Method of predicting development of complications of hemorrhagic fever with renal syndrome in early period of disease

FIELD: medicine.

SUBSTANCE: invention describes method of estimating severity of course of hemorrhagic fever with renal syndrome, which includes determination of marker of vessel endothelium dysfunction in blood, where in blood plasma as marker of vessel endothelium dysfunction determined is concentration of antigen of inhibitor of plasminogen 1 type (IAP-1) activators in febrile period of disease and value of IAP-1 antigen concentration from 341.2 to 570.0 ng/ml is estimated as predictor of moderate form of disease, from 240.0 to 320.1 ng/ml - as predictor of severe form of disease without complications, from 138.3 to 75.5 ng/ml value is estimated as predictor of severe form of disease with complicated course.

EFFECT: invention makes it possible to estimate severity of HFRS course in order to predict in the earliest terms development of disease complications.

1 tbl, 3 ex

 

The invention relates to medicine, namely to the section of infectious diseases, and can be used to predict the development of such severe complications of hemorrhagic fever with renal syndrome (HFRS), acute renal failure, disseminated intravascular coagulation, infectious-toxic shock, rupture of the kidney, acute respiratory failure, etc. in the initial period - the period of fever. The possibility of forecasting of development of these complications in the early period of the disease will allow us to choose adequate treatment to reduce the frequency of their occurrence and severity.

HFRS - acute viral natural focal disease caused by viruses of the genus Hantavirus, serotype Puumala. Feature pathomorphological picture of the disease is systemic affecting the small vessels - arterioles, capillaries and venules with the development of inflammatory and destructive necrotic changes in all layers of the vascular wall. Characteristic is swollen-destructive vasculitis, which is expressed in the loosening of the walls of small vessels, swelling of adventitia, swelling and desquamation of endothelial, subsequently causing more or less severe hemorrhages in various organs and tissues. The maximum intensity of these changes observed is conducted in those bodies, in which there is an extensive system of microcirculation in the kidney, adrenal, lung, and pituitary gland, and Central nervous system, with the development of the syndrome of disseminated coagulation (Fazliev P.M. Hemorrhagic fever with renal syndrome in the Republic of Bashkortostan / Rempala, Djhousefire, Fchimero // Ufa, 1995; Somov-Vackova L.M. Photomorphogenic hemorrhagic fever with renal syndrome: from past to future / Lamba-Vackova, Ngeleja // Hantaviruses and Hantavirus infection: Materials, dedicated to the 70th anniversary of the study of HFRS in the far East. - Vladivostok, 2003. - Pp.182-200; Hemorrhagic fever with renal syndrome: current problems in the epidemiology, pathogenesis, diagnosis, treatment and prevention. Edited Rssmate. - Ufa: Gil, 2006. - 238 S.).

There are several ways to assess the severity of HFRS, taking into account the dynamics of the various indicators. These methods are:

1) a method of assessing the severity of HFRS by the severity of major clinical syndromes, the presence and duration of oligoanuria, level azotemii (creatinine and blood urea) and complications (application RU # 96100318, 1998). The disadvantage of this method is that not always the clinical picture of HFRS are all symptoms of the disease, which can be assessed tegest is. As a rule, when determining the severity of HFRS main criterion is the level azotemii, but there are severe forms of the disease, complicated toxico-infectious shock, hemorrhagic manifestations in unmodified indicators creatinine and urea. At the same time the determination of creatinine and urea in blood serum (Debts Century Clinical-diagnostic value of laboratory parameters / Dolgov, Vladimir Morozov, Remorselessly etc. // M, 1995) allows us to estimate only the violation of renal excretory function: glomerular filtration, and for HFRS, as is well known, characterized by various abnormalities in the activity of tubulointerstitial apparatus of the kidneys with prolonged decline canalave functions, especially concentration (Sirotin B.Z. Hemorrhagic fever with renal syndrome / Bsetroot // Khabarovsk, 1994). Another drawback of this method is its unacceptability to predict the development of complications HFRS;

2) a method of evaluating the severity level of prostaglandin E2in the blood plasma of patients with hemorrhagic fever with renal syndrome (patent RU №2155337, 2000). The disadvantage of this method is the need to determine the concentration of this prostanoid in the course of disease, that is not in the earliest time, and it is also not possible to predict the development of complications of HFRS, which reduces diagnostic valuable the proposed method;

3) there is a method of assessing the severity of HFRS at the end of the stable metabolites of nitric oxide (NOx) in whole blood (patent RU №2245552, 2005). However, the application of the proposed method in clinical practice has certain limitations due to the significant dependence on other sources of nitrites and nitrates, including foodborne. In addition, this method also does not allow to predict joining in subsequent menacing to life complications during the initial period of the disease.

The prototype of the invention is a method of evaluating the severity of HFRS, namely, that in the peripheral venous blood to determine the content of circulating endothelial cells (TSEK), and increase commissions to 6.4-10×104/l is estimated as moderate form of HFRS; increased commissions to 10.7 and 14.6×104/l as severe form of the disease without complications, increased level commissions to 14.9-21,0×104/l on the background of severe clinical picture is regarded as a severe form of HFRS with complicated course (patent RU №2392858, 2010). The proposed method of assessing the severity of HFRS also cannot be used to predict the development of complications of the disease at the earliest date.

The vascular endothelium is a single layer of thin cells covering inner walls of the vessel and having an extremely high metabolism, clean eskay and secretory activity. He plays a key role in the regulation of muscle tone and growth of blood vessels, with the processes of leukocyte adhesion in the balance profibrinolytic and prothrombogenic activity and other functions (Haller, H.Endothelial function. General considerations / H.Haller // Drugs. - 1997; 53, Suppl.1. - pp.1-10) by the synthesis and secretion of these active substances, as an inhibitor of tissue plasminogen activators type 1 (IAP-1), tissue inhibitor of activator plasminogen, endothelin-1, nitric oxide, prostaglandin E2, thromboxane, prostacyclin, cell adhesion molecules, angiotensinase enzyme, etc. Due to the unique location of this internal lining on the border between blood and tissues of its cells - endothelial cells - the first to meet with various pathogenic factors in the system flow, the first involved in the process of limiting the action of damaging agents (viruses, small molecules, free radicals and other) and therefore they are more susceptible to damage. The vascular endothelium is involved in the early stages in the pathogenesis of diseases such as coronary heart disease, hypertension, diabetes, and diseases of viral etiology, including hemorrhagic fever with renal syndrome (HFRS) (Vane J.R.Regulatory functions of the vascular endothelium / J.R.Vane, E.E.Anggard, R.M.Botting // New England Jornal of Medicine 1990; 323 - p.27-36.; Lusher T.F. Biology of endothelium / T.F.Lusher, M.Barton // Clin. Cardiol.,1997; 10 (suppl.11), II-3 to II-10), as the causative agent of hemorrhagic fever with renal syndrome refers to viruses, exhibiting a pronounced tropism to the cells of the inner lining of blood vessels (Smorodintsev A.A. Hemorrhagic, nefrosa-jade / May, Vchodove, Awilo // M.: Medicine, 1953. - 126 S.; Bashkirov T.A. Modern aspects of morphogenesis hemorrhagic fever with renal syndrome / Tashakkori, Uggabugga // Haemorrhagic fever with renal syndrome in the Middle Volga and Urals: Sat. scient. works - L., 1980. - P.84-103.; Fazliev P.M. Hemorrhagic fever with renal syndrome in the Republic of Bashkortostan / Rempala, Djhousefire, Fchimero // Ufa, 1995. - 343 C.). The pathogenic nature of the disease is the defeat of the walls of the small vessels with the development of inflammatory and destructive-necrobiotic processes (Suzdaltsev A.A. Hemorrhagic fever with renal syndrome (modern assessment criteria severity, treatment and prognosis) / Ala // abstract. thesis... Dr. med. Sciences. - SPb., 1992. - 19 C.). After repeated cycles of intracellular reproduction of Hantavirus increases the degree of damage of endothelial cells with subsequent detachment from the basal membrane. The effect of changing the architectonics of the inner lining of blood vessels is impaired production by endothelial cells of mediators, provide them the norm optimal for all endothelium-dependent processes. As a consequence of increased vascular permeability, increase its thrombogenicity and leukocyte adhesion, impaired vascular tone, and this is one of the reasons for mutual gain numerous "vicious circles" in the pathogenesis of hemorrhagic fever with renal syndrome.

From the accuracy assessment of the severity of the disease in the earliest periods depends on both the adequacy and duration of therapy, and the ability to predict disease outcome and complications.

Object of the present invention to provide an efficient and simple method of predicting the development of complications of HFRS in the initial period of the disease (during fever).

The technical result when using the invention, an early assessment of the severity of HFRS and prediction of complications of the disease, improving the accuracy and objectivity of the method.

The proposed method is as follows.

In the initial period of the disease (during fever) are determining the concentration of an inhibitor of plasminogen activators type 1 (IAP-1) at the level of antigen in plasma. The patient fasting take blood from the cubital vein in the amount of 1-2 ml, determination performed by ELISA according to the instructions attached to the kit. The test is based on the "sandwich"method tverdofazno the th enzyme immunoassay. During the first incubation the antigen IAP-1 binds to immobilized in the wells by antibody single binding site. After washing added biotinylated antibodies against antigen IAP-1, which during the second incubation, bound to the immobilized antigen molecules IAP-1, who contacted in the first incubation. After removal of excess second antibody is added to the streptavidin-peroxidase, which binds to biotinylating antibodies with the formation of a sandwich complex of the four reagents. After a third incubation and washing removes unbound enzyme, and then added the substrate solution, which interacts with the enzyme with the formation of the colored complex. The colour intensity of the solution is directly proportional to the concentration of antigen IAP-1 present in the sample.

The increase in blood of patients with HFRS concentration of antigen IAP-1 in the period of fever from 341,2 to 570,0 ng/ml was evaluated as a predictor of moderate forms of the disease, increase in blood of patients with HFRS concentration of antigen IAP-1 in the period of fever from 240,4 to 320,1 ng/ml as a predictor of severe disease without complications and a reduction in the blood of patients with HFRS concentration of antigen IAP-1 in the period of fever from 138,3 to 75.5 ng/ml was evaluated as a predictor of severe disease with a complicated course. The level of antigen is AP-1 in plasma of the control group ranged from 193,0 to 263,3 ng/ml.

The comparison of the proposed solutions not only prototype, but other solutions in this field of medical science has shown that the best way to assess the severity of HFRS in order to predict the development of complications is the determination of plasma levels of antigen IAP-1 in the period of the height of the disease. It is essential for the timely choice of tactics of conducting the patient, adequate severity to prevent the development of complications.

The identified feature that distinguishes the inventive method allows to make a conclusion on compliance with a criterion of "inventive step".

We studied 114 patients with serologically confirmed by indirect fluorescent antibody diagnosis of HFRS (97 men and 17 women) aged 15 to 65 years (average age is 39.1±3,4 years)who were hospitalized in MU Infectious clinical hospital №4" Ufa and in the haemodialysis Department of the Republican clinical hospital. GG Kuvatova in 2003-2009. Exclusion criteria from the study were a history of hypertension, heart disease and blood vessels, diabetes, malignant diseases, diseases of the liver and kidneys. The intermediate form were detected in 49 patients (43%), severe without complications in 37 patients (32.5%), the heavy with complicated course - at 28 ill the (25,5%). The control group consisted of 26 healthy individuals, matched by sex and age. Results determine the concentration of antigen IAP-1 was performed using a standard statistical software package Statistica 7.0 for Windows: determined the median and interquartile range [25%; 75%]. The critical level of confidence the null statistical hypothesis p was taken equal to 0.05.

The results showed that the level of antigen IAP-1 in plasma of patients with HFRS in febrile period depends on the severity of the disease (see table). So, in a feverish period of moderate forms of HFRS concentration detectable substance in the blood plasma was 420,0 [341,2; 570,0] ng/ml (p=0.01), severe without complications - 296,7 [240,4; 333,8] ng/ml (p=0.04), severe complications - 108,0 [75,5; 138,3] (p=0.03)in the control group 220,8 [193,0; 263,3]. Thus, in all forms of disease severity is a statistically significant deviation of the concentration of the inhibitor from control values, but if in the initial period with moderate and severe uncomplicated forms exhibit an increase of 1.9 and 1.3 times, respectively, in the same period of the complicated forms, on the contrary, a twofold reduction.

Stimulus for enhanced production by cells of the vascular endothelium IAP-1 in a feverish period of moderate and severe is th uncomplicated course of HFRS, it is possible that cytokines are the first generation of IL-1β and α, the expression of which in a given period of illness also increased [Baigildina A.A. Pathogenetic significance of some cytokines and protein cell adhesion VCAM-1 in the development of inflammatory changes of the vascular endothelium in hemorrhagic fever with renal syndrome / GLn, Athaliah, Fchimero // Morphological sheet. - 2008. - №3-4. - S-161]. Another direction of change of the concentration of antigen IAP-1 in the blood of patients during the initial period when severe complicated form of HFRS is two-fold reduction compared to control - can only be explained within the concept of cytokine stimulation, because metabolic changes in vascular endothelium that determine the development in subsequent DIC, infectious-toxic shock and other complications, as well as extensive damage to the endothelium [Kamilov FH the integrity of the vascular endothelium in HFRS / Fagamalo, GLn, Vchagaev // Morphology. - 2008. No. 4. - P.72] with the development of endotheliopathy will be involved in the pathogenesis of the disease and other mechanisms, in particular, increased fibrinolysis due to increased thrombogenicity blood vessels due to exposure of the subendothelial layer. Under these conditions, during the height of the disease, despite Wuxi is built cytokine stimulation, apparently, included mechanisms of inhibition of gene expression IAP-1.

Thus, determining the level of antigen IAP-1 in plasma of patients with HFRS in febrile period, it is possible to predict and assess the severity of illness and likelihood of joining life-threatening complications, as well as the degree of damage to the vascular endothelium producer IAP-1.

The proposed method is illustrated by the following examples.

Example 1. Patient K., aged 15, case history No. 11458/2010, enrolled in MU Infectious clinical hospital №4" Ufa on the 2nd day of illness with a diagnosis of Hemorrhagic fever with renal syndrome. When entering a serious condition caused by the severity of the intoxication syndrome and fever. Complaints at admission for pain in the lumbar region, the decrease in amount of urine, pain in the epigastrium. In the Department of patient once was vomiting. Olimpijski period lasted 5 days with a decrease in daily urine output of 100 ml, a rise in creatinine of up to 200.0 μmol/l, urea - to 20.0 mmol/l complete blood count: hemoglobin 159 g/l, erythrocytes of 5.26×1012/l, leukocytes 10,8×109/l, platelets 112,0×109/l, erythrocyte sedimentation rate 10 mm/h urine Analysis: hyposthenuria (tank weight to 1003), proteinuria (up to 1,315 g/l), microhematuria (up to 5-6-8 in the field of view), leukocyturia (up 2-3-4 in the field of view), cylindruria (granular - to 3-3-4; hyaline to 4-3-4 field is rhenium). Before discharge indicators General clinical tests normalized. The level of antigen IAP-1 in plasma was determined in the dynamics of the disease: 492,8 ng/ml (febrile period), 213, 1 ng/ml (olimpijski period), 204,0 ng/ml (politicheskii period), 134,2 ng/ml (restored period of diuresis. Clinical diagnosis: Hemorrhagic fever with renal syndrome, moderate to severe form. Antibody titer (IIF) - 1:256 1:1024 (increase in antibody titer in 4 times). The concentration of antigen IAP-1 in the blood plasma of the patient in febrile period exceeded the reference value is 2.23 times.

Example 2. Patient K., 23 year history No. 12095/1735, did MU Infectious clinical hospital №4" Ufa on the 2nd day of illness with a diagnosis of Hemorrhagic fever with renal syndrome. When entering a serious condition expressed by the phenomena of intoxication, fever, aching joints, pain in the lumbar region. Olimpijski period lasted 5 days with a decrease in daily urine output of 100 ml At admission in the General blood analysis: hemoglobin 139 g/l, erythrocytes 4,47×1012/l, leukocyte count of 20.2×109/l, platelets 100×109/l, ESR 15 mm/HR In the General analysis of urine: hyposthenuria (tank weight 1000), proteinuria (up to 2,457 g/l), cells Dunaevsky to 3-2-2 in the field of view, erythrocytes to 5-7-8 in the field of view, leukocytes to 5-6-6 in the field of view, cylinders: granular to 5-4-4 in the field of view of the Oia, galinova to 1-10 in the field of view, waxy until 0-1-0 in the field of view. In the biochemical analysis of the increase in creatinine was determined to 637,0 µmol/l, urea up to 57.0 mmol/l and then decreased to the statement: creatinine up to 102 µmol/l, urea - to 8.1 mmol/L. the Level of antigen IAP-1 in a feverish period amounted to AZN 264.2 ng/ml, oligarchism - 115, 3 ng/ml, politicheskoi - 198,9 ng/ml, recovered diuresis - 92,2 ng/ml Clinical diagnosis: Hemorrhagic fever with renal syndrome, a severe form without complications. Antibody titer (IIF) - 1:64 and 1:1024. Antigen content IAP-1 in the blood plasma of the patient in febrile period exceeded control values by a factor of 1.2.

Example 3. Patient F., 54, is a case history No. 2007/20020, entered the RSC them. GG Kuvatova on the 5th day of the disease. When entering a critical condition, objectively: single petechiae on the front chest, vascular injection of the sclera, enanthema throat. From the anamnesis it is known that the patient was feverish all days of the disease, complained of pain in the eyeballs, nasal congestion, pain in the abdomen, lower back, was vomiting up to 4 times. The patient on the severity of the condition was hospitalized in the haemodialysis Department. Olimpijski period lasted 7 days with a decrease in daily urine output of 50 ml total blood analysis: hemoglobin 133 g/l, erythrocytes to 4.14×1012/l, leukocytes 22,7×109/l, platelets 273,0×0 9/l, erythrocyte sedimentation rate of 50 mm/h In the General analysis of urine on the day of admission was determined: protein - 19,8 g/l, erythrocytes in large quantities in the field of view, leukocytes 20-22-25 in the field of view, a single granular cylinders 0-0-1 in the field of view. In the biochemical analysis of the rise of creatinine was determined to 790,0 µmol/l, urea to 38.0 mmol/L. the Level of antigen IAP-1 in a feverish period decreased down to 91.3 ng/ml, oligarchism period amounted to 224,2 ng/ml, politicheskoi is 253.7 ng/ml, recovered diuresis - 179,6 ng/ml Given the clinic and the results of additional methods of research, exhibited clinical diagnosis: Hemorrhagic fever with renal syndrome, a severe form. Complications: toxic shock I-II degree, acute renal failure, DIC, hematoma of the right kidney, acute erosive gastritis. Antibody titer (IIF) - 1:1024 1:1024. The concentration of the studied antigen inhibitor of plasminogen activators type 1 in the period of fever lower control 2.4 times.

The advantage of the proposed method is that the determination of the level of antigen IAP-1 in plasma of patients with HFRS can objectively and in a timely manner to assess the severity of hemorrhagic fever with renal syndrome in the period of fever in order to predict the accession of life-threatening complications.

How iincident flow hemorrhagic fever with renal syndrome, including the identification token dysfunction of vascular endothelium in the blood, characterized in that in plasma as a marker of endothelial dysfunction vascular determine the concentration of antigen inhibitor of plasminogen activators of the 1st type (IAP-1) in febrile period of the disease and the value of the concentration of antigen IAP-1 from 341,2 to 570,0 ng/ml was evaluated as a predictor of moderate forms of the disease, from 240,4 to 320,1 ng/ml as a predictor of severe disease without complications from 138,3 to 75.5 ng/ml was evaluated as a predictor of severe disease with a complicated course.



 

Same patents:

FIELD: medicine.

SUBSTANCE: method includes determining complex of serum cytokines in period of disease beginning. In case of tick-born encephalitis level of interleukin-1 α is determined in interval 298-358 pg/ml, interferon-γ-295-350 pg/ml and interleukin-10-115-150 pg/ml; at ixodid tick-borne borreliosis - interleukin-1 α 178-270 pg/ml, interferon-γ 125-190 pg/ml and interleukin 10-11.5-18 pg/ml; in case of mixed infection, generated by virus of tick-borne encephalitis and borrelia - interleukin-1 α- 30-75 pg/ml, interferon-γ 115-130 pg/ml and interleukin-10 -22-65 pg/ml.

EFFECT: method is simple, makes it possible to determine disease causative agent reliably and accurately in short terms.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: described is method of cell analysis by means of biochip, containing immobilised molecules of substances, able of binding with molecules, which are on the surface of cells, includes incubation of biochip with suspension of cells. Then, washing of biochip from nonspecifically bound cells is carried out. After that, fixation and staining of cells, reading of results and estimation of quantity of cells, which bound in one or several parts of biochip of the given area, are performed. In conclusion, analysis of the image of bound cells is carried out. Before carrying out fixation from biochip surface excess of liquid is removed, without permitting it to dry.

EFFECT: improvement of technology.

4 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: blood serum is analysed for the contents of human tissue inhibitor of matrix metalloproteinases (hTIMP-1) by an ELISA technique. If hTIMP-1 ranges within 138 ng/ml to 183 ng/ml, the presence of early subclinical renal irritation in the patients suffering hypertensive disease with normal glomerular filtration rate with the absence of microalbuminuria is stated.

EFFECT: use of the technique allows diagnosing early subclinical renal irritation in the suffering hypertensive disease with normal glomerular filtration rate with the absence of microalbuminuria, use of the technique makes it possible to control clinical effectiveness.

2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: blood serum of a patient on her 38-40 week of pregnancy is analysed for the lactoferrin (LF) contents. If observing the LF value 4.5 mcg/ml and less, the absence of a pre-natal foetal infection and birth of a healthy child 8-9 points by Apgar score are predicted. If observing the LF value 4.5 mcg/ml and more, the presence of a pre-natal foetal infection and birth of a healthy child underevaluated by Apgar score 7 and less.

EFFECT: use of the method allows of high-accuracy prediction of a foetal condition and the presence of the pre-natal infection that allows optimising a therapeutic approach in newborns and well-timed treatment of the pre-natal infection.

2 ex

FIELD: medicine.

SUBSTANCE: method involves bacteria transfer from a sample in phosphate-buffered saline, addition of a magnetic particle suspensions with antibodies fixed thereon to certain types of bacteria, incubation with mixing. A magnetic sampler probe with a replaceable nonmagnetic tip is introduced into an incubating tank where a magnetic field generated by the magnetic sampler probe makes the complexes of magnetic particles - antibodies - bacteria to be collected on the tip; the sampler probe is transferred to a distilled water tank for washing from bacteria not bonded with antibodies. Final re-slurrying is ensured by transferring the sampler probe into the distilled water tank and separating the nonmagnetic tip from the magnetic probe; mixed magnetic particles and complexes of a magnetic particle - an antibody - bacteria are transferred in an aqueous medium which is placed in a measuring cell of an electro-optical analyser wherein a variable electric field is generated to record changes of optical properties of the suspension, in the form of a frequency dispersion of anisotropy of polarizability (FDAP) which provides a basis to state the presence or absence of target bacteria in the sample in case of the presence or absence of a FDAP peak ranging within 100 to 10000 kHz respectively.

EFFECT: invention allows simplifying and accelerating a bacteria identification process, and carrying it out in an automatic mode.

2 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: method involves DNA genome recovery of an examined woman followed by PCR analysis of site of MTHFR and PAH genes by mixing the components and adding oligoprimers, and analysis of polymorphism of restriction fragment lengths and visualisation of electrophoregram in a polyacrylamide gel. For amplification for the purpose of analysis of the site of MTHFR gene, an upstream primer CCAGTCCCTGTGGTCTCTTCAT and a downstream primer AGGGAGCTTATGGGCTCTCCT are used; for the purpose of analysis of the site of PAH gene, an upstream primer CAGAGAGAGTCTGGCCACGT and a downstream primer CGTGATTGTCTAGGTTTTGTCTGTCTAGG are used. If observing the MTHFR 677T/T and/or PAH -675 4G/4G, a risk of gestosis is predicted.

EFFECT: higher accuracy of prediction of risk of gestosis.

2 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: patient is examined for a level of D-dimer one day before and after consistently alternating pneumatic compression (CAPC) of lower extremities. If observing the level of D-dimer increased in a second sample, the presence of latent intravascular fibrin formation is diagnosed.

EFFECT: use of the technique allows detecting high risk of thromboses at the early stages of thrombogenesis in the patients with thromboses of any localisation in past history and differentiating approaches to prescribing a therapy in such patients.

2 ex

FIELD: medicine.

SUBSTANCE: method includes using a monoclonal A3 antibody for detection of a proliferation marker - nucleolar protein A3 followed by visualisation of positive focuses. A process of proliferation is shown by increasing focuses of A3 antigen localisation from one in G0 phase to 8-10 focuses in an S-period of a cell cycle.

EFFECT: invention allows evaluating effectively a condition of proliferative activity of human lymphocytes.

2 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: method for producing EHF Diagnosticum by reproduction of four hantaviruses - Puumala strain PUU-TDK/VERO, Dobrava strain DOB-EAT-VERO, Hantaan strain Ussuri-4590 and Seoul strain SK-515/Georgia-88, in a monolayer passaged cell culture of VERO-line grass monkey kidneys, followed by virus-specific antigen concentration test, polyvalent antigen production, antigen fixation on a slide and UV processing.

EFFECT: invention provides a more sensitive diagnostic test, presenting a low-price production process and more effective use of the EHF Diagnosticum.

4 cl, 2 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: on 5-7 day after pelvis trauma blood serum is analysed and concentration of polypeptides of type 1 collagen (CICP, ng/ml), concentration of osteotropic cytokine - osteprotegerin (OPG, pmol/k) and prothrombin by Quick (%) are determined. Values of prothrombin by Quick and OPG concentration are used to calculate value of discriminant function: F(Y1, Y2) = 0.170767466 · Y1 - 2.15811515 · Y2 - 13.11227538 (1) where Y1 is prothrombin value bu Quick, %, Y2 is Ln (natural logarithm) of OPG concentration in blood serum, pmol/l. If CICP value constitutes less than 146 ng/ml, and value F>0, absence of complications in post-operation period is predicted. If CICP value is higher than 146 ng/ml, and value F<0, patient is referred to group of risk on development of complications in post-operation period.

EFFECT: application of method makes it possible to predict risk of developing complications of traumatic disease course in post-operation period before surgery.

1 tbl

FIELD: medicine.

SUBSTANCE: hematocrit is determined in patient's blood and in drainage content. Ratio of drainage content hematocrit to blood hematocrit is calculated. If its value is less than 0.05 absence of hemorrhage is diagnosed, if the value is from 0.05 to 0.2 capillary hemorrhage is diagnosed, from 0.2 to 0.5, diffusive hemorrhage is diagnosed, over 0.5 vascular hemorrhage is diagnosed.

EFFECT: methods application makes it possible to increase accuracy of internal hemorrhage diagnostics in short terms and at early stages of disease.

2 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of medicine. For laboratory diagnostics of early disorders of liver functional state activity of ALT, AST, LDH, GGT, ALP, total bilirubin are measured. Additionally carried out is 3-minute long occlusion of shoulder vessels - "cuff test" (CT) to create short-timer hypoxia. Indices of liver functional activity are determined by the following formulas: ALT index=((ALT after CT - ALT before CT)/ALT before CT)*100%; AST index=((AST after CT - AST before CT/AST before CT)*100%; LDH tot = ((LDH after CT - LDH before CT)/LDH before CT)*100%; ALP index=((ALP after CT - ALP before CT)/ALP before CT)*100%; GGT index=((GGT after CT - GGT before CT)GGT before CT)*100%; Bilirubin index=((Bilirubin after CT - Bilirubin before CT)/Bilirubin before CT)*100%. If said indices increase by more than 10%, early disorder of liver functional state is diagnosed.

EFFECT: method increases diagnostics efficiency due to early detection of liver functional state disorders, preceding registered by laboratory methods changes in its functioning.

2 ex, 4 tbl

FIELD: medicine.

SUBSTANCE: pregnant woman suffering hypotheriosis and obesity on their 2-12 weeks of gestation are examined for a fT4 level. If the fT4 values are less than 10 pmol/l, macrosomic delivery is predicted.

EFFECT: use of the method enables high-accuracy prediction of macrosomic delivery.

2 ex

FIELD: medicine.

SUBSTANCE: multiple urine samples are taken during external exposure on a body for one day. Each sample is examined for the concentrations of thiols and urochrome that is followed by calculation of a thiol-urochrome coefficient (TUC) as a relation of the concentrations of thiols and urochrome. If the TUC value is 1.46±0.2, the body status is stated to be satisfactory. The TUC value more than 1.66 or less than 1.26 enables to state the status beyond the satisfactory limits.

EFFECT: use of the method allows analysing dynamics of the antioxidant body status, response to the external exposure, including to cosmophysical.

3 tbl, 3 ex, 3 dwg

FIELD: medicine.

SUBSTANCE: pH of thrombocyte-poor plasma, and a diagnostic coefficient D is calculated by formula: D=const1xPPP-const2, where D is a diagnostically significant coefficient, PPP is a pH value of thrombocyte-poor plasma of an examined patient, const1=18.877, const2=139.381. If D is less than 0.25, thrombocyte hyperaggregation is stated reliably, and the value of D exceeding 0.25 makes to state reliably the absence of thrombocyte hyperaggregation signs.

EFFECT: use of the declared technique allows high-accurate and sensitive evaluation of thrombocyte hyperaggregation.

3 ex

FIELD: medicine.

SUBSTANCE: invention describes a method for determining antibacterial resistance of a human body in diseases caused by a staphylococcus infection, based on blood neutrophil analysis; functional activity of neutrophilic granulocytes of patient's peripheral blood is determined by chemoluminescence with calculating a bacterial activation index (the BAI-index) of neutrophils representing the relation of an area under a curve of neutrophilic granulocyte chemoluminescence induced by Staphylococcus epidermidis bacteria to an area under a curve of spontaneous neutrophilic granulocyte chemoluminescence, and if the derived value is less than 1.47, a high level of antibacterial resistance is stated, while the derived values 1.47 and more shows a low level of antibacterial body resistance.

EFFECT: method is informative, precise, complies with the modern requirements for laboratory diagnostic techniques and allows predicting a nature, a clinical course period and bacterial complications in the patients of various groups.

1 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: method for prediction of rate of acute infectious diseases in infants with determining the immune status values on the first and fifth postnatal day: absolute lymphocyte count, differentiation marker carriers CD3, CD4, CD8, CD 19, CD56, CD95, a spontaneous nitroblue tetrazolium test value (NBTsp), a level of a phagocytic coefficient (PC), blood serum immunoglobulin A, M, G (IgA, IgM, IgG) concentrations, and further calculating a forecasting index (Ifor) with using a certain equation of multiple linear regression if Ifor does not exceed 3.2, a probability of no more than one acute infectious disease in an infant is concluded; if Ifor is within 3.2-3.7, 2 to 5 probable acute infectious diseases in an infant is stated; if Ifor exceeds 3.7, probability of more than 5 acute infectious diseases in an infant is concluded.

EFFECT: higher prediction accuracy.

2 ex

FIELD: medicine.

SUBSTANCE: complete blood count is performed, and the leukogram components are used to calculate integral hematological values: Calph-Caliph leucocytic intoxication index - LII1, Ostrovsky leucocytic intoxication index - LII2, stress index - SI, neutrophil-lymphocyte index - NLI, neutrophil-monocyte index - NMI, lymphocyte-monocyte index - LMI. If observing the values LII1≤2.5, LII2≤2.75, SI≤1.0, NLI≤11.0, NMI≤16.0, LMI≤2.0, a mild severity is detected. The values LII1 2.6 to 4.5, LII2 2.76 to 5.0, SI 1.1 to 2.0, NLI 11.1 to 15.0, NMI 16.1 to 24.0, LMI 2.1 to 2.5 enables to predict a moderate severity level. A severe level is ensured by LII1> 4.5, LII2> 5.0, SI> 2.0, NLI> 15.0, NMI> 24.0, LMI> 2.5.

EFFECT: use of the declared method allows higher objectivity of determining severity level of acute pancreatitis.

4 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: method of early solid malignant disease staging (at the stage of provisional clinical diagnosis) by cell number with stable ontogenetic disorders detected in patient's peripheral blood lymphocytes by quantitative and qualitative analysis of stable chromosomal and genomic disorders in metaphase plates from patient's peripheral blood lymphocytes.

EFFECT: method enables following disease change shift in response to treatment and determining clinical effectiveness.

5 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: method of diagnosing rejection of kidney allotransplant includes determination of phase height PH of peripheral blood live lymphocytes by method of phase-interference microscopy, determination of quantity of lymphocytes with phase height PH≤1.5 mcm, 1.5 mcm<PH≤2 mcm, 2 mcm<PH≤2.5 mcm, PH>2.5 mcm, selection of lymphocyte activity coefficients for each limit, said phase heights of lymphocytes equal k3=3, k2=2, k1=1, k0=0 respectively. Obtained data are used to determine functional activity of lymphocytes in sample by formula: FA=(k3n3+k2n2+k1n1+k0n0)/n, where n is number of lymphocytes in sample, n3 is number of lymphocytes with PH≤1.5 mcm, n2 is number of lymphocytes with 1.5 mcm<PH≤2 mcm, n1 is number of lymphocytes with 2 mcm<PH≤2.5 mcm, n0 is number of lymphocytes with PH>2.5 mcm, k3, k2, k1, k0 are coefficients of lymphocyte activity, and if value of lymphocyte functional activity is within FA=1.8-2.0, rejection of kidney transplant is diagnosed.

EFFECT: application of claimed method makes it possible to set diagnosis in due time, which considerably increases efficiency of anti-crisis therapy in post-transplantation period.

2 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: invention relates to laboratory methods for blood analysis. Plasma is dropped in copper sulfate solution with density 1.023 g/cm3, not above, and time for drop falling on bottom of graduated cylinder with column height 243 mm is measured. The blood plasma density value is calculated by the formula:

wherein is the unknown blood plasma density (g/cm3); is copper sulfate solution density measured by areometer (g/cm3); t is average falling time of plasma drop in the copper sulfate solution (as seconds); 0.260130126 and 0.00290695 are correction coefficients. Temperature of plasma and copper sulfate solution is 20oC. Method is simple and suitable and allows carrying out analysis of small volumes of blood plasma and to reduce analysis time.

EFFECT: improved assay method.

2 ex

Up!