Method of cell analysis by means of biochip

FIELD: medicine.

SUBSTANCE: described is method of cell analysis by means of biochip, containing immobilised molecules of substances, able of binding with molecules, which are on the surface of cells, includes incubation of biochip with suspension of cells. Then, washing of biochip from nonspecifically bound cells is carried out. After that, fixation and staining of cells, reading of results and estimation of quantity of cells, which bound in one or several parts of biochip of the given area, are performed. In conclusion, analysis of the image of bound cells is carried out. Before carrying out fixation from biochip surface excess of liquid is removed, without permitting it to dry.

EFFECT: improvement of technology.

4 dwg, 2 ex

 

The invention relates to the field of medicine, but can also be used in veterinary medicine and biology.

The known method of the study of cells using immunological biochips (see Liu, A.Y. Differential Expression of Cell Surface Molecules in Prostate Cancer Cells // Cancer Research. 2000, Vol.60, p.3429-3434), namely, that the biochip containing immobilized antibody is incubated with the cell suspension. Cells, having on its surface corresponding antigens bind to the antibodies immobilized in strictly defined areas of the substrate. Then biochip washed from the cells, contacting the immobilized antibody. Spend reading by microscopic examination of the biochip, which determines at which of its sites have been linking cells. So, establish the presence of a defined surface antigens of the studied cells.

The disadvantage of this method is that it is not possible staining and morphological analysis of cells. As a result, in the study of suspensions containing multiple cell types, cannot be determined with certainty on what cells contain one or the other of defined antigens.

The known method of the study of cells using immunological biochips (see A.V. Shishkin, I.I. Shmyrev, S.A. Kuznetsova, N., Ovcina is a, A. Butylin, FI Ataullakhanov, A.I. sparrows "Immunological biochips for parallel detection of surface antigens and morphological analysis of cells, Biological membranes, 2008, volume 25, No. 4, 277-284), taken as a prototype, which consists in the fact that the biochip containing immobilized antibody is incubated with the cell suspension. Cells, having on its surface corresponding antigens bind to the antibodies immobilized in strictly defined areas of the substrate (the spots of the biochip). Then biochip washed from the cells, is not specific to the contacting surface of the biochip, but not contacting the immobilized antibody. As a result, on the surface of the biochip remain only cells by contacting antibodies. After that, the biochip is dried in air, fixed with methanol, stained by Romanovsky-Giemsa and conduct morphological study of bound peroxidase cells. Perform the reading of the result, which receive the image spots of the biochip (surface area of the biochip with immobilized antibodies), in which the contacted cells. Determine the density of binding cells in each spot of the biochip (the ratio of the number of connected cells to the surface area of the plot). Analyze results. Thus, on the basis of the density values of the binding of cells obtained for each p the TNA, calculate the contents in cell suspension with appropriate surface antigens. In addition, conduct image analysis cells (morphological study) by direct microscopic examination of cells bound peroxidase in the stained area of the biochip, or by studying the images in the photographs spots. Conducting morphological analysis allows you to determine exactly what types of cells have on their surface a particular antigen.

The disadvantage of this method is that in the drying process of the biochip is a significant change in the morphological characteristics of the cells. The morphological examination of the cells are marked with their deformation, many cells have the characteristics of apoptosis. Part of the cells is destroyed. It complicates their detection. In spots with a high density of binding cells in some cases, cells are "fused" together. This complicates the determination of the density of their binding. The reason is that when drying biochip evaporation of water from remaining on the surface of drops of buffer solution. This leads to a gradual increase in the concentration of salts. The change in osmotic pressure causes deformation of cells and, in all likelihood, cause the processes leading to the launch is at the mechanisms of apoptosis.

Objective of the claimed invention is the preservation of the morphological characteristics contacting biochip cells, improving the accuracy and reliability of the results due to the exclusion of possible errors when carrying out morphological studies and determine the density of binding cells.

The problem is solved due to the fact that according to the method of the study of cells using a biochip containing immobilized molecules of substances which are able to bind with molecules located on the cell surface, including the incubation of the biochip with the cell suspension, washing the biochip from non-specifically bound peroxidase cells, fixation and staining of cells, the read result, the estimate of the number of cells bound peroxidase in one or more areas of the biochip given area, the image analysis of bound peroxidase cells before fixation with the surface of the biochip remove excess fluid, while preventing it from drying.

From the biochip prepare long-term preparation for microscopic examination.

During removal of the excess wash fluid biochip is placed in an atmosphere with high humidity.

The result of the use of the invention is to improve the accuracy and reliability of the results due to persistence of morphological characteristics is istic contacting biochip cells and avoid mistakes during their morphological studies and the determination of the density of binding cells.

Using the inventive method allows to prevent the change of cell shape, shape of the nucleus and other morphological characteristics of the cells, due to a change in osmotic pressure by evaporation of water from remaining on the surface of the biochip drops of buffer solution and apoptotic processes in cells. Adding locking liquids directly after removing excess wash solution is cell death without triggering the mechanism of apoptosis. It also doesn't change due to increasing concentrations of salts.

Of the biochip after performing the staining can be cooked long-term preparation for microscopic examination. This helps to protect its surface with bound peroxidase cells from damage and to repeatedly perform microscopic examination using oil immersion lenses. In addition, it allows indefinitely to keep the biochip after the research.

Performing manipulations associated with removing excess wash solution, under conditions of high humidity can slow or prevent drying of the surface of the biochip and allows you to increase the allowable period of time between the removal of excess wash solution and location of the biochip in the fixing liquid

The claimed method is illustrated by drawings (Fig.1-4).

Figure 1 presents the results of a study using the biochip cells of the patient C., 51 years old, with a diagnosis of chronic b-cell lymphocytic leukemia (b-CLL). In the diagram are expressed in percent density values of binding cells in the test areas of the biochip with the immobilized antibodies. These values numerically correspond to the percentage in the sample of cells with each of the defined antigens.

Figure 2 presents the micrograph sections spots (with immobilized antibodies specific to the antigen CD23) two biochips, in which the study was conducted lymphocytes isolated from peripheral blood of a patient with a diagnosis of chronic b-cell lymphocytic leukemia. Color Romanovsky-Giemsa. The increase in 1000 times. a) the Study was conducted according to the claimed method. The structure of the cells are well preserved. b) the Study was conducted by the method, taken as a prototype. The deformed cells, in some cells there is a fragmentation of the nucleus. Some cells are destroyed.

Figure 3 presents the results of determination by using the biochip percentage of cells with various antigens. Cells patient V. 77 years. The diagnosis of hairy cell leukemia (on). At presents dia is using are expressed in percent density values of binding cells in the test areas of the biochip with the immobilized antibodies. These values numerically correspond to the percentage in the sample of cells with each of the defined antigens.

4 shows a micrograph of the area of the spot (with immobilized antibodies anti-D19) biochip on which the study was conducted lymphocytes isolated from peripheral blood of a patient with a diagnosis of hairy cell leukemia. The study was conducted according to the claimed method. The structure of the cells are well preserved. Visible outgrowths of cytoplasm, reminiscent of the villi, which is typical for cells of this tumor. The increase in 1000 times. Painting on Pappenheim.

The claimed method is performed as follows. Biochip, which represents a transparent solid substrate with immobilized in predetermined areas (spots) of antibodies or other molecules capable of contact with the surface molecules of cells, fixed in a dish, Petri dish or other container. In a container pour the investigated cell suspension and carry out incubation. The cells are deposited on the surface of the biochip and come into contact with the immobilized antibodies. If the cells have the appropriate surface antigens, they are binding in these areas (spots) of the surface of the biochip. Then carry out a washing biochip isotonic to eliminate cells that do not tie wsysa with antibodies. After washing the stained area of the biochip remain bound only those cells that have the appropriate surface antigens. Immediately after washing the remaining wash solution is drained, and it drops resolve with the vessel wall of the pipette without touching the biochip. Then into the container biochip pour fixing liquid, such as methanol, spirit-formalin solution or other liquid, and carry out incubation within the required time. The time interval between removal of excess wash solution and add locking liquids must not exceed 15-30 seconds. But it can be increased if the phase analysis is performed under high humidity, preventing the evaporation of water from the surface of the biochip.

After completion of the processing of the biochip locking fluid (12-15 minutes for methanol, 30 seconds to spirit-formalin solution) it is drained. At this stage, the drying of the biochip Pets. In a cuvette filled coloring solution, for example a solution of azure II and eosin at colouring Romanovsky-Giemsa. Possible staining of the drug in any other known manner. In particular, you can perform various options cytochemical staining, allowing to detect in cells the presence of various substances (See, example is, Atlas of blood cells and bone marrow" edited Higashino, M.: "Triada-X", 1998, p.65-73).

After staining biochip rinsed with water or other liquid and dried. Then carry out the preparation of long-term drug by any known method, used when working with cytological preparations. It is possible, in particular, the conclusion of the biochip in canadian balsam or other composition with similar properties, for example, in a liquid for the preparation of histological and cytological preparations "Shandon-Mount" (producer-"Thermo-electron corporation, USA, Pitsburg).

Carry out the reading of the result, for receiving the image of the spots and the background areas of the biochip (for example, by photographing with the camera mounted on the microscope or other device) to determine the density of the binding of cells (number of cells, who contacted the surface of the biochip given area) in the area of the spots of the biochip and the background areas. The process can be automated.

If incubation of the biochip with the cell suspension was carried out without any mixing or flows of the fluid, the analysis of the possible determination of the concentration of the suspension of cells expressing defined surface antigens. The density of binding cells in the area of the toe is as biochip is proportional to concentration in the cell suspension, expressing the corresponding surface antigen. When performing analysis determine the ratio of the density values of the binding of the cells in the region of each of the spots of the biochip to the maximum possible under these conditions the density of binding cells (positive control spots). As such, for example, to perform the stain with antibodies specific to the antigen CD45 on the chip, designed for the study of cells. The results can be expressed in percent (Fig 1, 3). These values are numerically well correspond to the actual percentage in the sample of cells with the appropriate antigens, determined by reference methods. Besides the quantitative determination of the density of binding cells in some cases may be qualitative or semi-quantitative determination. In these cases, the assessment of the content in the sample of cells with defined antigens will also be qualitative or semiquantitative.

Depending on the goals and objectives of the study to determine the density of binding cells in all spots of the biochip or only in certain spots.

Perform morphological examination of the cells, bound peroxidase in the region of each of the spots of the biochip (Fig 1, 2). It is carried out by direct ICRI is skopicheskaja study of cells, bound peroxidase in the stained area of the biochip, or by studying the images in the photographs spots. Microscopic examination can be performed with the use of lenses, not coming in contact with the surface preparation and application of immersion (oil) lenses. It is possible multiple microscopic study of the drug with the use of an immersion lens without any damage to the product and contamination of the lenses. The image spots of the biochip and bound peroxidase in these cells can also be obtained, for example, by using projection equipment, which in some cases is preferable.

When conducting a morphological analysis of cells by contacting biochip determine the characteristics necessary for their identification (the shape and dimensions of the cells and their nuclei, nuclear-cytoplasmic ratio, structure of chromatin, the presence or absence of nucleoli, the presence perinuclear enlightenment, the color of the nucleus and cytoplasm, presence of vacuoles, granules and other cytoplasmic structures, and the presence, localization and pattern of staining any other structures and objects detected with the used method of coloring). Based on this, determine which cells are contacted in the field of different spots of the biochip. When analyzing Raza is Tata on the site with a given area or other stains can be used to determine the amount of bound peroxidase cells of certain types or cells, with any morphological or other feature (set of features). May be determined by the ratio of the density of the binding of cells of different species to the total density of binding cells in the area of this spot, or to the maximum possible density of binding. This approach allows to determine the content in the sample of cells belonging to different subpopulations.

If necessary, can be carried out morphometric study of bound peroxidase cells. Morphological or morphometric study of bound peroxidase cells can be carried out without automation (for example, by viewing each of the spots of the biochip under a microscope or by examining micrographs of sections corresponding spots), and with the help of computer programs that can recognize the image and conducting its analysis.

The claimed invention is directed to improving the accuracy, reliability and diagnostic value of the analysis results.

Examples of use of the method.

Example 1.

Using two biochips (No. 1 and No. 2) were studied lymphocytes isolated from peripheral blood of the patient C., 51 years old, with a diagnosis of chronic b-cell lymphatic leukemia (b-CLL). Cells were resuspension in isoosmotic buffer solution, to which were added EDTA (to a concentration of 0.5 mg/ml) and inactivated n is grebanier human serum (20% by volume).

Used biochips with antibodies (IgG)specific to antigens: CD2, CD3, CD4, CD5, CD7, CD8, CD9, CD10, CD11a, CD11b,CD16, CD19, CD20, CD21, CD22, CD23, CD27, CD29, CD31, CD36, CD38, CD41, CD44, CD45, CD45RA, CD56, CD71, CD72, CD95, CD98, HLA-DR, and IgM. The biochip is a substrate of transparent material in predetermined areas which were immobilized data antibodies.

Using biochip No. 1 the research was carried out the claimed method, and using the biochip No. 2 the research was carried out by the method taken for the prototype.

Before conducting the study, the biochips were fixed in a transparent cuvettes and processed protein solution, a blocking nonspecific binding sites and reduce the strength of nonspecific binding of cells to the substrate. After performing this processing, the biochips were washed with a solution of detergent and buffer solution.

To each cuvette was added to 1000 μl of cell suspension with a cell concentration of 106cells/ml Incubation biochips with cell suspension was carried out for 60 minutes without any mixing. Then biochips repeatedly rinsed with isotonic buffer solution for washing of cells, contacting the immobilized antibody. The quality of cleaning was monitored by microscopy (used inverted microscope). Washing was considered completed when not remained associated glue is OK in those parts of the surface of the biochip, where was absent immobilized antibody. From the cell with the biochip No. 1 was poured wash solution and eliminated its remaining drops from the walls of the cuvette automatic pipette without touching the surface of the biochip (it also remained drops of solution). This manipulation was carried out in order to maintain 100% humidity. The run time of this manipulation was 2 minutes. Then in the cell with the biochip No. 1 was introduced 1 ml of methanol and incubation was performed for 15 minutes. After that, methanol was poured.

From the cell with the biochip No. 2 was poured wash liquid. After this biochip for 30 minutes, dried in air, and then were fixed with methanol for 15 minutes and again dried.

Both biochip were stained with Romanovsky-Giemsa. For this, the cell was filled with a dilute solution of azure II and eosin and were incubated for 35 minutes. Then, the dye solution was decanted, and the cell with the biochips were rinsed with water and dried. Removed the biochips of the ditch and carried out the preparation of these long-term drugs. For this purpose, each of the biochips were placed on a glass slide, which previously caused a drop of liquid for the preparation of long-term histological preparations ("Shandon-Mount"; the manufacturer, Thermo-electron corporation, Pittsburgh, PA, USA). Slightly pressed biochip, top inflicted on him is the bottom drop of the liquid, covered with cover glass and placed under the press prior to its solidification.

Then each spot biochip photographed with the camera mounted on the microscope. The obtained micrographs were chosen for 3-4 region with a given area (in this case 100x100 µm) and was performed by counting cells in each of them. The obtained values were averaged. The average density values of the binding of cells obtained for each of the spots of the biochip, expressed in percent. 100% took an average density of binding cells in the spots of the biochip with antibodies specific to the antigen CD45 (this antigen is present on the surface of all types of leukocytes). The results obtained (biochip No. 1) are given in figure 1.

Then conducted a morphological study of bound peroxidase cells. For each spot biochip viewed at high magnification (used the lens with magnification X100). Preparation of the biochip long-term drug was allowed to use the oil immersion lens without damage to the associated cells and their mechanical separation from the surface of the biochip. With the camera mounted on the microscope, got micrograph of cells, who contacted each spot of the biochip. Examples are given in figure 2. The cells are painted on the biochip No. 1 (figure 2-a) well-preserved shape and size, the shape of the kernel structure is ru chromatin and other morphological features, typical of Mature lymphocytes. Cells located on the biochip No. 2 (figure 2-b) were deformed. A significant portion of the cells had changed the shape of the nuclei. Part of the cells was destroyed. Some cells seemed fused together.

Thus, using the inventive method allows to obtain much more accurate results compared with the method, taken as a prototype.

Example 2.

Using the biochip were investigated lymphocytes isolated from peripheral blood of a patient Century, 77 years old, suffering from hairy cell leukemia (on). Used exactly the same biochip as in example 1. Preparation of a biochip for the analysis, incubation with cell suspension and washed from not contacting antibodies cells were performed as described in example 1.

After completion of the cleaning of the cuvette was poured buffer solution. From the walls of the cuvette pipette was removed drops of liquid without touching the biochip. This procedure was carried out under normal humidity (about 70%), while its implementation was 20 seconds. This was followed by staining contacting biochip cells Pappenheim. To do this, immediately after removal of the excess wash fluid in the cuvette was filled with the solution May-Grunwald (solution of eosin and methylene blue in methanol) and was carried out by incubation for 5 m the chickpeas. Under this treatment the fixation combined with the first stage of painting. After that, the chip was rinsed with distilled water in a cuvette was filled with a dilute solution of azure II and eosin and were incubated for 30 minutes. Then, the dye solution was decanted, and the biochip was again rinsed with water.

Preparation of the biochip long-term preparation was carried out as described in example 1.

In the same way as in example 1 was performed to obtain images of the spots of the biochip, the determination of the density of binding cells and estimate the percentage of cells (all types), with each of the defined antigens. The results obtained are given in figure 3.

Conducted a morphological study of bound peroxidase cells. The structure of the cells were well preserved (figure 4). Signs of deformation, fragmentation of nuclei and cell disruption was not observed. When painting on Pappenheim all was well defined morphological features of the cells. A significant portion contacting biochip cells was presented by lymphocytes rounded, with rounded or bobbidy kernel with scattered chromatin, pale cytoplasm with thin processes reminiscent of the villi, which is typical for cells of hairy cell leukemia.

Translation of the article - description analogue.

The reactivity of CD antigens was determined using FR who offered cytofluorimetry, was tested binding of cells with the same antibodies immobilized on a plastic chip. This biochip was created by applying spots of individual antibodies on the surface of polystyrene Petri dishes Falcon - 1034 (65 x 15 mm) in increments of 10 mm To 1 Cup could be applied 16 spots antibodies. Each spot was wet 1 µl PBS before application of 0.1 µg of antibody in 0.1% BSA - PBS [solution of bovine serum albumin (BSA) in phosphate buffer (PBS)]. Antibodies were associated with a plastic surface for 1 hour. Then the chip was rinsed with 0.1% BSA - PBS. Next incubated for 1 hour in 1% BSA-PBS. Cells were resuspension small aliquot (<5 μl) in 0.1% BSA - PBS. Linking cells [on the surface] was convenient for light microscopy and photographed. This method was also used to determine fusina, integrin β7, antigen CD47, CD62L, CD62E, CD72, CD93, CD99R, CD114, CD121a, CDwl25 and CDwl31.

Method of the study of cells using a biochip containing immobilized antibodies capable of contact with the surface antigens of the cells, including the incubation of the biochip with the cell suspension, washing the biochip from nonspecific bound peroxidase cells, fixation and staining associated cells, obtaining the enlarged image areas of the surface of the biochip, the estimation of the density of binding cells in one or more areas, the analysis image is of bound peroxidase cells, characterized in that the holding fixation carried out immediately after removal of the wash liquid from the surface of the biochip or before committing conducts the removal of wash liquid at a humidity of 100% during the time that happens the appearance of gross morphological changes of the cells.



 

Same patents:

FIELD: medicine.

SUBSTANCE: blood serum is analysed for the contents of human tissue inhibitor of matrix metalloproteinases (hTIMP-1) by an ELISA technique. If hTIMP-1 ranges within 138 ng/ml to 183 ng/ml, the presence of early subclinical renal irritation in the patients suffering hypertensive disease with normal glomerular filtration rate with the absence of microalbuminuria is stated.

EFFECT: use of the technique allows diagnosing early subclinical renal irritation in the suffering hypertensive disease with normal glomerular filtration rate with the absence of microalbuminuria, use of the technique makes it possible to control clinical effectiveness.

2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: blood serum of a patient on her 38-40 week of pregnancy is analysed for the lactoferrin (LF) contents. If observing the LF value 4.5 mcg/ml and less, the absence of a pre-natal foetal infection and birth of a healthy child 8-9 points by Apgar score are predicted. If observing the LF value 4.5 mcg/ml and more, the presence of a pre-natal foetal infection and birth of a healthy child underevaluated by Apgar score 7 and less.

EFFECT: use of the method allows of high-accuracy prediction of a foetal condition and the presence of the pre-natal infection that allows optimising a therapeutic approach in newborns and well-timed treatment of the pre-natal infection.

2 ex

FIELD: medicine.

SUBSTANCE: method involves bacteria transfer from a sample in phosphate-buffered saline, addition of a magnetic particle suspensions with antibodies fixed thereon to certain types of bacteria, incubation with mixing. A magnetic sampler probe with a replaceable nonmagnetic tip is introduced into an incubating tank where a magnetic field generated by the magnetic sampler probe makes the complexes of magnetic particles - antibodies - bacteria to be collected on the tip; the sampler probe is transferred to a distilled water tank for washing from bacteria not bonded with antibodies. Final re-slurrying is ensured by transferring the sampler probe into the distilled water tank and separating the nonmagnetic tip from the magnetic probe; mixed magnetic particles and complexes of a magnetic particle - an antibody - bacteria are transferred in an aqueous medium which is placed in a measuring cell of an electro-optical analyser wherein a variable electric field is generated to record changes of optical properties of the suspension, in the form of a frequency dispersion of anisotropy of polarizability (FDAP) which provides a basis to state the presence or absence of target bacteria in the sample in case of the presence or absence of a FDAP peak ranging within 100 to 10000 kHz respectively.

EFFECT: invention allows simplifying and accelerating a bacteria identification process, and carrying it out in an automatic mode.

2 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: method involves DNA genome recovery of an examined woman followed by PCR analysis of site of MTHFR and PAH genes by mixing the components and adding oligoprimers, and analysis of polymorphism of restriction fragment lengths and visualisation of electrophoregram in a polyacrylamide gel. For amplification for the purpose of analysis of the site of MTHFR gene, an upstream primer CCAGTCCCTGTGGTCTCTTCAT and a downstream primer AGGGAGCTTATGGGCTCTCCT are used; for the purpose of analysis of the site of PAH gene, an upstream primer CAGAGAGAGTCTGGCCACGT and a downstream primer CGTGATTGTCTAGGTTTTGTCTGTCTAGG are used. If observing the MTHFR 677T/T and/or PAH -675 4G/4G, a risk of gestosis is predicted.

EFFECT: higher accuracy of prediction of risk of gestosis.

2 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: patient is examined for a level of D-dimer one day before and after consistently alternating pneumatic compression (CAPC) of lower extremities. If observing the level of D-dimer increased in a second sample, the presence of latent intravascular fibrin formation is diagnosed.

EFFECT: use of the technique allows detecting high risk of thromboses at the early stages of thrombogenesis in the patients with thromboses of any localisation in past history and differentiating approaches to prescribing a therapy in such patients.

2 ex

FIELD: medicine.

SUBSTANCE: method includes using a monoclonal A3 antibody for detection of a proliferation marker - nucleolar protein A3 followed by visualisation of positive focuses. A process of proliferation is shown by increasing focuses of A3 antigen localisation from one in G0 phase to 8-10 focuses in an S-period of a cell cycle.

EFFECT: invention allows evaluating effectively a condition of proliferative activity of human lymphocytes.

2 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: method for producing EHF Diagnosticum by reproduction of four hantaviruses - Puumala strain PUU-TDK/VERO, Dobrava strain DOB-EAT-VERO, Hantaan strain Ussuri-4590 and Seoul strain SK-515/Georgia-88, in a monolayer passaged cell culture of VERO-line grass monkey kidneys, followed by virus-specific antigen concentration test, polyvalent antigen production, antigen fixation on a slide and UV processing.

EFFECT: invention provides a more sensitive diagnostic test, presenting a low-price production process and more effective use of the EHF Diagnosticum.

4 cl, 2 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: on 5-7 day after pelvis trauma blood serum is analysed and concentration of polypeptides of type 1 collagen (CICP, ng/ml), concentration of osteotropic cytokine - osteprotegerin (OPG, pmol/k) and prothrombin by Quick (%) are determined. Values of prothrombin by Quick and OPG concentration are used to calculate value of discriminant function: F(Y1, Y2) = 0.170767466 · Y1 - 2.15811515 · Y2 - 13.11227538 (1) where Y1 is prothrombin value bu Quick, %, Y2 is Ln (natural logarithm) of OPG concentration in blood serum, pmol/l. If CICP value constitutes less than 146 ng/ml, and value F>0, absence of complications in post-operation period is predicted. If CICP value is higher than 146 ng/ml, and value F<0, patient is referred to group of risk on development of complications in post-operation period.

EFFECT: application of method makes it possible to predict risk of developing complications of traumatic disease course in post-operation period before surgery.

1 tbl

FIELD: medicine.

SUBSTANCE: claimed is method of obtaining antigen diagnosticum with application of species-specific membrane proteins of Y. Pseudotuberculosis, sensibilised on acrolein polymer spheres, for detection of antibodies to causative agent of pseudotuberculosis of the most epidemically essunsial serovars, spread among people. As sensitin used is pool from 10 protein antigens with molecular weight within 28-80 kDa and total protein concentration 0.9-1.3 mg/ml, isolated from coarse protein membranes. As sensitin carrier used are spherical polymer particles with diameter 1.5 mcm, which contain 1.3 mM/g of aldehide groups.

EFFECT: method improvement.

5 cl, 6 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: in children with congenital heart disease 10-14 days before carrying out cardiosurgical correction of defect, levels of interleukin-6, interleukin-10 and subclass of immunoglobulins G2 are determined. If it is determined that interleukin-6 level is from 8.25 to 15.20 pg/ml, interleukin-10 from 3.21 to 5.12 pg/ml and immunoglobulin G2 from 2.31 to 3.22 g/l, high risk of developing infectious-inflammatory complications is predicted. If it is determined that interleukin-6 level is from 6.12 to 8.22 pg/ml, interleukin-10 from 6.31 to 10.25 pg/ml and immunoglobulin G2 from 3.70 to 4.90 g/l, low risk of developing infectious-inflammatory complications at early stages of post-operation period is predicted.

EFFECT: application of method makes it possible to increase accuracy of predicting risk of developing infectious-inflammatory complications in case of congenital heart disease in children at early terms of post-operation period after cardiosurgical operation.

1 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: method includes cultivation of pluripotent stem cells in culture medium, which does not contain substance, stimulating activation of canonical signal way Wnt, during period of time between beginning of differentiation induction and 24 hours before period of increased expression of genes of canonical Wnt. After that carried out is cultivation of pluripotent stem cells in culture medium, which contains substance, stimulating activation of canonical signal way Wnt, during period of time from 24 to 96 hours, starting from 24 to 0 hours before period of increased expression of genes of canonical Wnt.

EFFECT: method makes it possible to induce cardiomyocyte differentiation efficiently and selectively.

15 cl, 15 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: method includes cultivation of pluripotent stem cells in culture medium, which does not contain substance, stimulating activation of canonical signal way Wnt, during period of time between beginning of differentiation induction and 24 hours before period of increased expression of genes of canonical Wnt. After that carried out is cultivation of pluripotent stem cells in culture medium, which contains substance, stimulating activation of canonical signal way Wnt, during period of time from 24 to 96 hours, starting from 24 to 0 hours before period of increased expression of genes of canonical Wnt.

EFFECT: method makes it possible to induce cardiomyocyte differentiation efficiently and selectively.

15 cl, 15 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: method of cryoconservation of multipotent mesenchymal stromal cells (MMSC) includes preparation of culture mixture in culture medium, mixing cell culture in culture medium with cryoprotector, step-by-step controlled cooling and freezing mixture of culture medium with cryoprotector to storage temperature and further storage of frozen mixture at low temperatures. As cryoprotector for mixture saturation used is xenon gas, introduced till saturation is achieved into prepared mixtute of cell culture MMSC in DMEM medium, which is in open cryo test tubes by blowing culture medium with xenon at 0°C with further cooling and formation of primary monolith of culture medium with cryoprotector, directed later at cooling to storage temperature.

EFFECT: invention ensures preservation of cells in cryopreservation.

4 cl, 2 dwg, 2 tbl

FIELD: medicine.

SUBSTANCE: described is method of obtaining population of stem cells, which come from dental follicle of human, named FENC (coming from follicles stem cells of embryonic nerve crest), which include: a) collection of follicle sac in sterile conditions, splitting, growing and grafting of initial culture; b) optional amplification; c) sorting out on FAC - sorter by the following stem characteristics: SSEA-4, TRA 1-60, TRA 1-81, OCT-4+; d) analysis of RNA with respect to positivity by transcriptional factors Nanog and Rex-1.

EFFECT: invention makes it possible to obtain homogenous population of stem cells.

10 cl, 6 ex

FIELD: medicine.

SUBSTANCE: method provides the following stages: (a) preparing a matrix, (b) preparing isolated hepatocytes, (c) inoculating a matrix of density 2 to 4x103 mm-2 with hepatocytes, (d) leaving the cell-coated matrix for 10-180 minutes so that to enable the cells to adhere to the matrix, (e) washing the nonadherent cells from the cell-coated matrix, (f) leaving the cell-coated matrix for max. 180 minutes, and (g) freezing the cell-coated matrix in a freezing medium, (h) storing the frozen cell-coated matrix, (i) defrosting the frozen cell-coated matrix, (j) washing the nonadherent cells from the cell-coated matrix, (k) coating the defrozen cell-coated matrix with a layer of a second matrix, and (1) reculturing the cells built-in between the matrixes.

EFFECT: invention allows providing an increased percentage of viable hepatocytes in the sandwich-type cultures.

12 cl, 4 dwg, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method involves increasing biomass of human embryo stem cells of the feeder-less hESKM-05 with the use of a base mTeSR medium in the bottles coated with 0.1 % gelatin. An increasing procedure is enabled with the use and daily change of a base coDMEM medium containing 10% serum substitute SR, 100 mcg/ml of kanamycin sulphate, 1 mM L-glutamine, 4 ng/ml of a base fibroblast growth factor (bFGF), 1 mM essential amino acids. A conditioned medium is produced from a culture of mice embryo neuronal cells. The increased biomass is transferred by means of 0.5 % collagenase in bottles containing a prepared collagen-chitosan matrix in the conditioned medium or in a complete nutrient medium with neuronal factor N2 added. The medium is changed every three days.

EFFECT: invention allows producing the neuronal matrix suitable for direct transplantation.

16 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: method involves preparing a biological referent material on the basis of a biological material of animal origin, after alimentary introduction to an animal of water-soluble lead or mercury or cadmium salts before ensuring in the biological materials of the certain lead or mercury or cadmium concentrations. Thereafter, the animals are killed by decapitation. Further, the biological material is sampled with an aliquote being analysed for the preset concentrations of toxic metals, then the biological material is packed and lyophilised.

EFFECT: invention allows improving diagnosing toxic metal poisonings and providing higher accuracy of determination of the toxic metal concentrations.

11 cl, 3 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: method includes increase of biomass of human germ stem cells of non-feeder line hESKM-05 with application of main medium mTeSR in flasks covered with matrigel. After that, performed is subcultivation by means of 0.05% dispase solution. Then, in order to form germ stem cells of embrioid bodies, by means of dispase cells are transferred into "коДМЕМ" medium with addition of 10% substituent of SR serum, 100 mcg/ml of sulfate canamicine, 1mM of L-glutamine solution and 1 mM solution of essential amino acids, as well as 2 mcg/ml solution of 5-asa-2-seoxycitidine or 2 mcM of sodium butirate solution and stimulated for 3 days. After that retransmission onto prepared collagen-chitosane matrix and cultivation in nutritional medium "коДМЕМ" with addition of 1 mM solution of essential amino acids, 1 mM of L-glutamine, 10% substituent of SR serum, 10-7 M of retinoic acid and 10 ng/ml of ascorbic acid are performed with replacement of solution every three days.

EFFECT: invention makes it possible to obtain cardiomyicytal matrix suitable for direct transplantation.

7 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: stem cells of an adult human recovered from subcutaneous fat eye tissues are induced to differentiate in insulin-secreting cells in a medium containing cytokines and growth factors, including the B27 additive, fibroblast-2 growth factor, epidermal growth factor, nicotinamide, glucagon-like peptide-1, active A, insulin-like growth factor and betacelluline. For a cultivation process, high-concentrated glucose is replaced for low-concentrated glucose.

EFFECT: invention enables producing cells synthesising considerable amounts of insulin and C-peptide.

3 cl, 8 dwg, 2 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: invention represents biotransplant for correction of soft tissue defects, characterised by the fact that it represents suspension which contains autologic culture of fibroblasts in 0.9% solution of sodium chloride in concentration 0.6-3.0×106 in 1 ml of biotransplant, integrated on pharmaceutically acceptable biocompatible biodegradable crushed to size of 100-200 mcm cell-free matrix in solution of pharmaceutically acceptable biocompatible biodegradable preparation of hyaluronic acid, volume ratio of autologic culture of fibroblasts, cell-free matrix and preparation of hyaluronic acid constitutes 4:1:1 respectively, and as pharmaceutically acceptable biocompatible biodegradable cell-free matrix used is preparation "Saimetra", representing processed donor human skin, deprived of cells and structural immunospecific proteins, whose basis consists of collagen and elastin, represented as injection form.

EFFECT: considerable reduction of quantity of injected cells, increase of their viability and ensuring long preservation of implant in affected tissue.

19 cl, 4 ex, 5 dwg

FIELD: chemistry.

SUBSTANCE: invention discloses a device based on SSB technology for cleaning, separating, modifying and/or immobilising chemical objects or biological objects in fluid medium. The disclosed device has one or more supports made from microwire tied by their ends and having a multilayer structure consisting of a centre rod and at least one coating layer suitable for binding chemical or biological objects with a functional coating or ligands lying on the surface of the support made from microwire in the absence of the effect of a magnetic field created between the supports made from microwire and particles in the fluid medium. Described also is a method of cleaning, separating, modifying and/or immobilising chemical or biological objects in a fluid medium using said device.

EFFECT: invention enables to clean, separate, modify or immobilise objects in a fluid medium with high flow rate.

24 cl, 2 tbl, 14 ex

Up!