Use of lgg for prevention or treatment of respiratory allergies

FIELD: medicine.

SUBSTANCE: group of inventions refers to medicine, namely to allergology, and can be used for prevention of development of respiratory allergies in a subject. That is ensured by introduction of an effective amount of Lactobacillus rhamnosus GG (LGG) either in a pregnant mother's body, and/or postnatal in a feeding mother's body, or in a subject directly.

EFFECT: introduction of LGG allows preventing an early allergic sensitisation and the following development of respiratory allergies due to higher production of serum antibodies IgA in a subject, and also prevention of allergic inflammation in lungs and respiratory ways.

12 cl, 13 ex, 9 dwg

 

The level of technology

The present invention generally relates to the use of LGG to create a medicinal product intended for the prevention or treatment of respiratory allergies.

The level of technology

Under an Allergy refers to an "abnormal hyperphosphorylate to the substance, which is normally considered to be harmless and to which the body has a tolerance". Allergy symptoms can vary from mild rhinitis to anaphylactic shock. Approximately 50 million Americans suffer from various allergic diseases, and the prevalence and incidence of constantly rising.

Any allergic response includes two main phases. The first stage involves the development of the early phase reactions of immediate type hypersensitivity in response to the allergen. When the allergen is first met with by the immune system, allergies does not occur. Instead, the immune system begins to prepare for future meetings with the allergen. Macrophages, which are cells scavenger", surround and destroy embedded in the body of the allergen. Then they represent fragments of the allergen on the surface of T-lymphocytes, which are the main participants in the immune response in the body.

Specified cognitive signal and several non-cognitive signals (e.g. the R, cytokines) activate native T-cells and directed differentiation of T cells into effector subpopulations. The main participants of the allergic cascade are T-cell phenotype Th-2 (TN-2). T-cells T-2 phenotype characterized by the secretion of several cytokines, including interleukin-4 (IL-4), IL-5 and IL-13. The cytokines IL-4 and IL-13 then activate b-lymphocytes to produce immunoglobulin E (IgE). IgE antibodies directed against a specific allergen. The interaction of specific IgE antibodies to the allergen on the surface of effector cells (mast cells and basophils) starts early phase reactions of immediate type hypersensitivity.

Described activation of mast cells usually occurs within a few seconds after the second meeting with the allergen. The complex of IgE on the surface of fat cells created during the sensitization phase, recognizes an allergen, and is associated with him. Once the allergen binds to the receptor, there is a release of active substances from the granules of mast cells. These active substances or mediators are Pro-inflammatory compounds such as histamine, platelet activating factor, prostaglandins, cytokines and leukotrienes. These mediators actually trigger allergic otvetit stimulates the production of mucus and call the characteristic redness, swelling and inflammation. Prostaglandins cause narrowing of the Airways and the blood vessels to dilate.

The second phase of the allergic immune response characterized by infiltration of the Airways by inflammatory cells such as eosinophils, in response to exposure to the allergen. This is a very important link between sensitization and inflammation is the T-cells that secrete mediators, who are not only involved in the synthesis of IgE, but also responsible for the recruitment, activation and survival of eosinophils. Fat cells and neighboring cells produce a chemical signal molecules that transmit the signal circulating basophils, eosinophils, and other cells, causing their migration into tissues and helps to fight alien agent. Eosinophils secrete their own chemically active compounds that support inflammation, cause tissue damage and attract more immune cells in the hearth. This phase may occur after several hours or even days after exposure to the allergen and lasts for several hours or days.

Respiratory Allergy is a specific type of allergic reaction, which damaged the respiratory tract. Since the structure of the respiratory tract are the same all over, from the nasal passages to the lungs, all departments of a stomach is considerable ways about the same damage in allergic process. Therefore, the allergen that affects the nasal passages or sinuses can also damage the lungs.

For example, allergic rhinitis also known as hay fever, is the result of an allergic reaction of the nasal mucosa and respiratory tract allergen present in the air. The symptoms of allergic rhinitis include itching in the nose, throat and eyes and frequent sneezing. These symptoms are also accompanied by nasal congestion and runny nose.

Because the allergens that affect one area of the respiratory tract, can cause damage to other divisions, rhinitis, localized in the nasal passages can lead to asthma, which is a much more serious disease and affects the lungs. Asthma is characterized by the development of hyperresponsiveness of the Airways, shortness of breath, wheezing for breath, dry cough and a feeling of tightness in the chest. Repeated exposure to the allergen can support an inflammatory immune response in the respiratory tract, which leads to their remodeling and the development of chronic bronchial asthma. Not every patient suffering from allergic rhinitis develop asthma symptoms, however in many patients, in particular with recurrent and untreated rhinitis, there are inflammatory changes in the lung tissue. Approximately 40% of patients who are economical with allergic rhinitis develop the clinical picture of asthma.

In the case when the inflammation of the nasal passages accompanying allergic rhinitis, apply to the sinuses, developing sinusitis or rhinosinusitis, a pathological condition in which the paranasal sinus or sinuses may not be able to break free from bacteria. The symptoms of sinusitis include nasal congestion, runny nose, sore throat, headache, weakness, and cough, and pain in the frontal lobes, cheeks and even in the teeth and jaws.

Respiratory allergies are the most common diseases in children. As adults, respiratory allergies in children occur most often allergic rhinitis and bronchial asthma.

Prevention of respiratory allergies in infants and young children is especially important because it is believed that early sensitization to allergens is associated with later maturation of the immune system. In addition, it is believed that allergic sensitization is the first step in the development of atopic diseases. Baena-Cagnani, Role of Food Allergy in Asthma in Childhood, Allergy. Clin. Immun. 1(2): 145-149 (2001). Often bronchial asthma that begins in early childhood, is associated with Otopeni, as well as early allergic sensitization, apparently, plays an important role in maintaining inflammation in asthma. Martinez, F., Development of Wheezing Disorders and Asthma in Preschool Children, Pediatr. 109:362-67 (2002).

Not only that there is a strong Association between allergic sensitization and bronchial asthma, this Association varies by age. Despite the fact that a small number of children are allergic sensitization at an early age, most of them in later years develop symptoms resembling asthma. Martinez, F., Viruses and Atopic Sensitization in the First Years of Life, Am. J. Respir. Crit. Care Med., 162:S95-S99 (2000). Thus, it is very important to find ways to prevent early allergic sensitization and subsequent development of respiratory allergies.

Every day there is increasing evidence that many aspects of health and illness are determined not only during childhood, but also during pregnancy. This is especially true for allergic diseases, where the immune responses at birth are the result of intrauterine exposure to antigens and are the primary sensitization. For example, antigen-specific T cells are already present at birth, and early sensitization to food allergens is considered to be the predecessor of later respiratory allergies. Illi, et al., The Natural Course of Atopic Dermatitis from Birth to Age 7 Years and the Association with Asthma, Clin. Exp. Allergy 27:28-35 (1997). In addition, lung development begins very early after conception and continues for at least another two or three years p is after birth. Thus, both prenatal and postnatal development of the lung tissue plays an important role in the pathogenesis of respiratory allergies in infants and young children later age.

It was also shown that human fetal IgE-producing B-cells develop in the early stages of gestation and have the ability to secrete IgE in response to suitable allergic stimulus, in the same way as it occurs in well-studied IgM response, which is observed in many prenatal infections. Weil, G., et al., Prenatal Allergic Sensitization to Helminth Antigens in Offspring of Parasite-Infected Mothers, J. Clin. Invest. 71:1124-1129 (1983). It also illustrates the need for prevention as prenatal and postnatal allergic sensitization to respiratory allergens.

Traditional medicines used for the treatment of respiratory allergies include antihistamines, local nasal steroids, decongestants funds or decongestants and solutions cromolyn. Alternative to traditional methods of treatment is the use as medicines, probiotics for the treatment of certain types of allergies.

Probiotic bacteria are living microogranism, which have a beneficial effect on the health of the host. Lactobacillus spp. Bifidobacterium spp., which are n maliniemi inhabitants healthy bowel are typical representatives of probiotic bacteria. Unfortunately, there are currently very few publications concerning the study of the clinical effects of probiotic support in children. Agostoni, C., et al" Probiotic Bacteria in Dietetic Products for Infants: A Commentary by the ESPGHAN Committee on Nutrition, J. Pediatr. Gastro. Nutr. 38:365-374 (2004).

In the application for U.S. patent No.20040208863, Versalovic, disclose compounds having anti-inflammatory activity and Sekretareva lactic acid bacteria. The application describes the use of Lactobacillus GG (LGG) for inhibiting the production of proinflammatory cytokines. However, this application focuses on adult models and does not disclose the possibility that the introduction of LGG can be useful for pregnant women and children.

In U.S. patent No.6506380, Isolauri et al., describes how to suppress hypersensitivity reactions in patients suffering from food allergies, which consists in the introduction of probiotics. However, this patent does not disclose the possibility of using probiotics for the treatment of respiratory allergies. In addition, despite the fact that the patent disclosed the possibility of treating children with probiotics, it does not focus on the necessity of pre - and postnatal treatment.

There have been several studies aimed at exploring the possibility of preventing certain allergies in children by pre - the postnatal administration of probiotics. For example, one study suggests that probiotics entered during pregnancy and breastfeeding, help to prevent the development of atopic eczema in children. Rautava S, et al., Probiotics During Pregnancy and Breast-Feeding Might Confer Immunomodulatory Protection Against Atopic Disease in the Infant, J. Allergy Clin. Immunol. 109:119-121 (2002). The study showed that only some children treated with probiotics had developed atopic eczema, compared with a group of children who received placebo, but the researchers concluded that probiotics "have no effect on the traditionally existing correlation between atopy and atopic disease" (i.e. the results of injectable skin tests and IgE level). Thus, since probiotics do not have any impact on the traditional markers of atopy, it can be argued that their introduction is only effective for the prevention of atopic eczema, but not all types of allergies.

Similarly, the survey results 2001 allow us to conclude that the introduction of probiotics may prevent the development of atopic eczema, however, "the total IgE concentration, the frequency of increasing concentrations of antigen-specific IgE and the skin samples were almost the same in the group receiving the probiotic and the placebo group". Kalliomaki, M., Probiotics in Primary Prevention of Atopic Disease: a Randomised Placebo-ControlledTrial, Lancet 357:1076-79 (2001). Therefore, again we can conclude that the introduction of probiotics may be effective for the prevention of atopic eczema, but not other types of allergies.

The invention

The present invention relates to a new method of using LGG to create a medicinal product intended for the prevention and treatment of the development of respiratory allergies in a patient.

The present invention also relates to a new method of using LGG to create a medicinal product intended for the prevention and treatment of respiratory allergies in a patient.

According to another aspect, the present invention relates to a new method of using LGG to create a medicinal product intended for the prevention and treatment of emission of one or more proinflammatory cytokines in a patient.

In addition, the present invention relates to a new method of using LGG to create a medicinal product intended for the prevention and treatment of the production of IgE in a patient.

The present invention also relates to a new method of using LGG to create a medicinal product, designed to increase the production of serum IgA in patients.

Method declared in accordance with the present invention, meetmeinto benefits including the fact that the patient is suppressed or prevented allergic inflammation in the lungs or respiratory tract, as well as reduced local tissue inflammation in the lumen of the respiratory tract. The present invention also reduces the production of mucus and promotes expansion of the respiratory tract. In addition, the present invention reduces or prevents the release of Pro-inflammatory cytokines and serum IgE, and also increases the production of serum IgA. These favorable effects were unexpected, as similar studies have shown opposite results.

Brief description of drawings

For a more complete understanding of the present invention, the following presents a more detailed description with reference to the accompanying drawings.

Figure 1 shows the scheme used in accordance with the present invention.

Figure 2 shows the definition of LGG in the faeces of mice treated with LGG compared to control.

Figure 3 shows the definition of different types of bacteria in the faeces of mice treated with 1GG, compared to control.

Figure 4 shows the effect of LGG on the level of serum anti-OVA-IgE, anti-OVA-IgGl and anti-OVA-IgG2a.

On Risuke 5 illustrates the effect of LGG on the levels of serum IgA.

Figure 6 illustrates the effect of LGG on the levels of various proinflammatory cytokines, IFN-(figa), MCP-1 (pigv), IL-10 (figs) and IL-6 (fig.6D) in OVA-sensitized children.

7 shows the effect of LGG on the distribution of mononuclear cells in the respiratory tract.

On Fig shown to suppress the production of specific antibodies in cow's milk.

Figure 9 shows the evaluation of immunological effector functions of specific antibodies in cow's milk by passive cutaneous anaphylactic test and research ejection protease-1 fat cells.

Detailed description of preferred embodiments of the invention

Following is a detailed description of the preferred embodiments of the present invention, which illustrates one or more examples. Each of these examples are presented to explain the embodiments of the present invention and in any case does not limit its essence. In fact, any person skilled in the art it is obvious that can be made various changes and modifications of the claimed invention within the following claims. In particular, the properties and characteristics of one possible implementation of the present invention can be used to describe or illustrate another variant implementation of the present invention.

Therefore, it is understood, Thu the present invention include their own versions or modifications which fall under the following claims. Other objects, characteristic features and aspects of the present invention are further addressed, or are apparent from the below detailed description. Any person skilled in the art it is obvious that the present discussion is merely a description of an example of embodiments of the present invention without limiting the total volume of its essence.

Definition

The term "probiotic" refers to a microorganism that has a beneficial effect on the health of the host.

The term "prebiotic", as used here, refers to nevereverever food ingredient that stimulates the growth and/or activity of probiotics.

The term "subject" refers to any mammal, preferably human.

Used herein, the term "treatment" refers to the improvement of the disease, pathological condition, or suppression of symptom of the disease or pathological condition.

Used herein, the term "prevention" refers to the termination or prevention of disease, pathological condition, or symptom of a disease or pathological condition by any act.

The term "therapeutically effective amount" refers to the number, with the introduction of which the observed improvement of the disease or pathological condition, or recovery from a disease or pathological condition, or suppression of the symptoms of the disease or pathological condition.

The term "prenatal introduction" means any drug to a pregnant woman, i.e. the unborn fetus.

The term "postnatal introduction" means a drug subject immediately after birth to 1 year of life.

Used herein, the term "baby food" (milk formula) refers to the composition that fully satisfies the nutritional needs of the child and is a substitute for breast milk. In the US, the composition of infant formula is regulated by the regulations of the Federal Agency 21 C.F.R., Sections 100, 106 and 107. These provisions regulate macronutrient, vitamin, mineral composition formula, and the levels of other components in order to best reproduce the properties of the female breast milk.

In accordance with the present invention appears to be a new way to use LGG to create medicines for the treatment or prophylaxis of respiratory allergies in the subject.

LGG is a probiotic bacterial strain isolated from the intestinal microflora of healthy humans. This is disclosed in U.S. patent No.5032399, Gorbach et al., which is included in the present invention as a reference. LGG are resistant to most antibiotic is, stable in the presence of acid and bile and is actively attached to the cells of the mucosa of human intestine. They remain viable for 1-3 days in most people, and within 7 days in 30% of subjects. In addition to the ability to colonization, LGG also has a positive effect on the immunological reactivity of the mucous. LGG is available in the American type culture collection under the number of ATSS 53103.

According to the method stated in accordance with the present invention, a therapeutically effective amount of LGG is in the range from 1×104up to 1×1012CFU/l/kg/day. According to another variant implementation of the present invention, the claimed method includes the introduction of the baby LGG in the amount of approximately 1×106and 1×109CFU/l/kg/day. According to another variant implementation of the present invention, the claimed method includes the introduction of the baby LGG in the amount of approximately 1×108CFU/l/kg/day.

In that case, if you enter a therapeutic amount of LGG, according to the method stated in accordance with the present invention, the method of their introduction is not crucial. In the case of prenatal introduction LGG injected into the body of a pregnant mother, from the bloodstream which an active connection enters the body of the fetus. Prenatal introduction can be carried out using bi is a Boolean additive, want to give a pregnant woman. For example, LGG may enter into the composition of pills, tablets, capsules, powders, solutions or gel. According to a variant of implementation of the present invention, LGG support may be given in combination with other dietary supplements or vitamins.

According to another variant implementation of the present invention, LGG for prenatal introduction can be part of the sugar, lipid or polysaccharide mixture in order to further increase the survival rate of bacteria. Composition claimed in accordance with the present invention, can be represented in a form suitable for use in food, including drinks, milk, yogurt, fruit juice, fruit drink, chewing tablet, cookies, crackers, or their various combinations.

In the case, when during the first year of life the child is still breastfeeding, postnatal introduction LGG can be accessed through breast milk. According to a variant of implementation of the present invention, a nursing mother continues to receive LGG additive during the whole lactation period, which ensures effective amount of LGG in the body of the child through the milk.

In the case, when during the first year of life the child is bottle-fed or combo receiver is nom breastfeeding mother's milk and milk mixtures LGG can be part of the formula, which then feed the baby. It is also an option postnatal introduction LGG.

According to one variant of implementation of the present invention, the formula used in accordance with the present invention, is balanced in nutrients and contains the right types of fats, carbohydrates, proteins, vitamins and minerals in the right quantities. The number of lipids or fats can vary from 3 to 7 g/100 kcal. The number of proteins typically ranges from 1 to 5 g/100 kcal. The amount of carbohydrate usually varies from 8 to 12 g/100 kcal. Sources of protein can be any known sources, for example, skim milk, whey, casein, soy protein, hydrolyzed protein, amino acids and other Sources of carbohydrates can be any known sources, for example, lactose, glucose, corn syrup, maltodextrins, sucrose, starch, rice syrup and other Sources of lipids can be any known sources, including vegetable oils such as palm oil, soybean oil, palmolein, coconut oil, triglycerides of medium-chain, high oleic sunflower oil, high oleic safflower oil, etc.

Commonly used commercially available infant formula. For example, Enfamil®, Enfamil®Premature oremula, Enfamil®with iron, Lactofree®, Nutramigen®, Pregestimil®and ProSobee®(produced by Mead Johnson &Company, Evansville, IN, U.S.) can be enriched LGG in a suitable quantity for the implementation of the method declared in accordance with the present invention.

Alternatively, LGG for post-injection may be in the composition, which is not included in children's meals. For example, LGG can be enclosed in pills, tablets, capsules, powders, solutions or gels. According to a variant of implementation of the present invention, LGG supplementation can be administered in combination with other supplements, such as vitamins.

According to another variant implementation of the present invention, LGG for prenatal introduction can be part of the sugar, lipid or polysaccharide mixture in order to further increase the survival rate of bacteria. Composition claimed in accordance with the present invention, can be represented in a form suitable for use in food, including drinks, milk, yogurt, fruit juice, fruit drink, chewing tablet, cookies, crackers, or their various combinations.

According to another variant of the use of the present invention, postnatal introduction LGG lasts at least 3 months. According to another variant implementation of the crust is asego of the invention, postnatal introduction LGG lasts at least 6 months. According to another variant implementation of the present invention, postnatal introduction LGG lasts at least 12 months. According to a particular variant of implementation of the present invention, the introduction of LGG continues indefinitely.

According to one variant of implementation of the present invention, LGG for prenatal and/or postnatal injection can be combined with one or more probiotic. Any of the known probiotics can be used in accordance with this embodiment of the present invention. According to a particular variant of implementation of the present invention, the probiotic is selected from the group comprising Lactobacillus and Bifidobacterium.

According to another variant implementation of the present invention, LGG can be entered prenatal and/or postnatal in combination with one or more prebiotic. Any of the known probiotics can be used in accordance with this embodiment of the present invention. To prebiotics, notified in accordance with the present invention, include, for example, lactulose, galacto-oligosaccharide, fructo-oligosaccharide, isomalto-oligosaccharide, soybean oligosaccharides, lactosucrose, Xylo-oligosaccharide, gentio-oligosacchar is water.

According to the present invention, pentalene and/or postnatal introduction LGG contributes to the prevention or treatment of allergic rhinitis, asthma, or sinusitis.

According to another variant implementation of the present invention, prenatal and/or postnatal introduction LGG contributes to the prevention or treatment of allergic inflammation in the lungs and respiratory tract of the patient. Specifically, the use of the present invention can contribute to the prevention and treatment of tissue inflammation in the respiratory tract, inflammatory phenomena in the lumen of the respiratory tract; reduce the production of mucus or extend the respiratory tract.

According to another variant implementation of the present invention, prenatal and/or postnatal introduction LGG reduces or prevents the emission of one or more proinflammatory cytokine. Used herein, the term "Pro-inflammatory cytokine" refers to cytokines that activate the inflammatory process. Examples of these cytokines, without limitation specified are INF-γ, MCP-1, IL-6 and IL-10.

According to a specific aspect of implementation of the present invention, prenatal and/or postnatal introduction LGG prevents or reduces production of serum IgE in the patient. According to another variant implementation of the present invention, prenat the aspects and/or postnatal introduction LGG increases the production of serum IgA in patients.

The following examples describe certain embodiments of the present invention. Other embodiments of the present invention, within the following claims, will be obvious to experts in this field. Assume that the specific embodiments of the present invention, and examples of their implementation, are presented solely for the purpose of illustration and better understanding of the present invention and are within the following claims of the invention without limiting its scope and nature. In all examples presented here, if not stated otherwise, all data are expressed in percent by weight.

Example 1

This example describes the materials and methods needed to study the effects of prenatal introduction of LGG on the development of respiratory allergies and inflammation in the lungs and respiratory tract. Substem 6-8-week-old mice albinos female (BALB/c) obtained from the laboratory Harlaan Hinkelmann (Hannover, Germany). They are grown on analbuminemia diet (OVA-deficient diet). All experimental procedures approved by the ethics Committee on animal rights.

Prenatal exposure to Lactobacillus rhamnosus GG (LGG)

At -10, -8, -6, -4 and -2 day before mating mice female BALB/c mice 5 times intragastric administered 108coloniales the participating units (CFU) of lyophilised LGG in a volume of 200 μl (dissolved in phosphate-buffered saline (PBS)). After mating and during pregnancy and lactation, mice from all groups every two days to enter intragastric 108SOME of lyophilised LGG in a volume of 200 µl. Control animals of the same age received PBS instead of LGG (control group).

Neonatal V-impact

On the 25th day of life and then again on day 39 the life of mice sensibiliser to OVA by two intraperitoneally OVA injection at a dose of 10 μg (scale VI; Sigma, Deisenhofen, Germany) emulsified in 1.5 Al(Oh)3(Pierce, Rockford, USA) to a total volume of 200 μl.

In order to assess airway inflammation, mice are placed in a chamber made of organic glass and exposed to OVA in the aerosol (1% wt./about., dissolved in PBS) for 20 minutes at 44, 45, 46 and 47 day life. Airway inflammation assessed 24 hours after the last exposure to the allergen.

The production of cytokines, IgA and IgE - or antibody-based test response in OVA-sensitized mice assessed on day 53.

The definition of LGG DNA in stool samples of animals

Stool samples (0.05 g) was weighed aseptically placed in a sterile flask and homogenized in 1.4 ml of lyse buffer. Extraction of genomic DNA is carried out according to the manufacturer's instructions (kit QIAamp for determining DNA in the faeces, Quiagen). DNA amplified using a set of PCR Hot-start (Quiagen) with LGG-specific paired Prime time is AMI (sense sequence LGG: gagaagaatggtcggcagag, the antisense sequence LGG: catttcaccgctacacatgg).

Offspring: effects OVA

25 and 39-day lives offspring sensibiliser to OVA by two intraperitoneally OVA injection at a dose of 10 μg (scale VI; Sigma, Deisenhofen, Germany) emulsified in 1.5 Al(Oh)3(Pierce, Rockford, USA) to a total volume of 200 μl. Or antibody-based test response in OVA-sensitized mice assessed on day 53.

44, 45, 46 and 47 day subgroup of mice placed in a chamber made of organic glass and exposed to OVA in the aerosol (1% wt./about., dissolved in PBS) for 20 minutes to assess airway inflammation.

Measurement of the levels of V-specific antibodies in serum

Levels of OVA-specific IgGI, IgG2a and IgE titers in the serum was determined by ELISA on day 53. 96-well flat-bottomed polystyrene plates to micrometrology (Greiner) cover with OVA (20 μg/ml)dissolved in 0.1 M carbonate covering buffer, pH 8.2 (IgG1) or PBS (for IgE and IgG2a). Tablets incubated over night at 4°C, washed three times washing buffer (PBS/0.1% tween-20) and blocked for 2 hours at room temperature with blocking solution (3% BSA/PBS). After washing (three times) on the tablets add samples (dissolved in PBS/0.1% tween-20) and incubated at 4°C overnight, then incubated with Biotin-conjugated artemisinine IgE, IgG2a or IgG1 monoclonal antibodies is AMI (2.5 µg/ml, all antibodies obtained from the laboratory Pharmingen) for 2 hours at room temperature. React with streptavidin-peroxidase (diluted in the ratio 1:1000) for 30 minutes at room temperature in the dark and tetramethylbenzidine (Roche) as a substrate. The reaction is stopped by adding 2n sulfuric acid, tablets appreciate when 450/490 nm.

Bronchoalveolar lavage (BAL) and cell differentiation

Lavagno liquid collected 24 hours after the last exposure to OVA-aerosol. Are cannuscio trachea and collect the BALL using two swabs 0.8 ml ice-cold PBS. Determine the recovered volume of the BALL and the total number of cells. Lespinay smear receive for each sample by centrifugation of 50 μl of BAL fluid (150 ál PBS (100 g for 5 minutes). After fixing cytopenia smears stained by the dye Diff-Quick (Baxter Dade).

Count the number of cells of different types for every 100 cells. Cells are classified as neutrophils, eosinophils, macrophages or lymphocytes by standard morphological criteria.

Example 2

This example illustrates the presence of LGG in the faeces of mice. The presence of LGG determined in samples of faeces of mice treated with LGG, and in samples of faeces of mice received only PBS. After microbiological cultivation was shown that LGG p is outstay in samples of faeces of mice receiving LGG, and not detected in the faeces of mice treated with only PBS (figa). To confirm the identity of the input LGG and LGG in the faeces of samples emit DNA and amplified using LGG-PCR-specific primers. As shown in figv, LGG-specific PCR products can be determined in samples obtained from animals treated with LGG, and not detected in samples of faeces of animals receiving only PBS (pigv). The results suggest that prenatal and early postnatal introduction LGG mice leads to colonization of the intestine specified microorganisms, while LGG is determined in faeces for at least three weeks after the last injection.

In order to determine whether the introduction of LGG mother-to-long (>3 weeks after stopping the introduction of LGG) colonization of the intestine of newborn mice, isolated DNA from samples of faeces of mice on day 53 of their lives. PCR analysis showed that none of the group or of mice treated with LGG, neither of mice treated with PBS, not observed colonization LGG (figs). The obtained results indicate that the introduction of LGG in the mother's body does not lead to prolonged colonization of the intestine offspring in the postnatal period.

In order to further assess how pre - and early postnatal introduction LGG effect n the distribution of bacterial colonization in the intestine, determine the presence of several bacterial strains (LGG, Enterococcus, E. coli, Staphylococcus aureus, Bacteroides) in samples of faeces. As shown in figure 3, during the experiment was observed a tendency that LGG-support has a positive effect on bacterial colonization. Bacteria of the genus Enterococcus, E.coli and Bacteroides in large quantities were determined in samples of faeces of mice treated with LGG-support, compared with the control group (figure 3). In addition, there is a marked decrease in colonization of the intestine by bacteria of the species Staphylococcus aureus compared with a control group that received only PBS. The results obtained indicate that LGG-support improves colonization normal healthy bowel and, in parallel, reduces the proliferation of pathogenic bacteria in the intestine of mice.

Example 3

This example illustrates the effect of LGG on the production of serum allergen-specific antibodies in subjects suffering from allergies. Also studied how prenatal and early postnatal introduction LGG prevents the formation of the allergic phenotype in later life. Thus, the production of allergen-specific antibodies evaluated in the offspring of mice after intraperitoneally OVA sensitization, which is carried out by exposure of OVA-allergic aerosol. As shown in figa and 4B, LGG-support mother suppresses development is the development of allergen-specific or antibody-based test response in the offspring, as evidenced by the significant decrease in the production of anti-OVA-IgGl of mice treated with LGG in the prenatal and early postnatal period, compared with the PBS control (figa, In). The mouse IgG1 subclass is an effector molecule that identifies the symptoms of allergies, such as positive injecting skin test and the development of airway inflammation. Given the indicated effector function, we can say that the mouse IgG1 subclass is identical to the IgE subclass of person. When studying the level of production of anti-OVA IgG2a were significant differences (figs). These results suggest that LGG is to support the mother reduces allergic sensitization to respiratory allergens in the offspring.

Example 4

This example illustrates the effect of LGG on the increase in the level of IgA in the serum of the patient. Breast milk contains large amounts of secretory antibodies of the IgA class. It is also known that antibodies of this class is associated with the development of immunological tolerance after exposure to an allergen. Thus, a significant increase in production of serum IgA in the offspring of mothers treated with LGG-support, compared to offspring of control animals (PBS), was unexpected (figure 5). This result suggests that LGG-support mothers, not only prevents the development of allergic immunol the response in the offspring, as evidenced by a significant decrease in the production of IgG1, but also induces the production of antibodies (IgA), which is associated with the development of immunological tolerance.

Example 5

This example illustrates the effect of LGG on the production of proinflammatory cytokines by splenocytes. In order to additionally determine whether the beneficial effect of LGG-support mothers on the production of antibodies in the offspring, associated with immunological immune response associated immunological tolerance, cultured mononuclear cells isolated from spleens of OVA-sensitized and desensibilisation mice, in the presence of LGG or allergen (OVA). The production of cytokines assessed after 72 hours. In the offspring of mice treated with LGG-support, there was a significant decrease in the production of INF-gamma, MCP-1, IL-10 and IL-6 (6 A-D). These results indicate that LGG-support mothers leads to a significant suppression of the production of proinflammatory cytokines in offspring.

Example 6

This example illustrates the effect of LGG on the suppression of allergic airway inflammation in subjects suffering from allergies. In order to determine how prenatal introduction LGG affects the development of experimental asthma, OVA-sensitized mice exposed to allergen four razavian respiratory analyze, exploring bronchoalveolar aspirates (BAL). In bronchoalveolar washings OVA-sensitized offspring of mothers treated with LGG support of leukocytes was significantly less than rinse OVA-sensitized mice from the control (PBS) group (7). In addition, the cellular composition of the BAL was characterized by a significant reduction in the content of granulocytes: eosinophils, and macrophages, while there was also a tendency to a decrease in the number of lymphocytes.

Example 7

This example describes the materials and methods needed to study the effects of prenatal and postnatal introduction of LGG on the development of respiratory allergies and inflammation in the lungs and respiratory tract. Before mating and during pregnancy mice female BALB/c intragastric was administered LGG. LGG-support and continue after the appearance of the offspring during breastfeeding up to 21 days after birth. Control animals received PBS instead of LGG.

On 0, 2, 4, 6, 8, 10 and day 12 BALB/c mice intragastric was injected 5 times 108SOME of lyophilised LGG in a volume of 200 ál (diluted in PBS). Control animals received only PBS. On 21 and 28 day all animals received sensitizing injections cow's milk protein at a dose of 100 mcg with 1.5 mg of the adjuvant Al(Oh)3. To assess the level of serum antibodies and immunological effect of the nuclear biological chemical (NBC functions (PCA) blood samples were collected at 0 and day 49.

To Wistar rats shave the hair on the back and sides and injected intradermally 0.1 ml of test serum in dilution obtained from mice at day 49, and then after 24 hours intravenously injected 1 ml of a mixture solution of cow's milk protein (Mead Johnson Nutritionals, Evansville, IN, USA) and a solution of Evans blue (2% in sterile saline) in a 1:1 ratio. After 20-30 minutes in animals to determine the presence of a positive answer. Measure the diameter of the colored spots in the injection of serum.

The levels of specific IgG1, IgG2a and IgE titers cow's milk is determined on the 49th day, using ELISA. 96-well flat-bottomed polystyrene plates to micrometrology (NUNC, Germany) covered with cow's milk protein (5 μg/ml)dissolved in 0.1 M carbonate covering buffer, pH 9.6, and blocked for 1 hour at 37°C using a blocking solution of PBS/1% BSA/0.02 tween-20. Each tablet using curve comparing the obtained positive polerowanie serum (control day 49), define (starting dilution 1:10 for IgE, 1:100 for IgG2 and 1:6400 for IGg1) set to 1000 conventional units/ml (AU/ml) levels of the complex specific Ag-specific AB". To determine IgE, IgG1 and IgG2a add RO-conjugated antibodies (1 hour at 37°C). Then for staining reaction mixture using 3,3',5,5'-tetramethylbenzidine (TMB; Sigma, Germany, 100 mcla hole; 6 mg/ml DMSO), after which the reaction is stopped by adding 2N solution of H2SO4at a dose of 100 μl per well, and the absorption was measured at 450 nm. The titers of specific antibodies in cow's milk are expressed in arbitrary units (AU) relative to control serum.

Blood samples taken before oral sensitization of animals (100 mg protein in cow's milk, on day 56) and one hour after it; the levels of mmcp-1 in serum was determined using an ELISA kit (Moredun, Scotland). ELISA is carried out according to the manufacturer's instructions. Data analyzed using the program GraphPad Prism, version 3.02. Differences between groups determined using the test Mann-Whitney-u Value p<0.05 considered statistically significant.

Example 8

This example illustrates the presence of LGG in the faeces of mice treated with LGG pre - and postnatal. The presence of LGG determined in samples of faeces of mice treated with LGG, and compared with samples of faeces of animals received only PBS. After microbial growth cultivation was shown that LGG is present in the faeces of animals treated with LGG, and not detected in the faeces of mice received only PBS. To confirm the identity of the input LGG and LGG in the faeces of samples emit DNA and amplified using LGG-PCR-specific primers. As shown in figv, LGG-specific PCR products can be ODA is divided in samples obtained from animals treated with LGG, and not detected in samples of faeces of animals received only PBS. The results suggest that prenatal and early postnatal introduction LGG mice leads to colonization of the intestine specified microorganisms, while LGG is determined in faeces for at least three weeks after the last injection.

To install, does LGG-support mother-to-colonization of the intestine offspring in the neonatal period specified microorganisms, isolated DNA from samples of faeces of newborn 53 day of their life. PCR analysis showed that neither of mice treated with LGG, neither of mice treated with PBS, not observed colonization of the intestine LGG. The result suggests that LGG entered in the mother's body, do not penetrate into the body of the offspring during prenatal and postnatal period.

In order to further assess how pre - and early postnatal introduction LGG affects the distribution of bacterial colonization in the intestine, determine the presence of several bacterial strains (LGG, Enterococcus, E. coli, Staphylococcus aureus, Bacteroides) in samples of faeces. There is a tendency that LGG-support has a positive effect on bacterial colonization. Bacteria of the genus Enterococcus, E.coli and Bacteroides in large quantities were determined in samples of faeces of mice, polucavsie the LGG-support, compared with the control group. In addition, there is a marked decrease in colonization of the intestine by bacteria of the species Staphylococcus aureus, compared with a control group that received only PBS. The results obtained indicate that LGG-support improves colonization normal healthy bowel and, in parallel, reduces the proliferation of pathogenic bacteria in the intestine of mice.

Example 9

This example illustrates the effect of pre - and early postnatal introduction of LGG on the production of serum allergen-specific antibodies in mice in the neonatal period compared with the control. The production of allergen-specific antibodies evaluated in mice in the neonatal period after intraperitoneally OVA sensitization and subsequent sensitization OVA-allergen spray cans. LGG-support mothers prevents the development of allergen-specific or antibody-based test response, as evidenced by the significant decrease in the production of anti-OVA IgGI in pre - and early postnatal period in the offspring of animals treated with LGG compared with PBS control. The mouse IgG1 subclass is an effector molecule that identifies the symptoms of allergies, such as positive injecting skin test and the development of airway inflammation. The mouse IgG1 subclass is identical to the IgE subclass of person. The level of production of anti-OVA IgG2a things the public differed in animals receiving LGG, and in animals treated with PBS. These results suggest that LGG is to support the mother reduces allergic sensitization to respiratory allergens in the offspring.

Example 10

This example illustrates the effect of pre - and early postnatal introduction of LGG on the production of serum IgA in mice in the neonatal period compared with the control. Breast milk contains large amounts of secretory antibodies of the IgA class. It is also known that antibodies of this class is associated with the development of immunological tolerance after exposure to an allergen. Thus, a significant increase in production of serum IgA in the offspring of mothers treated with LGG-support, compared to offspring of control animals (PBS), was unexpected. This result suggests that LGG-support mothers, not only prevents the development of allergic immune response in the offspring, as evidenced by a significant decrease in the production of IgG1, but also induces the production of antibodies (IgA), which is associated with the development of immunological tolerance.

Example 11

This example illustrates the effect of pre - and early postnatal introduction of LGG on the production of proinflammatory cytokines in mice in the neonatal period compared with the control. Mononuclear cells isolated from the spleen OVA-sensibility avannah and desensibilisation mice in the neonatal period, cultivated in the presence of LGG or allergen (OVA). The production of cytokines assessed after 72 hours. In the offspring by Matera treated with LGG-support, there was a significant decrease in the production of INF-gamma, MCP-1, IL-10 and IL-6. These results indicate that LGG-support leads to a significant suppression of the production of proinflammatory cytokines in offspring.

Example 12

This example illustrates the effect of pre - and early postnatal introduction LGG to suppress airway inflammation in mice in the neonatal period compared with the control. OVA-sensitized mice exposed to allergen four times. Inflammation of the respiratory tract analyze, exploring bronchoalveolar aspirates (BAL). In bronchoalveolar washings OVA-sensitized offspring of mothers treated with LGG support of leukocytes was significantly less than rinse OVA-sensitized mice treated with PBS in the prenatal period (p<0.05). In addition, the cellular composition of the BAL was characterized by a significant reduction in the content of granulocytes: eosinophils, and macrophages, while there was also a tendency to a decrease in the number of lymphocytes.

Example 13

This example illustrates the effect of postnatal introduction of LGG on the development of the allergic phenotype in later years of life. For storysociety, how postnatal effects of LGG affects the development of the allergic phenotype in the future, the female mice of BALB/c within two weeks was administered LGG or PBS in saline solution. On 21 and 28 day, mice received two sensitizing injections cow's milk protein. 49 and 59 day was estimated production of specific antibodies to cow milk proteins (Fig) and immunological effector function, using the passive cutaneous anaphylactic test (figa) and release of protease-1 fat cells in serum after oral sensitization (pigv).

As shown in Fig, postnatal introduction LGG prevents the development of allergen-specific or antibody-based test response, as evidenced by the significant decrease in the production of specific IgE to cow milk proteins. The decrease in the production of allergen-specific IgE was associated with poor manifestations of inflammation and a small papule after the introduction of the allergen (figa). The decrease in the production of allergen-specific IgE was also associated with reduced emissions of protease-1 fat cells after exposure to the allergen (pigv). These results indicate that the introduction of LGG prevents the development of allergen-specific immune response and leads to the suppression of allergic symptoms after the introduction of the allergen. Therefore, the effect of LGG before Aller the systematic sensitization prevents the development of allergic phenotype in later life.

All references cited herein, including publications, patents, patent applications, reports, reviews, manuscripts, theses, pamphlets, books, Internet sites, magazine articles, periodicals, etc. included in the description only as the quoted material. Discussion of links is intended to summarize the statements of the authors of these publications here and not made any assumptions about their occurrence in the prior art. The applicant reserves the right to dispute the accuracy and reliability of sources of information. Disclosed in the description and other modifications and variations of the present invention can be carried out by a specialist in this field of knowledge without going beyond the scope of invention, which is reflected in the formula. In addition, it should be clear that various aspects and embodiments of the invention can be partially or completely modified without changing its essence. Specialist in this field is also clear that given in this application is the description of the invention serves only for illustrative purposes and in no way limits the scope of the invention, the essence of which is expressed in the formula. Thus, the content and breadth of the claims of the claims is not limited to the description that characterizes the preferred embodiment of the invention.

1. Pic is b prevent the development of respiratory allergies in a subject, includes introduction to the body of a pregnant mother and/or postnatal organism nursing mothers, or to the subject a therapeutically effective amount of Lactobacillus rhamnosus GG (LGG).

2. The method according to claim 1, in which respiratory allergies selected from the group including allergic rhinitis, asthma and sinusitis.

3. The method according to claim 1, in which postnatal introduction LGG subject includes the introduction of LGG in the milk mixture and the use of a mixture of a subject.

4. The method according to claim 1, in which postnatal introduction LGG subject lasts at least 3 months.

5. The method according to claim 1, in which postnatal introduction LGG subject lasts at least 6 months.

6. The method according to claim 1, in which postnatal introduction LGG entity continues for at least 1 year.

7. The method according to claim 1, wherein therapeutically effective amount of LGG is from 1×104up to 1×1010CFU/l/kg / day.

8. The method according to claim 1, wherein therapeutically effective amount of LGG is from 1×106up to 1×109CFU/l/kg / day.

9. The method according to claim 1, wherein therapeutically effective amount of LGG is 1×108CFU/l/kg / day.

10. The method according to claim 1, which is added at least one probiotic.

11. The method according to claim 1, which is added at least one prebiotic.

12. SPO is about increasing the production of serum IgA antibodies from the subject, includes introduction to the body of a pregnant mother and/or postnatal organism nursing mothers, or to the subject a therapeutically effective amount of LGG.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: claimed invention relates to optimised fused protein for blocking BLyS or APRIL, which contains extracellular region of N-end of truncated TACI (transmembrane activator and CAML-partner) and Fc sequence IgG. TACI segment of fused protein contains sequence of amino-end region of extracellular region, starting with 13-th amino acid residue, complete sequence of stem area from TACI and is obtained from native sequence of TACI between 12-th and 120-th amino acids. Segment Fc of immunoglobulin IgG of fused protein contains hinge region, CH2 region and CH3 region, TACI segment and Fc segment are fused either directly or through linker sequence. In addition, claimed is DNA sequence which codes fused protein, expression vector, host-cell, pharmaceutical composition, containing fused protein, and application of fused protein for blocking BLyS or APRIL. Obtained fused protein does not degrade in process of expression, possesses high biological activity and high level of expression.

EFFECT: fused protein in accordance with claimed invention can be used in treatment of diseases, associated with abnormal immunologic functions and in treatment of diseases caused by abnormal proliferation of B-lymphocytes.

10 cl, 6 dwg, 8 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to medicine, namely to immunomodulatory interleukin-1 drugs. An interleukin composition contains interleukin-1, a cyclooxygenase inhibitor - diclofenac, taken in certain proportions.

EFFECT: compositions exhibit higher efficacy and have no side effects.

6 cl, 5 tbl, 6 ex

Amide derivatives // 2427575

FIELD: chemistry.

SUBSTANCE: invention relates to a compound of formula (I), where m equals 1-2, and each R1 (1-6C)alkyl, (1-6C)alkoxy, (1-6C)alkylthio, hydroxy-(2-6C)alkoxy, amino-(2- 6C)alkoxy, (1-6C)alkylamino-(2-6C)alkoxy, di-[(1-6C)alkyl]amino-(2-6C)alkoxy, amino-(1-6C)alkyl, (1-6C)alkylamino-(1-6C)alkyl, di[(1-6C)alkyl]amino-(1-6C)alkyl, hydroxy-(2-6C)alkylamino, halogen-(2-6C)alkylamino, amino-(2-6C)alkylamino, (1-6C)alkoxy-(2-6C)alkylamino, (1-6C)alkylamino-(2-6C)alkylamino, di-[(1-6C)alkyl]amino-(2-6C)alkylamino, heterocyclyl, heterocyclyl-(1-6C)alkyl, heterocyclyloxy, heterocyclyl-(1-6C)alkoxy and heterocyclylamino, where heterocyclyl is a 3-7-member monocyclic saturated ring containing one or two heteroatoms selected from nitrogen, oxygen and sulphur, wherein the heterocyclyl can have 1-2 substitutes defined in claim 1, and any of the substitutes R1 given above, which contains a CH3 group bonded to a carbon or nitrogen atom, can contain a substitute given in claim 1, R2 is a halogen, trifluoromethyl or (1-6C)alkyl; R3 is hydrogen, and R4 is hydroxy, (1-6C)alkyl or (1-6C)alkoxy; or pharmaceutically acceptable salts thereof. The invention also relates to methods for synthesis of said compounds, pharmaceutical compositions based on said compounds, and use of said compounds in treating diseases or medical conditions mediated by cytokines.

EFFECT: more effective use of the compounds.

13 cl, 8 tbl, 15 ex

Heterocompound // 2425832

FIELD: chemistry.

SUBSTANCE: invention relates to a compound of formula

or pharmaceutically acceptable salt thereof, where symbols assume the following values; ring denotes

or , X denotes a single bond, -CH2-, -NR3-, -O-, -S-, R1 denotes a halogen; phenyl; pyridyl; (C3-C8)cycloalkyl; or (C1-C6) alkyl or (C2-C6) alkenyl, each of which can contain a halogen, -CONH2, phenyl or (C3-C8)cycloalkyl as a substitute, R2 denotes CN, -O-(C1-C6)alkyl, -C(=O)H, halogen; or (C1-C6)alkyl, which can be substituted with a halogen or -OH, R3 can form morpholino or 1-pyrrolidinyl together with R1 and nitrogen, and when X denotes a single bond, R1 and R2 can jointly form a 5-member ring and additionally contain -(C1-C6)alkyl as a substitute, R4 denotes the following ring: , , , , , , , , , , or , where any one of the bonds in the ring is linked to an oxazole ring, R5 denotes -H, (C1-C6)alkyl, which can be substituted by not less than one group selected from: -C(=O)NRXRY, -NHRX and -ORX- (C2-C6)alkenyl-; -C(=O)H; -C(=O)NRXRY, RX and RY can be identical or different and denote -H; or (C1-C6)alkyl. The invention also relates to a pharmaceutical composition based on said compounds, having SlP1 agonist activity.

EFFECT: compounds and compositions can be used in medicine for preventing and treating rejection during organ transplant, bone marrow or tissue transplant and autoimmune diseases.

16 cl, 84 tbl, 198 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, also aims at treating babies suffering intestinal colics. A mother and a breast-fed child are treated simultaneously. A cephalosporin antibiotic, an antistaphylococcal immunoglobulin, a staphylococcal bacteriophage, an antifungal agent, a phagocytosis activator are prescribed in the mother for 7-10 days. A staphylococcal bacteriophage, Hylak forte are prescribed to the baby. The second stage involves prescribing a bacterial preparation, an immunomodulator and a therapeutic staphylococcal anatoxin. The baby intakes Hylak forte and the bacterial preparation.

EFFECT: method allows relieving intestinal colics and preventing the development of complications.

1 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely, to immunology and clinic laboratory diagnostics, and can be used to predict course of acute respiratory viral infections (ARVI) in children in the first days of disease and timely administration of immunomodulating medications. For this purpose by means of ELISA immunologic indices of spontaneous and induced interferon-γ in vitro (IFH-γ) are determined. Index of interferon-γ stimulation (IS IFH-γ) is calculated by division of index of induced level by index of spontaneous level of interferon-γ. Also carried out is calculation of lymphocyte activation index (LAI IFH-γ) per 1000 lymphocytes by division of index of induced interferon-γ by absolute number of patient's lymphocytes. Additionally in blood plasma determined is content of interleukin-10 (IL-10). If values of IS IFH-γ are higher than 3, LAI IFH-γ equals or is higher than 40, IL-10 is from 30 to 60 pg/ml favourable outcome of disease is predicted with therapeutic treatment which does not include immunomodulators. If IS IFH-γ is lower than 3, LAI IFH-γ is lower than 40, IL-10 is from 60 to 100 pg/ml, predicted are severe course of disease and development of complications, which requires urgent treatment by immunomodelling therapy. If IS IFH-γ is lower than 3, LAI IFH-γ is lower than 30, IL-10 is higher than 100 pg/ml, predicted are severe course of disease with development of bronchopulmonary complications and possible chronisation of pathologic process and recurrent ARVD, which requires additional introduction of immunomodelling medications.

EFFECT: increase of accuracy of early prediction of disease course severity and development of complications in children with ARVI, including those from 1 month old, which makes it possible to carry out necessary anti-viral and immunomodelling therapy, aimed at strengthening immunity cell responses, in due time.

3 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to the application of a biologically active peptide which represents the amino acid sequence SEQ ID No.1.

EFFECT: preparation of a drug for modulation of at least one of the following conditions: fatigue, liver glycogen level and blood lactic acid level.

30 tbl, 14 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to chemical-pharmaceutical industry, and can be applied for correction of malfunctions in immune system in case of pathological conditions, associated with insufficiency of Th 1 - dependent type of immune response. As immunomodulating medication, which stimulates Th 1 - dependent type of immune response, applied are water-soluble polysaccarides with molecular weight 540 and 390 kDa, separated from pharmacopeial raw material of elecampane.

EFFECT: medication extends arsenal of immunomodulating medications of vegetable origin, stimulates production of microphages of interleukin-12 and tumour necrosis factor-alpha.

4 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: claimed group of inventions relates to medicine. Claimed are methods of immune response regulation and reduction of inflammatory symptoms in mammal, with atopic dermatitis. For this purpose introduced is, at least, one medication of frost-resistant plant kiwi and, at least, one corticosteroid. In regulation of immune response in case of atopic dermatitis included is the following treatment period, during which carried out is monotherapy by medication of frost-resistant kiwi without introduction of corticosteroids. Also claimed is composition, which contains, at least, one medication of frost-resistant kiwi and, at least, one corticosteroid. Also claimed is product in form of animal forage, which contains claimed composition. Claimed group of inventions insure efficient regulation of immune response and reduction of inflammatory symptoms in case of atopic dermatitis due to synergetic effect of combination of medications of frost-resistant kiwi and corticosteroids, which makes it possible to reduce need in additional application of corticosteroids in treatment of said pathology and in future carry out monotherapy by medication of frost-resistant kiwi without reduction of treatment efficiency.

EFFECT: invention can be applied for regulation of immune response and reduction of , at least, one symptom of inflammation in mammal which has atopic dermatitis.

35 dwg, 5 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to cardiology, and deals with complex immunomodulating treatment of patients with chronic heart failure with reduced left ventricular heart ejection fraction. For this purpose in commonly accepted complex of drug therapy, which includes β-adrenoblockers, ACE inhibitors, diuretics, cardiomagnyl, additionally introduced is recombinant human interleukin 2 (IL-2). IL-2 is introduced in dose 500 IU/ml, in 200 ml of physiological solution, which containf for stabilisation 10 ml of 5% albumin solution, intravenously drop-by-drop daily 1 time for 10 days; treatment course is repeated 1 time per 3 months during 12 months.

EFFECT: complex treatment ensures suppression of chronic immune inflammation due to ability of IL-2 in elaborated mode of introduction to reduce level of endogenic cytokins and activate T- and B- lymphocytes efficiently in said group of patients.

2 ex, 2 tbl

FIELD: food industry.

SUBSTANCE: for prebiotic preparation one uses Lactobacillus acidophilus EP 317/402 strains with concentration in the final product no less than 1×108 - 4×108 CFU/ml. One prepares a mixture of D3 vitamin and hydrogenised nut oil heated to 40-50°C, taken at a ratio of 1:10 (vol). Then the said composition is mixed with fresh defatted milk heated to 40-50°C at a ration of 2:98 and proceeds with homogenisation. The milk, thus prepared, is chilled to a temperature of 37-38°C; Lactobacillus acidophilus EP 317/402 lactobacteriae starter is added to it, taken in an amount of 0.10%-0.12% of the prepared milk volume, as well as a mixture of calcium and magnesium minerals in a quantity (per 1 l of the mixture) equal to 40% of the adult or child organism daily demand for such minerals. The calcium and magnesium minerals mixture accounts for 0.056%-0.060% of the liquid component weight while the ration of calcium to magnesium minerals quantity qual to 2.5:1. The produced mixture is thoroughly stirred and maintained at a temperature of 37-38°C during 12-15 h. Co-presence of lactobacteriae and calcium in the product has a positive effect on calcium assimilation and gut microflora stabilisation while presence of EP 317/402 strain acidophilic lactobacteriae enhances immune response, having a positive effect on bowel performance, improves metabolic processes in the organism.

EFFECT: increase of prebiotic efficiency of the produced fermented milk drinking product and enhancement osteoporosis prevention effect which renders the product suitable for consumption by a wide range of consumers of all ages.

3 cl

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to children's uro-andrology. Preliminary ultrasonic examination is carried out. Presence of orchopathy is detected by size of gonads and presence of reflux into racemose plexuses and in case of its presence surgery of varicocele is performed. At the first stage into complex therapy included are antimicrobial therapy in combination with antifungal drugs, probiotics, uroseptics and immunomodulators, complex of vitamins with microelements, including zinc and selenium, prostatotropic phytotherapy in form of per oral medications and rectal suppositories. Enzymes wobenzime or phlogenzym and vein-tonics are administered, which are introduced successively - first detralex, after it aescusan, angioprotectors. Medications possessing antihypoxic, antioxidant and membrane-stabilising action - actovegin, vitamin E, ascorutin, cytochrome C - are applied. At the background of pharmacological therapy magnetic therapy is administered to patient rectally. At the second stage ultrasonic examination is performed, parameters of arterial hemodynamics are determined at the level of intratesticular recurrent arteries - index of peripheral resistance and pulsation index, in case of increase or reduction of which antispasmodic medications are administered. In addition, introduction of vein-tonics - escusan and troxevasin, prostatotropic medications, vitamins in complex with microelements, enzymes is continued.

EFFECT: method makes it possible to prevent secondary complications, reduction of fertility and infertility, increase in future life quality of active part of male population, improving demographic indices.

3 cl, 1 ex

FIELD: medicine.

SUBSTANCE: strain of Bifidobacterium longum is separated from bowels content of healthy baby and is deposited in Government collection of microorganisms of normal microflora (GKNM) FSIS "MNIIEM named after G.N. Gabrichevskiy Rospotrebnadzor " under registration number 230. Strain multiplies in various nutrition mediua with accumulation of production biomass with high concentration of bifidobacteria.

EFFECT: Bifidobacterium longum strain has acid-forming activity, antagonistic activity with respect to pathogenic and opportunistic microorganisms, ferments milk, which makes it possible to apply it for obtaining bifidocontaining production.

2 tbl, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: in invention described is composition for causing immune reaction against Neisseria meningitidis basing on vesicles, separated from bacteria N. meningitidis, in which endogenous gen GNA 1870 is inactivated and which is transformed by gene construction, coding polypeptide GNA 1870. Such bacterium insures super-expression of GNA 1870 polypeptide in vesicles of N. meningitidis. Composition can additionally contain antigen vesicle from second, third bacteria of N. meningitidis, on condition that both bacteria are genetically different from each other and from said first bacteria. GNA 1870 polypeptides, expressed by first, second and third bacteria are also genetically different from each other. Invention describes method of exciting immune reaction against bacteria of species Neisseria by introduction to mammal of composition based on vesicles, containing polypeptide GNA 1870, as well as method of obtaining composition based on vesicles, obtained as a result of culturing in proper way prepared bacteria, by their mixing with pharmaceutically acceptable carrier.

EFFECT: invention provides protective immunity against broad spectrum of N meningitidis strains, including strains N meningitidis of serogroup B.

45 cl, 20 dwg, 5 tbl, 8 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to pharmaceutical industry, in particular to method of obtaining medication, which possesses gastroprotective action (versions). Method of obtaining medication, possessing gastroprotective action, according to which in milk after autoclaving and cooling added are 2% of activated liquid culture of Bifidobacterium longum D 379 M, dry water-soluble extract of liquorice Glycyrrhiza Glabra L. root and natural zeolite - clinoptilolite, mixture is carefully mixed and thermostated until clot formation with specified acidity. Method of obtaining medication, possessing gastroprotective action, according to which in milk after autoclaving and cooling added are 2% of activated liquid culture of Bifidobacterium longum D 379 M, dry water-soluble extract of liquorice Glycyrrhiza Glabra L. root and natural zeolite - clinoptilolite, mixture is carefully mixed and thermostated until formation of clot with specified acidity.

EFFECT: medication, obtained by upper claimed method (versions) positively influences functional condition of gastrointestinal tract, effectively influences various links of pathological process, normalises malfunctions of microbiogenesis of intestine.

2 cl, 4 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: according to the invention, versions of an immunobiological antiallergic agent contain Lactobacillus acidophilus 100 "аш" PA strain, collection No. 207, is stored in the State collection of microorganisms of normal microflora Federal State Research Institution Gabrichevskiy Moscow Research Institution of Epidemiology and Microbiology of Federal Service for Supervision of Consumer Rights and Human Welfare in a culture medium in amount 106-1010 CFU/ml. The immunobiological antiallergic agent additionally contains species-specific virulent bacteriophages and bacteriophages with induced virulence, a biomass of Lactobacillus acidophilus "КзШз4" strain in a culture medium in amount 106-1010 CFU/ml, a biomass of Lactobacillus acidophilus NKi strain in the culture medium in amount 106-1010 CFU/ml and a biomass of Bifidobacterium bacteria in the culture medium in amount 106-1010 CFU/ml. The immunobiological antiallergic agent additionally contains target additives in amount 0.01-95.0 wt % from mass of the agent. The additives are selected from a number of: glycine, cysteine, copper sulphate, copper gluconate, quinosol, chitosan, licorice root extract, hips extract, origanum extract, cranberry extract and a flavouring agent. The immunobiological antiallergic agent is presented in the form of a suspension. The Lactobacillus acidophilus 100 "аш" PA strain is produced by means of a sequence of multiple passages through a nutrient medium MPC with added sources of histamine, Cu1+, Cu2+, Co2+, Ni2+ ions and at culture pH 6.2-7.4. The agent is used for prevention and treatment of allergic or pseudo-allergic disease without an accompanying pathology or in a combination with an infectious disease, intestinal dysbacteriosis and psychological adaptation disorders.

EFFECT: more efficient antiallergic action of the immunobiological agent on the basis of lactobacilli.

10 cl, 3 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to drugs and concerns a composition for intestinal dysbacteriosis correction, characterised by the fact that it is prepared on the basis of a consortium of lactobacilli strains providing a ratio of total short-chain monocarboxylic fatty acids of fractions (C2-C4) and a butyric acid isomer as 20:1 to 40:1.

EFFECT: composition under the invention provides personification of intestinal dysbacteriosis correction in the patients with a higher value of an invert correlation of total short-chain monocarboxylic fatty acids (C4-C6) to total fractions of their isomers (C4-C6) in faeces.

3 ex

FIELD: medicine.

SUBSTANCE: invention represents a preparation exhibiting hepatoprotective action and prepared of a bacterial biomass and their metabolites differing by the fact that the bacterial biomass is Bacillus subtilis bacterial cells of 3/28 (59T) strain in amount (1-3)·109 cell·cm-3, and also the preparation contains metabolites of Bacillus subtilis bacterial cells of 3/28 (59T) strain produced by a sterilisation filtration of a culture broth, and glycerine, an aromatiser and water, thus the ingredients of the preparation are taken in certain proportions, wt %.

EFFECT: invention provides good gastrointestinal absorbability, ability to normalise hepatic biochemical functions, to prevent formation of high-active toxic and cell-damaging compounds, or ability to bind such compounds, exhibits anti-inflammatory and immunomodulatory properties, and ability to stimulate regenerative and repairative hepatic processes; it is non-toxic.

2 ex, 1 tbl, 2 dwg

FIELD: food industry.

SUBSTANCE: mixture for baby feeding contains a source of proteins based on milk whey, casein and their mixture as well as based on soya in an amount of no more than 2.0 g/100 kcal, a source of lipids, a source of carbohydrates and a probiotic or a mixture of probiotics. The probiotic or the mixture of probiotics is/are represented by strain(s) preferably chosen from Lactobacillus and/or Bifidobacterium genus in an amount equivalent to 102-105 CFU/g of the dry mixture. The source of lipids and carbohydrates is suitable for use in baby mixtures.

EFFECT: possibility for application of the mixture for newborn baby immune system modulation for initiation of development of useful digestive microbiota (in the initial few weeks of baby life) comparable to microbiota of babies fed with breast milk as well as for stimulation of maturation of newborn baby immune system in the initial few weeks of baby life.

12 cl, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention can be used in bacteriological laboratories for individual selection of probiotic preparations containing lactic acid bacilli and/or bifidus bacteria for elimination of opportunistic pathogens (OP) recovered from a patient examined for intestinal dysbacteriosis. Individual selection of probiotics is carried out with an average or high degrees of adhesive activity of probiotic strains with using buccal epithelium of a specific patient, and also the presence of biocompatibility of probiotic and indigenous lactic acid bacilli and bifidus bacteria and with a high degree of antagonist activity of probiotic strains by a number of methods covering the OP recovered from a specific patient.

EFFECT: more precise detection of antagonist activity of probiotic preparations, simplified inoculation procedure and result analysis.

2 cl, 5 dwg, 19 tbl, 3 ex

FIELD: biotechnology, microbiology, medicine.

SUBSTANCE: invention relates to the strain Lactobacillus paracasei CNCM I-2116 used for diarrhea prophylaxis causing by pathogenic microorganisms. Supernatant of this strain culture elicits ability to prevent colonization of intestine with pathogenic microorganisms causing diarrhea also and this strain is designated for preparing agent used for prophylaxis and/or treatment of disorders associated with diarrhea. Agent for oral administration represents therapeutically effective dose of the strain L. paracasei CNCM I-2116 or supernatant of its culture and acceptable foodstuff. Invention provides the enhanced viability of the strain in its applying and effectiveness in prophylaxis of adhesion to intestine cells and invasion to intestine cells of pathogenic microorganisms causing diarrhea.

EFFECT: valuable medicinal properties of strain.

5 cl, 8 dwg, 10 ex

Up!