig during these time points. For pigs that died after exposure and before 49 days, ADWG customized to represent ADWG from 24 days before the day of death.

For serological determination of PCV2 each pig was collected whole blood from a vein from the orbital venous sinus on day -3 and 14. Each pig blood was collected from the orbital venous sinus through the introduction of a sterile capillary tube in the median angle of the palpebral fissure of one eye and removal of approximately 3.0 ml whole blood at 4.0 ml tube to separate the serum (ST). On day 24, 31 and 49 of whole venous blood was collected from each pig from the anterior Vena cava using a sterile needle for vacuum container 18 g × 11/2" (Becton Dickinson and Company, Franklin Lakes, New Jersey), the needle holder to the vacuum container, and 13 ml SST. Sampling of blood at each time point was recorded in the minutes of sample collection. Blood in each SST allowed to shrink, then each SST centrifuged and collected serum. The collected serum was transferred into a sterile snap-on tube and stored at -70±10°C until testing at a later date. In serum samples staff BIVI-R&D was testing the presence of antibodies to PCV2.

In piglets once a day from 20 days to 49 days observed clinical symptoms and clinical examination documented in the Protocol of the clinical investigations.

For testing nasal selection PCV2 on day 24, 25, and then on each day of study with an odd number until day 49, inclusive, sterile bow swab was administered intranasally either the left or the right nostril of each pig (one swab on a pig) so sterile as possible, daubed around for a few seconds and then removed. Then, each swab was placed in a separate sterile test tube with snap-on lid, containing 1.0 ml of EMEM medium with 2% IFS, 500 units/ml penicillin, 500 μg/ml of streptomycin and 2.5 µg/ml Fungizone. The swab into the test tube was divided into parts, snapped the tube was sealed and appropriately marked on the label number of the animal, the number of studies, the date of selection, the day of the study and nasal smear". Stuck locked in a test tube was kept at -40±10°C until transportation during the night in the ice in the BIVI-St. Joseph. Selections nasal samples documented in the form of a collection of samples of nasal smears. In BIVI-R&D were checked by quantitative separation virus (VI) PCV2 in samples of nasal smears. The results were expressed in values of log10. The value of A 1,3 log or less is considered negative, and any value more than 1.3 log was considered positive.

Piglets(№№28, 52, 56, 69, 82, and 93), who died in the first research center was opened at the level required for a diagnosis. Macroscopic damage documented, and tissues from these pigs were not kept. In the second research center conducted the autopsy piglets died before 49 days(№45, 23, 58, 35), pigs found dead at 49 days prior to euthanasia (No. 2, 43), and piglets euthanized for 49 days. Noted any macroscopic damage, and the percentage of shares lung damage documented in the form of the autopsy report.

From each of the 103 piglets exposed in the second goal is tre study sample of tissue from the tonsils, lung, heart, liver, mesenteric lymph node, kidney and inguinal lymph node was placed in a separate container with buffered 10% formalin; at the same time, another tissue sample from the above-mentioned bodies were placed in a package for centrifugation (M-Tech Diagnostics Ltd., Thelwall, UK) and each batch centrifuge was placed in ice. Each container is properly marked. Collecting samples documented in the form of the autopsy report. Then fixed in formalin samples and the form of the diagnostic request received for IHC testing. Testing IHC was performed according to standard laboratory methods ISU for receipt of samples, sample preparation and glass and methods of dyeing. Fresh samples in packages for the centrifugation was sent with ice packs to the controller of surveys for storage (-70°±10°C) and possible future use. Fixed in formalin tissue examined by the pathologist for the detection of PCV2 by IHC and evaluated using the following scoring system: 0 = no; 1 = limited positive staining, little plots; 2 = moderate positive staining, multiple sites; and 3 = abundant positive staining, widespread throughout the fabric. Due to the fact that the pathologist could not definitely distinguish the inguinal LN of the mesenteric LN, this is Canam marked simply as lymph node, and this points to the animal represented the highest score for each of the two fabrics.

Results

The results for this example are shown below. It is noted that one pig from group 9 died before day 0, and 5 pigs died after vaccination (1 pig from group 4; 1 pig from group 6; 2 piglets from group 8 and 1 pig from group 9). Postmortem examination showed that all six died due to serious infections that are not associated with vaccination or PMWS. In addition, none of the groups found no adverse events or reactions at the injection site.

Results the average weight gain (ADWG) are presented below in table 6. Group 9, group a strict negative control, had the highest ADWG (1,06±0,17 pounds/day), followed by group 5 (0,94±0,22 lb/day), which was administered one dose of 8 μg rORF2. Group 3, which was administered one dose of 4 ug vORF2, had the lowest ADWG (0,49±0,21 pounds/day), followed by group 7 (0,50±0,15 lbs/day), which was administered 2 doses of killed vaccine.

Table 6. The generalization of the average daily weight gain (ADWG)
GroupImpactN ADWG - ft/day (day 24 to day 49) or substitution for piglets died before 29 days
1vORF2 - 16 μg (1 dose)120,87±0,29 pounds/day
2vORF2 - 8 μg (1 dose)120,70±0,32 pounds/day
3vORF2 - 4 μg (1 dose)120,49±0,21 pounds/day
4rORF2 - 16 μg (1 dose)110,84±0,30 pounds/day
5rORF2 - 8 μg (1 dose)120,94±0,22 pounds/day
6rORF2 - 4 μg (1 dose)110,72±0,25 lbs/day
7KV (2 doses)120,50±0,15 lbs/day
8Controls infection100,76±0,19 pounds/day
9Strict negative controls111,06±0,17 pounds/day
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; the killed virus with whole cells = PCV2 virus grown in suitable cell culture

Serological results for PCV2 presented below in table 7. All nine groups were seronegative for PCV2 on day-3. On day 14 groups, which were injected vaccine vORF2, had the highest titers ranging from 187,5 to 529,2. Pigs after injection killed virus vaccines have the following of the most high titers, after groups with the introduction of the vaccine rORF2. Groups 8 and 9 remained seronegative by this time. On day 24 day 31 for pigs after administration of the vaccine vORF2 continued to find a strong serological response, following close behind the group with the introduction of two doses of a killed virus vaccine. Piglets with the introduction of vaccines rORF2 were slower to respond serologically and groups 8 and 9 remained seronegative. On day 49 for pigs with vaccine vORF2 2 doses of killed viral vaccines and the lowest dose of rORF2 showed the strongest serological responses. Piglets with the introduction of 16 μg and 8 μg of vaccine rORF2 had a little bluevisionii titles in IFA, what controls the infection. For a group of 9 on day 49 showed a strong serological response.

Table 7. Generalization of PCV2 titers in IFA in groups
The AVERAGE TITER IN IFA
GroupImpactDay -3Day 14Day 24Day 31**Day 49***
1vORF2 - 16 μg (1 dose)50,0529,24400,07866,711054,5
2vORF2 - 8 μg (1 dose)50,0500,03466,76800,010181,8
3vORF2 - 4 μg (1 dose)50,0187,51133,35733,39333,3
4rORF2 - 16 μg (1 dose)50,0 95,51550,03090,98000,0
5rORF2 - 8 μg (1 dose)50,075,0887,52266,77416,7
6rORF2 - 4 μg (1 dose)50,050,0550,03118,210570,0
7KV (2 doses)50,0204,23087,54620,88680,0
8Controls infection50,055,050,050,05433,3
9Strict negative controls50,059,159,154,56136,4
vORF2 = ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; the killed virus with whole cells = PCV2 virus grown in suitable cell culture
*For the purposes of calculating the titer in IFA ≤100 was defined as a titer of "50"; at IFA titer ≥6400 identified as the IFA titers in "12800".
**The day of infection
***Night showdown

The results of clinical examinations after infection are presented below in table 8. This generalization results include the observation of abnormal behavior, abnormal respiration, cough and diarrhoea. Table 9 contains the results from the generalization of the total frequency of occurrence of clinical symptoms in groups, and table 10 contains the results of generalization of mortality from the generalization of mortality in groups after infection. The most common clinical symptom, found in this study were anomalous behavior, which was estimated as the retardation from mild to severe. Piglets after the introduction of the 2 lower doses of vORF2, piglets after the introduction of 16 ug rORF2 and pigs after administration of 2 doses of vaccine KV had a frequency of occurrence ≥27.3 per cent. Pigs after injection of 8 μg rORF2 and a group of strict negative control had no abnormal behavior. None of the pigs in this study did not show any abnormal breathing. The cough is often found in all the group is (0-25%), as well as diarrhea (0-20%). None of the detected symptoms were not pathognomonic for PMWS.

The overall frequency of appearance of clinical symptoms differed between groups. Group after administration of any vaccine vORF2 the group after the introduction of 16 ug rORF2, group after administration of 2 doses of vaccine KV and group control of infection had the highest frequency of occurrence common clinical symptoms (≥36,4%). The group has strict negative control group after injection of 8 μg rORF2 and group after introducing 4 μg rORF2 had a total frequency of appearance of clinical symptoms is 0%to 8.3% and 9.1%, respectively.

Overall mortality rates also differed between groups. Group after administration of 2 doses of vaccine had the highest mortality rate (16.7 percent); while the group after the introduction of 4 ug vORF2, 16 ug rORF2 or 8 μg rORF2, and a group of strict negative control all had 0% mortality.

Table 8. The summary of observations in groups of abnormal behavior, abnormal respiration, cough and diarrhea
GroupImpactNAnomalous behavior of1Anomalous behavior of2 3Diarrhea4
1vORF2 - 16 μg (1 dose)122/12
(16,7%)
0/12
(0%)
3/12
(25%)
2/12
(16,7%)
2vORF2 - 8 μg (1 dose)124/12
(33,3%)
0/12
(0%)
1/12
(8,3%)
1/12
(8,3%)
3vORF2 - 4 μg (1 dose)128/12
(66,7%)
0/12
(0%)
2/12
(16,7%)
1/12
(8,3%)
4rORF2 - 16 μg (1 dose)113/11
(27,3%)
0/11
(0%)
0/11
(0%)
2/11
(18,2%)
5rORF2 - 8 μg (1 dose)120/12
(0%)
0/12
(0%)
1/12
(8,3%)
0/12
(0%)
6rORF2 - 4 μg (1 dose)111/11
(9,1%)
0/11
(0%)
0/11
(0%)
0/12
(0%)
7KV (2 doses)127/12
(58,3)
0/12
(0%)
0/12
(0%)
1/12
(8,3%)
8Controls infection101/10
(10%)
0/10
(0%)
2/10
(20%)
2/10
(20%)
9Strict negative controls110/11
(0%)
0/11
(0%)
0/11
(0%)
0/11
(0%)
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; the killed virus with whole cells = PCV2 virus grown in suitable cell culture
1The total number of pigs in each group that demonstrated any abnormal behavior on at least some of the weft
2The total number of pigs in each group that demonstrated any abnormal breathing at least for one day
3The total number of pigs in each group that showed a cough for at least one day
4The total number of pigs in each group that showed diarrhea at least for one day

Table 9. Summarizing the overall frequency of occurrence of clinical symptoms of
GroupImpactNThe proportion of pigs with clinical symptoms1The frequency of occurrence
1vORF2 - 16 μg (1 dose)12541,7%
2vORF2 - 8 μg (1 dose)12541,7%
3vORF2 - 4 μg (1 dose)12866,7%
4rORF2 16 μg (1 dose) 11436,4%
5rORF2 - 8 μg (1 dose)1218,3%
6rORF2 - 4 μg (1 dose)1119,1%
7KV (2 doses)12758,3%
8Controls infection10440%
9Strict negative controls1100%
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; the killed virus with whole cells = PCV2 virus grown in suitable cell culture
1The total number of pigs in each group that showed any clinical symptoms at least for one day

Table 10. The compilation of mortality in groups after infection
GroupImpactNDead after infectionThe mortality rate
1vORF2 - 16 μg (1 dose)1218,3%
2vORF2 - 8 μg (1 dose)1218,3%
3vORF2 - 4 μg (1 dose)1200%
4rORF2 - 16 μg (1 dose)1100%
5rORF2 - 8 μg (1 dose)1200%
6rORF2 - 4 μg (1 dose)1119,1%
7KV (2 doses)12216,7%
8Controls infection10110%
9Strict negative controls1100%
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; the killed virus with whole cells = PCV2 virus grown in suitable cell culture

The results on nasal secretion PCV2 presented below in table 11. After exposure on day 24 at 1 pig in group 7 have begun allocation of PCV2 on the 27th day. None of the other groups did not allocate up to 33 days. The main volume of nasal allocation discovered from 35 days to 45 days. Group after the introduction of any of the three vaccines vORF2 and groups after the introduction of either 4 or 8 μg rORF2 had the lowest frequency of occurrence of nasal selection PCV2 (≤9,1%). Group control of infection (group 8) had the highest frequency allocation (80%), followed by group a strict negative control (group 9), with cha what Thoth manifestations of 63.6%.

Table 11. The generalization of the symptoms of nasal selection PCV2 groups
GroupImpactNThe number of piglets emitting at least for one dayThe frequency of occurrence
1vORF2 - 16 μg (1 dose)1218,3%
2vORF2 - 8 μg (1 dose)1218,3%
3vORF2 - 4 μg (1 dose)1218,3%
4rORF2 - 16 μg (1 dose)11218,2%
5rORF2 - 8 μg (1 dose)1218,3%
6rORF2 - 4 μg (1 dose) 1119,1%
7KV (2 doses)12541,7%
8Controls infection10880%
9Strict negative controls11763,6%
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; the killed virus with whole cells = PCV2 virus grown in suitable cell culture

The generalization of the frequency of occurrence of jaundice in groups, the frequency of occurrence of stomach ulcers in groups, the average rating of lung damage in groups and frequency of appearance of lung damage in the groups shown below in table 12. Six pigs died in the first research center during the study phase after vaccination (group 4, N=1; group 6, N=1; group 8, N=2; group 9, N=2). Four of the six piglets had fibrinous damage in one or more body cavities, one pig (group 6) had injuries related to stridulum disease, and another pig (group 9) had no macroscopic damage. None of the pigs died during the research stages after vaccination, did not have lesions associated with PMWS.

Pigs that died after infection, and piglets euthanized at 49 days, were subjected to autopsy. In none of the groups at autopsy was not present jaundice and stomach ulcers. In terms of average % of lung damage, group 9 had the lowest average % of lung damage (0%), followed by group 1 with 0,40±0,50% and group 5 with 0,68±1,15%. Groups 2, 3, 7 and 8 had the highest average % of lung damage (≥7,27%). Each of these four groups contained one Piglet per cent of lung damage ≥71.5%of that has shifted the results for these four groups towards higher. With the exception of group 9 with detection 0% of lung damage, and the remaining 8 groups possessed ≤36% of lung damage. Almost all detected lung injury was described as red/purple and consolidated.

Table 12. A generalization of the frequency of manifestations of jaundice in groups, the frequency of manifestations of gastric ulcers in groups, average % points of lung damage in groups and frequency of manifestations of the detected lung damage in groups
Groups the ImpactJaundiceStomach ulcersAverage % of lung damageThe frequency of manifestations of the detected lung damage
1vORF2 - 16 μg (1 dose)0/12
(0%)
0/12
(0%)
0,40±0,50%10/12
(83%)
2vORF2 - 8 μg (1 dose)0/12
(0%)
0/12
(0%)
7,41±20,2%10/12
(83%)
3vORF2 - 4 μg (1 dose)0/12
(0%)
0/12
(0%)
9,20±20,9%10/12
(83%)
4rORF2 - 16 μg (1 dose)0/11
(0%)
0/11
(0%)
1,5±4,74%4/11
(36%)
5rORF2 - 8 μg (1 dose)0/12
(0%)
0/12
(0%)
0,68±1,15% 9/12
(75%)
6rORF2 - 4 μg (1 dose)0/11
(0%)
0/11
(0%)
2,95±5,12%7/11
(64%)
7KV (2 doses)0/12
(0%)
0/12
(0%)
7,27±22,9%9/12
(75%)
8Controls infection0/10
(0%)
0/10
(0%)
9,88±29,2%8/10
(80%)
9Strict negative controls0/11
(0%)
0/11
(0%)
0/11
(0%)
0/11
(0%)
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; the killed virus with whole cells = PCV2 virus grown in suitable cell culture

A generalization of the frequency of positive IHC results in the groups shown in table 13. Group 1 (vORF2 - 16 μg) and group 5 (rORF2 - 8 µg) had the lowest share of positive IHC results (16,7%). Group 8 (to the trolls infection) and group 9 (strict negative control) had the highest share of positive IHC results, 90% and 90.9%, respectively.

Table 13. A generalization of the frequency of positive IHC results in groups
GroupImpactNThe number of piglets with at least one positive for PCV2 clothThe frequency of occurrence
1vORF2 - 16 μg (1 dose)12216,7%
2vORF2 - 8 μg (1 dose)12325,0%
3vORF2 - 4 μg (1 dose)12866,7%
4rORF2 - 16 μg (1 dose)11436,3%
5rORF2 - 8 μg (1 dose)12216,7%
6rORF2 -4 μg (1 dose) 11436,4%
7KV (2 doses)12541,7%
8Controls infection10990,0%
9Strict negative controls111090,9%
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; KV or killed virus with whole cells = PCV2 virus grown in suitable cell culture

After infection group 5, which was administered one dose of 8 μg of rORF2 antigen, was better than the other 6 groups with vaccine. Group 5 had the highest ADWG (0,94±0,22 pounds/day), while the lowest frequency of occurrence of abnormal behavior (0%), the second from the lowest frequency of symptoms of cough (8,3%), the lowest frequency of the common manifestations of clinical symptoms (8.3 per cent), the lowest mortality rate (0%), the lowest percentage of nasal selection PCV2 (8,3%), second lowest average % of lung damage (,68±1,15%) and the lowest frequency of occurrence of positive tissues (16,7%). Group after the introduction of various levels of rORF2 antigen as a whole was better than the group after the introduction of various levels of vORF2, and group after administration of 2 doses of killed whole cell PCV2 vaccine was the worst. Tables 14 and 15 contain aggregate data for groups after infection.

Table 14. Compilation of data for groups after infection - Part 1
GroupNImpactADWG (pounds/ day)Abnormal behaviorCoughThe overall frequency of clinical manifestations symptoms
112vORF2 - 16 μg
(1 dose)
0,87±0,292/12 (16.7 per cent)3/12 (25%)41,7%
212vORF2 - 8 mcg
(1 dose)
0,70±0,324/12 (33.3 per cent)1/12 (8.3 per cent)41,7%
312vORF2 - mcg
(1 dose)
0,49±0,218/12 (66.7 per cent)2/12 (16.7 per cent)66,7%
411rORF2 - 16 μg
(1 dose)
0,84±0,303/11 (27.3 per cent)0/11 (0%)36,4%
512rORF2 - 8 mcg
(1 dose)
0,94±0,220/12 (0%)1/12 (8.3 per cent)8,3%
611rORF2 - 4 mcg
(1 dose)
0,72±0,251/11 (9.1 per cent)0/11 (0%)9,1%
712KV
(2 doses)
0,50±0,157/12 (58,3)0/12
(0%)
58,3%
810Controls infection0,76±0,191/10 (10%)2/10 (20%) 40%
911Strict negative controls1,06±0,170/11
(0%)
0/11 (0%)0%
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; KV or killed virus with whole cells = PCV2 virus grown in suitable cell culture

Table 15. Compilation of data for groups after infection - Part2
GroupNImpactThe mortality rateNasal secretionAverage % of lung damageThe frequency of occurrence of at least one tissue positive for PCV2 in IHC
112vORF2 - 16 μg
(1 dose)
8,3%8,3%0,40±0,50%16,7%
212 vORF2 - 8 mcg
(1 dose)
8,3%8,3%7,41±20,2%25,0%
312vORF2 - 4 mcg
(1 dose)
0%8,3%9,20±20,9%66,7%
411rORF2 - 16 μg
(1 dose)
0%18,2%1,50±4,74%36,3%
512rORF2 - 8 mcg
(1 dose)
0%8,3%0,68±1,15%16,7%
611rORF2 - 4 mcg
(1 dose)
9,1%9,1%2,95±5,12%36,4%
712KV
(2 doses)
16,7%41,7%7,27±22,9%41,7%
810Controls infection10%80%9,88±29,2%90,0%
911Strict negative controls0%63,6%0/11 (0%)90,9%
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; KV or killed virus with whole cells = PCV2 virus grown in suitable cell culture

The results of this study show that all further work on the production of vaccine should focus on vaccine rORF2. In General, after infection revealed nasal allocation of PCV2, and vaccination PCV2 vaccine led to a decrease in allocation. Immunohistochemistry selected lymphoid tissues also served as a good option for vaccine efficacy, whereas large differences in the ADWG, clinical symptoms and macroscopic lesions between groups were found. This study was complicated by the fact that at some point during the study was introduced foreign PCV2, as is evident by nasal secretion PCV2, seroconversion PCV2 positive by IHC tissue in group 9, the group has strict negative control.

Discussion

This study evaluated seven PCV2 vaccines, which included three different levels of doses of vORF2 antigen entered once on day 0, three different levels of dose of rORF2 antigen, entered once on day 0, and one level dose of a killed whole cell PCV2 vaccine, introduced on day 0 and day 14. In General, group 5, which was administered 1 dose of vaccine containing 8 μg of rORF2 antigen, had the best results. Group 5 had the highest ADWG, the low-frequency manifestations of abnormal behavior, the lowest frequency of occurrence of abnormal respiration, the second of the lowest frequency of symptoms of cough, the low-frequency manifestations of the General clinical symptoms, the lowest mortality rate, the lowest frequency of nasal selection PCV2, the second lowest share of average % of lung damage and the lowest frequency of occurrence of positive by IHC tissues.

Interestingly, group 4, which was administered a higher dose of rORF2 antigen than in group 5 did not show the same good, or better, quality than group 5. Group 4 had a slightly lower ADWG, higher frequency of manifestations of abnormal behavior, higher frequency of clinical manifestations of common symptoms, a higher incidence of nasal selection PCV2, Bo is its high average % of lung damage and a higher proportion positive by IHC tissue, than group 5. Statistical analyses, which could show that the differences between the two groups was not statistically significant, these data did not, but found a tendency that the group 4 did not show the same good quality as group 5.

After vaccination, 6 pigs died in the first research center. Four of the six piglets were from group 8 or group 9, which was not introduced vaccines. For none of the six piglets showed no lesions associated with PMWS, not described adverse events, and in General, all seven vaccines, apparently, was safe when administered to pigs at the age of approximately 11 days. During the study phase after vaccination, the pigs after administration of either vaccine vORF2-level three doses, or killed whole cell vaccine, had the highest levels of IFAT, while group 5 had the lowest group with vaccines levels IFAT immediately prior to infection.

Although it is not formally proven, believe that prevailing by migrating to PCV2 young pig soon after weaning from sows is direct contact, and an effective vaccine that reduces nasal selection PCV2 when setting up production, will help to control the spread of infection. Group after the introduction of one of the three levels of ORF2 antigen and the group after the introduction of 8 μg rORF2 had the lowest frequency of occurrence of nasal selection PCV2 (8,3%). As expected, the control group infection had the highest low-frequency manifestations of nasal discharge (80%).

Macroscopic damage in pigs with PMWS, secondary to infection with PCV2, as a rule, are generalized lymphadenopathy in combination with one or more of the following: (1) interstitial pneumonia with interlobular edema, (2) pallor of the skin, or jaundice, (3) a mosaic of atrophic livers, (4) gastric ulcers, and (5) jade. At autopsy, jaundice, hepatitis, nephritis, stomach ulcers not found for any of the groups, and lymphadenopathy is not specifically examined. Average % degree of lung injury differed between groups. Group after the introduction of 16 ug vORF2 had the lowest % degree of lung damage (0,40±0,50%), followed by the group after the introduction of 8 μg rORF2 (0,68±1,15%). As expected, the control group infection had the highest average % degree of lung damage (9,88±29.2 per cent). In all four groups average % degree of lung injury was elevated because of one pig in each of these groups with very high degrees of damage. The majority of lung damage was described as red/purple and consolidated. Typically, lung damage associated with PMWS, described as brown and not deformed interlobulares the TECOM. Lung injury found in this study, or were not associated with PCV2 infection, or could be the second pulmonary infectious agent. In the context of this study % degree of lung damage does not reflect the true measure of infections of the lungs due to PCV2.

Other researchers have shown a direct correlation between the presence of PCV2 antigen by IHC and histopathology. In this study, did not conduct histopathological studies of selected tissues. Group 1 (16 ug vORF2) and group 5 (8 μg rORF2) had the lowest frequency of occurrence of pigs positive for PCV2 antigen (8,3%), while group 9 (group a strict negative control - 90,9%) and group 8 (the control group contamination to 90.0%) had the highest frequency of manifestation of pigs positive for PCV2 antigen. Due to the subjective nature of this test, the results of IHC may represent some of the best options for judgments about the effectiveness of the vaccine.

Thus, in one aspect of the present invention was determined by the minimum protective dose (MPD) as 1 ml/1 dose recombinant product with the selected antigen PCV2 ORF2 (rORF2) model CDCD piglets under threat of PCV2 infection. Of the three groups after the introduction of various levels of rORF2 antigen group 5 (8 μg of rORF2 antigen) clearly had the highest level of protection. G is the UPP 5 or who had the best results, or is closely related to the most favorable results with respect to all measured parameters. When comparing group 5 with six other groups with vaccine groups after infection, group 5 had the highest ADWG (0,94±0,22 pounds/day), while the lowest frequency of occurrence of abnormal behavior (0%), the second from the lowest frequency of symptoms of cough (8,3%), the lowest frequency of the common manifestations of clinical symptoms (8.3 per cent), the lowest mortality rate (0%), the lowest level of the nasal selection PCV2 (8,3%), the second from the lowest degrees of the average % of lung damage (0,68±1,15%) and the lowest frequency of occurrence of positive by IHC tissues (16,7%).

In another aspect of the present invention was determined MPD as 1 ml/1 dose of the conventional product, which is a partially purified antigen of PCV2 ORF2 (vORF2), on the model CDCD piglets under threat of PCV2 infection. Of the three groups after the introduction of various levels of vORF2 antigen, group 1 (16 ug vORF2) had the highest level of protection. Group 1 was superior to group 2 and 3 against ADWG, average % of lung damage and IHC. Groups 1 and 2 (8 μg of vORF2 antigen) was the same in relation to the total frequency of occurrence of clinical symptoms, group 3 (4 μg of vORF2 antigen) had the lowest mortality, and all three groups were similar with respect to nasal ejecta is. In General, vaccines vORF not acted as well as vaccines rORF.

In another aspect of the present invention was determined by the efficiency of the maximum dose of 2 ml/2 doses of conventional killed vaccines PCV2 model CDCD piglets under threat of PCV2 infection. Of the seven vaccines evaluated in this study, killed whole cell PCV2 vaccine acted worse. Pigs after administration of two doses of a killed whole cell PCV2 vaccine had the lowest ADWG, the second of the highest degrees of abnormal behavior (58,3%), the second highest total frequency of the common manifestations of clinical symptoms (58,3%), the highest mortality (16.7%)in the second highest frequency of symptoms of nasal discharge (41,7%), the highest average % of lung damage (9,88±29.2 per cent), high frequency of occurrence of the described damage to the lungs (75%) and moderate frequency of occurrence of positive IHC tissues (41,7%). However, it was effective for inducing an immune response.

In another aspect of the present invention nasal allocation of PCV2 was assessed as a parameter of efficiency and reconfirmed prior to the performance parameters of PCV2 from previous studies. The results of this study show that nasal selection PCV2 occurs after intranasal infection and that PCV2 vaccines reduce nasal allocation of PCV2 in the Le of infection. Moreover, the results of this research and publications in the literature show that IHC should also continue to use for estimating future vaccine trials PCV2.

Some additional conclusions arising from this study is that lymphadenopathy is one of the distinguishing signs of PMWS. Another hallmark PMWS is lymphoid depletion and multi-core/giant histiocytes. Additionally, undetected adverse events or reactions at the injection site for any of the 7 PCV2 vaccines, and all 7 PCV2 vaccines, apparently was safe with the introduction of young piglets.

EXAMPLE 5

In this example tested the effectiveness of eight candidate vaccines with PCV2 and again confirmed the parameters of PCV2 infection from previous studies of infection after exposure to a virulent strain of PCV2. One hundred fifty (150) extracted caesarean section, not receiving colostrum (CDCD) piglets at the age of 6-16 days were grouped by weight and randomly divided into 10 groups of equal size. Table 16 describes the overall structure of the research for this example.

Table 16. The General structure of research
GroupThe number poro is Yat ImpactNight exposureKLH/ICFA on day 21 and day 28Infection with virulent PCV2 on day 25PRRSV MLV on day 46An autopsy on day 50
115PCV2 vaccine 1 16 ug rORF2-IMS 13140 and 14++++
215PCV2 vaccine 2 16 ug vORF2-carbopol0 and 14++++
315PCV2 vaccine 3 16 ug rORF2-carbopol0 and 14++++
415PCV2 vaccine 2 16 ug vORF2-carbopol0+++ +
515PCV2 vaccine 3 4 ug rORF2-carbopol0 and 14++++
615PCV2 vaccine 3 1 ug rORF2-carbopol0 and 14++++
715PCV2 vaccine 3 of 0.25 ug rORF2-carbopol0 and 14++++
815PCV2 vaccine 4 >8,0 log µg KV-carbopol0 and 14++++
915Controls infectionN/A++++
1015No
The group has strict negative control
N/A+-++
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; KV or killed virus with whole cells = PCV2 virus grown in suitable cell culture

Vaccine compositions entered in each group were as follows. PCV2 vaccine No. 1, entered in the 1×2 ml dose in group 1, was a high dose (16 mg/2 ml dose) inactivated recombinant ORF2 antigen with adjuvant IMS 1314 (16 ug rORF2 - IMS 1314). PCV2 vaccine No. 2, introduced into 1×2 ml dose in group 2, was a high dose (16 mg/2 ml dose) of partially purified received in VIDO R-1 antigen of PCV2 ORF2, mixed with the adjuvant carbopol (16 ug vORF2 - carbopol). PCV2 vaccine No. 3, entered in the 1×2 ml dose in group 3, was a high dose (16 mg/2 ml dose) inactivated recombinant ORF2 antigen, mixed with the adjuvant carbopol (16 ug rORF2 - carbopol). PCV2 vaccine No. 4, introduced into 1×1 ml dose group 4, was a high dose (16 μg/1 ml dose) partially purified received in VIDO R-1 antigen of PCV2 ORF2 mixed with adjuvant what carbopol (16 ug vORF2 - the carbopol). Vaccine No. 5, entered into 1×2 ml per dose group 5 consisted of 4 mcg/2 ml dose of inactivated recombinant ORF2 antigen, mixed with the adjuvant carbopol (4 ug rORF2 - carbopol). PCV2 vaccine No. 6 introduced into 1×2 ml dose to group 6 was a 1 ug/2 ml dose of inactivated recombinant ORF2 antigen, mixed with the adjuvant carbopol (1 ug rORF2 - carbopol). PCV2 vaccine No. 7 introduced into 1×2 ml dose to group 7, was a low dose of 0.25 mg/2 ml dose) inactivated recombinant ORF2 antigen, mixed with the adjuvant carbopol (of 0.25 ug rORF2 - carbopol). PCV2 vaccine No. 8 introduced into 1×2 ml dose to group 8, was a high dose (titer before inactivation >8,0 log/2 ml dose) inactivated conventional killed obtained in VIDO R-I PCV2 antigen Struve, mixed with the adjuvant carbopol (>8,0 log KV - carbopol). On day 0 groups 1-8 were treated destined for them vaccines. In groups 1-3 and 5-8 were again introduced a secondary injection of their respective vaccines on day 14. The effectiveness of a single dose of 16 ug vORF2 - carbopol tested in group 4, which did not enter secondary injection on day 14. Piglets were examined adverse events and reactions at the injection site after both vaccinations. At 21 days the pigs were transferred to the second Central research where groups 1-9 are the two who were the groups contained in a single building, but a group of 10 contained in a separate building. All pigs entered hemocyanin marine saucer, emulsified with incomplete adjuvant's adjuvant (KLH/ICFA) on 22 and 28 days. On day 25 groups 1-9 were infected approximately 4 log virulent PCV2 virus. To 46 days in control group contamination occurred very few deaths. In an attempt to immunostimulating pigs and increase the virulence of the material PCV2 infection all groups were treated INGELVAC® PRRSV MLV (vaccine porcine respiratory reproductive syndrome, a modified live virus) on day 46.

Before and after infection were collected blood samples for serological studies of PCV2. After infection collected data on body weight to determine the average daily weight gain (ADWG) and examination of clinical symptoms. On day 50 of all surviving pigs were subjected to autopsy, documented lesions in the lungs, obtained quantitative assessment of lung pathology, and selected tissues were fixed in formalin for immunohistochemical (IHC) analysis for detection of PCV2 antigen at a later date.

Materials and methods

This was partially blind analysis of the feasibility of vaccination, infection, held on CDCD piglets at the age of 6-16 days on day 0. The PCV2 titers by IFA in sows for inclusion in the study was ≤1:1000. Also, what about the serological status of the sows was known PRRS-negative herds. Sixteen (16) sows tested serological status for PCV2, all sixteen (16) had PCV2 titer ≤1000, and they were transferred to the first research center. One hundred fifty (150) piglets were removed by caesarean section, and they were available for this study on day - 3. On day -3 150 CDCD piglets in the first research center weighed, marked ear tags, were grouped by weight and randomly distributed in groups of 1-10, as indicated above in table 16. If any animal that meet the inclusion criteria, were registered for the study, and then excluded for any reason, the researcher and supervisor consulted to determine the applicability of the data collected for this animal, in the final analysis. Date exclusions registered piglets and the cause of the exceptions documented. None of the sows that meet the inclusion criteria selected for the study and transported to the first research center, has not excluded. No one pig was excluded from the study, and no animal testing was not removed from the study prior to discontinuation. Table 17 describes the time frame for key operations in this example.

21
Table 17. Operations research
Day researchValid dateOperations research
-34-04-03Weighed pigs; examined health; Randomly distributed in groups; Collected samples of blood
-3,
0-21
4-04-03
4-07-03-
5-27-03
Examined the General health status and adverse events after vaccination
04-07-03Have introduced the corresponding IVP groups 1-8
0-74-07-03-
4-14-03
Examined pigs in a reaction at the site of infection
144-21-03Conducted secondary introduction to groups 1-3, 5-8 corresponding IVP; Collected blood samples from all pigs
14-214-21-03-
4-28-03
Examined pigs in a reaction at the site of infection
19-214-26-03-
4-28-03
Processed all pigs antibiotics
4-28-03Piglets transported from Sturbe Labs, Inc in Veterinary Resources, Inc. (VRI)
22-504-07-03-
5-27-03
Examined piglets on clinical signs after infection
224-29-03Treated groups 1-10 KLH/ICFA
255-02-03Collected blood samples from all pigs; Weighed with all piglets; infected group 1-9 material for PCV2 infection
285-05-03Treated groups 1-10 KLH/ICFA
325-09-03Collected blood samples from all pigs
465-23-03Introduced INGELVAC® PRRS MLV in all groups
505-27-03Collected samples of blood, weighed and carried out the autopsy of all piglets; noted macroscopic damage; evaluated lung damage; kept fresh and formalin fixed tissue samples; Completed the in vivo phase of the study

After completion of the in vivo phase of the study pathologist examined formalin fixed tissues by immunohistochemistry (IHC) for detection of PCV2 antigen, PCV2 in blood samples was determined serologically, and determined the average weight gain (ADWG) from 25 days to 50 days.

In the first research center animals were kept in individual cages in seven rooms from birth until the age of approximately 11 days (approximately 0 day of the study). All the rooms were identical in layout and contained racks with individual cells from stainless steel with heated and filtered air is supplied separately to each individual unit. Each room had a separate heating and ventilation, thus warned of cross-contamination of air between rooms. In the second centre of the study animals were kept in two different buildings. Group 10 (group a strict negative control) were kept separately in a converted room for young animals, but groups 1-9 contained in a converted pigsty for farrowing. Each group contained in a separate enclosure (14-15 piglets per pen), and each pen was provided to approximately 2.3 square feet of a pig. Groups 2, 4 and 8 contained in the three neighbouring pens on one side of the aisle, and group 1, 3, 5, 6, 7, and 9 contained in W is STI neighbouring paddocks on the other side of the aisle. The separation of the groups was done because of fears of the Comptroller of the study that the vaccines administered to groups 2, 4 and 8, was not completely inactivated. Each pen was raised flooring with flooring from plastic plates. Deepening under the pens served as a reservoir for feces and garbage. Each building had its own heating and ventilation, with a small probability of cross contamination of air between the buildings.

In the first research center of piglets fed specially prepared milk diet from birth until the age of about 3 weeks. To 21 days (approximately age 41/2weeks) all pigs consumed solid, specially mixed diet. In the second research centre of all piglets were fed prepared to order, not containing medicinal substances commercial mixed diet appropriate for their age and weight, as desired. The water in both research centres were also available on request.

All test pigs were injected with 1.0 ml of NAXCEL®, IM in a changing hip, on day 19, 20 and 21. In addition, pig No. 11 (group 1) were administered 0.5 ml of NAXCEL® IM on day 10, the pig No. 13 (group 10) was administered 1 ml of penicillin and 1 ml PREDEF® 2X on day 10, the pig No. 4 (group 9) were injected with 1.0 ml of NAXCEL® IM on day 11, and each of piglets 1 (group 1), 4 and 11 were administered 1.0 ml of NAXCEL® on the ducks 14 for various medical reasons.

At this time, in both research centres piglets were under the supervision of a veterinarian. Examination of the health status of the animals was carried out on day -3 and documented in the form of a record of health status. All animals had good health and nutritional status before vaccination, as determined by examination on day 0. All test animals, as surveyed, were in good health and nutritional status before infection. Skeletons and fabrics utilized in selotape. The last placement of the studied animals was recorded in the minutes of the animals.

On day 0 and 14 piglets recorded in groups 1-3 and 5-8, introduced 2.0 ml appointed PCV2 vaccines 1-4, respectively, IM in the neck left and right, respectively, using a sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x1/2". The piglets recorded in group 4 was injected with 1.0 ml of PCV2 vaccine NO. 2, IM in the neck area to the right using a sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x1/2" only on day 0.

On day 22 all test pigs were injected 2.0 ml KLH/ICFA IM in the neck area to the left using a sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x 1". On day 28 all test pigs were injected 2.0 ml KLH/ICFA in the region of the right femur with use the of sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x 1".

On day 25 piglets recorded in groups 1-9, were injected with 1.0 ml of the material to PCV2 infection ISUVDL (3,98 log10TCID50/ml) IM in the neck area to the right using a sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x 1". An additional 1.0 ml of the same material was injected IN each pig (0.5 ml per nostril) using a sterile 3.0 ml syringe with Luer lock and nasal cannula.

On day 46 all test pigs were injected 2.0 ml INGELVAC® PRRS MLV, IM in the neck area to the right using a sterile 3.0 ml syringe with Luer lock and a sterile needle 20g x 1". PRRSV MLV was introduced in an attempt to increase the virulence of the material of PCV2 infection.

The test animals are examined daily for General health status and presence of adverse events on days -3 and 0 days to 21 days. Each pig was quantitatively assessed as normal or abnormal behavior, breath or cough. Surveys documented in the Protocol of the clinical investigations. All tested pigs were examined from day 0 to day 7 and group 7 additionally examined from 14 to 21 days for the reactions at the site of injection. The average daily increase in weight was determined by weighing each pig in the calibration scale on day -3, 25 and 50, or on the day on which the pig found dead after infection. Body weight record is ivali in the form of body weight. Body weight on day -3 used for separation of piglets in groups before randomization. Data mass of 25 days and 50 days were used to determine the average daily weight gain (ADWG) for each pig during these time points. For pigs that died after exposure and before 50 days, ADWG customized to represent ADWG from 25 days before the day of death.

For serological determination of PCV2, each pig was collected whole blood from a vein from the orbital venous sinus on day -3 and 14. Each pig blood was collected from the orbital venous sinus through the introduction of a sterile capillary tube in the median angle of the palpebral fissure of one eye and removal of approximately 3.0 ml whole blood at 4.0 ml tube to separate the serum (SST). On day 25, 32 and 50, whole venous blood was collected from each pig from the anterior Vena cava using a sterile needle Vacutainer® 20 g × 11/2" (Becton Dickinson and Company, Franklin Lakes, New Jersey), the needle holder for Vaccutainer® and 13 ml SST. Sampling of blood at each time point was recorded in the minutes of sample collection. Blood in each SST allowed to shrink, then each SST centrifuged and collected serum. The collected serum was transferred into a sterile snap-on tube and stored at -70±10°C until testing at a later date. In samples SIV rocky staff BIVI-R& D was testing the presence of antibodies to PCV2.

In piglets once a day from 22 to 50 days observed clinical symptoms and quantitatively evaluated as normal or abnormal behavior, breath or cough. Clinical examination documented in the Protocol of the clinical investigations.

Piglets No. 46 (group 1) and 98 (group 9) died in the first research center. Both of these deaths were classified as death from bleeding, and opening for these two pigs did not. In the second research center conducted the autopsy of piglets that died after exposure to 50 days, and piglets euthanized for 50 days. Noted any macroscopic damage, and the percentage of shares lung damage documented in the form of the autopsy report.

From each of piglets exposed in the second research center, the tissue of the tonsil, lung, heart, liver, mesenteric lymph node, kidney and inguinal lymph node was placed in a separate container with buffered 10% formalin; at the same time, another tissue sample from the above-mentioned bodies were placed in Whirl-pak® (M-Tech Diagnostics Ltd., Thelwall, UK) and each Whirl-pak® was placed in ice. Each container is properly marked. Collecting samples documented in the form of the autopsy report. Then fixed in formalin samples and the diagnostic form of the query p is animali for IHC testing. Testing IHC was performed according to standard laboratory methods for sample receipt, sample preparation and glass and methods of dyeing. Fresh samples in Whirl-pak® was sent with ice packs to the controller of surveys for storage (-70°±10°C) and possible future use.

Fixed in formalin tissue examined by the pathologist for the detection of PCV2 by IHC and evaluated using the following scoring system: 0 = no; 1 = limited positive staining, little plots; 2 = moderate positive staining, multiple sites; and 3 = abundant positive staining, widespread throughout the fabric. For analytical purposes a score of 0 was considered "negative", and a score greater than 0 was considered "positive".

Results

The results for this example are shown below. It is noted that the piglets No. 46 and 98 died on day 14 and 25, respectively. These deaths are classified as death from bleeding. Pig No. 11 (group 1) choked frequent breathing on day 15. Otherwise, all piglets were normal in behavior, breathing and cough during this observation period, and any team found no systemic adverse events. After vaccination on day 0 did not find the reactions at the injection site. After vaccination, on day 14 the seven (7) of the fourteen (14) piglets group is s 1 (50.0%) were found swelling with a score of "2" on day 15. Four (4) of the fourteen (14) in group 1 (28,6%) still had swelling with a score of "2" on day 16. None of the other groups did not experience reactions at the injection site after any vaccination.

Results the average weight gain (ADWG) are presented below in table 18. Piglets No. 46 and 98, died from bleeding were excluded from the results of the group. Group 4, which was administered one dose of 16 ug vORF2-carbopol, had the highest ADWG (1,16±0,26 lb/day), followed by groups 1, 2, 3, 5, 6 and 10, with ADWG in the range of 1.07±0,23 pounds/day to 1.11±0,26 lb/day. Group 9 had the lowest ADWG (0,88±0,29 pounds/day), followed by group 8 and 7, with ADWG 0,93±0,33 lb/day and 0.99±0,44 lbs/day, respectively.

Table 18. The generalization of the average daily weight gain (ADWG)
GroupImpactNADWG - ft/day (day 25 to day 50) or substitution for piglets died before 50 days
1rORF2 - 16 μg - IMS 1314 2 doses141,08±0,30 pounds/day
2vORF2 - 16 μg - carbó the ol 2 doses 151,11±0,16 pounds/day
3rORF2 - 16 μg - carbopol 2 doses151,07±0,21 pounds/day
4vORF2 - 16 μg - carbopol 1 dose151,16±0,26 lb/day
5rORF2 - 4 ug - carbopol 1 dose151,07±0,26 lb/day
6rORF2 - 1 µg - carbopol 2 doses151,11±0,26 lb/day
7rORF2 - 0.25 microgram - carbopol 2 doses150,99±0,44 lbs/day
8KV >8,0 log - carbopol 2 doses150,93±0,33 lb/day
9Controls infection140,88±0,29 pounds/day
10Strict negative controls 151,07±0,23 pounds/day
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; KV or killed virus with whole cells = PCV2 virus grown in suitable cell culture

Serological results for PCV2 presented below in table 19. All ten (10) groups were seronegative for PCV2 on day-3. On day 14 PCV2 titers remained low for all ten (10) groups (in the range 50-113). On day 25 the group of 8, which was introduced a killed whole cell virus vaccine, had the highest titer of PCV2 (4617), followed by group 2, which was administered to 16 ug vORF2 - carbopol, group 4, which was administered in a single dose of 16 ug vORF2 - carbopol, and group 3, which was introduced 16 ug rORF2 - carbopol, with titles 2507, 1920 and 1503, respectively. On day 32 (one week after infection), titles for groups 1 to 6 and group 8 ranged from 2360 to 7619; while group 7 (of 0.25 ug rORF2 - carbopol), 9 (control of infection) and 10 (strict negative control) had titers 382, 129 and 78, respectively. On day 50 (opening day) for all ten (10) groups showed high PCV2 titers (≥1257).

On day 25, 32, and 50 group 3, which was administered two doses of 16 ug rORF2-carbopol, had higher antibody titers than group 1, which was introduced LW the doses of 16 ug rORF2 - EVIS 1314. On day 25, 32 and 50 group 2, which was administered two doses of 16 ug vORF2, had higher titers than group 4, which was introduced only one dose of the same vaccine. Groups 3, 5, 6, 7, which was introduced increasing levels of rORF2-carbopol 16, 4, 1 and 0.25 µg, respectively, had a correspondingly decreasing antibody titers on day 25 and 32

Table 19.Generalization of PCV2 titers in IFA in groups
GroupImpactDay -3Day 14**Day 25***Day 32Day 50****
1rORF2 - 16 μg -
IMS 1314 2 doses
506464633264314
2vORF2 - 16 μg - carbopol 2 doses50110250756274005
3rORF2 - 16 μg - carbopol 2 doses 80150351206720
4vORF2 - 16 μg - carbopol 1 dose50113192037201257
5rORF2 - 4 mg -
the carbopol 1 dose
5061186739334533
6rORF2 - 1 mg -
the carbopol 2 doses
507049023605740
7rORF2 - 0.25 microgram - carbopol 2 doses5073633825819
8KV >8,0 log - carbopol 2 doses50974617761910817
9Controls infection5053501294288
10Strict negative controls5050507811205
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; KV or killed virus with whole cells = PCV2 virus grown in suitable cell culture
*For the purposes of calculating the titer in IFA ≤100 was defined as a titer of "50"; at IFA titer ≥6400 identified as the IFA titers in "12800".
**The day of infection
***Night showdown

The results of clinical examinations after infection is shown below. Table 20 contains observations of abnormal behavior, abnormal respiration, cough and diarrhoea. Table 21 contains the results from the generalization of the total frequency of occurrence of clinical symptoms in groups, and table 22 contains the results of generalization of mortality from the generalization of mortality in groups after infection. The frequency of occurrence of abnormal behavior, breathing and coughing after infection was low in piglets after centuries the Denia 16 ug rORF2-IMS 1314 (group 1), 16 ug rORF2-carbopol (group 3), 1 ug rORF2-carbopol (group 6), and 0.25 ug rORF2-carbopol (group 7), and piglets in the control group infection (group 9). The frequency of occurrence of abnormal behavior, respiration and cough after exposure is zero in piglets after the introduction of 16 ug vORF2-carbopol (group 2), a single dose mg vORF2-carbopol (group 4), 4 ug rORF2-carbopol (group 5), >8 log KV-carbopol (group 8), and in pigs in the group of strict negative control (group 10).

The overall frequency of appearance of clinical symptoms differed between groups. Piglets after the introduction of 16 ug vORF2-carbopol (group 2), a single dose of 16 ug vORF2-carbopol (group 4), and pigs in the group of strict negative control (group 10) had a frequency of occurrence 0%; pigs after introduction of 16 ug rORF2-carbopol (group 3), and 1 ug rORF2-carbopol (group 6) had a frequency of occurrence of 6.7%; pigs after introduction of 16 ug rORF2-IMS 1314 (group 1) had a total frequency of occurrence of 7.1%; piglets after introducing 4 μg rORF2-carbopol (group 5), and 0.25 ug rORF2-carbopol (Group 7), and >8 log vaccine KV had a frequency of occurrence of 13.3%; and piglets in the control group infection (group 9) had a frequency of occurrence of 14.3%.

Overall mortality rates also differed between groups. Group 8, which was administered 2 doses of the vaccine KV, had the highest mortality rate of 20.0%; followed by gr is the PAP 9, group control infection and group 7, which was injected with 0.25 ug rORF2-carbopol and which had mortality rates of 14.3% and 13.3%, respectively. Group 4, which was administered one dose of 16 ug vORF2-carbopol, possessed of 6.7% mortality. All other groups 1, 2, 3, 5, 6, and 10 had 0% mortality.

Table 20. The summary of observations in groups after infection, abnormal behavior, abnormal respiration and cough
GroupImpactNAnomalous behavior of1Anomalous behavior of2Cough3
1rORF2 - 16 μg -
IMS 1314 2 doses
140/14
(0%)
0/14
(0%)
1/14
(7,1%)
2vORF2 - 16 μg - carbopol 2 doses150/15
(0%)
0/15
(0%)
0/15
(0%)
3rORF2 - 16 μg - carbopol 2 doses15 0/15
(0%)
0/15
(0%)
1/15
(6,7%)
4vORF2 - 16 μg - carbopol 1 dose150/15
(0%)
0/15
(0%)
0/15
(0%)
5rORF2 - 4 mg -
the carbopol 1 dose
151/15
(6,7%)
1/15
(6,7%)
0/15
(0%)
6rORF2 - 1 mg -
the carbopol 2 doses
150/15
(0%)
0/15
(0%)
1/15
(6,7%)
7rORF2 - 0.25 microgram - carbopol 2 doses150/15
(0%)
1/15
(6,7%)
1/15
(6,7%)
8KV > 8,0 log - carbopol 2 doses151/15
(6,7%)
1/15
(6,7%)
0/15
(0%)
9Controls infection14 1/14
(7,1%)
1/14
(7,1%)
2/14
(14/3%)
10Strict negative controls150/15
(0%)
0/15
(0%)
0/15
(0%)
1The total number of pigs in each group that demonstrated any abnormal behavior on at least one day
2The total number of pigs in each group that demonstrated any abnormal breathing at least for one day
3The total number of pigs in each group that showed a cough for at least one day

Table 21. Summarizing the overall frequency of occurrence of clinical symptoms of
GroupImpactNThe proportion of pigs with clinical symptoms1The frequency of occurrence
1rORF2 - 16 μg -
IMS 1314 2 doses
1417,1%
2vORF2 - 16 μg - carbopol 2 doses1500,0%
3rORF2 - 16 μg - carbopol 2 doses1516,7%
4vORF2 - 16 μg - carbopol 1 dose1500,0%
5rORF2 - 4 µg -
the carbopol 1 dose
15213,3%
6rORF2 - 1 µg -
the carbopol 2 doses
1516,7%
7rORF2 - 0,25 µg - carbopol 2 doses15213,3%
8KV >8,0 log - carbopol 2 doses15213,3%
9Controls infection14 214,3%
10Strict negative controls1500,0%
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; KV or killed virus with whole cells = PCV2 virus grown in suitable cell culture
1The total number of pigs in each group that showed any clinical symptoms at least for one day

Table 22. The compilation of mortality in groups after infection
GroupImpactNDead after infectionThe mortality rate
1rORF2 - 16 μg -
IMS 1314 2 doses
1400,0%
2vORF2 - 16 μg - carbopol 2 doses1500,0%
3rORF2 - 16 μg - carbopol 2 doses1500,0%
4vORF2 - 16 μg - carbopol 1 dose1516,7%
5rORF2 - 4 mg -
the carbopol 1 dose
1500,0%
6rORF2 - 1 mg -
the carbopol 2 doses
1500,0%
7rORF2 - 0.25 microgram - carbopol 2 doses15213,3%
8KV >8,0 log - carbopol 2 doses15320,0%
9Controls infection14214,3%
10Strict negative controls 1500,0%
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; KV or killed virus with whole cells = PCV2 virus grown in suitable cell culture

Generalizations average percent lung damage and preliminary diagnoses listed in the following table 23. Group 9 group control infection had the highest percentage of lung damage with an average 10,81±23,27%, followed by group 7, which was injected with 0.25 ug rORF2-carbopol and which had an average 6,57±24,74%, group 5, which was introduced 4 ug rORF2-carbopol and which had an average 2,88±8,88%, and group 8, which introduced the vaccine KV and which had an average 2,01±4.98%of. The remaining six (6) groups had lower average incidence of lung damage in the range of 0.11±0,38% to 0.90±0,15%.

Preliminary diagnoses of pneumonia differed between groups. Group 3, which was administered two doses of 16 ug rORF2-carbopol, had the lowest percentage of pre-diagnosis of pneumonia is 13.3%. Group 9 group control infection, had 50% of the initial diagnosis of pneumonia, followed by group 10, group a strict negative control, and group 2, which was administered two doses of 16 ug vORF2-carbopol, from 46.7% and 40%, respectively, predvaritelnym a diagnosis of pneumonia.

Groups 1, 2, 3, 5, 9 and 10 had 0% of groups with a preliminary diagnosis of PCV2 infection; whereas the group of 8, which was administered two doses of the vaccine KV, had the highest percentage in the group a preliminary diagnosis of PCV2 infection, 20%. Group 7, which was administered two doses of 0.25 ug rORF2-carbopol, and group 4, which was administered one dose of 16 ug vORF2-carbopol, had a prior diagnosis of PCV2 infection in a group of 13.3% and 6.7% of each group, respectively.

The ulcer was diagnosed with only one pig in group 7 (6,7%); while the other group remained free from stomach ulcers.

Table 23. The generalization of the average % of lung damage and frequency of pre-diagnosis groups
GroupImpactNThe number of piglets emitting at least for one dayThe frequency of occurrence
1rORF2 - 16 μg -
IMS 1314 2 doses
1500%
2vORF2 - 16 μg - carbopol 2 doses15 16,7%
3rORF2 - 16 μg - carbopol 2 doses15320,0%
4vORF2 - 16 μg - carbopol 1 dose15213,3%
5rORF2 - 4 mg -
the carbopol 1 dose
15320,0%
6rORF2 - 1 mg -
the carbopol 2 doses
15640,0%
7rORF2 - 0.25 microgram - carbopol 2 doses15746,7%
8KV >8,0 log - carbopol 2 doses151280%
9Controls infection1414100,0%
10Strict about the negative controls 151493,3%
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; KV or killed virus with whole cells = PCV2 virus grown in suitable cell culture

A generalization of the frequency of positive IHC results in the groups shown below in table 24. Group 1 (16 ug rORF2 - IMS 1314) had the lowest frequency in the group of positive IHC results with 0% of pigs positive for PCV2, followed by group 2 (16 ug vORF2-carbopol) and group 4 (single dose of 16 ug vORF2 - carbopol), with frequencies of IHC in groups of 6.7% and 13.3%, respectively. Group 9 group control infection had the highest percentage manifestations of positive IHC with 100% of pigs positive for PCV2, followed by group 10, group a strict negative control, and group 8 (vaccine KV), with 93.3% and 80% of pigs positive for PCV2, respectively.

Table 24. A generalization of the frequency of positive IHC results in groups
GroupImpactNThe number of piglets emitting at least for some of the day The frequency of occurrence
1rORF2 - 16 μg -
IMS 1314 2 doses
1500%
2vORF2 - 16 μg - carbopol 2 doses1516,7%
3rORF2 - 16 μg - carbopol 2 doses15320,0%
4vORF2 - 16 μg - carbopol 1 dose15213,3%
5rORF2 - 4 mg -
the carbopol 1 dose
15320,0%
6rORF2 - 1 mg -
the carbopol 2 doses
15640,0%
7rORF2 - 0.25 microgram - carbopol 2 doses15746,7%
8 KV > 8,0 log - carbopol 2 doses151280%
9Controls infection1414100,0%
10Strict negative controls151493,3%
vORF2 = selected viral ORF2; rORF2 = recombinant, expressed in baculovirus ORF2; KV or killed virus with whole cells = PCV2 virus grown in suitable cell culture

Discussion

In this example, the estimated seven PCV2 vaccines, which included a high dose (16 μg) of rORF2 antigen, mixed with adjuvant IMS 1314 entered twice, a high dose (16 μg) of vORF2 antigen, mixed with the adjuvant carbopol entered twice, one group of piglets and twice the second group of piglets, a high dose (16 μg) of rORF2 antigen, mixed with the adjuvant carbopol entered twice, a dose of 4 μg of rORF2 antigen, mixed with the adjuvant carbopol entered twice, a dose of 1 µg of rORF2 antigen, mixed with the adjuvant carbopol entered twice low dose (0.25 microgram) of rORF2 antigen, mixed with adjuvant ka is Bobola, typed, double -, and high dose (>8 log) killed whole cell PCV2 vaccine mixed with adjuvant with carbopol. In General, group 1, which was administered two doses of 16 ug rORF2 - IMS 1314, was slightly better than the group with 2 to 7, which was administered vaccines containing different levels or vORF2 antigen, or of rORF2 antigen, mixed with the adjuvant carbopol, and much better than the G8, which was administered two doses of a killed whole cell PCV2 vaccine. Group 1 had the third highest ADWG (1,80±0,30 pounds/day), while the lowest frequency of occurrence of abnormal behavior (0%), the lowest frequency of occurrence of abnormal breathing (0%), low-frequency manifestations of cough (7.1%)and low-frequency manifestations of the General clinical symptoms (7,1%), closely related to three other groups, the lowest mortality rate (0%), the second from the lowest degrees of the average % of lung damage (0,15±0,34%), the second from the lowest degrees of pneumonia (21,4%) and the lowest frequency of occurrence of positive by IHC tissues (0%). Group 1, however, was only one group in which the detected reaction at the injection site, including 50% of vaccinated at 1 day after the second vaccination. Other vaccines that are entered in groups 2 through 7, worked better than the killed vaccine and almost as good as the vaccine, introduced in group 1.

Group 8, which was introduced two is Uzzah killed PCV2 vaccine, mixed with the adjuvant carbopol, had the worst set of results from all groups of vaccines. Group 8 had the lowest ADWG (0,93±0,33 lb/day), the second highest frequency of manifestations of abnormal behavior (6,7%), the highest frequency of occurrence of abnormal breathing (6,7%), closely related with the other three groups, the highest total frequency of occurrence of clinical symptoms (13.3 per cent)had the highest mortality rate of all groups (20%) and had the highest percentage positive by IHC (80%) of all groups of vaccines. There was fear that killed whole cell PCV2 vaccine may not be completely inactivated before the introduction of group 8, which may explain the poor results for this group. Unfortunately, no specific data was available to confirm this concern. In General, in the context of this example, the conventional killed vaccines have not helped to reduce associated with PCV2 diseases.

As mentioned earlier, was not present adverse events associated with the tested vaccines, except for vaccines mixed with adjuvant IMS 1314. The reactions at the injection site found in 50.0% of piglets after 1 day after the second vaccination the vaccine, made with IMS 1314 and 28.6% of piglets in 2 days after the second vaccination. None of the pigs had not discovered reactions after vedenyagin with adjuvant with carbopol. In any further research, including pigs vaccinated with vaccines with adjuvants IMS 1314, should continue to carefully monitor piglets reactions at the injection site.

All pigs were seronegative for PCV2 on day -3 and only group 2 had titers above 100 on day 14. On day 25 (day of infection) group 8 had the highest titer of antibodies to PCV2 (4619), followed by group 2 (2507). With the exception of groups 7, 9 and 10, all groups showed strong antibody responses to 32 days. To 50 days for all groups, including groups 7, 9 and 10 showed strong antibody responses.

One of the hallmarks of late-stage PCV2 infection and the subsequent development of PMWS is stunting weaned from sows piglets, and in severe cases, celebrated the mass loss. The average weight gain in groups is a quantitative way to show stunted growth or weight loss. In this example, there was not much difference in the ADWG between groups. Group 8 had the lowest ADWG 0,88±0,29 pounds/day, while group 4 had the highest ADWG 1,16±0,26 lb/day. In the context of this study there was not significant difference between groups in order to justify the effectiveness of future vaccines for ADWG.

In addition to weight loss, shortness of breath, lethargy, pale skin, and sometimes jaundice represent liricheskie symptoms associated with PMWS. In this example, abnormal behavior, abnormal respiration and cough not often found for each group. As shown in this study, this model of infection and strain for infection did not lead to a very strong clinical symptoms and thus, it is not simply an option on which you can base the efficacy of the vaccine.

In General, mortality rates in this example were not high, and the absence of high mortality in the control group contamination imposes limitations on this option to build on the effectiveness of the vaccine. Before 46 days in each of the groups 4 and 7 died one of the fifteen piglets in group 9 died, two of the fourteen piglets in group 8 died, three of the fifteen piglets. Due to the fact that in group 9, the control group contamination, found no clinical symptoms for PCV2, and in this group occurred only two deaths to day 46, MLV vaccine porcine respiratory reproductive syndrome (PRRSV), was administered to all pigs on day 46. In earlier studies used INGELVAC® PRRS MLV as immunostimulant for gain associated with PCV2 disease PMWS, and mortality rates in these earlier studies was higher. Two deaths occurred shortly after the introduction of PRRS vaccine on day 46 in group 4 there was one death on the TCI 46 and in group 7, there was one death on day 47, which may not have been associated with the introduction of PRRS vaccine. 50 days of group 8, which was administered two doses of killed vaccine, had the highest mortality rate (20%), followed by group 9 (infection control) and group 7 (of 0.25 ug rORF2 - carbopol), with mortality rates of 14.3% and 13.3%, respectively. In General, the introduction of PRRS vaccine in a model of infection at a later time in the phase of examination in this example was not significantly increased levels of mortality.

Macroscopic damage in pigs with PMWS, secondary to infection with PCV2, as a rule, are generalized lymphadenopathy in combination with one or more of the following: (1) interstitial pneumonia with interlobular edema, (2) pallor of the skin, or jaundice, (3) a mosaic of atrophic livers, (4) gastric ulcers, and (5) jade. At necropsy (day 50) jaundice, hepatitis and nephritis not found for any of the groups. The ulcer was found to have one pig in group 7, but lymphadenopathy is not specifically evaluated. On the basis of the presence of damage corresponding to PCV2 infection, three groups had at least one pig with a preliminary diagnosis of PCV2 (PMWS). Group 8, which was administered two doses of killed vaccine, had 20% with a preliminary diagnosis of PCV2, while group 7 and group 4 had a 13.3% and 6.7%, respectively, with prewar the positive diagnosis of PCV2. At autopsy averages % of lung damage differed between groups. Groups 1, 2, 3, 4, 6 and 10 had the lowest values % of lung damage, ranging from 0.11±0,38% to 0.90±0,15%. As expected, group 9, group control infection, had the highest average % of lung damage (10,81±23,27%). Four groups of averages % damage lungs were inflated due to the fact that from one to three pigs in each of these groups had very high scores of lung damage. The majority of lung damage was red/purple and consolidated. Typically, lung damage associated with PMWS, described as brown and not deformed interlobular edema. Lung injury found in this study, or were not associated with PCV2 infection, or could be the second pulmonary infectious agent. In the context of this study % degree of lung damage may not reflect the true measure of infections of the lungs due to PCV2. Similarly, a preliminary diagnosis of pneumonia may also be excessive. For all pigs with lung damage, some so small as to 0.10%, recorded a preliminary diagnosis of pneumonia. In this example, did not present significant difference between groups with respect to mA is roscopically damage and % damage lungs, on which to base the efficacy of the vaccine.

The IHC results showed the greatest differences between groups. Group 1 (16 ug rORF2 - IMS 1314) had the lowest positive IHC results for PCV2 antigen (0%); while group 9 and 10 had the highest positive IHC results with the frequency of occurrence 100% to 93.3%, respectively. Groups 3, 5, 6 and 7, which were introduced 16, 4, 1 or 0.25 µg of rORF2 antigen, respectively, mixed with the adjuvant carbopol, possessed a degree of positive IHC 20%, 20%, 40% and 46.7%, respectively. Group 2, which was administered two doses of 16 ug vORF2 mixed with the adjuvant carbopol, possessed a degree of positive IHC of 6.7%, while group 4, which was introduced only one dose of the same vaccine, possessed a degree of positive IHC of 13.3%. Because of the objective nature of this test and the fact that the results of IHC correlated with the expected results, testing IHC, perhaps, is one of the best options for judgments about the effectiveness of the vaccine.

Thus, in one aspect of the present invention was determined by the minimum protective dose (MPD) of PCV2 antigen rORF2 mixed with the adjuvant carbopol, in the model CDCD piglets under threat of PCV2 infection. In each of groups 3, 5, 6 and 7 were administered two doses of rORF2 antigen, mixed with the adjuvant carbopol, however, the level of rORF2 antigen varied DL the each group. In each of groups 3, 5, 6 and 7 were introduced 16, 4, 1 or 0.25 µg of rORF2 antigen, respectively. In General, lower levels of rORF2 antigen reduced the titers of antibodies to PCV2 and increased mortality rates, average % of lung damage and the frequency of occurrence of positive by IHC tissues. Of the four groups, which had different levels of rORF2 - carbopol, groups 3 and 5, which were administered two doses of 16 or 4 µg of rORF2 antigen, respectively, each had a degree of positive IHC only 20%, and all had similar titers of antibodies. In General, on the basis of positive results of IHC, the minimum protective dose of rORF2 antigen, entered twice, was approximately 4 mcg.

In another aspect of the present invention was evaluated antigenicity of recombinant (rORF2) and VIDO R-1 (vORF2) PCV2 antigens. In group 2 was administered two doses of 16 ug vORF2 and in group 3 was administered two doses of 16 ug rORF2. Both vaccines were mixed with adjuvant with carbopol. Found that both vaccines were safe and both had 0% mortality. Group 2 had titers of antibodies to PCV2 2507 on day 25, while group 3 had a titer of antibodies to PCV2 1503. Group 3 had a lower value % of lung damage than group 2 (0,11±0,38% against 0,90±0,15%), but group 2 had a lower frequency of occurrence of positive IHC than group 3 (6.7% vs. 20%). In General, both vaccines had CX is ne-antigenicity, however vORF2 was associated with slightly better results IHC.

In another aspect of the present invention determined the applicability of two different adjuvants (carbopol and IMS 1314). In both groups 1 and 3 were administered two doses of vaccine containing 16 μg of rORF2 antigen, but in group 1 were injected antigen, mixed with adjuvant IMS 1314, while in group 3 were injected antigen, mixed with adjuvant with carbopol. Both groups had essentially the same ADWG essentially the same frequency of appearance of clinical signs after infection, the same mortality rate, and essentially the same mean % lung damage; however, group 1 had a positive degree IHC 0%, while group 3 had a positive degree IHC 20%. However, group 3, which had introduced the vaccine is mixed with the adjuvant carbopol, had higher titers IFAT PCV2 on day 25, 32 and 50, than group 1, which was administered vaccine mixed with adjuvant IMS 1314. In General, although PCV2 vaccine mixed with adjuvant IMS 1314, received more good results IHC, it did not provide much better protection against PCV2 infection and caused a reaction in the site of injection. At the same time, the PCV2 vaccine, mixed with the adjuvant carbopol, acted almost as good as the vaccine with adjuvant IMS 1314, however, was not associated with any adverse events.

In the other aspect of the present invention determined the applicability of the PCV2 ORF2 in the form of product with 1 dose 1 ml In both groups 2 and 4 were injected 16 µg vaccine vORF2 mixed with the adjuvant carbopol on day 0, but in group 2 was administered the second dose on day 14. Group 4 had a slightly higher ADWG and smaller average % lung damage than group 2, but group 2 had higher titers EFAT PCV2 on day 25, 32 and 50, and a little more low-frequency manifestations of the positive by IHC tissues. All other results for these two groups were the same. In General, a single dose vORF2 mixed with the adjuvant carbopol, acted as two doses of the same vaccine.

1. A method of obtaining a recombinant protein expressed by open reading frame 2 of PCV2, comprising the stage of:
A) cloning of the indicated recombinant open reading frame 2 of PCV2 in vector-vector;
B) introducing a portion of the specified vector vector containing the indicated recombinant open reading frame 2, in baculovirus;
C) infection of insect cells in the environment specified by the baculovirus;
(D) providing the expression specified by the baculovirus protein with the indicated open reading frame 2;
(E) separating the cells of the insect from the specified baculovirus vector in the supernatant; and
F) allocation of the specified protein expressed by open reading frame 2, from the specified supernatant at least five days after infected with the project for a cell specified by the baculovirus.

2. The method according to claim 1, where the specified method further includes a step of amplification of the indicated open reading frame 2 of PCV2 strain before cloning the specified open reading frame in the specified vector is a vector.

3. The method according to claim 1, where the indicated recombinant open reading frame 2 further comprises a sequence selected from the group consisting of the 5'Kozak sequence, a 3'EcoR1 site and their combinations.

4. The method according to claim 3 where the specified 5'Kozak sequence contains SEQ ID NO: 1.

5. The method according to claim 3, where the specified 3'EcoR1 site contains SEQ ID NO: 2.

6. The method according to any one of claims 1 to 5, where this open reading frame PCV2 contains SEQ ID NO: 4.

7. The method according to any one of claims 1 to 5, where indicated recombinant protein expressed by open reading frame 2, contains SEQ ID NO: 6.

8. The method according to any one of claims 1 to 5, where this environment includes a serum-free medium for insect cells.

9. The method according to any one of claims 1 to 5, further comprising the stage of:
i) cloning in front of the stage And the specified amplified open reading frame 2 in the first vector;
ii) cutting the indicated open reading frame 2 from the specified first vector; and
iii) applying the specified cut open reading frame 2 at the stage of A.

10. The method according to any one of claims 1 to 5, where these cells nasekomoe which include cells SF+.

11. The method according to any one of claims 1 to 5, where specified insertion section contains SEQ ID NO: 4.

12. A method of obtaining a composition for inducing an immune response against PCV2, where the method involves the following stages:
i) introduction of constructs in the baculovirus where the specified design contains recombinant DNA from open reading frame 2 of PCV2;
ii) infection of insect cells specified by the baculovirus, where these cells are in culture medium;
iii) providing the expression specified by baculovirus recombinant protein with the indicated open reading frame 2;
iv) selection of the specified protein expressed by open reading frame 2 from the supernatant, where this protein with an open reading frame 2 allocate at least 5 days after infection of these cells insect specified baculovirus; and
v) combining the specified selected protein with an open reading frame 2 with a suitable adjuvant or other pharmaceutically acceptable carrier or excipient.

13. The method according to item 12, where the method additionally includes a step for specified construction of the vector vector.

14. The method according to item 12, where the method additionally includes a step of amplification of the indicated open reading frame 2 of PCV2 strain before cloning the specified open reading frame 2 of the criminal code of the related vector-vector.

15. The method according to item 12, where this recombinant open reading frame 2 further comprises a sequence selected from the group consisting of the 5'Kozak sequence, a 3'EcoR1 site and their combinations.

16. The method according to clause 15, where indicated 5'Kozak sequence contains SEQ ID NO: 1.

17. The method according to clause 15, where indicated 3'EcoR1 site contains SEQ ID NO: 2.

18. The method according to any of PP-17, where this open reading frame 2 of PCV2 contains SEQ ID NO: 4.

19. The method according to any of PP-17, where the indicated recombinant protein with an open reading frame 2 contains SEQ ID NO: 6.

20. The method according to any of PP-17, where this environment includes a serum-free medium for insect cells.

21. The method according to 14, further comprising the stage of:
i) cloning the specified amplified open reading frame 2 in the first vector;
ii) cutting the indicated open reading frame 2 from the specified first vector; and
iii) applying the specified cut open reading frame 2 for cloning into the specified vector-vector.

22. The method according to any of p-17 and 21, where these cells include insect cells insect SF+.

23. The method according to any of p-17 and 21, where the specified input structure contains SEQ ID NO: 4.

24. The method according to any of p-17 and 21, where this stage of selection additionally includes the stage of the division specified environment from these insect cells and cell debris.

25. The method according to paragraph 24, where the specified phase separation involves the step of filtering these insect cells, cellular debris and culture medium through a filter with pore size in the range from about 0.45 μm to approximately 1.0 μm.

26. The method according to any of p-17 and 21, where the specified method further includes a step of inactivation of the specified baculovirus before the Union of the specified selected protein with an open reading frame 2 with a suitable adjuvant.

27. A method of obtaining a recombinant protein expressed by open reading frame 2 of PCV2, where the method involves the following stages:
i) infection of insect cells in culture medium of recombinant baculovirus vector containing the indicated open reading frame 2;
ii) providing the expression specified baculovirus vector specified protein open reading frame 2; and
iii) the allocation of the specified downregulation of protein open reading frame 2 from the supernatant,
where the specified highlighting spend at least 5 days after infection of the cells specified baculovirus vector.

28. The method of obtaining a diagnostic kit for detection of PCV2 infection in the sample, including
i) obtaining a recombinant protein with an open reading frame 2, as described in any one of claims 1 to 5 and 27;
ii) packaging pointed to by the th of the recombinant protein with an open reading frame in a suitable container.

29. The method according to p additionally includes the stage of attachment instructions in a container Packed with recombinant protein with an open reading frame.

30. Set for the prevention of PCV2 infection or reduce the severity of clinical symptoms associated with PCV2 infection, comprising at least one container containing at least one dose of a composition obtained by combining protein with an open reading frame 2, obtained by the method according to any one of claims 1 to 5 and 27, with an acceptable adjuvant and/or other pharmaceutically acceptable carrier or a composition obtained by the method according to any of p-17 and 21, where this composition is immunogenic and one dose contains at least 2 μg protein open reading frame 2 of PCV2.

31. Set for the prevention of PCV2 infection or reduce the severity of clinical symptoms associated with PCV2 infection, including:
i) a container containing at least one dose of a composition obtained by combining protein with an open reading frame 2, obtained by the method according to any one of claims 1 to 5 and 27, with an acceptable adjuvant and/or other pharmaceutically acceptable carrier or a composition obtained by the method according to any of p-17 and 21, and
ii) a container containing immunogenic composition comprising the antigen of PRRS.

32. Set for the prevention of PCV2 infection or reduce the severity to incesti symptoms associated with PCV2 infection, including:
i) a container containing at least one dose of a composition obtained by combining protein with an open reading frame 2, obtained by the method according to any one of claims 1 to 5 and 27, with an acceptable adjuvant and/or other pharmaceutically acceptable carrier or a composition obtained by the method according to any of p-17 and 21, and
ii) a container containing immunogenic composition comprising a PRRS antigen, where the antigen of PRRS is a IngelVac PRRS MLV.



 

Same patents:

FIELD: medicine.

SUBSTANCE: offered test system for quantitative determination of Streptococcus agalactiae includes species-specific primers having nucleotide sequences 5'-CAGTTGAATCCAAATGTTACGG-3' and 5'-TAATGCTGTTTGAAGTGCTG-3', and a probe having a nucleotide sequence 5'-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3'. A DNA target for specific amplification is a gene cfb Streptococcus agalactiae fragment between 685 and 762 nucleotide residues of its complete sequence.

EFFECT: invention allows quick and high-specific detection of Streptococcus agalactiae in samples of a biological material and determination of the definition of its quantitative content.

2 dwg, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method includes separation by centrifugation of heparinised mononuclear cells of umbilical blood (further UB) in gradient of density on Ficoll-Paque™PLUS. After that realised are thorough washing in PBS+0.1 % BSA medium and denaturation at temperature 82°C of suspension, consisting of UB cells and control cell culture 1301, supported in RPMI medium with addition of 10% bull serum of glutamine and penicillin with streptomycin. After that, analysed and control cells are distributed in two pairs of test tubes, adding to them up to 0.5 ml PBS 0.1% BSA solution, centrifuging with acceleration 500 g for 5 minutes. Then in two rest tubes with cells poured is hybridisation buffer, and into the second pair - poured is hybridisation buffer with peptide-nuclein probe. After that, they are incubated in darkness for 2-20 hours, washed, mixed, centrifuged, stained in solution of propidium-iodide and RNK A. After that, analysis of cell samples is carried out with determination of their relative length telomeres depending on length of telomeres of cell culture 1301, taking into account DNA index.

EFFECT: invention makes it possible to increase quality of determination of properties of transplant, samples of hemopoetic stem cells of umbilical blood for transplantation.

1 ex

FIELD: medicine.

SUBSTANCE: method of predicting development of arterial hypertension in pregnant women consists of realisation of DNA separation from peripheral venous blood, carrying out polymerase chain reaction, finding out data about presence of polymorphism of α-adducin 1 gene. If carrying genotype 460WW of gene of α-adducin 1 ADD1 G460W is detected, conclusion about risk of hypertension development in pregnant women is made.

EFFECT: increased efficiency of predicting arterial hypertension development in pregnant women.

1 ex, 1 tbl, 2 dwg

FIELD: medicine.

SUBSTANCE: invention represents primer sets for carrying out LIMP or PCR used for Saccharomyces pastorianus detection. Also, there are presented sets for Saccharomyces pastorianus detection containing a primer set according to the invention in a combination with a primer set for carrying out LAMP used for Saccharomyces bayanus detection, and also in a combination with a primer set for carrying out LAMP used for Saccharomyces cerevisiae and Saccharomyces pastorianus detection. There are presented methods for Saccharomyces pastorianus detection.

EFFECT: invention provides precise, quick and easy identification of Saccharomyces pastorianus yeast by means of PCR or LIMP.

19 cl, 4 dwg, 5 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: what is presented is a method for Apo2L/TRAIL sensitivity prediction of a malignant tissue or cell sampled from a mammal, involving the stages as follows: sampling a malignant tissue or cell from a mammal; analysing the sample malignant tissue or cell for detecting expression of one or more biomarkers selected from a group of fucosyl transferase 3, fucosyl transferase 6, sialyl-Lewis A and/or X antigen (antigens) where expression of one or more specified biomarkers is an indicator of the fact that the specified sampled tissue or cell is sensitive to apoptosis-inducing activity Apo2L/TRAIL. Also, what is described is a method of apoptosis induction in the sampled malignant tissue or cell of a mammal. What is offered is a method of treating a malignant tumour in a mammal. The inventions enables using the detection of expression of one or more biomarkers as the indicator of the fact that a sample is sensitive to apoptosis-inducing agents, such as Apo2L/TRAIL and DR5 agonist antibodies. Specific biomarkers to be examined include fucosyl transferases, particularly fucosyl transferase 3 (FUT3) and/or fucosyl transferase 6 (FUT6), as well as sialyl-Lewis A and/or X antigens.

EFFECT: method improvement.

35 cl, 22 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: cell suspension under investigation is incubated with biochip, containing immobilised on biochip antibodies, which have specificity to superficial antigens of investigated cells. After incubation, biochip is washed from non-specifically bound cells. Cells, which remain bound with biochip, are subjected to processing with labelled polynucleotide probes of one or several types with further hybridisation. Reading and processing of results are performed by presence of cell binding in area of biochip sites, containing immobilised antibodies, presence in them of determined superficial antigens is detected, and presence and character of binding of labelled polynucleotide probes are used to determine genetic signs in the same cells.

EFFECT: method application makes it possible to increase quantity of simultaneously determined superficial antigens on different cells with application of non-conjugated with label antibodies, simultaneously reducing number of used antibodies.

9 cl, 2 dwg, 2 ex

Biomarkers // 2429297

FIELD: medicine.

SUBSTANCE: what is offered is applying an analysis of p53(TP53) gene status and/or expression level as a biomarker while evaluating sensitivity of an individual suffering a proliferative disease to treatment by an mTOR inhibitor combined with a cytotoxic agent or while selecting individuals sensitive to the specified combined therapy for the following treatment of the disease by this method. Thus sensitivity to treatment of the proliferative disease by the mTOR inhibitor combined with the cytotoxic agent is predicted if wild-type functionally active p53 gene is found in a sample taken from the patient.

EFFECT: higher analysis accuracy.

14 cl, 5 ex

FIELD: medicine.

SUBSTANCE: what is offered is a method of structure stabilisation of thrombin binding DNA-aptamers, and also DNA-aptamers stabilised in such a way. The presented method provides formation of an additional base-stacking system by means of heterocycles or their analogues by means of increasing a surface of an aromatic system of heterocycles or their analogues, owing to using methods of determining a tertiary structure or molecular simulation with stating the fact of contact formation of the aromatic system of heterocyclic bases or their analogues with a G-quadruplex quartet which is related to a lateral loop.

EFFECT: method allows more effective assembly of antithrombin DNA-aptamers and improved structural stability under physiological conditions.

7 cl, 7 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method involves allele-specific Nested-PCR with primers which are matched with nucleotide sequences coding amino acids in positions 70-71 of the amino acid sequence. The allele-specific primers E70f1 - 5'-AGAAGGAGATCCTGGAGGATAG - 3' and R71r1 - 5'-CCTGTCCACCTCGGCCCGCCTATC - 3' are matched with a part of BoLA-DRB3 gene located on chromosome 23 (localisation 23q21). They interact only with the nucleotide sequences coding alleles *11, *23, *28 =*7A causing genetic stability to cattle leukaemia. Then sequencing primer Zond 70/71 5'-GCCCGGCTACACCTGT - 3' is used to identify homo- or heterozygosity of an individual by the given alleles. If observing the primers interacting with alleles *11, *23, *28 =*7A, animals are considered to be leukaemia stable, while the absence of interaction with the same alleles can enable to refer to leukaemia unstable, and to neutral.

EFFECT: invention can be used for mass genetic typing of BoLA-DRB3 leukaemia tolerable animals in livestock and commodity economies for animal selection in a nuclear stock.

2 dwg, 4 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of biotechnology of veterinary medications. Vaccine against rabies virus represents allantoic fluid of chicken embryos. Fluid contains glycoprotein of rabies virus, as well as mixture if recombinant adenoviruses of birds, which carry gene of surface glycoprotein of rabies virus, one of which contains secreted form of surface glycoprotein of rabies virus, and second - membrane-bound one. Interaction of glycoproteins with animal organism is reached by peroral introduction of medication.

EFFECT: invention can be applied in veterinary.

3 dwg, 1 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: there are developed infectious clones having a nucleotide sequence identical to PRRS viruses such as VR-2332, Lelystad or others, and additionally optionally containing a deletion in the ORF1 region which codes nsp2 polypeptide.

EFFECT: applicability of the invention in veterinary science.

34 cl, 27 dwg, 6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: synthetic oligonucleotides for indentifying DNA of Torque teno virus of all known genotypes are disclosed. Primers are combined in a set for DNA identification in blood and other biomaterials of the infectious agent of the latent viral infection Torque teno virus of Circoviridae family by polymerase chain reaction.

EFFECT: invention allows reliable identification of said virus in a biological material.

FIELD: medicine.

SUBSTANCE: invention refers to synthetic oligonucleotide primers, complementary to high conservative VP60 gene region of a genome of rabbit viral hemorrhagic disease virus, to a method for identifying rabbit viral hemorrhagic disease virus and to a test system for identifying RNA of rabbit viral hemorrhagic disease virus. The offered invention can be used in veterinary virology. The method for identifying rabbit viral hemorrhagic disease virus involves sample preparation, RNA recovery from the biological material. It is followed with conducting a polymerase chain reaction with using primers 5'-caa cgt get cca gtt ttg gta cg-3', 5'-att ctg tct ggt tgg ggc gtg t-3'. Further, viral RNA is amplified. Then, the reaction is assessed by agarose gel electrophoresis, with a reaction result considered as positive if the PCR product corresponds to the size of 398 base pairs.

EFFECT: invention allows higher sensitivity of the method, as well as reduced time of diagnostic manipulations with organ and blood samples of the infected animals.

3 cl, 4 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: invention refers to synthetic oligonucleotide primers for detecting 1a and 1b virus subgenotypes of viral diarrhoea - bovine mucosal disease (VD - BMD) and to a method of applying said synthetic oligonucleotide primers for detecting 1a and 1b virus subgenotypes of viral diarrhoea - bovine mucosal disease. The method can be used in veterinary virology for subgenotype differentiation of strains and isolates of genotype 1 virus. The offered method involves a PCR with pairs of primers SEQ ID NO:1 5'-tcgacgccttaacatgaaggt-3' and SEQ ID N0:3 5'-ccatgtgccatgtacag-3' for subgenotype la, SEQ ID NO:2 5'-tcgacgctttggaggacaagc-3' and SEQ ID NO:3 5'-ccatgtgccatgtacag-3' for subgenotype lb. It is followed with detecting a DNA fragment sized 186 bp in each reaction. Further, the presence in an analysed material of 1a and lb subgenotype virus of viral diarrhoea - bovine mucosal disease is concluded.

EFFECT: invention allows express subgenotype differentiation of genotype one VD - BMD virus strains.

2 cl, 2 dwg, 2 tbl, 4 ex

FIELD: medicine; molecular biology.

SUBSTANCE: invention concerns molecular biology, genetic engineering and can be used in medicine. Quantitative express identification of the HIV-1 genome in assay is detected with the help of oligonucleotide primers, complementary to a conservative site 5'-LtR-part of the HIV-1 genome, fluorescently marked probes and the RNA-modified fragment of a conservative site of 5'LTR area of the HIV-1 genome as the internal quantitative standard. The analysis is performed in real time in "the closed test tube" format by means of the calibration curves received with the help plasmides pVarl5-HIV-LTR and pBluSK-HIV-LTR mod, containing the native and modified kdnk-fragment virus genome from conservative 5'-LTR-pocledovatelnocti accordingly. Plasmide pVar15-HTV-LTR it is received on the basis of the pVar15 plasmides. The pBluSK-HIV-LTR mod plasmides is received on the basis of pBluKSM plasmide.

EFFECT: possibility of determination of HIV-1 presence in assay irrespective of type of a virus, a combination of types and presence of related kinds.

4 cl, 10 dwg, 9 ex

FIELD: medicine diagnosis, molecular biology.

SUBSTANCE: invention relates to method for detection of DNA of human Lyme borreliosis excitant in peripheral blood, cell culture and mites. Claimed method includes DNA isolation from biological material; synthesis of primers; PCR with using synthesized primers and evaluation of obtained data. In method BBs14.F/BBs14.R - 5'-AAGAATACATTAAGTGCGATANN-3', 5'-CAATCCACTTAATTTTGTGTTAT-3' primers to gene site encoding 16S rRNA are used. Kit for this method also in disclosed.

EFFECT: high-specific, sensitive and simplified method.

2 cl, 2 dwg, 5 tbl

FIELD: veterinary virology.

SUBSTANCE: invention relates to 5 strains of II type porcine circovirus (PCV II) which represents causative agent of porcine post-wealing multy-systemic wasting syndrome (PMWS). Disclosed are various immunogenic compositions and vaccine based on said strains for PMWS prophylaxis and/or treatment. Also disclosed are vectors, viral preparations, cell extracts, cell culture supernatants, containing PCV II or nucleotide or protein components thereof; method for PCV II diagnosis, as well as diagnostic composition and kit.

EFFECT: new agent for treatment of porcine PMWS.

178 cl, 7 dwg, 5 tbl, 19 ex

FIELD: virology, biotechnology, molecular biology.

SUBSTANCE: invention proposes oligonucleotides, primers and probes based on thereof designated for a detection method and/or quantitative determination of nucleic acids of adenoviruses in biological sample. Method involves amplification by polymerase chain reaction (PCR) in real time by using the proposed primers HEX1 and HEX2 wherein product is detected by using probe HEX. Also, invention proposes a set of reagents for realization of such method and methods for diagnosis and detection based on thereof. Proposed inventions provide carrying out detection of different serotypes of adenoviruses for a single reaction and quantitative determination of their small amounts.

EFFECT: improved methods for detection, diagnosis and selection.

7 tbl, 1 dwg, 8 ex

FIELD: microbiology, pharmacology.

SUBSTANCE: invention relates to field of microbiology ad pharmacology. Claimed is novel recombinant version of polypeptide PapM. Polypeptide possesses activity of SAM-dependent N-metyhyltransferase and is able to catalyse reaction of methylating 4-amino-L-phenylalanine to 4-methylamino-L-phenylalanine with formation of majoritarian isoform PIB streptogramin B. Polypeptide is obtained by at least one substitution of glycine in position 249 with serine and/or substitution of threonine in position 192 with isoleucine in sequence of polypeptide ParM of wild type S. Pristinaespiralis. Also claimed are nucleic acid encoding it, vector, containing said nucleic acid, host cell, method of obtaining polypeptide, strains, producing it.

EFFECT: invention can be used in medicine.

37cl, 13 dwg, 9 tbl, 9 ex

Up!