Test system for quantitative deterination of streptococcus agalactiae in biological material

FIELD: medicine.

SUBSTANCE: offered test system for quantitative determination of Streptococcus agalactiae includes species-specific primers having nucleotide sequences 5'-CAGTTGAATCCAAATGTTACGG-3' and 5'-TAATGCTGTTTGAAGTGCTG-3', and a probe having a nucleotide sequence 5'-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3'. A DNA target for specific amplification is a gene cfb Streptococcus agalactiae fragment between 685 and 762 nucleotide residues of its complete sequence.

EFFECT: invention allows quick and high-specific detection of Streptococcus agalactiae in samples of a biological material and determination of the definition of its quantitative content.

2 dwg, 2 tbl, 1 ex

 

The invention relates to biotechnology, in particular for laboratory diagnosis of diseases caused by pathogenic microorganisms, can be used for detection and quantification of Streptococcus agalactiae in biological material.

Streptococcus agalactiae belong to β-hemolytic streptococci and included in the serological group, often colonise the intestine and urogenital tract healthy adults of both sexes. In particular, the frequency of detection of Streptococcus agalactiae in the vaginal tract of healthy women varies from 10% to 36%, while the number of bacteria may reach values of 104-105CFU/ml of vaginal discharge (Trijbels-Smeulders M.A., Kollee LA, Adriaanse A.H., Kimpen J.L., Expresses L.J. Neonatal group streptococcal infection: incidence and strategies for prevention in Europe. Pediatr. Infect. Dis. J. 2004; 23:172-173; Schuchat A. Epidemiology of group streptococcal disease in the United States: shifting paradigms. Clin. Environ. Rev. 1998; 11:497-513).

In most cases, colonization by these organisms do not cause disease in healthy adults, however, Streptococcus agalactiae is a major cause of sepsis, meningitis and pneumonia in infants, often leading to fatal or disabling post-infectious complications. Neonatal infections occurring in the first 3 days of life, in 40% of cases due to Streptococcus agalactiae. The baby can be infected during the race is in when passing through the birth canal of the mother, asymptomatically colonized by Streptococcus agalactiae (W.J.G. Melchers, Bakkers J.M.J.E., Toonen, M., van Kuppeveld, F.J.M., Trijbels M., Hoogkamp-Korstanje J.A.A. Genetic analysis of Streptococcus agalactiae strains isolated from neonates and their mothers. FEMS Immunol. Med. Environ. 2003; 36:111-113).

In the case of premature rupture of fetal membranes, the risk of contamination of the fetus and the development of infectious diseases increases. Infection in newborn streptococcal this species may also occur after birth by hospital strains of bacteria, the sources of which can be the subject of the environment, including medical equipment. In addition, the source of Streptococcus agalactiae can be and obstetric staff of the institution.

The successful solution of problems of perinatal infections, caused by bacteria of the species Streptococcus agalactiae, as in their prevention and pathogenetically justified and timely treatment depends on the effective use of diagnostic technologies.

Currently, the primary method intended for the detection and quantitative determination of Streptococcus agalactiae, remains bacteriological examination, including seeding serial dilution of the studied material on nutrient medium to obtain pure cultures of bacteria and establishment of their species by studying their morphological, cultural and physiological-biochemical properties using the and a number of differential diagnostic of nutrient media (Ruoff K.L. and co-authors, Streptococcus In: P.R. Murray (eds) Manual of Clinical Microbiology, 2003, str).

In addition, for species identification extracted from the analyzed material pure cultures of bacteria, suspicious belonging to the species Streptococcus agalactiae, instead of the differential diagnostic of nutrient media can be used test systems based on the use of serological reactions, for example, the reaction of agglutination of latex particles, loaded specific to antigens of Streptococcus agalactiae antibodies (Ruoff K.L. and co-authors, Streptococcus In: P.R. Murray (eds) Manual of Clinical Microbiology, 2003, str).

Despite the effectiveness of this approach, the main drawback of traditional bacteriological method is its complexity and duration of the research component depending on the investigated material from 36 hours, for example for samples of saliva, urine, feces, vaginal discharge, and up to 5 days in cases where the examination of blood samples and cerebrospinal fluid.

However, given the speed of development of infectious process in the newborn child, you can understand the importance of the use in the neonatal clinic methods for rapid detection of the pathogen. Therefore, a rapid, sensitive and highly specific test that can detect Streptococcus agalactiae direct what about in clinical samples and to establish their quantitative content, would simplify and make more effective the implementation of programmes for the prevention of infection in newborns from mothers carriers of these organisms, and the timely detection of these bacteria in a clinical specimen obtained from newborn infants.

Currently, the most promising are molecular methods based on DNA detection of pathogens in the material studied, in particular methods based on PCR technology. These methods have high sensitivity and specificity and can detect the presence of a very small number of copies of the genetic sequences of microorganisms in amounts of the investigated material and in a short time. In addition, modern modification of the polymerase chain reaction, carried out in real time, also allow you to determine the quantitative values for microorganisms.

A known technology for the detection of Streptococcus agalactiae in the PCR reactions occurring in real time, by using two oligonucleotide primers, amplificating region of the gene cfb between 59 and 212 base pairs its nucleotide sequence with simultaneous detection of the products (amplicon) by the specific hybridization with them two oligonucleotide probes, labeled with fluo what forami. The principle of the method lies in the resonance excitation energy transfer of electrons from one fluorophore located at the 3' end of one probe to the second fluorophore located at the 5' end of the second probe, which occurs when both probes simultaneously hybridize with one amplicon and the distance between the fluorophores is 1 nucleotide. Simultaneous binding of both probes with DNA matrix energy excitation of the first fluorophore is transferred to the second fluorophore, and the radiation detected by the instrument (M.G. Bergeron, D. Ke, Ménard C., Picard F.J., Gagnon M., Bernier M., Ouellette M., Roy, P.H., Marcoux, S., Fraser W.D. (2000) Rapid detection of group streptococci in pregnant women at delivery. N Engl J Med 343, 175-179).

Currently there is only one commercialized diagnostic test system (Smart GBS, Cepheid) for the detection of Streptococcus agalactiae in a biological material, based on the above approach, developed by a group Bergeron M.G and co-authors.

However, the described test system recommended by the manufacturer only for detection of the pathogen in rectal and vaginal smears and is not intended for the detection of Streptococcus agalactiae in other types of biological material (saliva, bronchoalveolar lavage and gastric aspirate, urine and blood).

In addition, the high cost of the test system and the inability to perform PCR on the devices ro the Russian production limit its application in the national laboratories.

Conducted a search of the patent and scientific and technical information sources showed the absence of information about the test-systems for detection of Streptococcus agalactiae by PCR with hybridization-fluorescence based outcomes for the quantification of the pathogen in a biological material, and is also available in the laboratories of Russia. Thus, there is a need to develop inexpensive, sensitive and specific set, which would have found wide application in medical practice.

The present invention is the creation of a test system for the quantitative determination of Streptococcus agalactiae in the samples of biological material, with the possibility of its use in PCR, real-time hybridization-fluorescence in light of the results.

The technical result consists in increasing the efficiency of detection of Streptococcus agalactiae in samples of different types of biological material that is expressed in the possibility not only to determine the presence of bacteria in the studied material, but also with high accuracy to install and quantity. In addition, the process of detection of the PCR product using the proposed test system runs without opening the tubes, which eliminates the dispersion of amplification products in the environment, which is fundamental the m source of false-positive PCR results.

The technical result is achieved by the use of a test system for the quantitative determination of Streptococcus agalactiae. The inventive test system for the detection and quantitative determination of Streptococcus agalactiae in the samples of biological material by polymerase chain reaction in real time includes a set of synthetic oligonucleotide primers having nucleotide sequence 5'-CAGTTGAATCCAAATGTTACGG-3' and 5'-TAATGCTGTTTGAAGTGCTG-3', and probe having the nucleotide sequence 5'-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3'.

A brief description of graphic materials

Figure 1. Alignment of the nucleotide sequences amplificare offer primers regions of genes cfb four strains of bacteria of the species Streptococcus agalactiae (str1 - A, str2 - 260 V/R, str3 - NEM316; str4 No. 4). The top shows the consensus sequence between the compared regions of genes cfb. The position of hybridization of the primers and probe between specified limits. The amplification product corresponds to the segment of the nucleotide sequence of the genome of Streptococcus agalactiae length 78 BP

Figure 2. Determining the reliability of quantitative detection of DNA of Streptococcus agalactiae and efficiency flow PCR reactions performed using the developed test system in a series of reactions using as matrix serial tenfold dilutions (from 10 to 106times) GE is UMNO DNA isolated from 1 ml of culture Streptococcus agalactiae N4.

Table 1. The results of the study of the specificity of the test system for the detection of Streptococcus agalactiae.

Table 2. The results of the study simulated clinical samples bacteriological method and by PCR in real time using the proposed test system.

As the DNA target for the development of a diagnostic test system for the detection of Streptococcus agalactiae was elected a fragment of the gene jacket.

Gene cfb is responsible for the formation of camp factor, which is the extracellular protein of Streptococcus agalactiae, the biological activity of which is in education, together with β-hemolysin of Staphylococcus aureus extended zone of hemolysis on blood agar. Almost all isolates of bacteria belonging to the species Streptococcus agalactiae, produce camp factor. Gene cfb Streptococcus agalactiae is unique for this type of a nucleotide sequence not found in evolutionary related species and genera of microorganisms and has no close homologues in the genomes of bacteria of other genera (Hassan AA, Abdulmawjood A, Yildirim AO, Fink K, Lämmler C, Schlenstedt R. Identification of streptococci isolated from various sources by determination of cfb gene and other CAMP-factor genes. Can J Environ 2000; 46(10):946-951).

The nucleotide sequence of the gene cfb Streptococcus agalactiae were obtained from the database of GenBank NCBI, as well as in the sequencing of a similar plot from strains isolated who's on the territory of the Russian Federation. In the resulting alignment of the nucleotide sequences of the gene cfb reference strains of Streptococcus agalactiae A909, GDzl, NEM316, R268 and 260V/R (GenBank NCBI: CP000114.1, GU217532.1, AL766855.1, X72754.1, AE009948.1) and strains of Streptococcus agalactiae, isolated on the territory of the Russian Federation, we have been withdrawn its consensus sequence SEQ ID NO 1:

5'-ATGAACGTTAMACATATGATGTATCTATCTGGAACTCTAGTGGCTGGTG

CATTGTTATTTTCACCAGCTGTATTAGAAGTACATGCTGATCAAGTGAC

AACTCCACAAGTGGTAAATCATGTAAAYAGTAATAATCAAGCCCAGCA

AATGGCTCAAAAGCTTGATCAAGATAGCATTCAGTTGAGAAATATCAA

AGATAATGTTCAGGGAACAGATTATGAAAAAMCGGTTAATGAGGCTAT

TACTAGYGTKGAAAAATTAAAGACTTCATTGCGTGCCAACCCTGAGAC

AGTTTATGATTTGAATTCTATTGGTAGTCGTGTAGAAGCCTTAACAGAT

GTGATTGAAGCAATCACTTTTTCAACTCAACATTTARCAAATAAGGTTA

GTCAAGCAAATATTGATATGGGATTTGGGATAACTAAGCTRGTTATTCG

CATTTTAGATCCATTTGCTTCAGTTGATTCAATTAAAGCTCAAGTTAAC

GATGTAAAGGCATTAGAACAAAARGTTTTAACTTATCCTGATTTAAAAC

CAACTGATAGAGCTACMATCTATACAAAATCAAAACTTGATAAGGAAA

TCTGGAATACACGCTTTACTAGAGRTAAAAAAGTACTTAACGTCAAAG

AATTTAAAGTTTACAATACTTTAAATAAAGCAATCACACATGCTGTTGG

AGTTCAGTTGAATCCAAATGTTACGGTACAACAAGTTGATCAAGAGAT

TGTAACATTACAAGCAGCACTTCAAACAGCATTA AAATAA-3'

The next step is the result of a careful study of the obtained consensus sequences cfb gene we have identified an extensive area of 100%identity of nucleotide sequences among all the compared strains (685 on 762 nucleotide), which was chosen as a target for annealing of the primers and probe and having the sequence SEQ ID NO 2:

5'-CAGTTGAATCCAAATGTTACGGTACAACAAGTTGATCAAGAGA TTGTAACATTACAAGCAGCACTTCAAACAGCATTA-3'

Nucleotide sequences of primers for amplification of the sequence SEQ ID NO 2 and probe for de is ecchi amplicons were generated using PerlPrimer (Owen Marshall). The specificity of the primers and probe were estimated by the method of multiple comparisons of sequences using software, such as NCBI BlastN.

Specific to the cfb gene primers and probe have the following composition: forward primer - 5'-CAGTTGAATCCAAATGTTACGG-3'; reverse primer - 5'-TAATGCTGTTTGAAGTGCTG-3'; probe 5'-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3'. Localization of the regions of hybridization of the primers and probe sequences SEQ ID NO 2 is shown in figure 1.

The oligonucleotide primers and probe were synthesized method was used, for example, on an automatic DNA synthesizer/RNA ASM-2000 (000 BISSET, Russia) and purified using preparative electrophoresis in SDS page.

To use the probe in Poland in the real-time hybridization-fluorescence based on the results in the synthesis phase, the probe was anywhereman with a fluorescent dye R6G at the 5'end of the oligonucleotide chain, and tusitala fluorescence RTQ1 internal thymine residue. In addition, the 3'-terminal hydroxyl group of the probe was blocked ester bond with a phosphoric acid residue. Thus, in a further probe was used following structure: 5'-R6G-CAACAAGTTGAT(RTQ 1)CAAGAGATTGTAACATTACAAGCA-P-3'.

Optimal parameters of the amplification reaction with the oligonucleotide primers and probe. In particular, the reaction mixture has the following composition:15 to 25 mm Tris-Hcl buffer, pH 8.4; 50 mm KCl; 2.5 mm MgCl2; 0,2 mm deoxynucleotides; 0.2 mm forward and reverse primer; 0.2 mm labeled with fluorophore and the quencher probe; 0.04 U/μl Taq polymerase.

PCR can be carried out, for example, in the device of the ANC-32 (Synthol, Russia) using the following program: initial denaturation - 95°C, 5 min; 42 cycle - 1) 94°C, 15 s; 2) 60°C 60 chloresterol in test tubes detects in real-time on the channel R6G. The threshold cycles are determined automatically by the device.

Evaluation of the specificity of PCR in real time was performed using genomic DNA isolated from pure cultures of 32 strains of bacteria isolated from clinical material (PL. 1). It is established that designed the primers and probe for detection of Streptococcus agalactiae have 100% specificity. The increase of fluorescence signal on the channel R6G was observed only in the case of using as a template DNA of Streptococcus agalactiae. When introduced in response to DNA of other species of microorganisms increase of the fluorescent signal during PCR was not observed.

To determine the reliability of the quantitative detection of DNA, the efficiency of the flow of the PCR reactions and the analytical sensitivity of the test system was exposed to a series of reactions using as matrix serial tenfold dilutions (from 10 to 10 times) preparations of genomic DNA isolated from 1 ml of culture Streptococcus agalactiae N4, were in exponential growth phase at a concentration of 3.0×109CFU/ml

The reliability of quantitative detection was determined by constructing a calibration curve and determine the correlation coefficients. The amplification efficiency was calculated based on the slope of the calibration straight line is constructed through the experimental points in semi-logarithmic coordinate system. When analyzing the reliability of quantitative detection of DNA was identified high amplification efficiency (E=2) and strong correlation between the concentration value of the calibration DNA samples and determine the threshold cycle (R2=1) (Figure 2). The analytical sensitivity of the resulting test system was not lower than 300 genomics.

To confirm the possibility of implementing the stated purpose and achievement of the technical result here is the following data.

Example 1

Evaluation of the diagnostic characteristics of the developed test system model simulated clinical samples

For testing the proposed test system used drugs total DNA extracted from simulated clinical samples of biological fluids, including saliva, urine and whole blood with the addition of preservative e is THE taken from healthy adult volunteers (Table. 2).

All 15 samples were prepared in 4 of them, in particular in a sample of saliva, urine, and two samples of whole blood was added to a pure culture of Streptococcus agalactiae, and in the saliva sample was also added pure culture of K. pneumoniae. In the following 6 samples of biological material were added to other bacteria, in particular K. pneumoniae, K. oxytoca, or E. coli. Finally, in the remaining 5 samples of biological material bacteria were not added (Table. 2).

DNA samples from clinical materials emit in the following manner: to 100 μl of a clinical sample, add 100 ál of buffer for DNA extraction (20 mM Tris-HCl (pH 8.0), 2 mm EDTA, 10 mg/ml lysozyme) and stirred on the vortex 10 C. the resulting suspension is incubated for 20 min at 37°C. Then, to the suspension is added 20 μl of a solution of proteinase K (20 mg/ml) and continue incubation at a temperature of 55°C for 20 minutes Then the suspension are lysed by adding 600 ál lyse buffer (6M guanidine isothiocyanate, 40 g/l Triton X-100 and 10 g/l DTT), followed by incubation of 5 min at 55°C. the Lysates contribute to microcolony for sorption of DNA, for example, Zymo-SpinTMIC (Zymo Research, USA) and produce them centrifugation for 30 s at 10,000 g. The eluate was removed and the speakers make a 500 ál of wash buffer (50 mm NaCl, 10 mm Tris-HCl pH 7.5, 2.5 mm EDTA 50% ethanol and again centrifuged for 30 s at 10000 g. Mark the internals repeat one more time. After carefully remove residual wash buffer spend the elution of DNA from the sorbent by adding 50 μl of an eluting buffer (10 mm Tris-HCl pH 8.0, 1 mm EDTA), followed by centrifugation as described above. The eluate containing the purified DNA used in PCR based, for example, 10 ál 25 ál reaction mixture.

As DNA positive control, and calibrating sample for the quantitative determination of DNA content of Streptococcus agalactiae in the samples using the recombinant plasmid DNA containing the cloned fragment of the target genes for PCR with nucleotide sequence SEQ ID NO:2. This plasmid is used to generate a series of solutions calibrating DNA corresponding to the concentration of 3×107; 3×106; 3×105; 3×104 and 3×103 copies/ml of the target gene cfb. The negative control is prepared by introducing into the reaction mixture, for example, 10 μl of TE buffer.

Diagnostic characteristics of the developed test systems studied in comparison with classical bacteriological method, which consisted of isolation of pure culture of Streptococcus agalactiae from each sample of the material using nutrient media and subsequent morphological and biochemical identification of the selected crops.

In the study blind simulated data samples for the qualitative and quantitative presence is the influence of Streptococcus agalactiae, the obtained PCR-RV using the developed test systems, is fully consistent with the results of bacteriological tests (Table 2).

Thus, the sensitivity of the proposed test system and its specificity in comparison with bacteriological method was 100% and 100%, respectively.

The described invention is not limited to those specified in table objects, which are intended only for illustration. All types of samples of biological material are within the scope of the present invention.

Thus, the task of creating a diagnostic test system for the quantitative determination of Streptococcus agalactiae in samples of biological material by polymerase chain reaction in real-time hybridization-fluorescence in light of the results has been resolved. Component test system the set of selected primers and the probe does not give cross-reactions with other kinds of microorganisms that allow you to quickly and reliably determine the presence or absence of DNA of Streptococcus agalactiae and the number of copies of it, thereby making it possible to establish the quantitative content of the pathogen per unit volume of the material under investigation.

Table 1
№ p/pThe name of the strainThe result fluorescent detection amplificare region cfb gene by PCR in real time ("+" - increase in fluorescence signal, "-" - absence of fluorescence signal)
1Streptococcus agalactiae N4+
2Streptococcus agalactiae F12+
3Streptococcus anginosus K3-
4Klebsiella oxytoca EL1-
5Klebsiella pneumoniae EK1-
6Acinetobacter sp.3-
7Acinetobacter sp.4-
8Proteus sp.XI-
9Proteus sp.AV1-
10Proteus sp.AV2-
11Klebsiella sp.XI -
12Klebsiella pneumoniae BA1-
13Klebsiella oxytoca BA2-
14Streptococcus sp.A4-
15Streptococcus sp.A9-
16Citrobacter sp.#11-
17Escherichia coli BA1-
18Lactococcus sp.EK1-
19Enterococcus sp.EK6-
20Enterococcus sp.EK2-
21Enterococcus sp.EK3-
22Escherichia coli BA1NT-
23Escherichia coli BA2-
24Escherichia coli BA3-
25 Escherichia coli BA4-
26Escherichia coli BA5-
27Escherichia coli BA6-
28Escherichia coli BA7-
29Escherichia coli BA8-
30Escherichia coli BA9-
31Escherichia coli BA10-
32Escherichia coli BA11-
33Escherichia coli BA 12-
34Escherichia coli BA 13-
35Escherichia coli BA 14-
36Escherichia coli BA 15-
37Escherichia coli BA 16-
38Staphylococcus sp.AV1-
39Staphylococcus aureus BA1-
40Staphylococcus aureus BA2-
41Pseudomonas aeruginosa 1-
42Pseudomonas aeruginosa 2-
43Pseudomonas aeruginosa 3-
44Pseudomonas aeruginosa 4-
45Pseudomonas sp AV2.-

Table 2
№ p/pCharacteristics of the surveyed sampleThe number of colony forming units of S. agalactiae in 1 ml samples of simulated clinical samples defined by a bacteriological methodThe number of copies of the genomes of S. agalactiae in 1 ml samples of biological material determined using the developed test system
1The saliva of healthy volunteers with time to relax is by E. coliNot foundNot found
2The saliva of healthy volunteers with the addition of S. agalactiae and K. pneumoniae1,0×105CFU/mlof 3.2×106copies
3The saliva of healthy volunteers with the addition of E. coliNot foundNot found
4The saliva of healthy volunteers with the addition of K. oxytocaNot foundNot found
5The saliva of healthy volunteers without adding bacteriaNot foundNot found
6The saliva of healthy volunteers without adding bacteriaNot foundNot found
7Urine of healthy volunteers with the addition of E. coliNot foundNot found
8Urine of the healthy kind is volca with the addition of E. coliNot foundNot found
9Urine of healthy volunteers with the addition of K. oxytocaNot foundNot found
10Urine of healthy volunteers without adding bacteriaNot foundNot found
11Urine of healthy volunteers without adding bacteriaNot foundNot found
12Urine of healthy volunteers with the addition of S. agalactiae3,0×105CFU/mlof 3.2×105copies
13Whole blood of a healthy volunteer with the addition of S. agalactiae1,0×103CFU/mlof 2.0×103copies
14Whole blood of a healthy volunteer with the addition of S. agalactiae1,0×105CFU/ml3,0×105copies
15Not foundNot found

The test system is intended for the quantitative determination of Streptococcus agalactiae in biological material by polymerase chain reaction in real time, including a primer having the nucleotide sequence 5'-CAGTTGAATCCAAATGTTACGG-3', primer having the nucleotide sequence 5'-TAATGCTGTTTGAAGTGCTG-3', and probe having the nucleotide sequence 5'-CAACAAGTTGATCAAGAGATTGTAACATTACAAGCA-3'.



 

Same patents:

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method includes separation by centrifugation of heparinised mononuclear cells of umbilical blood (further UB) in gradient of density on Ficoll-Paque™PLUS. After that realised are thorough washing in PBS+0.1 % BSA medium and denaturation at temperature 82°C of suspension, consisting of UB cells and control cell culture 1301, supported in RPMI medium with addition of 10% bull serum of glutamine and penicillin with streptomycin. After that, analysed and control cells are distributed in two pairs of test tubes, adding to them up to 0.5 ml PBS 0.1% BSA solution, centrifuging with acceleration 500 g for 5 minutes. Then in two rest tubes with cells poured is hybridisation buffer, and into the second pair - poured is hybridisation buffer with peptide-nuclein probe. After that, they are incubated in darkness for 2-20 hours, washed, mixed, centrifuged, stained in solution of propidium-iodide and RNK A. After that, analysis of cell samples is carried out with determination of their relative length telomeres depending on length of telomeres of cell culture 1301, taking into account DNA index.

EFFECT: invention makes it possible to increase quality of determination of properties of transplant, samples of hemopoetic stem cells of umbilical blood for transplantation.

1 ex

FIELD: medicine.

SUBSTANCE: method of predicting development of arterial hypertension in pregnant women consists of realisation of DNA separation from peripheral venous blood, carrying out polymerase chain reaction, finding out data about presence of polymorphism of α-adducin 1 gene. If carrying genotype 460WW of gene of α-adducin 1 ADD1 G460W is detected, conclusion about risk of hypertension development in pregnant women is made.

EFFECT: increased efficiency of predicting arterial hypertension development in pregnant women.

1 ex, 1 tbl, 2 dwg

FIELD: medicine.

SUBSTANCE: invention represents primer sets for carrying out LIMP or PCR used for Saccharomyces pastorianus detection. Also, there are presented sets for Saccharomyces pastorianus detection containing a primer set according to the invention in a combination with a primer set for carrying out LAMP used for Saccharomyces bayanus detection, and also in a combination with a primer set for carrying out LAMP used for Saccharomyces cerevisiae and Saccharomyces pastorianus detection. There are presented methods for Saccharomyces pastorianus detection.

EFFECT: invention provides precise, quick and easy identification of Saccharomyces pastorianus yeast by means of PCR or LIMP.

19 cl, 4 dwg, 5 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: what is presented is a method for Apo2L/TRAIL sensitivity prediction of a malignant tissue or cell sampled from a mammal, involving the stages as follows: sampling a malignant tissue or cell from a mammal; analysing the sample malignant tissue or cell for detecting expression of one or more biomarkers selected from a group of fucosyl transferase 3, fucosyl transferase 6, sialyl-Lewis A and/or X antigen (antigens) where expression of one or more specified biomarkers is an indicator of the fact that the specified sampled tissue or cell is sensitive to apoptosis-inducing activity Apo2L/TRAIL. Also, what is described is a method of apoptosis induction in the sampled malignant tissue or cell of a mammal. What is offered is a method of treating a malignant tumour in a mammal. The inventions enables using the detection of expression of one or more biomarkers as the indicator of the fact that a sample is sensitive to apoptosis-inducing agents, such as Apo2L/TRAIL and DR5 agonist antibodies. Specific biomarkers to be examined include fucosyl transferases, particularly fucosyl transferase 3 (FUT3) and/or fucosyl transferase 6 (FUT6), as well as sialyl-Lewis A and/or X antigens.

EFFECT: method improvement.

35 cl, 22 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: cell suspension under investigation is incubated with biochip, containing immobilised on biochip antibodies, which have specificity to superficial antigens of investigated cells. After incubation, biochip is washed from non-specifically bound cells. Cells, which remain bound with biochip, are subjected to processing with labelled polynucleotide probes of one or several types with further hybridisation. Reading and processing of results are performed by presence of cell binding in area of biochip sites, containing immobilised antibodies, presence in them of determined superficial antigens is detected, and presence and character of binding of labelled polynucleotide probes are used to determine genetic signs in the same cells.

EFFECT: method application makes it possible to increase quantity of simultaneously determined superficial antigens on different cells with application of non-conjugated with label antibodies, simultaneously reducing number of used antibodies.

9 cl, 2 dwg, 2 ex

Biomarkers // 2429297

FIELD: medicine.

SUBSTANCE: what is offered is applying an analysis of p53(TP53) gene status and/or expression level as a biomarker while evaluating sensitivity of an individual suffering a proliferative disease to treatment by an mTOR inhibitor combined with a cytotoxic agent or while selecting individuals sensitive to the specified combined therapy for the following treatment of the disease by this method. Thus sensitivity to treatment of the proliferative disease by the mTOR inhibitor combined with the cytotoxic agent is predicted if wild-type functionally active p53 gene is found in a sample taken from the patient.

EFFECT: higher analysis accuracy.

14 cl, 5 ex

FIELD: medicine.

SUBSTANCE: what is offered is a method of structure stabilisation of thrombin binding DNA-aptamers, and also DNA-aptamers stabilised in such a way. The presented method provides formation of an additional base-stacking system by means of heterocycles or their analogues by means of increasing a surface of an aromatic system of heterocycles or their analogues, owing to using methods of determining a tertiary structure or molecular simulation with stating the fact of contact formation of the aromatic system of heterocyclic bases or their analogues with a G-quadruplex quartet which is related to a lateral loop.

EFFECT: method allows more effective assembly of antithrombin DNA-aptamers and improved structural stability under physiological conditions.

7 cl, 7 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method involves allele-specific Nested-PCR with primers which are matched with nucleotide sequences coding amino acids in positions 70-71 of the amino acid sequence. The allele-specific primers E70f1 - 5'-AGAAGGAGATCCTGGAGGATAG - 3' and R71r1 - 5'-CCTGTCCACCTCGGCCCGCCTATC - 3' are matched with a part of BoLA-DRB3 gene located on chromosome 23 (localisation 23q21). They interact only with the nucleotide sequences coding alleles *11, *23, *28 =*7A causing genetic stability to cattle leukaemia. Then sequencing primer Zond 70/71 5'-GCCCGGCTACACCTGT - 3' is used to identify homo- or heterozygosity of an individual by the given alleles. If observing the primers interacting with alleles *11, *23, *28 =*7A, animals are considered to be leukaemia stable, while the absence of interaction with the same alleles can enable to refer to leukaemia unstable, and to neutral.

EFFECT: invention can be used for mass genetic typing of BoLA-DRB3 leukaemia tolerable animals in livestock and commodity economies for animal selection in a nuclear stock.

2 dwg, 4 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: set contains species-specific oligonucleotide primer pairs and appropriate fluorescent-marked probes for conducting one-stage instant identification of several human-pathogenic Orthopoxviruses (VARV, MPXV, CPXV and VACV) by means of real-time multiplex PCR.

EFFECT: invention is intended for instant diagnostics of human and animal Orthopoxvirus infections by real-time multiplex PCR.

10 dwg, 2 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method provides recovery of DNA of an analysed strain followed by PCR with using nucleotide primers of terC, ilvN and inv genes of the following sequences: 89-S - AATCAAATCTCGCCCAGC, 89-As -GCTGCGTATCATTTCACC; 45-S - AGTGGTCTGCTTCTCTGG, 45-As -CGGCATACACAGAATACC; inv839 - TACCTGCACTCCCACAAC, inv1007 -CCCATACGCTGATCTACC. The analysed strains are differentiated by matching the sizes of the derived fragments of terC, ilvN and inv genes with the similar fragments in typical strains of principal and nonprincipal plague agents.

EFFECT: invention allows quick, effective and reliable differentiation of the strains.

1 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention describes mutations of the amino acid sequence of the protein of atpE mycobacteria (M. tuberculosis and M. smegmatis), which determine their resistance to DARQ J. Obtained are coding mutant forms of atpE nucleic acids, vectors containing said forms and host cells expressing mutant proteins.

EFFECT: invention discloses use of said host cells in a method of identifying compounds which can be used as antimicrobial agents for mycobacteria strains resistant to existing drugs.

5 cl, 4 dwg, 7 tbl

FIELD: medicine.

SUBSTANCE: polypeptides exhibit antimicrobial activity and recovered polynucleotides coding these polypeptides. Nucleic acid constructs, vectors and host cells contain said polynucleotides.

EFFECT: applicability of polypeptides in veterinary science and medicine, as well as in forage production.

16 cl, 6 tbl, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention concerns biotechnology and health care. Recombinant adenovirus p53 is capable of lowering side effects of the type caused by anti-tumour chemotherapy and radio-therapy. In cancer patients, recombinant adenovirus p53 can restore operation of organs, including blood analysis, liver functioning, kidney functioning etc in order to improve the quality of life of patients, for example improvement of appetite, mental status and the like.

EFFECT: invention can be used in medicine.

19 cl, 7 dwg, 4 tbl, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: compounds, included into one of compositions represent polypeptides, which contain at least immunogenic fragment of protein CT858 or protein CT089 Chlamydia trachomatis with specific amino acid sequence, or polynucleotides, coding immunogenic fragments of said proteins. Compounds, included into other composition, represent fused polypeptides, which contain immunogenic fragment of protein CT858 or CT089 and fusion partner, selected from immunologic fusion partners, expression amplifiers, affine markers and unrelated known proteins of Chlamydia trachomatis. Said compositions can be used for stimulation of specific T-cell response to Chlamydia trachomatis, for inhibition of infection development and for treatment of infection induced by Chlamydia trachomatis, ensuring high level of immune response and therapeutic effect.

EFFECT: described are compositions based on compounds for prevention and treatment of Chlamydia infection.

11 cl, 16 dwg, 7 tbl, 13 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and is a lipolytic enzyme which is obtained from one Streptomyces. Such a lipolytic enzyme has an amino acid sequence reduced to SEQ ID No.4, or an amino acid sequence which is at least 70% identical to it. The invention also relates to use of a lipolytic enzyme in a method of producing lyso-glycolipid, lysophospholipid, in an oil refining method, in phospholipid processing methods, in bio-conversion of polar lipids and in production of food products.

EFFECT: invention enables to obtain a novel enzyme having glycolipid hydrolysing action.

46 cl, 17 dwg, 4 tbl, 12 ex

FIELD: agriculture.

SUBSTANCE: polypeptide homological to polypeptide expressed by Eurotinium amstelodami, has antimicrobial activity and may be used to administer as medical or prophylactic agent to a person or animal, and also in fodder for animals.

EFFECT: improved efficiency of application.

19 cl, 2 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention can be used in producing vaccines against Streptococcus agalactiae - a representative of streptococci group B (SGB) in diagnostics of the diseases - for creation of a detection system of immunoglobulin A level in biological fluids, in immunochemistry as accessible immunochemical reagents (affine recovered IgA fragments). Offered unique recombinant DNA are produced by polymerase chain reaction (PCR) with using chromosomal DNA of strain 219/4849 Ibc of serotype SGB and unique primers. One recombinant DNA contains three nucleotide substitutes in comparison with an initial site of chromosomal DNA. The following cloning of amplified fragments is carried out in a linear vector pGEM-T Easy, and at the final stage by the system of express ionic vectors pQE30/31/32 in E coli JM 109. The produced recombinant DNA code amino acid sequences of recombinant polypeptides exhibiting ability to connect selectively various molecular forms of IgA and designated as P6, P7, P8. Polypeptide P6 causes synthesis of long circulating high-affine anti-Rb antibodies possessing protective properties against SGB.

EFFECT: application of the invention provides production of recombinant polypeptides based N-terminal conservative part of surface Bac SGB of Ibc serotype and containing a first IgA-connecting site A with changed or native sequence MLKKIE, polypeptide exhibits immunologically relevant and protective properties, and they also high selectively connect IgA.

12 cl, 20 dwg, 4 tbl, 19 ex

Expressing system // 2385348

FIELD: medicine.

SUBSTANCE: invention concerns the method for making an immunogenic reagent which causes immune response on infection Bacillus anthracis, including one to several polypeptides which together represent three domains of a full-size protective antigen (PA) from B anthracis or their versions, and at least, one of specified domains contains domain 1 or domain 4 of the PA, or its version. Said polypeptides of specified immunogenic reagent, and the full-size PA are produced as a result of expression in a recombinant cell E.coli. The invention also discloses an expression vector and nucleic acid with percent of residual guanidine and cytosine more than 35%, coding immunigenic polypeptide which is said protective antigen (PA).

EFFECT: high-yield immunogenic polypeptide.

13 cl, 5 dwg, 3 tbl, 6 ex

FIELD: biotechnology, microbiology, medicine.

SUBSTANCE: invention represents group of Neisseria proteins eliciting antigen properties. Protein eliciting antigen properties comprises fragment of protein ORF 40 (amino acid sequence of ORF 40 is given in the invention claim) that involves 7 or more conservative amino acids arranging in succession. Proteins as components of proteins in the claimed group are used as a medicinal agent or for it manufacturing for treatment and prophylaxis of infection caused by Neisseria, and for manufacturing the diagnostic preparation. Invention relates also nucleic acid encoding the Neisseria protein. Nucleic acid is used as the protein. Applying the invention provides the maximal recognition and reactivity between strains of Neisseria. Invention can be used in manufacturing curative-prophylactic preparations with respect to Neisseria meningitides.

EFFECT: valuable biological and medicinal properties of antigen.

27 cl, 51 dwg, 10 ex

Up!