Optimised fused protein taci-fc

FIELD: medicine, pharmaceutics.

SUBSTANCE: claimed invention relates to optimised fused protein for blocking BLyS or APRIL, which contains extracellular region of N-end of truncated TACI (transmembrane activator and CAML-partner) and Fc sequence IgG. TACI segment of fused protein contains sequence of amino-end region of extracellular region, starting with 13-th amino acid residue, complete sequence of stem area from TACI and is obtained from native sequence of TACI between 12-th and 120-th amino acids. Segment Fc of immunoglobulin IgG of fused protein contains hinge region, CH2 region and CH3 region, TACI segment and Fc segment are fused either directly or through linker sequence. In addition, claimed is DNA sequence which codes fused protein, expression vector, host-cell, pharmaceutical composition, containing fused protein, and application of fused protein for blocking BLyS or APRIL. Obtained fused protein does not degrade in process of expression, possesses high biological activity and high level of expression.

EFFECT: fused protein in accordance with claimed invention can be used in treatment of diseases, associated with abnormal immunologic functions and in treatment of diseases caused by abnormal proliferation of B-lymphocytes.

10 cl, 6 dwg, 8 ex

 

The technical field to which the invention relates

The present invention relates to the production of optimized fused protein, in particular fused protein TACI-Fc, through the use of technology, genetic recombination, and to its use for the treatment of immunological diseases.

The level of technology

The process of development and differentiation of lymphocytes strictly regulated by various cytokines. Stimulators of B-lymphocytes (BLyS or so-called BAFF, TNSF13B, THANK, TALL-1, zTNF4) and the ligand, induce proliferation (APRIL)are cytokines that play an important role in the regulation of immune responses in vivo (Schneider, 2005, Current Opinion in Immunology, 17:282-289; Seyler et al., 2005, The Journal of Clinical Investigation, 115:3083-3092). They stimulate the development and proliferation of B-lymphocytes c increase in the expression of various immunoglobulins in the blood. BLyS and APRIL are also major regulatory effects on the maturation of T-lymphocytes and, thus, cell-mediated immunity (Wang et al., 2001, Nature Immunology, 2:632-637).

BLyS and APRIL regulate the immune response of lymphocytes through receptors on the cell surface of lymphocytes. They bind to receptors of cell membranes TACI (transmembrane activator and CAML-partner) and BCMA (antigen maturation of b-lymphocytes). In addition, BLyS may also communicate with another receptor, BAFF-R. B-lymphocyte expresses TACI, BCMA and BAF-R. Mature T-lymphocyte expresses TACT. BLyS and APRIL regulate the activation, proliferation and development of lymphocytes through the transduction of signals mediated by these receptors, and thus enhance the immune response. In addition, in tumors derived from lymphocytes, BLyS and APRIL also facilitate the proliferation of tumor cells and inhibit apoptosis, thereby accelerating the development of tumors.

Overexpression of BLyS and APRIL is one of the factors in the pathogenesis of many autoimmune diseases, which include, without limitation, systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), Sjogren syndrome, and the like. In clinical studies it was shown that the concentration of BLyS is often positively correlated with the severity of autoimmune diseases. For this reason, inhibition of BLyS and APRIL becomes a potentially effective treatment for associated autoimmune diseases. At the same time as BLyS and APRIL can accelerate the development of tumors of B-lymphocytes, inhibition of BLyS and APRIL can also be used to treat tumors of B-lymphocytes, such as chronic limfocitna leukemia, multiple myeloma, lymphoma of B-lymphocytes and the like.

Since TACI is a high affinity for BLyS and APRIL, it is possible to use soluble TACI (extracellular plot TACI) for predator is their interaction BLyS or APRIL with their membrane receptors (TACI, BCMA, BAFF-R), thereby blocking the biological activity of BLyS or APRIL and treating autoimmune diseases or tumors.

Research shows that a protein of the extracellular site TACI and Fc fragment of IgG (TACI-Fc) can effectively inhibit the development of disease caused BLyS (Gross et al., 2001, Immunity, 15:289-302). However, research also shows that the protein TACI-Fc, constructed through the use of extracellular area native TACI, can easily degradirovali, when it is expressed in the cells, and the resulting products are often heterogeneous. For this reason, the TACI-Fc protein from native with TACI-Fc fragment is not suitable for industrial production. The present invention aims at the improvement of the fused protein TACI-Fc using the technology of genetic engineering to develop a pharmaceutical composition applicable for industrial production.

The invention

The present invention relates to methods of constructing and protein drug that blocks BLyS and APRIL, the method of its production and to its use for the treatment of diseases.

The present invention offers several fused proteins, which get by merging fragment of the TACI with the Fc fragment of immunoglobulin and that mouthbabyphat the proliferation of B-lymphocytes, the structure of the fused protein differs in that:

plot TACI fused protein contains a partial sequence of aminobenzoic region extracellular region, complete sequence containerelement region and partial sequence of a stem region from TACI; while the immunoglobulin Fc in fused protein contains a hinge region, a CH2 region and a CH3 region; TACI sequence and the sequence of the Fc is drained directly or through a linker sequence;

where a fragment of the TACI may be selected from the group consisting of positions from 13 to 108 or from 13 to 118 in the amino acid sequence TACI, and the specified linker sequence may be a 9Gly, and

the Fc fragment of immunoglobulin can be obtained from the Fc immunoglobulin human or animal and can be a full Fc or its partial sequence; and in addition to this Fc can be obtained from IgG, IgM, IgD and IgA, each of which includes all isotypes, respectively, such as IgG1, IgG2, IgG3 and IgG4, and preferably IgG1; and

where the specified fragment of the TACI may be selected from the group consisting of sequence TACI humans and animals.

In particular, the preferred protein of the present invention may be represented as:

a. protein T1: which is obtained by merging the 13-th - 10-th amino acid TACI and Fc immunoglobulin IgG1 (SEQ ID NO:1),

b. protein T2: which is obtained by merging the 13th - 118th amino acids TACI and Fc immunoglobulin IgG1 (SEQ ID NO:2), and

c. protein T3: which is obtained by merging the 13th - 118th amino acids TACI, the linker sequence 9Gly and Fc immunoglobulin IgG1 (SEQ ID NO:3); and

where TACI selected from the group consisting of the sequence of the extracellular regions for TACI (transmembrane activator and CAML-partner) of humans and animals.

The present invention also relates to a DNA sequence which encodes a protein of the present invention.

The DNA sequence presented in SEQ ID nos:5-7.

Protein TACI-Fc with native sequence TACI is not applicable for industrial production due to light degradation of the protein. PCT/US2002/015910 describes that the merger of TACI fragment, in which a deletion, aminobenzoic region and a partial sequence of a stem region, with the Fc fragment can prevent protein degradation fused protein. However, it is reported that the destruction of aminobenzoic region significantly reduces the biological activity of TACI (Wu et al., 2000, The Journal of Biological Chemistry, 275:35478-35485).

The key to the present invention lies in the fact that the artificial neural network system computer software for proprotein convertase (PC) is used to analyze the consequences of the successive amino acids of the extracellular region of TACI. The result of the analysis shows that the sequence of the extracellular region of TACI contains two sites of cleavage PC (9-I 135-I amino acids) and two additional site (12-I 120-I amino acids), with the rate close to the threshold value for the site of cleavage PC. It is assumed that these sites of cleavage PC per se could be responsible for the degradation of TACI in the process expression. On the basis of this discovery, the authors have removed the specific sites of cleavage PC optimization molecules TACI and merged fragments TACI without cleavage sites PC with Fc. The experiment of the inventors showed that the new protein effectively prevents degradation of the TACI during expression. The truncated sequence TACI, and other methods can be used to remove these cleavage sites PC. For example, site-directed mutagenesis of DNA can be used to remove these cleavage sites of RS. Thus, you can select various optimization methods to achieve the same goal. Optimized protein TACI-Fc of the present invention retains much of residues in aminobenzene region and a long sequence of amino acids in the stem region of the molecule TACI. Optimized protein TACI-Fc overcomes the problem of degradation of the protein. Compared with the merge TACI-Fc, which removes the Xu N-terminal region, optimized fused proteins TACI-Fc of the present invention show higher biological activity and the expression level of the protein.

Construction of the fused protein of the present invention is based on conventional molecular cloning technology, and specific experimental protocols can be found in various laboratory manuals, such as the 2nd and 3rd versions Molecular Cloning: A Laboratory Manual.

The method of synthesis used for PCR cloning of the DNA encoding the above protein in the vector. Vector for ekspressirovali fused protein may be a plasmid, commonly used in molecular biology. The signal peptide sequence is included in the front part of aminocore fused protein to ensure secretion of the protein from the cell. Vector sequence contains a promoter to initiate the expression of the gene start and stop signals for translation of the protein, and the sequence of polyadenylation (polyA). The vector may contain a gene for antibiotic resistance to facilitate replication of the plasmid in bacteria. In addition, the vector may contain a gene for selection in eukaryotic cells for selection of strains stably transfected cells.

After constructing the plasmid DNA sequence fused protein is confirmed sequencer the cation. Then the corresponding protein can be expressed by transfection of DNA plasmids into the cells. Many expression systems are available for the expression of such fused proteins, they include, without limitation, mammalian cells, bacteria, yeast, insect cells and the like.

Proteins expressed in mammalian cells, glycosylases in the process of post-translational modification. Amino acid sequence fused proteins TACI-Fc of the present invention contain glycosylated amino acids; so that mammalian cells are preferred for the expression of these proteins. There are a variety of mammalian cells suitable for large-scale protein expression, such as CHO cells, SP20 cells, NS0 cells, COS cells, BHK cells and PerC6 cells. Many other cells can also be used for expression and production of these proteins, and thus, they are treated in the present invention. A plasmid encoding the polypeptide, can penetrate into cells by transfection. There are many ways of transliterowany cells, and they include, without limitation, electroporation and transfection mediated by liposomes or calcium, and the like.

In addition to mammalian cells other expression systems can also be used for ex is ressie these fused proteins such as bacteria, yeast and insect cells, which are also addressed in this invention. The yield of protein in these expression systems may be higher than in mammalian cells, but the protein produced in these expression systems, as a rule, has no glycosylation or has the form of a conjugate with sugar, which differs from that of mammalian cells.

After expression of the protein enzyme-linked immunosorbent assay (ELISA) or other means can be used to determine the concentration of the fused proteins in supernatant cell cultures. Because these fused proteins containing the Fc fragment of immunoglobulin, affinity chromatography on protein A or G can be used as a primary cleaning stage to highlight these fused proteins.

The fundamental function of the fused protein TACI-Fc of the present invention is to block BLyS and APRIL, while BLyS and APRIL are the key factors to stimuliranje development of B-lymphocytes and maturation of T-lymphocytes. Accordingly, protein TACI-Fc can be used in diseases associated with abnormal immunologic functions and diseases caused by the abnormal proliferation of B-lymphocytes. These diseases include, without limitation, rheumatoid arthritis, systemic lupus erythematosus and tumor of B-lymphocytes. Protein TACI-Fc mo what should be entered in the form of injection into the human body as a purified recombinant protein. Alternatively, the DNA sequence encoding a protein can be inserted into an appropriate vector for expression of fused protein in the human body through gene therapy or cell therapy. For this reason, there are many approaches to the use of fused protein of the present invention which include the use of not only the protein but also the DNA that encodes a protein.

The present invention also relates to pharmaceutical compositions fused protein, which may contain a pharmaceutically acceptable carrier. The pharmaceutical composition may be any form of a pharmaceutical preparation, it is preferable drug for injection, including liquid and lyophilized form. The pharmaceutical composition may be obtained in accordance with conventional pharmaceutical technologies, which include mixing the active ingredient, i.e. the fused protein of the present invention, with the pharmaceutically acceptable carrier for the preparation of the desired dosage form based pharmaceutical technology.

Brief description of drawings

Figure 1 shows the analysis of the amino acid sequence TACI using artificial neural networks for proprotein convertase (PC). The remains of the 9th and 135 amino acids in the extracellular region is STI TACI shown as sites of cleavage of RS. The remains of the 12th and 120th amino acids also have a value close to the threshold for the site of cleavage of the PC.

Figure 2 shows the structure of the native full-TACI protein and four fused proteins TACI-Fc.

Figure 3 shows the comparison of the expression of protein from CHO cells for four fused proteins TACI-Fc.

Figure 4 shows the analysis of binding of four fused proteins TACI-Fc with BLyS. The results show that the entire protein can bind to BLyS, while T3 has the highest affinity for BLyS.

Figure 5 shows the analysis of SDS-PAGE of purified fused protein T3. Protein T3, expressed in a high-performance system expression CHO, looks like one area of the protein in the gel, and has an apparent molecular mass of approximately 42 kDa, which is consistent with the expected molecular weight of glycosylated fused protein T3.

Fig.6 shows a significant impact on autoimmune diseases for fused protein T3 on the model of collagen-induced arthritis in mice. The development of arthritis in mice measured by clinical scoring of arthritis. The results show that mice treated fused protein TACI-Fc T3, have significantly lower clinical scoring than the control group (P<0,01).

Detailed description of the invention

In the present invention are the following examples for detailed illustrated what I structure, design and evaluation of fused proteins TACI-Fc. However, the content and use of the present invention is not limited to the examples.

Example 1: sequence Analysis of TACI

Proprotein convertase (PC) may be specific to cleave polypeptides in cells. For many proteins, the cleavage PC is an important stage during post-translational modification of the protein. The family of PC consists of a number of enzymes that recognize and break down the specific amino acid sequence. Artificial neural network for PC is a system of computer software, which uses a database of known sites of cleavage of the RS for the prediction of cleavage sites RS available in the protein sequence. The system can be used to analyze any potential sites of cleavage of the RS in the protein. The present invention analyzes the amino acid sequence of TACI by using artificial neural network for the PC, and discovered that there are two sites of cleavage PC (9-I 135-I amino acids) in the extracellular region of TACI. In addition, two additional site (12-I 120-I amino acids) are scoring close to the threshold values for the sites of cleavage of the PC (figure 1). For this reason, it is possible to design optimized fused b the LCA TACI-Fc by removing these sites RS splitting and merging sequence TACI without potential sites of cleavage RS Fc, to prevent the decomposition of the protein. Based on this information, the authors have designed several fused proteins TACI-Fc, where TACI sequence derived from the native sequence TACI between the 12th and the 120th amino acids (figure 2). Common characteristics of this new fused proteins TACI-Fc, are that: 1) contains the main sequence of aminobenzoic region TACI, 2) contains a complete sequence containerelement region and 3) contains a partial sequence of the stem region.

Example 2. Design fused proteins and plasmids, coding them

Total RNA is isolated and purified from mononuclear cells of peripheral blood by use of the kit for purification of total RNA Qiagen. cDNA synthesized from total RNA using reverse transcriptase. Then the desired fragments TACI obtained by amplification using the polymerase chain reaction (PCR) with appropriate primers. The fragment of the immunoglobulin Fc obtained by PCR amplification of the cloned plasmids IgG1 Fc. Finally, the sequence TACI and Fc is drained by the PCR, and then successfully construct DNA sequence fused proteins TACI-Fc.

Reactions include PCR: 30 cycles of denaturation at 95°C for 30 seconds; annealing at 56°C for 45 seconds and elongation at 72°C for 2 minutes. Products PR TACI and Fc clone, accordingly, in plasmid pCR2.1 by using set for TA cloning. Plasmids transformed into E. coli. White colonies of E. coli cast selection and grown in LB medium overnight. Then the plasmids produce through the use of the kit Qiagen plasmid. Sequence TACI and Fc confirmed by cleavage with restriction enzyme and DNA sequencing. Finally, TACI and IgG Fc cDNA is drained by use of the PCR method with overlap. Fragments merge TACI-Fc is inserted into a plasmid expression of mammalian recombinant plasmids transformed into E. coli, produce positive breeding colonies and the target sequence is confirmed by thererofre the enzymes and analysis DNA sequencing. Finally, the resulting plasmid is used for transliterowany CHO cells for expression of the fused proteins.

Protein T1amino acids 13-108 TACI+FcSEQ ID NO:1 and 5
Protein T2amino acids 13-118 TACI+FcSEQ ID NO:2 and 6
Protein T3amino acids 13-118 TACI+linker sequence 9Gly+FcSEQ ID NO:3 and 7

In addition, this study also includes protein T4 for comparison.

Honors protein T4 from the other three fused proteins is the absence of the N-terminal region of TACI in T4. Actually, T4 is a protein fused between amino acid residues 30-110 TACI and Fc sequence (See SEQ ID NO:4 and 8).

Primer sequences for fused protein T1:

Direct primer: AGCCGTGTGGACCAGGAGGAG

Reverse primer: GAGCTTGTTCTCACAGAAGTATG

Primer sequences for fused protein T2:

Direct primer: AGCCGTGTGGACCAGGAGGAG

Reverse primer: GAGCTCTGGTGGAAGGTTCACTG

Primer sequences for fused protein T3:

Direct primer: AGCCGTGTGGACCAGGAGGAG

Reverse primer:

ACCTCCACCTCCACCTCCACCTCCACCGAGCTCTGGTGGAAGGTTCACTGGGCTCCT

Primer sequences for fused protein T4:

Direct primer: GCTATGAGATCCTGCCCCGAAG

Reverse primer: TGAAGATTTGGGCTCGCTCC

Example 3: expression of the fused proteins TACI-Fc in cells

The present invention illustrates the expression of the fused proteins TACI-Fc, for example, in mammalian cells. Four fused protein T1, T2, T3 and T4 clone in plasmid pcDNA3.1 (Invitrogen). The signal peptide sequence Flt-1 added at the 5'end of each fused protein. Four plasmids TACI-Fc purified using the kit for purification of plasmid DNA of high purity (QIAGEN). Then plasmid DNA is introduced into CHO cells, respectively, using the set t is inficirovannye FUGEN6 (ROCHE). The transient method transliterowany used for comparison of expression levels of four fused proteins TACI-Fc. The CHO cells are cultivated in the cups for cell culture in complete DMEM medium containing 10% fetal calf serum. When cells reach a certain density, add to the culture complex of plasmid DNA with the reagent FUGEN 6 (Roche). After culturing for three days supernatant collect, and they contain expressed fused protein. The concentration of the fused protein is determined using an ELISA method. The results for the concentration of proteins is shown in figure 3: T3 is the highest expression of, among others, followed by T2. T4 has the lowest level of expression. Thus, from the point of view of protein expression, protein T3 is the best molecular composition.

Example 4: evaluation of the activity of binding fused protein with BLyS

After expression of each fused protein, the authors determine the activity of its binding to BLyS in the analysis of binding to BLyS. In this assay, recombinant BLyS protein (R&D Systems) first applied as a coating on 96-well tablets ELISA. Sites nonspecific binding of protein blocked with a blocking solution of 2% BSA. Then merged TACI proteins at various concentrations added to the appropriate wells. Tablets incubated for two hours at 37°C, and then washed plumage is adding conjugate of rabbit antibodies against human Ig - HRP. Finally, the peroxidase substrate is used for the display of color. The reader tablets ELISA used to measure the values of OD (optical density) for each well of 96-hole tablet, the increase in the OD values indicates the binding of the fused protein with BLyS. The authors found that T3 has the best binding to BlyS, T1 and T2 have moderate binding and T4 has the lowest binding (figure 4). Thus, from the point of view of protein expression and activity of BLyS binding, protein T3 is the best molecular composition.

Example 5: Establishment of cell lines with high expression

After determining what protein T3 represents the best of molecular composition, the authors have established a stable and high expression cell strain CHO through the use of stable transliterowany and gene amplification. The gene encoding protein T3, clone into a plasmid, containing the gene for DHFR. DNA plasmids with high purity clean by using a cleaning kit QIAGEN plasmid, and cells CHO transferout the plasmid using electroporation. Transfetsirovannyh cells cultured in the medium selection with the receipt of resistant clones. Methotrexate (MTX) is added to the amplification of the gene T3 and receive cell clones with high e is spresi. Finally CHO cells obtained by selection of clones propagated in culture, and protein is produced in a large scale bioreactor. The concentration of the fused protein was determined by ELISA. When using this approach the authors successfully produce protein T3 on a large scale. The output of the fused protein can be higher than 20 PG per cell per day. Protein T3 can be purified by using affinity chromatography on protein A or G.

Example 7: Electrophoretic identification of fused protein TACI-Fc

In the present invention it has been shown experimentally that there is no degradation of the fused protein during expression optimized fused protein. The strain of CHO cells for high expression of the fused protein T3 cultured in the flask for cell culture. After cells reach high density, the supernatant of the cell culture is harvested and the protein purified by using affinity chromatography on protein. Purified protein mixed with loading buffer for SDS-PAGE and boil for 3 minutes. Protein separated in a polyacrylamide gel and stained with Kumasi bright blue. Zone protein visualized after removal of the dye from the gel using methanol. It is shown that protein T3 is seen as one area in the gel (figure 5), with an apparent molecular mass of approximately 42 kDa, which according to suede with the expected molecular weight glycosylating fused protein T3. It is important that there is an observed area of a protein with molecular weight less than 42 kDa. This result shows that the optimized protein TACI-Fc of the present invention can effectively prevent the cleavage and degradation of the protein during expression, and, thus, can be used for large-scale industrial production.

Example 8: therapeutic effects optimized fused protein TACI-Fc in autoimmune disease

Demonstrated on the model of collagen-induced arthritis in mice that are optimized protein TACI-Fc has antiautorun biological activity. Mice DBA/1 at the age of 8 weeks are divided into two groups of 10 animals in each group. Each mouse do percutaneous injection of 200 μg bovine collagen type II, mixed with complete Freund adjuvant. After 21 days, each mouse do percutaneous injection of the protein bovine collagen, type II, mixed with incomplete Freund adjuvant. From day 24 of each mouse in the group doing the subcutaneous injection of 100 μg fused protein T3 three times a week. Mice in the control group inject normal human IgG at the same dose. Development of arthritis was measured using a clinical score of arthritis. They show that the severity of arthritis in mice treated with T3, are much smaller than those to ntalnyh mice, and there is a significant difference (P<0.01) in clinical point estimates between the two groups (Fig.6).

Eventually optimized fused proteins TACI-Fc of the present invention prevents degradation of the protein during expression, have a higher biological activity and show high levels of expression of the protein, thus, they can be used in large-scale industrial production.

1. Protein to block BLyS or APRIL, consisting of a truncated TACI and Fc immunoglobulin IgG, characterized in that the plot TACI fused protein contains the sequence of aminobenzoic region extracellular region, starting from the 13th amino acid residue, the full sequence containerelement region and partial sequence of a stem region of TACI and derived from the native sequence TACI between the 12th and the 120th amino acids; plot Fc immunoglobulin IgG fused protein contains a hinge region, a CH2 region and a region snz; and the plot TACI and plot Fc fused, either directly or through a linker sequence.

2. Fused protein according to claim 1, characterized in that the plot TACI selected from the group consisting of 13th - 108th amino acids and 13th - 118th amino acids TACI; the linker sequence is a 9Gly.

3. Fused protein according to claim 1, characterized in that the plot immunoglobulin Fc on what is learned from IgGl.

4. Fused protein according to claim 1, characterized in that the amino acid sequence fused protein selected from the sequences disclosed in SEQ ID NO: 1-3.

5. The DNA sequence encoding a protein according to claim 1, characterized in that the amino acid sequence of the fused protein selected from the sequences disclosed in SEQ ID NO: 1-3.

6. The DNA sequence according to claim 5, characterized in that it represents the sequence presented in SEQ ID nos: 5-7.

7. The vector for the expression of fused protein according to claim 1, containing a DNA sequence according to claim 5.

8. Cell containing a vector according to claim 7, which is used for the expression of the corresponding fused protein according to claim 1 which is selected from eukaryotic cells or prokaryotic cells.

9. The use of fused protein according to claim 1 when receiving drugs to block BLyS or APRIL.

10. Pharmaceutical composition for blocking BLyS or APRIL, containing the protein according to claim 1 and a pharmaceutically acceptable carrier.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: claimed invention relates to field of immunology and biotechnology. Claimed are: versions of antibody and antigen-binding fragments of antibody to receptor Il-6 of humans. Considered are: isolated molecule of nucleic acid and vector which contains it. Described are: system "host-vector" and method of obtaining antibody or its antigen-binding fragment, as well as application of antibody or its antigen-binding fragment for obtaining medication.

EFFECT: invention application provides novel antibodies to receptor IL-6 of humans, which can be applied in therapy of IL-6- mediated diseases.

11 cl, 5 tbl, 7 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and particularly to obtaining guanylate cyclase receptor-activating peptides and can be used in medicine. A recombinant technique or chemical synthesis is used to obtain a polypeptide consisting of an amino acid sequence Cys Cys Glu Tyr Cys Cys Asn Pro Ala Cys Thr Gly Cys.

EFFECT: invention enables to obtain a guanylate cyclase-activating polypeptide, and can be used for efficient treatment of gastrointestinal disorders or visceral pain in a patient.

17 cl, 55 dwg, 2 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: genetically engineered technique is applied to produce in Escherichia coli cells the recombinant polypeptides with human plasminogen properties, containing a catalytic plasminogen domain, 5th plasminogen kringle domains, and a modified fragment of an amino acid sequence preceding to the 5th plasminogen kringle domain.

EFFECT: invention allows producing the polypeptides of high fibrinolytic human plaminogen activity and high yield in expression in Escherichia coli cells.

7 cl, 1 dwg, 11 ex

FIELD: medicine.

SUBSTANCE: genetically engineered technique is applied to produce in Escherichia coli cells the recombinant polypeptides with human plasminogen properties containing a catalytic plasminogen domain, 5th and 4th plasminogen kringle domains, and a modified fragment of an amino acid sequence preceding to 4 plasminogen kringle domains.

EFFECT: invention allows producing the polypeptides of high fibrinolytic human plaminogen activity and yield 40-60 mg per 1 l of the culture in expression in Escherichia coli cells.

7 cl, 1 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: in order to obtain protein PS-CFP2/TurboYFP_MBP7, constructed is recombinant plasmid DNA PS-CFP2/TurboYFP_MBP7 with size 4916 bp, coding hybrid protein, containing sequence of proteins PS-CFP2 and Turbo YFP, bound with fragment of myelin basic protein 80-104. Composition of plasmid DNA also includes promoter of T5 PHK-polymerase transcription, site of ribosome binding; fragment of DNA plasmid gen of β-lactamase, determining stability of Escherichia coli cells to ampicillin, as genetic marker. Obtained plasmid DNA is used to transform cells of Escherichia coli strain BL21(DE3) to obtain strain-producent of hybrid protein PS-CFP2/TurboYFP_MBP7. In order to obtain protein PS-CFP2/TurboYFP_MBP7 cultivation of strain-producent of Escherichia coli BL21 (DE3)/pQe30_PS-CFP2/TurboYFP_MBP7 is performed, cells are destroyed and target protein is purified by method of affine and gel-filtration chromatography.

EFFECT: invention makes it possible to increase biosensor sensitivity and stability and extend its specificity in respect to pool of catalytic antibodies.

3 cl, 7 dwg, 1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: there are offered: IL-6 receptor antibody, a coding gene, a vector and a host cell for producing the antibody, a method for producing the antibodies, and a pharmaceutical composition for treating IL-6-related diseases containing the antibody.

EFFECT: use of the invention provides new humanised IL-6 receptor antibodies that can find further application in therapy of the IL-6-mediated diseases.

8 cl, 22 dwg, 8 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: invention refers to producing fused proteins. The fused construct consists of an amino acid sequence of glycosyl phosphatidylinositol anchored tissue inhibitor of metalloproteinase.

EFFECT: cictrisation prevention during skin injures treatment when using the fused construct.

10 cl, 33 dwg, 18 ex

FIELD: medicine.

SUBSTANCE: there are offered versions of antibodies and their antigen-binding IL-13, particularly human IL-13 specific fragments. There are described: a pharmaceutical composition, a pharmaceutical compound of the antibody, versions of coding and hybridising nucleic acids and expression vectors. There are offered versions of: cells and methods of producing the antibody, methods of treating IL-13 associated disorders. A method of IL-13 detection in a sample is described.

EFFECT: use of the invention provides new IL-13 antibodies with KD about 10-10 M which can be used for diagnosing, preventing or treating one or more IL-13 associated diseases.

87 cl, 37 dwg, 5 tbl, 6 ex

Glypican-3 antibody // 2427588

FIELD: medicine.

SUBSTANCE: versions of antibodies bound with glypican-3 in a site with amino acid residues 1-563 are offered. Each version is characterised by the fact that it contains three CDRs of a light chain and three CDRs of a heavy chain. There are described: coding polynucleotide, and also a based expression and a host cell on the basis of the vector. There are disclosed: a method of producing the antibody with using a host cell, a cell growth inhibitor on the basis of the antibody, versions of application of the antibody for treating cancer or hepatoma. There is described peptide for producing glypican-3 antibodies containing residues 546-551 of glypican-3. The offered new antibodies exhibit higher cytotoxicity as compared with known glypican-3 antibodies and are specific to a certain site of glypican-3.

EFFECT: invention use can find further application in cancer therapy.

16 cl, 20 dwg, 2 tbl, 27 ex

FIELD: medicine.

SUBSTANCE: polypeptide contains extracellular and transmembrane domains of a human tissue factor. A DNA fragment coding this polypeptide, and a plasmid pET28a(+) are used to produce a genetic make-up enabling biosynthesis of the recombinant human tissue factor. Also, the E coli BL21 [DE3]/p6E-tTF strain that is a producer of the recombinant human tissue factor is offered.

EFFECT: high-yield recombinant protein and simplified recovery and purification procedures.

2 cl, 4 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: disclosed is a polypeptide having the capability of inducing antibodies which are bactericidal towards strains in each of three families of NMB 1870 I-III. The invention discloses an immunogenic composition containing said polypeptide. The invention also discloses nucleic acid which codes said polypeptide.

EFFECT: disclosed polypeptides can induce humoral immune response, which is bactericidal towards meningococcus.

8 cl

FIELD: medicine.

SUBSTANCE: in order to obtain protein PS-CFP2/TurboYFP_MBP7, constructed is recombinant plasmid DNA PS-CFP2/TurboYFP_MBP7 with size 4916 bp, coding hybrid protein, containing sequence of proteins PS-CFP2 and Turbo YFP, bound with fragment of myelin basic protein 80-104. Composition of plasmid DNA also includes promoter of T5 PHK-polymerase transcription, site of ribosome binding; fragment of DNA plasmid gen of β-lactamase, determining stability of Escherichia coli cells to ampicillin, as genetic marker. Obtained plasmid DNA is used to transform cells of Escherichia coli strain BL21(DE3) to obtain strain-producent of hybrid protein PS-CFP2/TurboYFP_MBP7. In order to obtain protein PS-CFP2/TurboYFP_MBP7 cultivation of strain-producent of Escherichia coli BL21 (DE3)/pQe30_PS-CFP2/TurboYFP_MBP7 is performed, cells are destroyed and target protein is purified by method of affine and gel-filtration chromatography.

EFFECT: invention makes it possible to increase biosensor sensitivity and stability and extend its specificity in respect to pool of catalytic antibodies.

3 cl, 7 dwg, 1 tbl, 3 ex

Protein production // 2429243

FIELD: chemistry.

SUBSTANCE: fused protein containing a protein-body inducing sequence is constructed, as well as a heterologous host cell and a sequence obtained from gamma-zein fused through the C-end with an N-end, which is of interest to the protein. The obtained fused protein is expressed in the host eukaryotic cell of mammals or insects.

EFFECT: invention enables to obtain recombinant proteins of interest, which are stably expressed and accumulate in host cells inside "ОРБПБТ".

7 cl, 3 dwg, 1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention refers to producing fused proteins. The fused construct consists of an amino acid sequence of glycosyl phosphatidylinositol anchored tissue inhibitor of metalloproteinase.

EFFECT: cictrisation prevention during skin injures treatment when using the fused construct.

10 cl, 33 dwg, 18 ex

FIELD: medicine.

SUBSTANCE: there is reconstructed recombinant plasmid DNA pGD-10 coding a chimeric protein construct DsD-sp-β-GAL containing a dextrane-binding domain DBD from Leuconostoc mesenteroides microorganism which is genetically combined through a glycine-serine spacer with thermostable beta-galactosidase from thermophilic Thermoanaerobacter ethanolicus microorganism. The Escherichia coli DH5α/pGD-10 strain producing the recombinant protein construct DsD-sp-β-GAL is produced by transforming the cells of parental Escherichia coli DH5α strain by recombinant plasmid DNA pGD-10.

EFFECT: invention allows producing protein DsD-sp-β-GAL exhibiting enzymatic activity of thermostable beta-galactosidase and affine connectable with dextrane.

3 cl, 4 dwg

FIELD: medicine.

SUBSTANCE: invention can be used for producing recombinant human interleukin-11 (rIL-11). The recombinant plasmid DNA pET32M/mTrx-rhIL-11 is produced by a method which involves synthesis of four fragments of a recombinant human interleukin-11 gene from oligonucleotide primers, cloning of each fragment in a plasmid vector pGEM5z restricted by EcoRV endonuclease, transformation of each of 4 plasmids of E.coli cells of strain DH5a, selection of clones coding the related fragments of the recombinant human interleukin-11 gene, selection of plasmids with the recombinant human interleukin-11 gene without mutations, combination of all fragments of the recombinant human interleukin-11 gene in the plasmid vector pUC19, construction of the vector pET32M of the plasmid pET32b, recloning of the recombinant human interleukin-11 gene in an expression vector pET32M, coding thioredoxin 1 E.coli with substitution of Asn84/Gln. The produced DNA is used to transform the E.coli BL21 (DE3) strain cells to produce the E.coli BL21 (DE3)/pET32M/mTrx-rhIL-11 strain that is a producer of recombinant human interleukin-11 as an ingredient of soluble fused protein mTrx-rhlL-11.

EFFECT: effective production of recombinant interleukin-11 in Escherichia coli cells.

3 cl, 5 dwg, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: protein is capable to inhibit thrombin activity specifically. Besides, what is offered is a nucleic acid coding said chimeric protein, a vector containing this nucleic acid and a host cell carrying the vector. The present invention also refers to a pharmaceutical composition containing the recombinant chimeric protein of neutrophils and girugen inhibition factor. An effect of the given composition consists in thrombocyte aggregation inhibition or peripheral leukocyte activation inhibition.

EFFECT: composition can be used for treating a cardio-cerebrovascular disease or preventing a cerebral ischemic injury or a cerebral hematoma.

13 cl, 11 dwg, 16 tbl, 17 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, more specifically to producing a neutralising epitopes for an anti-GdF-8 antibody, and can be used in medicine. Produced are peptide versions of the area of 327 to 346 amino acid of the sequence SEQ ID NO: 1 which is specifically bound with rat's monoclonal antibody 788. Peptides are produced by a recombinant method with using a host cell transformed by an expression vector with nucleic acid coding said peptide version. The produced peptides are used to prepare vaccine compositions which are used to elicit an anti-GdF-8 immune response and to enable GDF-8 activity down-regulation in an animal. Also, the produced peptides can be used in a method of anti- antibodies selection screening.

EFFECT: produced peptides exhibit the anti-GdF-8 antibody binding activity thereby applicable for the decreased activity of a growth and differentiation factor 8.

17 cl, 2 dwg, 6 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: presented recombinant proteins contain a sequence inducing protein bodies and fused with a sequence of a concerned product. The method implies producing an aqueous homogenate of transformed host cells which express fused protein in the form of recombinant protein body like aggregates (RPBLA) showing the density approximately 1.1 to 1.35g/ml. The homogenate is centrifuged with producing fractions of various densities, or in the absence of an additional solution providing volume, or with using a layer of a certain density which is less than the density of RPBLA. As a result, the fractions containing relatively lowered concentration of RPBLA and a fraction containing relatively higher concentration of RPBLA are produced. The fraction of the lowered concentration of RPBLA is separated from the fractions of relatively higher concentration of RPBLA. Then said fused protein is purified.

EFFECT: easy-to-implement, immediate and effective purification of recombinant proteins.

15 cl, 8 dwg, 1 tbl, 18 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine and concerns methods of treating diseases with using VEGF antagonists. Substance of the invention involves application of a VEGF antagonist containing VEGFR1R2-FcΔ C1 (a) SEQ ID NO:4 in preparing a drug for hypertension reduction, in treating the diseases associated with administering the VEGF antagonist where the treatment is conducted by subcutaneous introduction.

EFFECT: advantage of the invention consists in reducing side effects associated with treating the diseases by administering the VEGF antagonist.

8 cl, 3 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: invention represents application of a recovered molecule of nucleic acid coding a protein which is differentially expressed in tissues of a malignant growth of pancreas, in diagnosing and treating cancer of pancreas. Also, diagnosing and treating cancer of pancreas is presented by: application of a vector containing said molecule of nucleic acid, application of said recovered polypeptide or protein, and also application of the recovered antibody which contacts with said polypeptide or protein.

EFFECT: invention can be effectively used in accurate diagnostics of pancreatic adenocarcinoma, in methods of treating and methods of identifying the agents used for treating this disease effectively.

7 cl, 9 dwg, 1 tbl, 8 ex

Up!