Biomarkers of ischemia and their application for prediction of unfavourable neurologic consequences of surgical operation

FIELD: medicine.

SUBSTANCE: invention relates to method of predicting emergence of unfavourable neurologic consequences of surgical operation.

EFFECT: invention ensures adequate prediction of risk of transitory ischemic attacks or stroke with determination of biochemical marker before operation.

17 cl, 6 ex, 2 dwg, 5 tbl

 

REFERENCE TO PRIOR APPLICATIONS

This application claims priority under 35 U.S.C. §119(e), in accordance with the provisional application U.S. No. 60/646,762, filed January 25, 2005, the Contents of the aforementioned applications are incorporated herein by reference as if fully set out herein.

The technical FIELD TO WHICH the INVENTION RELATES.

The invention relates to methods for predicting the risk of adverse neurological effects of surgery. In particular, the present invention relates to a method of analysis for NO2-peptides and antibodies in the blood of patients awaiting surgery, and to methods of using such analysis to predict the probability of stroke, transient ischemic attack (TIA) and other attacks caused by ischemia in patients during surgery. This analysis, particularly useful for patients with existing cardiovascular disorders, cerebral-vascular disorders, hypertension, diabetes, or noise over the carotid artery who are most likely exposed to the adverse neurological effects of surgery, but whose risk of the consequences of surgery has not been studied in detail. Diagnostic and prognostic ability of this analysis, the promise is ensity number of diseases and deaths in the operating room and to improve the treatment of patients with cardiovascular and cerebral-vascular disorders, assigned to a surgical operation.

The LEVEL of TECHNOLOGY

Nerve damage due to surgery is a combination of direct toxic effects on neurons and secondary lesions due to General hypoxia and ischemia. Strokes can be occlusive (due to blood stasis)and hemorrhagic (due to bleeding from the vessel) and both can result in insufficient blood supply to the brain, resulting in the condition known as ischemia.

Focal brain damage differently from the General anoxic brain damage that occurs after the heart stops or inadequate perfusion (Graham SH, Chen j J Cereb Blood Flow 2001;21:99-109). Upon the occurrence of focal brain damage, ischemic focus is developing so that is basically surrounded by the edge area of surviving cells. These surviving cells prevent (or at least stop) the spread of a heart attack and the amount of brain damage (Deshpande J, et al.Exp Brain Res 1992;88:91-105; Matsui T, et al.J Cereb Blood Flow Metab 2002;22:711-722). In the event of cerebral ischemia in General, the most vulnerable areas of the brain are located in the parietal cortex and subcortical sites, which are characterized by apoptotic phenomena (Kjos BO, Brant-on show include M, Young RG.Am J Roentgenol 1983; 141:1227-1232).

During the latter satilite was proposed multiple biomarkers for the prediction and diagnosis of brain damage. Great interest in S100B in serum as biomarker for neurological and neurocognitive assessment of the heart surgery was caused by messages that S100B was correlated with brain damage after a stroke, traumatic brain damage and cardiac arrest (Abraha HD, et al.Ann Clin Biochem 1997; 34:366-370; Buttner T, et al. Stroke 1997; 28:1961-1965; Lynch JR, et al. Stroke 2004; 35:57-63). S100B is a calcium-regulating protein found mainly in glial cells and cells of Swanna. Another possible biomarker for cerebral-vascular effects of heart surgery is C-reactive protein (CRP), an acute phase reactant agent and the indicator of the underlying General inflammation. CRP is a novel plasma marker for atherothrombotic disease and an indicator of cardiovascular disease.

Recently proposed N-methyl-D-aspartate (NMDA)-receptor proteins and their antibodies as biomarkers of neurotoxicity underlying cerebral ischemia and stroke (Dambinova SA, et al.Stroke 2002; 33:1181-1182; Dambinova SA, et al.Clin Chem 2003; 49:1752-1762). The NMDA receptor is inherent only in the brain. With the death of neurons or ischemia peptide fragments of the NMDA receptor detached, appear in the blood current and cause an immune response. Peptide fragments and antibodies can be detected in the blood sample (Dambinova SA, et al.Stroke 2002). Adult is E. patients suffering from acute ischemic stroke have an increased level of NMDA-peptides and/or antibodies in the blood, which correlates with the amount of brain damage on the tomograms of the brain (MRI) and neurocognitive status of the patient (Dambinova SA, et al.Clin Chem 2003; 49:1752-1762).

The standard application of certain biomarkers with potential diagnostic and prognostic abilities could significantly improve the management and therapeutic outcome in patients with cardiovascular diseases and vascular diseases of the brain undergoing surgery, especially heart surgery including cardiopulmonary bypass (SLS). Cerebral complications represent a major cause of morbidity and disability after heart surgery with cardiopulmonary bypass. The incidence of stroke varies from 1 to 5% during the perioperative period (Gardner TJ, et al. Ann Thorac Surg 1985; 40:574-581; Murkin JM, et al. J Thorac Cardiovasc Surg 1995; 110:349-362; Roach GW, et al. N Engl J Med 1996; 335:1857-1863; Libman RB, et al. Arch Neurol 1997; 54:83-87; Carrascal Y, et al. Eur Neurol 1999; 41:128-134), and its occurrence is associated with increased mortality (Roach GW, et al. N Engl J Med 1996; 335:1857-1863; Carrascal Y, et al. Eur Neurol 1999; 41:128-134). Although stroke is an important complication, neurocognitive dysfunction and the increasingly dark consciousness are more subtle complications. Influence near the cognitive dysfunction on postoperative care and cost, associated with prolonged hospitalization as a result of this dysfunction, is huge.

Total cerebral ischemia is associated with cardiovascular disorders and greatly contributes to the deterioration of neurocognitive abilities and neurological complications. Numerous studies have reported minor neuropsychological impairments, using a set of neurocognitive tests, frequent after surgical operations on the heart (Murkin JM, et al. J Thorac Cardiovasc Surg 1995; 110:349-362; Shaw PJ, et al. Q J Med 1987; 239:259-268; McKhann GM, et al. Ann Throrac Surg 1997; 63:510-515; McKhann et al. Lancet 1997; 349:1282-1284). However, some neurocognitive tests are unable to predict adverse neurological effects from the surgery.

Defining the determinants of cerebral dysfunction associated with surgical heart surgery based on preoperative risk factors and mechanisms associated with the operational techniques that are important in order to reduce the risk due to such methods and to improve the clinical outcome of the patient. Cerebral damage due to surgical operations on the heart at the present time is estimated retrospectively by comparing preoperative and postoperative clinical and neuropsychological examinations, or, using the methods of the playback image (CT or MRI) to detect m is vologodskii changes. Unfortunately, neuropsychological evaluation requires time, highly qualified specialists and contact with patients. In addition, the image acquisition of the nervous system (especially MRI) are very expensive and can be hard and risky for the patient in the postoperative period. The ability of biochemical markers to detect brain damage and to predict further brain damage will have considerable practical value.

TASKS INVENTIONS

One of the objectives of the present invention is the accurate prediction of the risk of adverse neurological effects of planned surgery, including transient ischemic attack (TIA), stroke and neurocognitive dysfunction, using biomarkers that can be detected in human blood or other biological fluids prior to surgery.

Another objective of the present invention is to assess the risk of adverse neurological effects caused by ischemia due to planned surgery patients individual risk of these adverse complications, including patients with existing cardiovascular or cerebral vascular injuries or chronic ischemic stress, or diabetes.

Another objective nastojasih the invention - to make possible a more efficient choice of surgical strategies to reduce the risk of adverse neurological effects of surgery, including monitoring and neuroprotective therapy against damage caused by cerebral ischemia, before, during or after surgery.

Disclosure of inventions

Methods and kits for assessing the patient's risk of adverse neurological effects of surgery based on the presence and amount of the NMDA receptor peptides and antibodies in the bloodstream of the patient. Pre-determined clinically limits for the NMDA receptor peptides and antibodies allowed the author to demonstrate good performance and clinical usefulness of these tests with determination of peptide and antibodies to assess the risk of adverse neurological effects, including TIA and stroke in adult patients before surgery. Analyses of the distributions of NMDA-peptides and antibodies before and after surgery showed that these markers have a high predictive value for neurological complications separately and in combination with MMSE (short scale assessment of mental status) component scale. Also developed diagnostic and therapeutic methods to control and reduce this risk, based on the results of the addition of analysis.

The blood levels of NR2A - and NR2B-subunit of the NMDA receptor, especially peptide fragments from the N-terminal domain of NR2A - and NR2B-subunit is particularly preferred in the methods of the present invention and unusually accurate for predicting the likelihood of adverse neurological effects in the result of the operation. In one prospective, blinded, multicenter clinical study to determine the incidence of stroke or TIA in patients undergoing surgery cardiopulmonary bypass surgery, these methods were able to identify 96,2% of patients who suffer a stroke or TIA, when in the blood serum of the patient was attended by more than 2.0 ng/ml of antibody, and 95.6% of patients who will not suffer a stroke or TIA, when in the blood serum of the patient was attended by less than 2.0 ng/ml of antibody. On the contrary, S100B is a calcium-regulating protein that is widely investigated as a potential biomarker for neurological outcome of surgical operations on the heart, had little ability to detect patients who will undergo or not undergo TIA or stroke. CRP (C-reactive protein), which has also been reported as a marker for atherothrombotic disease and predictor of cerebrovascular diseases, also had little ability to detect what their patients, who will undergo or not undergo TIA or stroke.

Therefore, in one embodiment, the invention includes a method of auxiliary assess the risk of stroke in seemingly healthy man before surgery including: (a) receiving the analyzed sample of the person; (b) analyzing the test sample for the presence and quantity NR2-NR2 antigen and antibodies or combinations thereof; and comparing the results of step (C) c the corresponding control quantities of NO2-antigens and NR2 antibodies or combinations thereof, where the corresponding control quantity determined for populations of seemingly healthy people.

When identifying unacceptable risk of TIA or stroke, according to the invention used modes of monitoring and neuroprotective therapy to control or reduce such risk. For example, when observing a dangerous level of NMDA-receptor peptides or antibodies, the patient could receive a variety of known medicines, in order to exert beneficial effects on the cardiovascular system and reduce the risk of stroke, including various antiplatelet tools, anticoagulants, lipid-lowering means, medicines to lower your blood pressure if you have high blood pressure) and surgical intervention. On the other hand or in addition the s, can be entered as a specific mode of monitoring, in which the NO2 levels are controlled by adding one or more times, in particular, immediately before surgery, during surgery and immediately after surgery.

Additional advantages of the invention will be set forth in part in the description which will follow, and will partly be obvious from the description, or may be determined through use of the invention in practice. Advantages of the invention will be realized and attained by means of the elements and combinations are set forth in the accompanying claims. It should be clear that both the foregoing General description and the following detailed description are exemplary and merely illustrative, and not limiting the invention as it is claimed.

A DETAILED DESCRIPTION of the INVENTION

The present invention may be understood more fully by reference to the following detailed description of a preferred variant embodiment of the invention and the examples included therein.

Definitions and use of terms

As used in this description and in the claims that follow, the singular form also include the plural, if the meaning is not explicitly instructs the other. Therefore, for example, reference to "fragment" also includes mixtures of fragments, the reference to "oligo is nucleated DNA" includes more than one oligonucleotide, and so on.

The NMDA receptor is one of a family of ligand-regulated ion channels that are associated preferably with N-methyl-D-aspartate and which are the mediators of the vast majority of excitations neuropterida in the brain (R. Dingledine et al., Pharmacol Rev. 1999 Mar;51(1):7-61.). Receptors include several subunits described in the literature as NR1, NR2A, NR2B, NR2C, NR2D and NR3A, which perform certain pharmacological functions. Access numbers GenEMBL reported for NR1 (X58633), NR2A (U09002) and NR2B (U28861) and is described in WO 02/12892 (Dambinova). Cerebral NMDA receptor belongs to the receptor, which is located in the brain, in contrast to the NMDA receptor, which is found exclusively in the organs of the human body, except the brain.

NMDA-receptor peptide is a NMDA-receptor protein full length peptide fragment of naturally occurring NMDA receptor full length, or an analogue, derivative, fragment or nekombinirovannyh (a/K/and recombinant) the sum of their parts. NR2-peptide includes NR2A-and NR2B-, NR2C-and NR2D subunit full length in addition to fragments, analogs, derivatives and their rekomendovannym fragments. NR2A-and NR2B-, NR2C - or NR2D-peptide indicates NR2A-and NR2B-, NR2C - and NR2D-peptide subunit of full length, naturally occurring or fragment, analog, derivative or reconstituted fragments. The N-terminal domain of NR2A - and NR2B-peptide relative to the tsya to amino acid N-terminal domain fragment of NR2A - and NR2B-subunit of the full length or fragment, analogue, derivative or rekomendovannym fragments, as described in WO 02/12892 (Dambinova).

Circulating the NMDA receptor peptide belongs to NMDA receptor peptide, which has penetrated through the blood-brain barrier in the overall flow, and the fragments formed in the bloodstream. Especially preferred circulating NMDA receptor peptide is a peptide that includes one or more fragments of the sequences that occur frequently in both NR2A - and NR2B-subunit. The peptide may include one such sequence, or 2 or more such sequences, which are discretely localized in natural NR2 peptide backbone, and recombinants in one contiguous piece, both in vivo and in vitro.

"Analog" of a peptide refers to a peptide which includes one or more amino acid substitution, deletion, accession or rearrangement. For example, in biochemistry of proteins is well known that amino acid belonging to the group of amino acids having a particular size and characteristics (such as charge, hydrophobicity and hydrophilicity), can often be substituted for another amino acid without changing the activity of the protein, in particular in the areas of the protein that are not directly related to biological activity. Thus, similar to NMDA-peptide suitable for the present from which retene, if it includes amino acid substitution, deletion, accession or rearrangement of the parts, so that the antibodies induced by similar, are specific to NMDA-peptide.

If you do not say the opposite, similar to NMDA, as used in this document, refers to a sequence that has at least 80% amino acid identity with NMDA occurring in nature, although it may also contain at least 85%, 90% or 95% identity. Amino acid identity is determined using an analog comparison between analogue and NMDA occurring in nature. Two amino acid sequences are aligned so as to maximize the total number of amino acids along the length of these sequences; possible gaps in one of the two or in both together the sequences in the process of conducting a comparison of the primary structure in order to maximize the number of shared amino acids. The percentage amino acid identity above the following two values: (1) the number of amino acids in common between the two peptides in the alignment of the primary structure, divided by the number of amino acids in the analog NMDA, multiplied by 100, or (2) the number of amino acids in common between the two peptides in the alignment of the primary structure, divided by the number of amino acids in natural NMDA-peptide, multiplied by 100.

Deposition is by NMDA include natural NMDA and analogues NMDA receptors and fragments thereof, which chemically or enzymatically modified with distinction in one or more part of the amino acid, including modifications in the side chain, backbone modification, and N - and C-terminal modification with, for example, acetylation, hydroxylation, methylation, amidation, phosphorylation or glycosylation. The term also includes salts of NMDA receptors, such as NMDA zinc and NMDA ammonium.

The protein or peptide is measured "directly" in the sense that the protein or peptide is measured as such in the biological sample, unlike some other indirect measurements of protein or peptide, such as autoantibodies to the protein or peptide, other peptide fragments of the same protein or subunit or cdnc associated with the expression of a protein or peptide.

The term "antibody" is synonymous with "immunoglobulin". As used here, the term antibody includes natural antibodies, monoclonal antibodies, polyclonal antibodies, recombinant DNA antibodies and biologically active derivatives of antibodies, such as, for example, Fab', F(ab')2or Fv, as well as a single domain and single-chain antibodies. Biologically active derivative antibodies included in this definition, because it retains the ability to bind with a specific antigen. Thus, NO2-antibody has the ability to contact p is at least one NO2-peptide.

DISCUSSION

In one embodiment, the invention includes a method allowing to assess the risk of stroke in outwardly healthy people before surgery, including: (a) receiving the analyzed sample of the person; (b) analysis of the analyzed sample for the presence and quantity NR2-NR2 antigen and antibodies, or combinations thereof; and comparing the result of step (C) c the corresponding control quantities NR2-NR2 antigen and antibodies, or combinations thereof, where the appropriate reference number to get the population seemingly healthy people. In another aspect, the invention includes a method for predicting adverse neurological effects of surgical operations including: (a) the presence of the patient man, waiting for surgery; (b) measurement of the initial level of circulating cerebral NMDA receptor peptides in biological fluids above the patient; and (C) correlation of the mentioned level with risk of adverse neurological consequences of surgery.

When the patient is examined and has dangerous levels of NMDA receptor peptides or antibodies in your bloodstream, it is preferable to examine the patient several times before and during surgery. In addition, because patients often do not undergo blagopri Tim neurological complications soon after surgery, it is preferable to examine these patients one or more times later after surgery, during one or more subsequent periods of time: one hour, three hours, six hours, twelve hours, twenty-four hours, three days, seven days, or thirteen days. Thus, in one variant of the invention, furthermore, includes: (a) measuring levels of circulating cerebral NMDA receptor peptides have referred the patient after the surgery; (b) determining whether there is a difference between the above-mentioned initial and subsequent levels; and (C) correlating the difference between the above-mentioned initial and subsequent levels with adverse neurological consequences, which either occurs or is likely to occur in the near future.

The methods can be performed on adults or children, which is planned surgery, and in a particularly important embodiment of the invention are performed on neonatal patients and newborns, for whom neurological complication represents a special danger. The method is especially useful when evaluating patients who are already predisposed to undergo neurological effects, such as patients with diabetes, atherosclerosis, high blood pressure what to eat, or previously suspected or confirmed TIA or stroke. The methods can also be used in combination with MMSA command-analysis, before surgery, in order to predict the risk of adverse neurological effects. Preoperative reduction component estimates MMSA command relative orientation, attention and recall contact pomrachenie consciousness and cerebrovascular consequences soon after surgery.

The types of neurological complications, which can be predicted using the current invention are primarily those which are caused by cerebral ischemia, in particular, ischemic effects that are caused by insufficient provision of oxygen to the brain (unlike gemorrargicheskoj consequences that arise when the rupture of blood vessels in the brain). These consequences can be focused in certain areas of the brain, as occurs in stroke or TIA, or can be General, as observed in deliria. Adverse neurological effect, therefore, can be characterized by pomrachenie consciousness or may be diagnosed as a TIA or ischemic stroke. The oxygen supply may be in jeopardy because of the state of the patient's heart (as, for example, under certain blood Nar the temptations, such as anemia), but more often will be the consequences of the surgery. They say that adverse neurological complication is the result of a surgical operation, if a complication occurs during surgery, or within thirty days after surgery, although, if desired, the resulting adverse complication could also be identified in the period of seven days, three days, two days or one day.

The prognostic methods of the present invention can predict the risk of adverse neurological effects of all types of surgical operations, it is most valuable when traumatic operations, which temporarily slows or stops the flow of oxygen to the brain. For example, the method can be carried out before any cardiovascular procedure that stops or blocks the normal blood circulation, which leads to intraoperative micro - or microembolism, abnormal cerebral blood flow, reperfusion brain injury, or inflammation, or neurohumoral reactions. The invention is particularly useful when predicting the presence of adverse neurological consequences of cardiopulmonary bypass.

Methods of analysis can be conducted, envivas is on the measurement of any circulating NMDA receptor peptide and they can be carried out using any direct or indirect measurement method. Therefore, for example, the levels of circulating peptides can be measured using indirect measurement of antibodies to peptides, expression cDNA that encodes the peptide, or by using measurements of the peptides. Therefore, in one embodiment, the invention includes a method in which the above mentioned level is measured using a contact called the biological fluid with immobilized antibodies or their fragments (namely, antibodies or fragments that are attached to the carrier, such as a plate or a ball, or a small particle), and direct measurement of the level of one or more circulating cerebral NMDA receptor peptides. In another embodiment, the invention includes a method in which the above mentioned level is measured using a contact called the biological fluid with an immobilized cerebral NMDA receptor peptide and measuring the level of antibodies that bind with said immobilized peptide.

In addition, various subunits and fragments of the NMDA receptor can be preferably measured. For example, the method preferably is performed by measuring NR2A-peptides or NR2-peptides and, even more preferably to carry out measurements both. In one preferred is ariance of carrying out the invention the method is performed by measuring one or more peptide sequences that are characteristic of natural NR2A - and NR2B-sequences, one or more peptide sequences, which are characteristic of the N-terminal domain of natural NR2A - and NR2B-sequences, or antibodies. In another preferred embodiment of the invention, the circulating peptides, which include 2, 7 and 14 kDa fragments of the N-terminal domain of NR2A - and NR2B-subunit cerebral NMDA receptor, measured in the methods of the present invention.

The method can be implemented using almost any biological fluid, in which circulating cerebral NMDA receptors or markers such receptors expressed or detected, including blood, urine, blood plasma, blood serum, cerebrospinal fluid, saliva, sweat, or brain tissue. In a preferred variant of the invention, the biological fluid is plasma or serum, and in a more preferred embodiment of the invention, the plasma or serum diluted in ratio 1:50.

In a preferred embodiment of the invention, the risk assessment is done based on a predetermined boundary levels of the peptides. Thus, for example, experimentally and clinically pok is connected, what levels of NR2A/B N-terminal domain antibodies in serum or plasma, which are larger than 2.0, and 1.8, 1.5, or 1.0 ng/ml or levels of NMDA-peptides, which correspond to the NR2A/B N-terminal domain of circulating peptides more than 200, 100 or 50 PG/ml, are extremely prognostically valuable for predicting adverse neurological effects in patients undergoing surgery. In contrast, the levels of NR2A/B N-terminal domain antibodies in serum or plasma, which are less than 2.0, and 1.8, 1.5, or 1.0 ng/ml or levels of NMDA-peptides, which correspond to the NR2A/B N-terminal domain of circulating peptides and are less than 200, 100 or 50 PG/ml, are extremely valuable prognostic for predicting that adverse neurological effects will not occur during surgery. The preferred limit on the number of antibodies is of 2.0 ng/ml

In a prospective clinical studies described in the examples, patients with positive preoperative analysis of peptide/antibody (>200 PG/ml and ≥2.0 ng/ml, respectively) almost 18 times more likely to have experienced postoperative neurological effects than patients with a negative test (<2,0 ng/ml). According to clinical studies, women showed higher stepenaska neurological complications, than men, and adverse neurological effects were more prevalent among older people (> 70 years). In addition, high levels of NIHSS in combination with high (>2 ng/ml) concentrations of NR2 antibodies and peptide (>200 PG/ml) testified to the fact that they can predict TIA/stroke in patients undergoing surgery. However, preoperative NIHSS alone predicts adverse neurological consequences.

Based on the results of the analysis can be implemented in various modes in order to reduce the risk of adverse neurological effects, which are expected to occur. For example, the method may further include, if the patient has a risk of adverse neurological effects of surgery, (i) the use of neuroprotective therapy to said patient, (ii) implementation of control programs to control the risk or the occurrence of adverse neurological effects. Neuroprotective therapy includes medications such as antiplatelet, anticoagulant, lipid-lowering and lowering blood pressure medicines. Conversely, the method may further include, if the patient has a risk of adverse n is urologicheskim consequences of surgery, optionally, the analysis referred the patient education new area of infarction determined by MRI, and performing neurosurgical operations or surgical operations on vessels of said patient, such as carotid endarterectomy, direct endarterectomy, angioplasty with stent placement, extracranial-intracranial bypass and the transposition of the vertebral artery.

The method can be carried out using any number of known diagnostic methods, including immunoprecipitation (PI), indirect immunofluorescence (NIF), immunodot and Western blot turns (IB) (Western blotting), direct or indirect enzyme-linked immunosorbent assay (ELISA), radioimmunoassays (RIA), countercurrent immunoelectrophoresis (PI), flow cytometry (PC), latex agglutination, spreading in the radial direction (lateral flow), fluorescence polarization analysis or microchip. In a particular embodiment of the invention is used immobilizovannaya solid phase to absorb and measure the NMDA-peptide markers. The invention therefore includes a method for predicting adverse neurological consequences of surgical operations including: (a) the presence of the patient man, waiting for surgery; (b) contact the biologist is ical sample mentioned a patient with immobilized solid phase, including NO2-peptide or NO2-antibody for a sufficient time to form a complex between these NR2-peptide or referred NR2-NR2 antibody and a peptide or NO2-antibody mentioned biological sample; (C) contact the above complex with an indicator reagent attached to a signal generating compound to generate a signal; (g) measuring the generated signal; (d) correlation of the generated signal with the level mentioned NO2-peptide or referred NR2 antibodies in said sample; and (e) correlation of level mentioned NO2-peptide or referred NR2 antibodies in said sample with the above-mentioned risk of adverse neurological effects. In a preferred embodiment of the invention, the indicator reagent includes chicken anti-human or anti-human IgG attached to horseradish peroxidase.

In a preferred embodiment of the invention, the solid phase is a polymeric matrix. More preferably, the polymer matrix is a polyacrylate, polystyrene, or polypropylene. In one preferred embodiment of the invention the solid phase is a microtiter plate. In another preferred embodiment of the invention the solid phase is a nitrocellulose membrane or charged nail the new membrane.

In another embodiment of the invention the method is performed using the agglutination. In this embodiment, the invention includes a method for predicting adverse neurological consequences of surgery, including: (a) the presence of the patient man, waiting for surgery; (b) contact a biological sample of said patient with agglutinating media, including NO2-peptide or NO2-antibody for a sufficient time to form an agglutination complex between these NR2-peptide or referred NR2-NR2 antibody and a peptide or NO2-antibody mentioned biological sample; (C) generating a signal agglutination; (d) correlation of the above-mentioned signal to the above levels one or more markers NO2-peptide; and (d) correlation of level mentioned NO2-peptide or referred NR2 antibodies in said sample with the above-mentioned risk of adverse neurological effects. In a preferred embodiment of the invention, "sufficient time" is less than 30, 20, 15 or even 10 minutes.

Latex-agglutination methods of analysis described in Beltz, G. A. et al., in Molecular Probes: Techniques and Medical Applications, A.Albertini et al., eds., Raven Press, New York, 1989, introduced here by reference. In the latex-agglutination method of analysis, antibody to a specific biome is keram immobilized on the latex particles. A drop of the latex particles is added to the corresponding weak solution of serum for testing and mixing using a little jiggle maps. Samples lacking sufficient levels of biomarkers, latex particles remain in suspension and maintain the smoothness and opalescence. However, if the biomarkers reacting with the antibody, are present, the latex particles accumulate in the detected visually units.

The agglutination method of analysis can also be used to detect biomarkers, where appropriate antibody immobilized on a suitable particle, in addition to latex beads, for example, gelatin, red blood cells, nylon, liposomes, particles of gold, etc. the Presence of antibodies in the method of analysis is the cause agglutination, such agglutination precipitation reaction, which can then be detected using methods such as nephelometry, turbidity, infrared spectrometry, visual inspection, colorimetric and such.

The term "latex agglutination" is mainly used here to refer to any method based on the education program of agglutinate, and is not limited to the use of latex as ELISA substrate. While the preferred substrates for agglutinin is based on the latex, such as polystyrene and polypropylene, especially polystyrene, other well-known substrates include beads formed from glass, paper, dextran or nylon. The immobilized antibodies can be covalent, ionic or physically attached to solid phase Immunoadsorbent, using methods such as covalent linkage through an amide or ester bond, ionic attraction, or by adsorption. Specialists in the art will know many other suitable carriers or will be able to identify similar, using the standard experiment.

Conventional methods can be used to prepare antibodies for use in the present invention. For example, using peptide NMDA protein, polyclonal immune serum or monoclonal antibodies can be prepared using standard methods. Mammal (e.g., mouse, hamster, or rabbit) can be immunized with immunogenic form of the peptide (preferably NR2A and/or NR2B receptor, antigenic determinant of NR2A and/or NR2B receptor, or an analogue or derivative), which causes an immune response in mammals. The ways of imparting peptide immunogenicity include joining the media or others well known in the art methods. For example, the peptide may skin is sterile in the presence of excipients. The course of immunization can be monitored by determining the titer of antibodies in plasma or serum. Standard ELISA or other immunoassay can be used with the immunogen as antigen in order to determine the levels of antibodies. After immunization, the immune serum can be applied and, if desired, polyclonal antibodies can be isolated from whey.

To produce monoclonal antibodies, plasma cells (lymphocytes) can be obtained from the immunized animal and combined with myeloma cells using standard procedures merge to somatic cells, thus immortalizer these cells and yielding hybridoma cells. Such methods are well known in the art, for example, the hybridoma method was originally developed by Kohler and Milstein (Nature 256, 495-497 (1975)), as well as other methods such as a method of human B-cell hybridoma (Kozbor et al., Immunol. Today 4, 72 (1983)), EBV-hybridoma method to produce human monoclonal antibodies (Cole et al. Monoclonal Antibodies in Cancer Therapy (1985) Allen R. Bliss, Inc., pages 77-96), and screening of combinatorial libraries of antibodies (Huse et al., Science 246, 1275 (1989)). Hybridoma cells can be thoroughly tested by immunohistochemistry for production of antibodies specifically reactive with the peptide and monoclonal antibodies can be kind of the Lena. Therefore, the invention also covers hybridoma cells secreting monoclonal antibodies with specificity to NR2A - or NR2B - NMDA proteins or their fragments, as described here.

In one embodiment of the invention, the method is applied using a dial which is calibrated in the enterprise, based on antibodies and peptides, purified from human blood. Therefore, in another embodiment, the invention is carried out under the following conditions: (a) the levels of NR2 antibodies or peptide in said biological fluid is measured using a diagnostic kit; (b) referred to a diagnostic kit includes the binding of NO2-peptides or antibodies; and (C) the set is produced by standard antibody or peptide, including the fraction of immunoglobulin G or peptides, purified from human blood.

Furthermore, the method can be implemented using readily available in large quantities chemiluminescent methods. For example, the method can be used dogancay sandwich immunoanalysis using direct chemiluminescent technique, which uses constant amounts of two monoclonal antibodies. The first antibody in a liquid reagent, could be acridine yellow-labeled monoclonal mouse anti-human NMDA receptor peptide is idnum BNP (F(ab`) 2fragment specific to the first sector of the peptide. The second antibody, in the solid phase could be biotinylated mouse anti-human antibody specific for a different region of the peptide that could bind to streptavidin-functionalized magnetic particles. Immunocomplex can be formed by mixing the patient sample and the two antibodies. After any unbound conjugates antibodies are washed away, the chemiluminescent signal immunocomplex then measured using luminometer.

Immunosorbent of the present invention for measuring levels of antibodies can be produced as follows. A fragment of the receptor protein is fixed by covalent bonds or ionic bonds in a suitable medium such as polystyrene or nitrocellulose. If you are using standard polystyrene tablet for immunological studies, it first undergoes nitration, while the surface of the tablet become available nitrogroup, which are reduced to amino groups and activate glutaraldehyde is a dialdehyde, which serves as a linker. After that, the thus activated tablet stand with 2-50 nm peptide-targeted with the aim to chemically fix the appropriate immunogenic fragments of the receptor protein for a time and at a temperature of shortcuts is exact for to ensure fixation (i.e. for 16 hours at 4°C).

Also practically possible to make immunosorbent by clamping the corresponding fragment of the receptor protein on nitrocellulose strips through the power of ionic interactions. The corresponding fragment of the receptor protein isolated from the brain of a mammal, is added to the nitrocellulose and held for 15 min at 37°C. Next, the nitrocellulose is washed with 0.5% solution of TWEEN-20 and the resulting immunosorbent dried at room temperature and stored in a dry place during the period of one year.

EXAMPLES

The following examples are set forth in order to provide the person skilled in the art a complete disclosure and description of how the compounds claimed here, are made and evaluated. Further examples are intended to be only examples of the invention and are not intended to limit the scope of what the inventors regard as the invention. Efforts made to ensure accuracy with respect numbers (e.g., amounts, temperature, etc.) but some errors and deviations can be taken into account. If not stated otherwise, the part is a massive part of the temperature shown in °C or is room temperature, atmospheric pressure or close is to it.

Example 1. Analysis of NMDA-peptide

Preferred NO2-peptide test is a latex agglutination immunoassay for qualitative determination of NO2-peptides in the blood. Blood samples are mixed with antibodies associated with latex beads, and agglutination visually detected within 10 minutes. After addition of the blood sample in the hole pattern of the test set, red blood cells are removed from plasma by filtration. A predetermined amount of plasma is transported by capillary forces into the reaction chamber where it reacts with the latex reagent (latex beads coated with antibodies) to form complexes that can be detected visually. In the examples reported here, the analysis uses the calibrator installed with 100-5000 ng/ml and standards with low (<200 PG/ml) and high (1000 PG/ml) values of NO2-peptide.

Example 2. Analysis on NMDA antibody

A quick way analysis of NR2 antibodies (CIS-LA analysis on antibody) is based on the method latex agglutination. CIS-LA analysis on antibody uses triple glass slide with a hole with a built-in magnifying device in order to detect the reaction visually, providing immediate answer "Yes" or "no". In this analysis, the serum samples are mixed with NO2-pepti the Ohm, associated with colored latex particles, agglutination visually detected via built-in magnifying device within 2 to 5 minutes or detected using a turbidity meter. The concentration of IgG in patient samples expressed in ng/ml, according to the calibration curve of the installation calibrator 0-100 ng/ml and standards with low (<2,0 ng/ml) and high (6 ng/ml) values of NR2 antibodies.

Example 3. The determination of the number of NR2 antibodies in adults operated patients

Thirty adult patients awaiting surgery using AIC, we determined the levels of NR2 antibodies in the serum before surgery, 24 hours after surgery and 48 hours after surgery and was recorded adverse effects. The results are presented in table 1.

Table 1
No.NR2-antibody value±standard deviation, ng/mlThe type of surgeryAdverse effects
BeforeAfter 24 hoursAfter 48 hours
11,70±0,1 1,58±0,121,55±0,13valve1thpostop gamorr,
21,79±0,101,64±0,03was 2.76±0,08CABG1th-3rdpostop,
32,25±0,021,812,14±0,03CABG+valve2thpostop, C (h)
42,00±0,043,23±0,093,34±0,15CABG3rd-5thpostop,
53,9±0,082,32±0,062,70±0,15CABG2thpostop, IS
65,4±0,124,65±0,094,60±0,25CABG+valve2thpostop, C&D, DM
7to 2.29±0,092,05±0,02 2,20±0,02CABGPreop, *
81,69±0,021,35±0,0041,22±0,07CABG+valve3rdpostop, C (h)
91,94±0,031,69±0,0051,38±0,03valve2thpostop, C (4 h)
101,78±0,141,89±0,041,65CABG+valve1thpostop, **, DM
111,70±0,032,00±0,0062,35±0,24CABG+valve2thpostop, C&D, DM
121,40±0,031,38±0,031,39±0,06CABG+valve-
132,11±0,031,81±0,021,93±0,16CABG-
141,79±0,031,40±0,071,39±0,02CABG1thpostop, C (24 h)
151,47±0,021,30±0,081,31±0,07CABG+valve25thpostop, depress,
160,70±0,090,69±0,060,60±0,03CABG2th-3rdpostop, paroxysm
171,16±0,091,09±0,061,14±0,06CABG2thpostop, D
181,16±0,0040,78±0,030,60±0,01CABG1thpostop, anxiety,
191,35±0,051,10±0,0151,16±0,04CABG2thpostop,
201,21±0,005 0,92±0,090,82±0,05CABG2thpostop,
212,5±0,081,86±0,041,73±0,03CABGPreop, agitation
220,99±0,010,78±0,070,80±0,06CABG1thpostop, vosb and insom
231,000,92±0,020,82CABG3rdpostop,
241,10±0,181,15±0,050,98±0,004CABG1thpostop, anxiety
251,04±0,020,64±0,030,61±0,02CABG1thpostop, anxiety
260,98±0,030,81±0,050,70±0,004CABG 7thpostop, anxiety
270,91±0,0050,82±0,080,79±0,01CABG2thpostop,
280,92±0,031,15±0,090,69±0,01CABG1thpostop,
291,04±0,030,90±0,010,79±0,03CABG+valvepreop, agitation
301,10±0,110,82±0,09no sampleCABG+valve1thpostop, agitation
310,72±0,0040,73±0,0040,68±0,01CABG+valve1th-4thpostop, paroxysm
320,73±0,040,68±0,020,70±0,04valvepreop, agitation, 5is th -11thencephalo

IS - ischemic stroke,

With confusion,

D - disorientation,

DM - pancreatic diabetes,

* disturbed swallowing,

** change in mental state.

Example 4. Determination of the levels of NO2-peptide and antibodies during and after surgery

More than 32000 babies (one out of every 125 to 150) are born with congenital heart defects each year in the United States. JT the patient (date of birth 06/25/04) underwent surgery for the treatment of congenital heart defect, using AIC 7 December 2004. Data on the development of the nervous system (scale early development Mullen, MSEL), defining mental and motor ability was determined by preoperative and are presented in table 2. This baby showed low results and reduced visual, language skills and motor weakness.

Table 2
ValueValuePercentile
The composition of the early learningStandard value 809
The total motilityt-index 28 1
Visual perceptiont-index 4531
Fine motor skillst-score 345
Speech perceptiont-index 3710
Expression of speecht-indicator 4221

The results of observations of NO2-peptides and antibodies in the blood JT patient are presented in table 3. Abnormally high levels of peptides and antibodies were detected after intubation and until the end of the AIK. Elevated above the regulatory preoperative NO2-peptide/antibody data showed good correlation with preoperative MSEL values and confirmed with a brain injury and adverse neurological effects AIK. Matched on age control group (n=7) young children without congenital heart had NR2-peptide 0.2-0.4 ng/ml and NR2 antibodies of 0.4-0.8 ng/ml

Table 3
DateTimeOperationNR2-antibody, ng/ml
12/7/20047:55intubation9,5±0,071,4±0,12
12/7/200410:14AIK10,0±0,013,1±1,02
12/7/200411:531 h AIK7,0±0,331,2±0,27
12/7/200414:35The end AIK2,7±0,091,0±0,02
12/8/200411:3024 h after2,5±0,151,2±0,01
12/9/20049:3048 h after4,6±0,051,7±0,07

Example 5. Characteristics of CIS-LA analysis on antibody

Table 4 presents the results of research undertaken at the CCA patients in order to assess the value of preoperative NO2-Ab levels to predict the potential for the spine of adverse neurological effects. The results are presented for different boundary levels of NO2-Ab in the serum of the patient and are classified based on the presence or absence of postoperative adverse effects. Patients were considered to be affected by adverse neurological outcome, if within 28 days AIK surgery, the patient suffered from a confused state, TIA or stroke were found, based on the NIHSS scale, more than 9. Patients who do not undergo neurological effects were attributed to the group without neurological consequences."

Table 4
Preop NO2-AbWith neurological consequence of n/N (%)Without neurological implications n/N (%)
<1.5 ng/ml7/213 (3,3%)206/213 (96,7%)
1,5-<2,0 ng/ml12/159 (7,6%)147/159 (92,5%)
≥2.0 ng/ml25/26 (96,2%)1/26 (3,9%)

Table 5 reflects a detailed analysis of six different limits concentrations of NO2-Ab from 1.5 to 2.0 ng/ml and demonstrates the effectiveness of each interval when the Pro is noshirvani adverse neurological effects. Although the probability of the event increases in the interval from 1.5 to 2.0 for both groups, this increase occurs more rapidly in the group "neurological outcome. Therefore, the risk increases significantly within the analyzed region, with the greatest degree of risk, corresponding to 2.0 ng/ml (ClinChem, 2003). 96% (24/25) of patients with concentrations of NO2-Ab ≥2.0 ng/ml before surgery had neurological complications within 48 hours after AIK, compared with 5.4% of patients with concentrations of NO2-Ab <2,0 ng/ml, which leads to 17,9-fold increase (95% CI (confidence interval), the 11.6-27,6) the ability of a marker to predict postoperative adverse neurological consequences.

Table 5
Preop NO2-AbWith neurological consequence of n/N (%)Without neurological implications n/N (%)Risk1(least 95% of the norm)2
<1.5 ng/ml8/214 (3,7%)206/214 (96,3%)5,2
≥1.5 ng/ml36/184 (19,6%)148/184 (80,0%)2,8)
<1.6 ng/ml10/288 (3,5%)278/288 (96,5%)8,9
≥1.6 ng/ml34/110 (30,9%)76/110 (69,1%)(5,1)
<1,7 ng/ml12/319 (3,8%)307/319 (96,2%)10,8
≥1,7 ng/ml32/79 (40,5%)47/79 (59,5%)(6,4)
<1.8 ng/ml17/351 (4,8%)334/351 (95.2 per cent)11,9
(7,6)
≥1.8 ng/ml27/47 (57,5%)20/47 (42,6%)
<1.9 ng/the l 19/364 (5,2%)345/364 (94,8%)14,1
≥1.9 ng/ml25/34 (73.5 per cent)9/34 (26.5 per cent)(9,4)
<2,0 ng/ml20/373 (5,4%)353/373 (94,6%)17,9
≥2.0 ng/ml24/25 (96,0%)1/25 (4.0 per cent)(12,4)
1The probability of the event among patients with positive preoperative NO2-Ab divided by the probability of the event among patients with negative preoperative NO2-Ab;
2The smallest one-sided 95% limit of confidence in relation to risk

Currently, at least 30% of patients undergoing heart surgery, have postoperative neurocognitive disorder. Based on the obtained ratio of the probability neurological consequences of 17.9 found preoperative concentration of NR2 antibodies, which is greater than 2.0 ng/ml, will predict the neurologist is ical complications in 89% of patients after surgery.

Figure 1 presents three curves norms change, based on data from NO2-analysis. The area under the curve for the preoperative determination of NO2-Ab indicates that NO2-Ab marker has a high predictive ability (AUC=0,814) in relation to adverse neurological effects after surgery.

Example 6. Analyses of pre - and postoperative distribution of NR2 antibodies

The high prognostic value of NO2-Ab marker for TIA/stroke to AIK shown in figure 2. The concentration of NO2-Ab in serum samples of patients without neurological effects (neurocog 0) remained in the limit of 2.0 ng/ml at all time points during the study. On the contrary, the majority of patients with adverse neurological outcome (NIHSS value >9) had high levels of NO2-Ab above the limit of 2.0 ng/ml before surgery and at 24 and 48 hours after the procedure.

Detailed analyses of the distributions of NO2-Ab in patients before surgery, after 24 and 48 hours after surgery showed that NO2-Ab can reliably detect patients with neurological complications before surgery in patients with neurological complications, whereas patients without neurological complications had indicators NO2-Ab within the limit. Biomarker NO2-Ab was sensitive to decrease (i.e. deterioration) values NIHSS is via 24 hours after surgery.

CONCLUSION

Throughout the text of this application are referred to various publications. The disclosure of these publications in their entirety are introduced so by reference into this application to more fully describe the state of the art belongs to this invention. To a person skilled in the art it will be obvious that various modifications and variations of the present invention may be made without deviating from the scope and essence of the invention. Other embodiments of the invention will be obvious to a person skilled in the art from the description and the practical implementation of the invention, as described herein. It is assumed that the description and examples should be considered illustrative only, while the actual volume and the invention is shown in the following formula.

1. Way facilitate the assessment of stroke risk in seemingly healthy people to surgical operations including:
a) receiving the analyzed sample of the person;
b) analyzing the obtained test sample for the presence or the initial level of the NMDA-receptor peptide or antibody, or a combination;
C) comparing the result of step (b) with the corresponding reference number of the NMDA receptor peptide or antibody, or combinations thereof, where the corresponding control quantity is STV receive from populations of seemingly healthy people,
where the analyzed sample is serum; however, the initial level of NR2 antibodies to peptide fragments from the N-terminal domain subunits NR2A and NR2B in the specified test specimen in excess of 2.0 mg/ml, is correlated with the risk of neurological effects of surgery; and the initial level NR2 antibodies to peptide fragments from the N-terminal domain subunits NR2A and NR2B in the specified test specimen, which is lower than 1.0 mg/ml, is not correlated with the risk of neurological effects of surgery.

2. The method according to claim 1, further including:
a) identifying from said patient for the presence or absence of one or more additional risk factors for adverse neurological effects; and
b) correlating the presence or absence of the aforementioned one or more additional risk factors mentioned risk of adverse neurological effects after surgery.

3. The method according to claim 1, further comprising, if the patient has risk transfer adverse neurological consequences of surgery, (i) the use of neuroprotective therapy to the patient or (ii) the implementation of monitoring programs to track risk or adverse neuro is oricheskogo consequences.

4. The method according to claim 1, further comprising, if the patient has a risk of adverse neurological effects of the surgery, the study referred to the patient about new areas of infarction, defined using MRI, and performing a neurosurgical operation on said patient.

5. The method according to claim 1 where the above-mentioned adverse neurological effects are the focal ischemic neurological consequences.

6. The method according to claim 1 where the above-mentioned adverse neurological effects are characterized by a confused consciousness, TIA or ischemic stroke.

7. The method according to claim 1 where the above-mentioned adverse neurological effects occur during this surgery, or within 72 h after surgery.

8. The method according to claim 1 where the above-mentioned NMDA receptor peptides include a fragment NR2-subunit cerebral NMDA receptor.

9. The method according to claim 1 where the above-mentioned NMDA receptor peptides include a fragment NR2-subunit cerebral NMDA receptor, fragment NR2-subunit cerebral NMDA receptor or a combination of both.

10. The method according to claim 1 where the above-mentioned NMDA receptor peptides include N-terminal domain NR2-subunit cerebral NMDA receptor or combination thereof, N-terminal domain NR2-subunit cerebral NMDA receptor is or their combination.

11. The method according to claim 1, further including:
a) measurement the subsequent level of the NMDA-receptor peptides or antibodies in said patient after the surgical operation;
b) determining whether there is a significant difference between these initial and subsequent levels;
C) correlation significant differences between these initial and subsequent levels with adverse neurological consequences; and
g) correlating the absence of significant differences between these initial and subsequent levels with no adverse neurological effects.

12. The method according to claim 1 where the above-mentioned surgery involves anesthesia.

13. The method according to claim 1 where the above-mentioned surgical procedure involves cardiopulmonary bypass (CPB).

14. The method according to claim 1, where the said patient is a newborn or young child with a risk of neurological complications.

15. The method according to claim 1, where through this analysis, we referred the patient is diagnosed diabetes, atherosclerosis or pre suspected stroke or TIA.

16. The method according to claim 1, where:
a) the levels of NMDA-receptor antibodies in said test sample are measured using a diagnostic kit;
(b) the said diagnostic kit includes the provided NMDA receptor peptides; and
C) the set is made according to the standard for antibodies, including the fraction of immunoglobulin G purified from human blood.

17. The method according to claim 1, which is performed through the direct or indirect ELISA, RIA, immunodot, Western blot turns, latex agglutination, spreading in the radial direction (lateral flow), fluorescent analysis or microchip.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention describes method of estimating severity of course of hemorrhagic fever with renal syndrome, which includes determination of marker of vessel endothelium dysfunction in blood, where in blood plasma as marker of vessel endothelium dysfunction determined is concentration of antigen of inhibitor of plasminogen 1 type (IAP-1) activators in febrile period of disease and value of IAP-1 antigen concentration from 341.2 to 570.0 ng/ml is estimated as predictor of moderate form of disease, from 240.0 to 320.1 ng/ml - as predictor of severe form of disease without complications, from 138.3 to 75.5 ng/ml value is estimated as predictor of severe form of disease with complicated course.

EFFECT: invention makes it possible to estimate severity of HFRS course in order to predict in the earliest terms development of disease complications.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: method includes determining complex of serum cytokines in period of disease beginning. In case of tick-born encephalitis level of interleukin-1 α is determined in interval 298-358 pg/ml, interferon-γ-295-350 pg/ml and interleukin-10-115-150 pg/ml; at ixodid tick-borne borreliosis - interleukin-1 α 178-270 pg/ml, interferon-γ 125-190 pg/ml and interleukin 10-11.5-18 pg/ml; in case of mixed infection, generated by virus of tick-borne encephalitis and borrelia - interleukin-1 α- 30-75 pg/ml, interferon-γ 115-130 pg/ml and interleukin-10 -22-65 pg/ml.

EFFECT: method is simple, makes it possible to determine disease causative agent reliably and accurately in short terms.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: described is method of cell analysis by means of biochip, containing immobilised molecules of substances, able of binding with molecules, which are on the surface of cells, includes incubation of biochip with suspension of cells. Then, washing of biochip from nonspecifically bound cells is carried out. After that, fixation and staining of cells, reading of results and estimation of quantity of cells, which bound in one or several parts of biochip of the given area, are performed. In conclusion, analysis of the image of bound cells is carried out. Before carrying out fixation from biochip surface excess of liquid is removed, without permitting it to dry.

EFFECT: improvement of technology.

4 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: blood serum is analysed for the contents of human tissue inhibitor of matrix metalloproteinases (hTIMP-1) by an ELISA technique. If hTIMP-1 ranges within 138 ng/ml to 183 ng/ml, the presence of early subclinical renal irritation in the patients suffering hypertensive disease with normal glomerular filtration rate with the absence of microalbuminuria is stated.

EFFECT: use of the technique allows diagnosing early subclinical renal irritation in the suffering hypertensive disease with normal glomerular filtration rate with the absence of microalbuminuria, use of the technique makes it possible to control clinical effectiveness.

2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: blood serum of a patient on her 38-40 week of pregnancy is analysed for the lactoferrin (LF) contents. If observing the LF value 4.5 mcg/ml and less, the absence of a pre-natal foetal infection and birth of a healthy child 8-9 points by Apgar score are predicted. If observing the LF value 4.5 mcg/ml and more, the presence of a pre-natal foetal infection and birth of a healthy child underevaluated by Apgar score 7 and less.

EFFECT: use of the method allows of high-accuracy prediction of a foetal condition and the presence of the pre-natal infection that allows optimising a therapeutic approach in newborns and well-timed treatment of the pre-natal infection.

2 ex

FIELD: medicine.

SUBSTANCE: method involves bacteria transfer from a sample in phosphate-buffered saline, addition of a magnetic particle suspensions with antibodies fixed thereon to certain types of bacteria, incubation with mixing. A magnetic sampler probe with a replaceable nonmagnetic tip is introduced into an incubating tank where a magnetic field generated by the magnetic sampler probe makes the complexes of magnetic particles - antibodies - bacteria to be collected on the tip; the sampler probe is transferred to a distilled water tank for washing from bacteria not bonded with antibodies. Final re-slurrying is ensured by transferring the sampler probe into the distilled water tank and separating the nonmagnetic tip from the magnetic probe; mixed magnetic particles and complexes of a magnetic particle - an antibody - bacteria are transferred in an aqueous medium which is placed in a measuring cell of an electro-optical analyser wherein a variable electric field is generated to record changes of optical properties of the suspension, in the form of a frequency dispersion of anisotropy of polarizability (FDAP) which provides a basis to state the presence or absence of target bacteria in the sample in case of the presence or absence of a FDAP peak ranging within 100 to 10000 kHz respectively.

EFFECT: invention allows simplifying and accelerating a bacteria identification process, and carrying it out in an automatic mode.

2 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: method involves DNA genome recovery of an examined woman followed by PCR analysis of site of MTHFR and PAH genes by mixing the components and adding oligoprimers, and analysis of polymorphism of restriction fragment lengths and visualisation of electrophoregram in a polyacrylamide gel. For amplification for the purpose of analysis of the site of MTHFR gene, an upstream primer CCAGTCCCTGTGGTCTCTTCAT and a downstream primer AGGGAGCTTATGGGCTCTCCT are used; for the purpose of analysis of the site of PAH gene, an upstream primer CAGAGAGAGTCTGGCCACGT and a downstream primer CGTGATTGTCTAGGTTTTGTCTGTCTAGG are used. If observing the MTHFR 677T/T and/or PAH -675 4G/4G, a risk of gestosis is predicted.

EFFECT: higher accuracy of prediction of risk of gestosis.

2 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: patient is examined for a level of D-dimer one day before and after consistently alternating pneumatic compression (CAPC) of lower extremities. If observing the level of D-dimer increased in a second sample, the presence of latent intravascular fibrin formation is diagnosed.

EFFECT: use of the technique allows detecting high risk of thromboses at the early stages of thrombogenesis in the patients with thromboses of any localisation in past history and differentiating approaches to prescribing a therapy in such patients.

2 ex

FIELD: medicine.

SUBSTANCE: method includes using a monoclonal A3 antibody for detection of a proliferation marker - nucleolar protein A3 followed by visualisation of positive focuses. A process of proliferation is shown by increasing focuses of A3 antigen localisation from one in G0 phase to 8-10 focuses in an S-period of a cell cycle.

EFFECT: invention allows evaluating effectively a condition of proliferative activity of human lymphocytes.

2 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: method for producing EHF Diagnosticum by reproduction of four hantaviruses - Puumala strain PUU-TDK/VERO, Dobrava strain DOB-EAT-VERO, Hantaan strain Ussuri-4590 and Seoul strain SK-515/Georgia-88, in a monolayer passaged cell culture of VERO-line grass monkey kidneys, followed by virus-specific antigen concentration test, polyvalent antigen production, antigen fixation on a slide and UV processing.

EFFECT: invention provides a more sensitive diagnostic test, presenting a low-price production process and more effective use of the EHF Diagnosticum.

4 cl, 2 ex, 1 tbl

FIELD: medicine, ophthalmology.

SUBSTANCE: in lacrimal liquid one should detect the content of interleukin 8 (IL-8) and that of interleukin 1 beta (IL-1β) to calculate prognostic coefficient (PC) due to dividing the first value by the second one by the following formula: At PC value being below 10.0 one should predict favorable disease flow, and at PC value being above 10.0 - unfavorable flow.

EFFECT: higher accuracy of prediction.

2 ex

FIELD: medicine, medicinal microbiology.

SUBSTANCE: method involves growing microorganism culture to be studied in solid nutrient medium followed by preparing microbial suspension and its incubation in the presence of lactoferrin. Control sample is prepared in parallel series. Control and experimental samples are incubated, supernatant is removed from bacterial cells and lactoferrin concentration is determined in supernatant of experimental and control sample by immunoenzyme analysis. Then anti-lactoferrin activity is calculated by difference of concentrations of residual lactoferrin in experimental and control samples. This method provides enhancing the sensitivity and precision in carrying out the quantitative evaluation of anti-lactoferrin activity in broad spectrum of microorganisms that is urgent in diagnosis and prognosis of diseases with bacterial etiology. Invention can be used in determination of persistent indices of microorganisms for assay of their etiological significance in pathological processes.

EFFECT: improved assay method.

3 tbl, 3 ex

FIELD: medicine, biology.

SUBSTANCE: invention relates to nutrient medium used for accumulation of cells for the following cytological and/or immunocytochemical analysis carrying out. Invention relates to medium containing salts NaCl, KCl, anhydrous CaCl2, MgSO4 x 6 H2O, MgCl2 x 6 H2O, Na2HPO4 x 2 H2O, KHPO4, NaHCO3, and also glucose and Henx's solution, 10% albumin solution and polyglucin taken in the ratio 1:1:1. Invention provides enhancing the preservation of cells.

EFFECT: improved an valuable properties of nutrient medium.

3 ex

FIELD: medicine, cardiology.

SUBSTANCE: in peripheral blood one should detect the level of CD95(+) and CD16(+) neutrophilic granulocytes and at combination of increased level of CD95(+) neutrophilic granulocytes by 4 times and more and CD16(+) neutrophilic granulocytes by 0.6 times against the norm with ECG signs of myocardial infarction one should predict lethal result of large-focal myocardial infarction.

EFFECT: higher accuracy of prediction.

FIELD: medicine, parasitology.

SUBSTANCE: one should carry out immunoenzymatic assay to detect diagnostic optic density and that of labeled immune complex in a plot's hole with tested serum measured in conventional units at wave length being 492 nm. One should calculate coefficient of antibodies concentration measured in conventional units by the following formula: CAC = (Odtsh - Odd) x 100, where CAC - coefficient of antibodies concentration, Odtsh - optic density of the hole with tested serum, Odd - diagnostic value of optic density, 100 - coefficient of serumal dilution. By CAC value one should detect the titer of antibodies to Lamblia intestinalis antigens to interpret results of the trial. The method enables to study the dynamics of disease flow.

EFFECT: higher efficiency and accuracy of diagnostics.

1 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: the present innovation deals with studying and treating diseases of inflammatory, autoimmune and degenerative genesis. One should perform sampling of heparinized blood followed by its sedimentation to obtain blood plasma with leukocytes and centrifuging to isolate the latter which are washed against erythrocytic and serumal admixtures, and, also, it deals with calculating the number of cells in samples out of leukocytic suspension after incubation (B) for 1.5 h at 37 C in holes of plastic microplotting board, out of leukocytic suspension one should additionally prepare two samples, one should be applied to calculate total number of leukocytes before incubation (A), the second sample undergoes incubation at the same mode at addition of autoserum to calculate the number of cells remained after incubation (C). One should state upon adhesive properties of leukocytes by the index of spontaneous adhesion (D), where D=(A-B)/B.100%, and effect for enhanced cellular adhesion under the impact of autoserum should be detected by the value of K=(B-C)/C.100% at K ≥ 30%, where B - C - the number of cells undergone additional adhesion after addition of autoserum. The present innovation widens functional possibilities of the suggested method due to obtaining additional values depicting adhesive properties of blood leukocytes.

EFFECT: higher accuracy of detection.

FIELD: medicine, immunology.

SUBSTANCE: one should carry out reaction of blast-transformation, detect proliferation of T-lymphocytes activated with antibodies to CD3 in the presence of interleukin-7 (ACT IL-7) and in the presence of interleukin-7 and dexametazone (ACT IL-7 D), calculate the index for dexametazone action as the ratio of ACT IL-7 to ACT IL-7 D, moreover, the value of dexametazone action index being above 1.2 indicates increased production of cytokins that suppress T-lymphocytes in neonatals. The method enables to detect functional defect of immune system that characterizes neonatal period.

EFFECT: higher efficiency of detection.

2 ex

FIELD: medicine.

SUBSTANCE: method involves measuring forced exhalation volume per 1 s (FEV1) in l, full right ventricle evacuation time (RVE) in ms and angiotensin II value (AII) in ng/l. Discriminant relationship is built as D=0.504·RVE+3.038·FEV1 - 2.0·AII. D being less than 83.88, pulmonary hypertension occurrence is predicted within 1 year. D being equal to or greater than 83.88, no pulmonary hypertension is predicted to occur.

EFFECT: enhanced accuracy of prediction.

FIELD: medicine, medicinal immunology.

SUBSTANCE: method involves determination of heterophilic antibodies in human serum blood by the Paul-Bunnel's method relatively the level of circulating immune complexes, complement-activating properties of heterophilic antibodies by incubation of standardized ram erythrocytes with 0.8% serum for 30 ± 5 min and the following measurement of the erythrocytes lysis degree. The measurement of the effector function coefficient of heterophilic antibodies is carried out by the complement system Keff.f.h.a.-c.s. by the formula: Keff.f.h.a.-c.s. = Y/Tg.a. wherein Y means a lysis degree, %; Tg.a. means a reverse titer of heterophilic antibodies to ram erythrocytes. The damage assay is carried out by comparison of the immune status with the relative level of circulating immune complexes in serum. Method provides detection of preclinic from of immunodeficiency and autoimmune diseases that opens the possibility for their prophylaxis at most early stages of development. Invention can be used for assay of damage in the immune status in human serum blood.

EFFECT: improved method for assay.

5 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method involves concurrently examining anti-inflammatory IL-4 level in blood serum and lacrimal fluid. The value being within the limits of 60-70 pg/l in blood serum and 5-15 pg/l in lacrimal fluid, disease prognosis is considered to be unfavorable. The IL-4 concentration being within the limits of 90-100 pg/l in blood serum and 20-30 pg/l in lacrimal fluid, disease prognosis is considered to be favorable.

EFFECT: high accuracy of diagnosis.

Up!