Oligonucleotide primers and method of detecting dna of mycobacterium paratuberculosis that is paratuberculosis agent by method of polymerase chain reaction (pcr)

FIELD: medicine.

SUBSTANCE: there are offered synthetic oligonucleotide primers having the following base composition: (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac and complementary for a genome IS900 region specific for M.paratuberculosis that is a paratuberculosis agent. There is offered a one-round method for detecting DNA of Mycobacterium paratuberculosis that is a paratuberculosis agent, assisted by oligonucleotide primers (SEQ ID NO: 5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO: 6) ggcgttgaggtcgatcgcccacgtgac by polymerase chain reaction (PCR). The method includes DNA recovery, DNA amplification on oligonucleotide primers, transfer of the amplification product on gel followed by result detection in a transilluminator; a positive reaction enables synthesising a fragment matched with size 413 bps.

EFFECT: invention enables instant diagnostics of paratuberculous infection.

3 cl, 1 tbl, 4 ex

 

The invention relates to biotechnology, namely, genetic engineering, and can be used for rapid diagnosis paratuberculosis infection, and to address the research objectives for the study of polymorphism of Mycobacterium paratuberculosis (M.paratuberculosis).

Currently paratuberculosis in Russia remains less studied than other chronic diseases. Present research interest in the mechanisms of interaction of the pathogen with the host, particularly infectious and epidemic processes, biological properties of the pathogen that is associated with exceptional difficulties of isolating and culturing M. paratuberculosis on artificial nutrient media, with the reproduction model of infection both at the laboratory and susceptible animals (Ovdienko I.E. Prevention and control measures paratuberculosis animals / Nepovedena, Achimenes, Ngeleka etc.// veterinary medicine. - 2007. No. 12, page 3-7).

Well-known standard procedures for the identification of the causative agent of paratuberculosis, which starts with a microscopic examination of the feces for the presence of acid-fast bacilli followed by inoculation of material and biochemical testing were grown on nutrient media of microorganisms for the purpose of identification of the species detected mycobacteria. The presence M.paratuberculosis diagnose the nalitch what I paratuberculosis process (S. Benazzi Paratuberculosis in sheep flocks in Morocco: a serological, microscopical and cultural survey / S.Benazzi, M. el Hamidi, and So Schliesser // Zentbl. Veterinarmed. - 1996. - V.43. - P.213-219). The disadvantage of this method is the length of the analysis due to the slow growth of mycobacteria. For obtaining cultures M.paratuberculosis from knowingly infected material is not always possible and staining of smears in addition to M.paratuberculosis revealed many different types of acid-alcohol-antifermentative microorganisms. Also known automated system WASTES MGIT (Becton Dickenson) and MV/Wast (Organon Teknika) for isolation of mycobacteria in liquid environments, enabling them to get the results, starting from the 4th day after receipt of the specimen in 81% of cases. It should be noted that the automated system WASTES MGIT (Becton Dickenson) and MV/Wast (Organon Teknika) imported and expensive (RF Patent No. 2163022 from 28.05.1999).

Known methods of diagnostics of paratuberculosis based on the use of polymerase chain reaction (PCR). The principle of the method is to increase 106-108 in time copies of a specific segment of DNA (deoxyribonucleotide acid) microorganism activated DNA polymerase in automatic mode. It is highly specific and extremely sensitive test, which fundamentally can be identified in the analyzed sample, the presence on the same single molecule DNA of the pathogen. As a marker for detection and identification of the causative agent of paratuberculosis most commonly used sequence IS900, which is present in the amount of 14-16 copies within the genome M.paratuberculosis (Mobius P. Comparison of 13 singleround and nested PCR assays targeting IS900, ISMav 2, fa57 and locus 255 for detection of Mycobacterium avium subsp.paratuberculosis / P.Mobius, H.Hotzel, A.Rassbach et al // Vet. Environ. - 2008. - V.126. - PP.324-333).

The prototype of the present invention are primers and method of detecting DNA of the pathogen paratuberculosis based on polymerase chain reaction (PCR), including DNA isolation M.paratuberculosis, synthesis of oligonucleotide primers to sequence IS900, DNA amplification in nested-PCR and identification of PCR products by electrophoresis in a 1.5% agarose gel (Bull T. J. Detection and verification of Mycobacterium avium subsp.paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals with and without Crohn''s disease / T.J.Bull, E.J.McMinn, K.Sidi-Boumedine et al // J Clin Environ. 2003 July; 41(7): 2915-2923). The method includes the detection of DNA M.paratuberculosis in the material studied by conducting a two-step PCR using the first stage of the two external primers and the matrix in the form of a segment of DNA with getting amplificate, and at the second stage - two internal primers and matrix as obtained in the first stage of amplificate with subsequent determination obtained at the second stage of amplification products using horizontal electrophoresis in 1.5% agarose g the Le. Using the outer primers for the first round of amplification: SEQ ID NO:1 and SEQ ID NO:2. The internal primers for the second round of amplification: SEQ ID NO:3 and SEQ ID NO:4.

The disadvantages of this method include the fact that he is using nested-PCR and requires the synthesis of two pairs of primers (internal and external), and accordingly the reaction in two rounds.

The objective of the invention is to enhance detection of the causative agent of paratuberculosis in the material studied using molecular-biological methods, in particular single-stage polymerase chain reaction.

The problem is solved in that the synthesized oligonucleotide primers complementary to specific M.paratuberculosis region of the genome IS900 used to detect DNA of Mycobacterium paratuberculosis is the causative agent of paratuberculosis, having the following nucleotide composition:

(SEQ ID NO:5) gaagggtgttcggggccgtcgcttagg

(SEQ ID NO:6) ggcgttgaggtcgatcgcccacgtgac.

The task is solved in that in the method of detecting DNA of Mycobacterium paratuberculosis is the causative agent of paratuberculosis by polymerase chain reaction (PCR), including DNA isolation, amplification of DNA M.paratuberculosis on the oligonucleotide primers, the transfer of product amplification in gel and evaluation of the reaction, according to the invention, the primers have a nucleotide sequence (SEQ ID NO:5) and (SEQ ID NO:), in case of a positive reaction is synthesized fragment corresponding to the size of 413 BP

The problem is solved also by the fact that PCR is carried out in 1 round.

The invention is illustrated by the following examples:

Example 1. Obtaining oligonucleotide primers. Obtaining primers carried out on the basis of known sequences of strains M.paratuberculosis submitted to GenBank (http://www.ncbi.nim.nih.gov/ Genbank/GenbankOverview.html with the help of the software "Lasergen". The obtained sequence of several pairs of primers tested for specificity using simulation PCR program Vector NTI Suit.

In the selected oligonucleotide primers (SEQ ID NO:5) and (SEQ ID NO:6), specific to M.paratuberculosis.

Chemical synthesis of primers is our order in LLC "Laboratory of Medigen, is determined by the concentration of oligonucleotides in the mother solution.

Example 2. DNA isolation and PCR staging. DNA M.paratuberculosis allocate using a set of DNA-Sorb-B (CNII) according to the attached instructions. The working conditions of amplification for a given pair of primers is carried out with the use of the Museum strains of M. paratuberculosis, which includes: the development time of denaturation at 94°C - 30 sec - 1 min, the annealing temperature of the primers at 58°C, 59°C, 60°C, 61°C, the concentration of ions of Mg2+- from 0.8 to 2.5 mM, the cycle times of each of the stages of amplification from 30 sec to 1 min and the number of cycles for each stage from 20 to 35. The criterion of correctness of the selected mode for each step of the reaction is the visibility of the result of the presence or absence of the desired DNA fragment of a particular size on electrophoregram.

For PCR used ready PCR mix GenPack Universal PCR), as well as prepare the incubation mixture a final volume of 50 μl, containing 10 mm Mg-buffer, 10 mm dNTP, 2 μl primers, 5 µl of DNA template, 1 item. DNA polymerase, the remaining volume of water. On top of the mixture layer 25 ál of mineral oil. As a matrix using DNA standardized strain M.paratuberculosis (Central-truly), isolated from feces of infected animals and from the Museum of culture. To identify DNA M.paratuberculosis using primers (SEQ ID NO: 5) and (SEQ ID NO: 6), homologous to the plot IS900-specific M.paratuberculosis. The next mode amplification: denaturation at 94°C for 1 min, then 30 cycles, each of which consisted of denaturation at 93°C for 30 seconds, annealing at 58°C for 1 minute, synthesis at 72°C for 30 seconds, and 1 cycle at 72°C for 7 minutes. The PCR products analyzed in 2% agarose gel with drawing in wells 6 μl of amplificate. Electrophoresis is carried out for 30 minutes at a voltage of 300 C.

Example 3. The definition of products diagnostic PCR.

The PCR products analyzed by electrophoresis in 2% agarose gel in standard Tris-borate Il the Tris-acetate buffer (pH 8.0).

5 μl of amplificata mixed with 1 μl of the buffer for the application of samples on the gel, and in the case of set GenPack Universal PCR 6 μl of amplificata make the hole in the agarose gel. Electrophoresis is carried out at a voltage of 10 V/cm the length of the gel as long as the dye will not work from the start at least half of the gel (not less than 30 minutes). The results of elecrophoresis consider viewing the gel under ultraviolet light with a wavelength of 254 nm on the device Transilluminator. Use markers molecular weight pBluescript/Msp I and pUC19/KzoI. The result of the PCR is considered positive if the PCR product corresponds to the size of 413 BP in negative control (reaction mixture containing no DNA matrix) amplification products are missing.

Thus, this method allows to detect DNA M.paratuberculosis in the studied material.

Example 4. Determination of the specificity of PCR. The test results on the specificity of PCR for detection of DNA M.paratuberculosis. In order to avoid false positive results, due to the possible presence in the samples of pathogens and other infections was analyzed complementarity of the primers to the genomic sequences of the following microorganisms: Citrobacter frendii, Escherichia coli, Staphylococcus albus. In addition, it was found the possibility of nonspecific binding of primers with portions of the gene following types mycobacteria is: M.avium str. 104, M. intracellulare, M. tuberculosis NKU, M. bovis str. 14 (Subnavi), M. smegmatis (VGNKI), M. fortuitum (VGNKI), M. terrae (field isolate).

Table
The test results on the specificity of Poland for the detection of DNA M.paratuberculosis.
The microorganismThe results of Poland
Standardized strain M.paratuberculosis (Central lyubinskiy)+
M.avium str. 104-
M.intracellulare-
M.tuberculosis H37Rv-
M. bovis str. 14 (Subnavi)-
M.smegmatis (VGNKI)-
M.fbrtuitum (VGNKI)-
M.terrae (field isolate)-
Escherichia coli-
Staphylococcus albus-
Citrobacter frendii-
Note: "+" - positive result, "-" - negative result

Thus, oligonucleotide primers, allowing to detect the DNA of the pathogen paratuberculosis, do not give cross-reactions with related species permit, limited to single-stage procedure for the reaction, quickly and reliably determine the presence of DNA M.paratuberculosis - pathogen paratuberculosis, and the method of detecting DNA M.paratuberculosis highly sensitive and simple in execution.

The use of the inventive method will improve the speed and reliability of diagnostic paratuberculosis through the use of specific amplification characteristic for M.paratuberculosis plot IS900.

1. Oligonucleotide primers complementary to specific M.paratuberculosis region of the genome IS900 used to detect DNA of Mycobacterium paratuberculosis is the causative agent of paratuberculosis, having the following nucleotide composition: (SEQ ID NO:5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO:6) ggcgttgaggtcgatcgcccacgtgac.

2. The method of detecting DNA of Mycobacterium paratuberculosis is the causative agent of paratuberculosis using oligonucleotide primers by polymerase chain reaction (PCR), including DNA isolation, conducting amplification of DNA oligonucleotide primers, the transfer of product amplification in gel with subsequent detection results of the analysis on UV-transilluminator, ex is different, however, the primers have the nucleotide sequence:
(SEQ ID NO:5) gaagggtgttcggggccgtcgcttagg and (SEQ ID NO:6) ggcgttgaggtcgatcgcccacgtgac, in the case of a positive reaction is synthesized fragment corresponding to the size of 413 BP

3. The method according to claim 2, characterized in that the PCR is carried out in 1 round.



 

Same patents:

FIELD: medicine.

SUBSTANCE: method provides test inoculation of a nutrient medium containing pancreatic fish flour hydolyzate, fermentative meat peptone, NaCl, Tween-80, CaCl2, sodium thiosulphate (Na2S2O3 × 5H2O), ferrous ammonium sulphate ((NH4)2SO4 × FeSO4 × 6H2O), sorbite, bromthymol blue, irgasan (DP-300), rifampicin, NaOH, agar and distilled water in the preset proportions. Pancreatic fish flour hydolyzate, peptone, NaCl, agar are dissolved with heating, sterilised at 121°C for 20 min and thereafter added in a hot medium of the other components specified above. The inoculations are incubated on the nutrient medium in aerobic conditions at temperature 37°C and/or 28°C for 24-48 h and assessed by the presence of black-centre green or dark grey colonies surrounded by a cloudy precipitate zone in the nutrient medium.

EFFECT: invention allows simplifying and providing higher specificity of Shewanella bacteria recovery and identification.

2 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains yeast water, beef hydrolyzate, sodium chloride, glucose, glycerin, sodium citrate, sodium metabisulphite and distilled water.

EFFECT: invention allows providing optimum conditions for brucellous microbe growth, replication in a transport nutrient medium at any distances.

3 ex

FIELD: medicine.

SUBSTANCE: strain of bacteria Bacillus thuringiensis BIOS-1 VKPM B-10709, possessing insectoacaricidal activity against representatives of leaf-eating and sucking pests, such as representatives of orders Lepidoptera, Coleoptera, Homoptera, Thysanoptera and Acariformes, doing harm to crops, is deposited in All-Russian collection of industrial microorganisms (VKPM), Federal State Unitary Enterprise GosNIIgenetika under number B-10709.

EFFECT: invention makes it possible to increase mortality of representatives of leaf-eating and sucking pests, doing harm to crops.

6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: there is offered a method of preparing the antibiotic Cephalosporin C. A new antibiotic producer Acremonium chrysogenum strain, RNCM No. F-4081D is used. Acremonium chrysogenum, RNCM No.F-4081D is cultivated on an enzymatic nutrient medium containing carbohydrate sources - glucose, corn starch, dextrin, nitrogen sources - a corn extract, Pharmamedia, ammonium sulphate, and also inorganic salts - potassium phosphate, potassium sulphate, chalk, copper sulphate, zinc sulphate, manganese sulphate, ferrous sulphate, and as vegetable fat - rapeseed oil and in addition a phosphatidylcholine and/or sitosterol.

EFFECT: twice increased antibiotic production level, reduced fermentation time.

1 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention can be used in producing nutrient mediums which create the optimum conditions of legionella activity. The nutrient medium contains a enzymatic hydrolyzate of a pig's lung, a enzymatic hydrolyzate of peanut, 1-substituted potassium phosphate, 2-substituted 3-aqueous potassium phosphate, activated carbon, L-cysteine hydrochloride, microbiological agar and distilled water.

EFFECT: invention allows reducing time for legionella detection.

3 ex

FIELD: medicine.

SUBSTANCE: avirulent Vibrio cholerae strain of biovar eltor of serovar Ogawa - a producer of a major protective O1 antigen of serovar Ogawa is produced in a simulation experiment of virulent natural V.cholerae M569 Ogawa strain by spontaneous loss of "СТХφ" prophage at cholera agent continuance in sterile river water. The strain is deposited in the State Collection of pathogenic bacteria "Microbe" Registration No. 262 of the Collection of Miscroorganisms. A feature of the strain is the absence of genes of a core region of "СТХφ" prophage. The strain is avirulent for suckling rabbits, agglutinated by cholera serums O1 and Ogawa in dilution exceeding a diagnostic titre.

EFFECT: use of the invention allows producing a vaccine of O1 protective antigen of serovar Ogawa providing immunity formation in cholera.

5 ex

FIELD: medicine.

SUBSTANCE: avirulent Vibrio cholerae KM 263 strain of biovar eltor of serovar Inaba - a producer of a protective O1 antigen is produced in a simulation experiment of virulent natural V.cholerae M569 Inaba strain by spontaneous loss of "СТХφ" prophage at cholera agent continuance in sterile river water. The strain is characterised by a high production level of the major protective O1 antigen of serovar Inaba.

EFFECT: invention aims at preparing chemical cholera vaccines by formation of antibacterial cholera immunity, and producing purified preparation of the O1 antigen of serovar Inaba for a diagnostic serum preparation .

5 ex

FIELD: medicine.

SUBSTANCE: blood serum is diluted with physiologic saline in the ratio 1:2, 1:5, 1:10, 1:20 and 1:50, and tracheobronchial aspirates are diluted with physiologic saline in the ratio 1:2, 1:4, 1:8, 1:16 and 1:32. A solid nutrient medium of the following composition is prepared: a nutrient microbiological dry agar 26.5 g, a nutrient yeast extract 1.22 g, lactose 10.7 g, disodium phosphate 0.48 g, anhydrous sodium sulphite 0.83 g, sodium carbonate 0.03 g, sodium hydroxide 5.0 g, distilled water 1000 ml, pH 8.0 which contains the test strain Micrococcus lysodeiktikus 2665 in the concentration 50 million microbial cells in 1 ml of the medium. Simultaneously with the material being analysed, a reference concentration 5 mcg/ml is introduced in the wells of the diameter 8 mm on each Petri dish. In 18 hours of the incubation procedure at 37°C, a diameter of test strain growth retardation zone surrounding the wells are measured. The vancomycin concentration, mcg/ml is determined by a calibration curve of growth retardation zone diameter to the reference vancomycin concentration.

EFFECT: use of the declared method allows determining the vancomycin concentration in the biological fluids and ensuring higher clinical effectiveness.

2 ex

FIELD: medicine.

SUBSTANCE: method involves cultivation of recombinant koji mycelial fungi in a fluid medium, collection of recombinant protein from the prepared product. The culture medium contains as a raw substance, at least one selected from a group consisting of barley and wheat surface of which is completely or partially coated at least in the concentration 1 to 20% (weight/volume) and as nutrients, at least one inorganic salt. Recombinant koji mycelial fungi is produced by a procedure consisting in the fact that a gene coding a target protein is ligatured below a promotor of a gene coding an enzyme exposed to catabolite repression due to concentration of the nutrients, such as saccharides and amino acids, for preparing thereby the ligation product, and the ligation product is introduced in koji mycelial fungi as a host.

EFFECT: invention allows higher yield protein.

4 cl, 3 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention refers to a method of producing a mutant lactobacillus Streptococcus thermophilus, to a milk ferment, a method of producing a fermented milk product and to the fermented milk product. The offered invention can be used for producing the fermented milk products with improved storage characteristics. A method of producing the mutant lactobacillus Streptococcus thermophilus characterised by weaker postoxidation, than a parent strain is implemented by introducing in DNA a genome of said parent strain of mutation codon 552 coding histidine, of teh domain HA of lactose permease. Said mutation induces replacement of said histidine by amino acid which is distinct from serine, tyrosine, histidine and threonine.

EFFECT: invention allows producing the mutant lactobacillus Streptococcus thermophilus characterised by weaker postoxidation and suitable particularly for producing the fermented milk products.

10 cl, 5 dwg, 3 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method includes separation by centrifugation of heparinised mononuclear cells of umbilical blood (further UB) in gradient of density on Ficoll-Paque™PLUS. After that realised are thorough washing in PBS+0.1 % BSA medium and denaturation at temperature 82°C of suspension, consisting of UB cells and control cell culture 1301, supported in RPMI medium with addition of 10% bull serum of glutamine and penicillin with streptomycin. After that, analysed and control cells are distributed in two pairs of test tubes, adding to them up to 0.5 ml PBS 0.1% BSA solution, centrifuging with acceleration 500 g for 5 minutes. Then in two rest tubes with cells poured is hybridisation buffer, and into the second pair - poured is hybridisation buffer with peptide-nuclein probe. After that, they are incubated in darkness for 2-20 hours, washed, mixed, centrifuged, stained in solution of propidium-iodide and RNK A. After that, analysis of cell samples is carried out with determination of their relative length telomeres depending on length of telomeres of cell culture 1301, taking into account DNA index.

EFFECT: invention makes it possible to increase quality of determination of properties of transplant, samples of hemopoetic stem cells of umbilical blood for transplantation.

1 ex

FIELD: medicine.

SUBSTANCE: method of predicting development of arterial hypertension in pregnant women consists of realisation of DNA separation from peripheral venous blood, carrying out polymerase chain reaction, finding out data about presence of polymorphism of α-adducin 1 gene. If carrying genotype 460WW of gene of α-adducin 1 ADD1 G460W is detected, conclusion about risk of hypertension development in pregnant women is made.

EFFECT: increased efficiency of predicting arterial hypertension development in pregnant women.

1 ex, 1 tbl, 2 dwg

FIELD: medicine.

SUBSTANCE: invention represents primer sets for carrying out LIMP or PCR used for Saccharomyces pastorianus detection. Also, there are presented sets for Saccharomyces pastorianus detection containing a primer set according to the invention in a combination with a primer set for carrying out LAMP used for Saccharomyces bayanus detection, and also in a combination with a primer set for carrying out LAMP used for Saccharomyces cerevisiae and Saccharomyces pastorianus detection. There are presented methods for Saccharomyces pastorianus detection.

EFFECT: invention provides precise, quick and easy identification of Saccharomyces pastorianus yeast by means of PCR or LIMP.

19 cl, 4 dwg, 5 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: what is presented is a method for Apo2L/TRAIL sensitivity prediction of a malignant tissue or cell sampled from a mammal, involving the stages as follows: sampling a malignant tissue or cell from a mammal; analysing the sample malignant tissue or cell for detecting expression of one or more biomarkers selected from a group of fucosyl transferase 3, fucosyl transferase 6, sialyl-Lewis A and/or X antigen (antigens) where expression of one or more specified biomarkers is an indicator of the fact that the specified sampled tissue or cell is sensitive to apoptosis-inducing activity Apo2L/TRAIL. Also, what is described is a method of apoptosis induction in the sampled malignant tissue or cell of a mammal. What is offered is a method of treating a malignant tumour in a mammal. The inventions enables using the detection of expression of one or more biomarkers as the indicator of the fact that a sample is sensitive to apoptosis-inducing agents, such as Apo2L/TRAIL and DR5 agonist antibodies. Specific biomarkers to be examined include fucosyl transferases, particularly fucosyl transferase 3 (FUT3) and/or fucosyl transferase 6 (FUT6), as well as sialyl-Lewis A and/or X antigens.

EFFECT: method improvement.

35 cl, 22 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: cell suspension under investigation is incubated with biochip, containing immobilised on biochip antibodies, which have specificity to superficial antigens of investigated cells. After incubation, biochip is washed from non-specifically bound cells. Cells, which remain bound with biochip, are subjected to processing with labelled polynucleotide probes of one or several types with further hybridisation. Reading and processing of results are performed by presence of cell binding in area of biochip sites, containing immobilised antibodies, presence in them of determined superficial antigens is detected, and presence and character of binding of labelled polynucleotide probes are used to determine genetic signs in the same cells.

EFFECT: method application makes it possible to increase quantity of simultaneously determined superficial antigens on different cells with application of non-conjugated with label antibodies, simultaneously reducing number of used antibodies.

9 cl, 2 dwg, 2 ex

Biomarkers // 2429297

FIELD: medicine.

SUBSTANCE: what is offered is applying an analysis of p53(TP53) gene status and/or expression level as a biomarker while evaluating sensitivity of an individual suffering a proliferative disease to treatment by an mTOR inhibitor combined with a cytotoxic agent or while selecting individuals sensitive to the specified combined therapy for the following treatment of the disease by this method. Thus sensitivity to treatment of the proliferative disease by the mTOR inhibitor combined with the cytotoxic agent is predicted if wild-type functionally active p53 gene is found in a sample taken from the patient.

EFFECT: higher analysis accuracy.

14 cl, 5 ex

FIELD: medicine.

SUBSTANCE: what is offered is a method of structure stabilisation of thrombin binding DNA-aptamers, and also DNA-aptamers stabilised in such a way. The presented method provides formation of an additional base-stacking system by means of heterocycles or their analogues by means of increasing a surface of an aromatic system of heterocycles or their analogues, owing to using methods of determining a tertiary structure or molecular simulation with stating the fact of contact formation of the aromatic system of heterocyclic bases or their analogues with a G-quadruplex quartet which is related to a lateral loop.

EFFECT: method allows more effective assembly of antithrombin DNA-aptamers and improved structural stability under physiological conditions.

7 cl, 7 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method involves allele-specific Nested-PCR with primers which are matched with nucleotide sequences coding amino acids in positions 70-71 of the amino acid sequence. The allele-specific primers E70f1 - 5'-AGAAGGAGATCCTGGAGGATAG - 3' and R71r1 - 5'-CCTGTCCACCTCGGCCCGCCTATC - 3' are matched with a part of BoLA-DRB3 gene located on chromosome 23 (localisation 23q21). They interact only with the nucleotide sequences coding alleles *11, *23, *28 =*7A causing genetic stability to cattle leukaemia. Then sequencing primer Zond 70/71 5'-GCCCGGCTACACCTGT - 3' is used to identify homo- or heterozygosity of an individual by the given alleles. If observing the primers interacting with alleles *11, *23, *28 =*7A, animals are considered to be leukaemia stable, while the absence of interaction with the same alleles can enable to refer to leukaemia unstable, and to neutral.

EFFECT: invention can be used for mass genetic typing of BoLA-DRB3 leukaemia tolerable animals in livestock and commodity economies for animal selection in a nuclear stock.

2 dwg, 4 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: set contains species-specific oligonucleotide primer pairs and appropriate fluorescent-marked probes for conducting one-stage instant identification of several human-pathogenic Orthopoxviruses (VARV, MPXV, CPXV and VACV) by means of real-time multiplex PCR.

EFFECT: invention is intended for instant diagnostics of human and animal Orthopoxvirus infections by real-time multiplex PCR.

10 dwg, 2 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: tissue is homogenised in a buffer and centrifuged at 105000 g for 60-90 min at 0-4°C to produce a cytoplasmic fraction which is then incubated with 10 mM of phosphocreatine and 10 mcg/ml of phosphocreatine kinase for 25-45 minutes at 35°C. Cytoplasmic fraction proteins are divided by ammonium sulphate at three stages, at the first stage ammonium sulphate is added to 38% of saturation and centrifuged to isolate a precipitate containing a 26S-proteasome pool, at the second stage, a supernatant is added with ammonium sulphate to 42 % of saturation and centrifuged to isolate a precipitate containing ballast proteins, at the third stage to the supernatant is added with ammonium sulphate to 70 % of saturation and centrifuged to isolate a precipitate containing a 20S-npoteasome pool. Ammonium sulphate is added in portions during 20 min on a magnetic stirrer and further mixed for 20 minutes.

EFFECT: invention allows dividing native 26S- and 20S-proteasomes and isolating them in those amounts they exist in living cells, with preserving at most an undamaged 26S-proteasome structure.

3 cl, 1 ex

FIELD: medicine.

SUBSTANCE: method provides recovery of DNA of an analysed strain followed by PCR with using nucleotide primers of terC, ilvN and inv genes of the following sequences: 89-S - AATCAAATCTCGCCCAGC, 89-As -GCTGCGTATCATTTCACC; 45-S - AGTGGTCTGCTTCTCTGG, 45-As -CGGCATACACAGAATACC; inv839 - TACCTGCACTCCCACAAC, inv1007 -CCCATACGCTGATCTACC. The analysed strains are differentiated by matching the sizes of the derived fragments of terC, ilvN and inv genes with the similar fragments in typical strains of principal and nonprincipal plague agents.

EFFECT: invention allows quick, effective and reliable differentiation of the strains.

1 tbl, 3 ex

Up!