Primer set used for saccharomyces yeast detection

FIELD: medicine.

SUBSTANCE: invention represents primer sets for carrying out LIMP or PCR used for Saccharomyces pastorianus detection. Also, there are presented sets for Saccharomyces pastorianus detection containing a primer set according to the invention in a combination with a primer set for carrying out LAMP used for Saccharomyces bayanus detection, and also in a combination with a primer set for carrying out LAMP used for Saccharomyces cerevisiae and Saccharomyces pastorianus detection. There are presented methods for Saccharomyces pastorianus detection.

EFFECT: invention provides precise, quick and easy identification of Saccharomyces pastorianus yeast by means of PCR or LIMP.

19 cl, 4 dwg, 5 tbl, 4 ex

 

The technical field to which the invention relates

The present invention relates to a primer set used for the identification of yeasts of the genusSaccharomycesand particularly, to a primer set for LAMP and a set of primers for PCR, which is used for determination of yeasts of the genusSaccharomyces. In addition, the present invention relates to a method for identifying and quantifying yeast of the genusSaccharomycesthat uses this primer set.

The level of technology

Yeast of the genusSaccharomyceswidely used in baking, as well as in the production of alcoholic beverages such as beer, wine, Japanese rice vodka, distilled spirits and whiskey. YeastSaccharomyces cerevisiaeused in the production of alcoholic beverages obtained by fermentation, including verabradley beer, such as lager beer (ale), wine, Japanese rice vodka and fruity wine, such as cider, as well as in the production of purified with distillation of fluid, such as distilled spirits and whiskey. YeastSaccharomyces bayanusused in the manufacture of wine, sherry, sparkling wine, etc. bottom fermenting Yeast used in the production of light beer high quality, up to this time was attributed to the mindSaccharomyces pastorianus(Kurtzman, C. P. & Fell, J. W. The Yeasts, A Taxonomic Study, 4thedition, 1998, Elsevier Science, B. V., The Netherlands, Back, W.: Frbatlas und Handbuch der Geraenkebiologie, Teil I, 1994, Verlag Hans Carl. Nuernberg, Barnett, J. A. et al.: Yeasts, characteristics and identification, 3rdedition, 2000, Cambridge University Press, UK,SeishuKobo/KojiKenkyukai(Study Group for Sake Yeasts and Rice Malts): “Studies of Sake Yeasts”, 2003, Shinnihon Printing Inc., Tokyo). Thus, to understand whether the yeast used in the production of food and alcoholic beverages, assorted yeast, it is important to have a methodology for identification of the strain of yeast of the genusSaccharomyces.

However, if the yeast is stored in the filtered alcoholic drink, or they are introduced from the outside, there is excessive fermentation, resulting in turbidity and the emergence of the specific taste. So, this excessive fermentation, in addition, causes a sharp bitter taste, which affects the quality of the products. Back, W.: Farbatlas und Handbuch der Geraenkebiologie, Teil I, 1994, Verlag Hans Carl, nürnberg, European Brewery Convention: ANALYTICA-MICROBIOLOGICA-EBC, 2nded. 2005 Fachverlag Hans Carl, Nürnberg).

Moreover, yeast of the genusSaccharomycescan also be isolated from soft drinks and, in particular, from fruit juices. The presence of yeasts in foods leads to the separation of sugars, such as glucose or sucrose, carbon dioxide, ethanol and emergence of unpleasant taste and quality of the products as a result, much worse (Back, W.: Farbatlas und Handbuch der Geraenkebiologie, Teil II, 1999, Verlag Hans Carl, nürnberg).

Thus, the proliferation of yeast of the genusSaccharomycesthe products significantly affect industrial production. Accordingly, for quality control is an important method of rapid detection and/or identification of such yeast. In addition, if the yeast is of the genusSaccharomycesseparated from the products represent the yeast used in the production process, we make the conclusion that their presence is associated with a leak in the production process, lack of stage filtration, etc. If the yeast is separated from the products, brought from outside, then it is concluded insufficient rinsing of the filter, the presence of dust in the Bank, etc. Therefore, for solving problems in the detection of contamination is an important methodology for identification of yeast isolated from the products.

However, from the point of view of taxonomySaccharomyces pastorianus,Saccharomyces cerevisiaeandSaccharomyces bayanusare closely related species. Together with several other species of yeast, such asSaccharomyces paradoxusandSaccharomyces mikataethey form a taxonomic group calledSaccharomyces sensustricto's outcome., G. I. et al., Int. J. Syst. Evol. Environ., 2000, vol. 50, 1931-1942). In addition, be aware thatSaccharomyces pastorianusrepresents views obtained by crossingSaccharomyces cerevisiaeandSaccharomyces bayanusand at the gene level and at the chromosomal level, it was confirmed thatSaccharomyces pastorianusis a hybrid of the above types of yeast (Kielland-Brandt, M.C. et al.: Genetics of brewing yeast. The Yeast, 2ndedn, vol. 6, pp 223-254, Edited by Wheals, et al., Academic Press, New York, Ryu, S.-L. et al.: Yeast, 1996, vol. 12, 757, Tamai, Y. et al.: Yeast, 1998, vol. 14, 923-933, Tamai, Y. et al.: Yeast, 2000, vol. 16, 1335-1343). As traditional methods of identification of yeast using morphological, physiological and biochemical methods. In particular, in most cases, evaluated the ability of assimilation and fermentation of a large number of sugars. However, because the phenotypes of strains belonging to a taxonomic groupSaccharomyces sensustrictosimilar to each other, difficult such traditional methods to distinguish strains from each other (Naumova, E. S. et al.: Antonievan Leeuwenhoek, 2003, vol. 83, 155-166). As molecular biological approaches to distinguish these strains were known PCR fingerprinting, kinetic analysis of recombination, DNA/DNA, karyotype analysis, restriction analysis of mitochondrial DNA analysis of the nucleotide sequence of the rRNA genes, rDNA restriction analysis, PCR with universal primers, the analysis of isozyme, electrophoresis of PCR products in the gel with a temperature gradient PCR in real time, etc.

To date, developed a method, which includes the amplification of the gene FLO1 yeast of the genusSaccharomycesPCR or amplification of the gene rRNA PCR and then identification using RFLP whether the yeast of the genusSaccharomycesthe yeast is of a different kind, yeast, COI is Lituanie in fermentation, or yeast used for purposes other than fermentation (lined publication of the Japan patent No. 11-56366). In addition, based on the discovery that between genome 26S rRNA and 5S rRNA gene of the bottom fermenting yeast there are two types of sequences spacer elements areas were designed sets of primers for PCR, specific for the two types of sequences (lined publication of the Japan patent No. 2001-8684). In addition, primers were designed specific to congrego gene Lg-FLO1, in which the N-terminal site Lg-FLO1 are ligated with the gene of chromosome IX yeast (lined publication of the Japan patent No. 2002-233382).

However, because PCR or PCR in real time requires a high level of control over temperature and fluorescence observation, these methods require expensive equipment. In addition, upon completion of the PCR reaction should be carried out electrophoresis, painting, photography and etc, and thus, this method requires a longer period of time after amplification of genes to produce results. Moreover, for RAPD PCR, processing of the product of amplification by restrictase, analysis nucleotide sequence analysis of isozyme, gel electrophoresis in the temperature gradient, etc. require a longer period of time and and more complex operations, than conventional PCR, and therefore, these methods proved to be difficult in the exercise as a daily analysis of microorganisms.

On the other hand,Saccharomyces pastorianushas subgenera received fromSaccharomyces cerevisiae(Sc-type)and subgenera received fromSaccharomyces bayanus(Lg-type). According to recent studies at the bottom fermenting yeast is missing part of the right arm of chromosome XVI Sc-type, part of the right arm of chromosome III Lg-type and part of the left arm of chromosome VII Lg-type (Naoyuki Umemoto et al., “Production of physical map of beer yeasts and comparative genomic science”, 24thAnnual Meeting of the Molecular Biology Society of Japan (2001); Nakao et al., Proceedings of the 29thEBC Congress (2003); Yoshihiro Nakao: Chemistry and Organisms, 2005, vol. 43, No. 9, 559-561; and Japanese Patent Laid-Open Publication No. 2004-283169). However, under the existing conditions is still not received detailed information regarding chromosomal translocationSaccharomyces pastorianus.

In addition, they created a set of primers for the method LAMP (isothermally loop amplification, used for detectingSaccharomyces pastorianus(WO2005/093059). However, there is still a need to improve detection accuracy.

The invention

The authors of the present invention identified provisions of chromosomal translocations of the right arm of chromosome XVI, the right arm of chromosome III and the left arm of chromosome VII yeastSaccharomyces pastorianusand keeping Aravali genome around these provisions translocations. In addition, on the basis of this information, the authors present invention has been to develop a set of primers for accurate detection of yeasts of the genusSaccharomyces.

Further herein, the invention is related to a chromosomal translocation of the right arm of chromosome XVI, is designated as the first and second embodiments of the invention related to a chromosomal translocation of the right arm of chromosome III, is designated as a third option implementation, and the invention related to a chromosomal translocation of the left arm of chromosome VII, is designated as a fourth option implementation.

The first option exercise

The authors of the present invention have conducted genomic analysis of bottom-fermented yeast, referring to the form ofSaccharomyces pastorianusand in the result it was found that chromosome XVI Sc-type, bottom-fermented yeast translocases with the participation of Lg chromosome-type ORF gene GPH1 right shoulder, and additionally, it comes back translocases on ORF gene QCR2 in the final direction of the right shoulder, so she returns to the Sc-type. The authors of the present invention found that in the field, flanked genes GPH1 and QCR2 the right arm of chromosome XVI, at the bottom fermenting yeast is only the nucleotide sequence of an Lg-type.

The authors of the present invention, the bit which were developed by the primer set for LAMP, used for detectionSaccharomyces pastorianuson the basis of the sequence (SEQ ID NO: 6) gene MET Lg-type, located in the region flanked by the genes GPH1 and QCR2, and it was found that using designed a set of primers, it is possible to accurately determine theSaccharomyces pastorianus. The sequence of the gene MET Lg-type represents a new sequence, which so far has not been described in any of the published databases.

Specifically, the first variant of implementation of the present invention relates to a probe or primer used for detectionSaccharomyces pastorianusthat consists of polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotide having the nucleotide sequence of SEQ ID NO: 6, or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to the nucleotide sequence of SEQ ID NO: 6.

In accordance with the first embodiment the present invention also relates to a primer set for holding the LAMP used for detectionSaccharomyces pastorianus, which consists of two or more types of the above primers.

In accordance with the first embodiment the present invention also relates to a primer set d is I PCR, used for detectionSaccharomyces pastorianus, which consists of two or more types of the above primers.

In accordance with the first embodiment the present invention preferably refers to a set of primers for holding a LAMP used for detectionSaccharomyces pastorianusthat contains the following polynucleotide:

polynucleotide (FIP) with the nucleotide sequence SEQ ID NO: 1 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence;

polynucleotide (F3) with nucleotide sequence SEQ ID NO: 2 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence;

polynucleotide (BIP) with nucleotide sequence SEQ ID NO: 3 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence; and

polynucleotide (B3) with nucleotide sequence SEQ ID NO: 4 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotide having the sequence is, complementary to the given nucleotide sequence.

On the basis of the location of the chromosomal translocation of the right arm of chromosome XVI of the bottom fermenting yeast, the authors present invention has developed a set of primers for PCR used for detectionSaccharomyces pastorianusand then discovered that yeastSaccharomyces pastorianusyou can determine using this primer set.

Specifically, in accordance with the first embodiment the present invention relates to a primer set for PCR used for detectionSaccharomyces pastorianusthat contains: polynucleotide with nucleotide sequence SEQ ID NO: 27 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence; and polynucleotide with nucleotide sequence SEQ ID NO: 28 or ore of 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence.

In accordance with the first embodiment the present invention also relates to a primer set for PCR used for detectionSaccharomyces pastorianusthat contains: polynucleotide with the nucleotide sequence is SEQ ID NO: 29 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence; and polynucleotide with nucleotide sequence SEQ ID NO: 30 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence.

In accordance with the first embodiment the present invention also relates to a primer set for PCR used for detectionSaccharomyces pastorianusin which one of the primers is polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotide having the nucleotide sequence of SEQ ID NO: 6, or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to the nucleotide sequence of SEQ ID NO: 6, and the other primer is polynucleotide, consisting of at least 10 bases, which hybridizes with nucleotide sequence of Sc-type, which is out of scope, flanked genes GPH1 and QCR2 the right arm of chromosome XVI yeast grassroots fermentation or her with complementary sequence.

p> In accordance with the first embodiment the present invention relates to a method of detectionSaccharomyces pastorianus, which comprises carrying out the reaction nucleic acid amplification method LAMP, using a set of primers for holding the LAMP in accordance with the first embodiment.

In accordance with the first embodiment the present invention also relates to a method of detectionSaccharomyces pastorianus, which comprises carrying out the reaction nucleic acid amplification by the PCR method using a primer set for PCR in accordance with the first embodiment.

In accordance with the first embodiment the present invention additionally relates to a method of detectionSaccharomyces pastorianusthat includes the definition of the hybrid complex containing the probe in accordance with the first embodiment.

The second option exercise

The authors of the present invention have found that bottom-fermented yeast in the field, flanked genes GPH1 and QCR2 the right arm of chromosome XVI, is only the nucleotide sequence of an Lg-type. This means thatSaccharomyces pastorianusorSaccharomyces bayanusin the field, flanked genes GPH1 and QCR2 the right arm of chromosome XVI, no nucleotide sequence of Sc-type, and therefore the way, the above-mentioned nucleotide sequence of Sc-type-specificSaccharomyces cerevisiae.

On the basis of gene sequence MET Sc-type, located in the region flanked by the genes GPH1 and QCR2, the authors present invention has developed a set of primers for holding a LAMP used for detectionSaccharomyces cerevisiae. The inventors have later found that using this set of primers, one can accurately detectSaccharomyces cerevisiae.

Specifically, in accordance with the second embodiment the present invention relates to a primer set for holding the LAMP used for detectionSaccharomyces cerevisiaethat contains the following polynucleotide:

polynucleotide (FIP) with the nucleotide sequence SEQ ID NO: 7 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence;

polynucleotide (F3) with nucleotide sequence SEQ ID NO: 8 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence;

polynucleotide (BIP) with nucleotide sequence SEQ ID NO: 9 or polynucleotide comprising at m the re of 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence; and

polynucleotide (B3) with nucleotide sequence SEQ ID NO: 10 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence.

In accordance with a second embodiment the present invention relates to a method of detectionSaccharomyces cerevisiae, which comprises carrying out the reaction nucleic acid amplification method LAMP, using a set of primers for holding the LAMP in accordance with the second embodiment.

A third option exercise

The authors of the present invention found that chromosome III Lg-type bottom-fermented yeast translocases when part of a chromosome Sc-type locus MAT right shoulder and that of the bottom fermenting yeast from the MAT locus of the right arm of chromosome III to the end there is only the nucleotide sequence of Sc-type. This means that, becauseSaccharomyces cerevisiaeorSaccharomyces pastorianusfor the MAT locus of the right arm of chromosome III to the end lacks a nucleotide sequence Lg-type, the nucleotide sequence ofSaccharomyces bayanusaccording to the existing this area, specific toSaccharomyces bayanus.

On the basis of gene sequence homologous RAD18 located in the area between the MAT locus and the end of the right arm of the chromosome, the authors present invention has developed a set of primers for holding the LAMP used to determine theSaccharomyces bayanus. The inventors have later found that using this set of primers, one can accurately detectSaccharomyces bayanus.

Specifically, in accordance with a third embodiment the present invention relates to a primer set for holding the LAMP used to determine theSaccharomyces bayanusthat contains the following polynucleotide:

polynucleotide (FIP) with the nucleotide sequence SEQ ID NO: 13 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence;

polynucleotide (F3) with nucleotide sequence SEQ ID NO: 14 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence;

polynucleotide (BIP) with nucleotide sequence SEQ ID NO: 15 or polynucleotide, consisting of at least 10 bases of the deposits, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence; and

polynucleotide (B3) with nucleotide sequence SEQ ID NO: 16 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence.

The authors of the present invention has also developed a set of primers for PCR used for detectionSaccharomyces pastorianus,based on the position of the chromosomal translocation of the right arm of chromosome III of bottom fermenting yeast. The inventors have later found that using this set of primers, one can accurately detectSaccharomyces pastorianus.

Specifically, in accordance with a third embodiment the present invention relates to a primer set for PCR used for detectionSaccharomyces pastorianusthat contains: polynucleotide with nucleotide sequence SEQ ID NO: 23 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence; and polynucleotide with nucleotide sequence SEQ ID NO: 24 or polynucleotide consisting of p is at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence.

In accordance with a third embodiment the present invention relates to a method for determiningSaccharomyces bayanus, which comprises carrying out the reaction nucleic acid amplification method LAMP, using a set of primers for holding the LAMP in accordance with the third embodiment.

In accordance with a third embodiment the present invention also relates to a method for determiningSaccharomyces pastorianus, which comprises carrying out the reaction nucleic acid amplification by the PCR method using a primer set for PCR in accordance with the third embodiment.

The fourth option exercise

The authors of the present invention found that chromosome VII Lg-type bottom-fermented yeast translocases when part of a chromosome Sc-type ORF gene CAM located on the left shoulder. That is, the inventors have discovered that the bottom fermenting yeast for locus CAM the left arm of chromosome VII until the end of the left shoulder there is only the nucleotide sequence of Sc-type.

The authors of the present invention has also developed a set of primers for PCR used for detectionaccharomyces pastorianus, based on the regulation of chromosomal translocation of the left arm of chromosome VII of the bottom fermenting yeast. The inventors have later found that using this set of primers, one can accurately detectSaccharomyces pastorianus.

Specifically, in accordance with the fourth embodiment the present invention relates to a primer set for PCR used for detectionSaccharomyces pastorianusthat contains: polynucleotide with nucleotide sequence SEQ ID NO: 25 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence; and polynucleotide with nucleotide sequence SEQ ID NO: 26 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence.

In accordance with the fourth embodiment the present invention relates to a method of detectionSaccharomyces pastorianus, which comprises carrying out the reaction nucleic acid amplification by the PCR method using a primer set for PCR in accordance with the fourth embodiment.

Using sets of primers according to the present image is the shadow yeast of the genus Saccharomycescan be determined with high accuracy of form. In particular, the sets of primers for holding the LAMP in accordance with the present invention can be used in the reaction nucleic acid amplification method LAMP for detection nesenevich species on the basis of the presence or absence of the amplified product. Thus, using sets of primers for holding the LAMP according to the present invention is a yeast of the genusSaccharomycescan be with high precision, quickly and easily identified to species.

Using sets of primers for holding the LAMP in accordance with the present invention it is also possible to measure the number of cells contained in the sample. Thus, using sets of primers for holding the LAMP in accordance with the present invention can accurately quantify availabilitySaccharomyces pastorianus, Saccharomyces cerevisiaeandSaccharomyces bayanus.

Yeast of the genusSaccharomycesrepresent a species of yeast that make muddy different kinds of drinks, such as alcoholic and non-alcoholic drinks. Thus, the presence or absence of these types of yeast can be used as one indicator of the quality control of various types of drinks. Accordingly, sets of primers in accordance with the present invention can be used for quality control of the x types of drinks (for example, alcoholic and non-alcoholic beverages, namely, beer, beer, low-malt (fake beer, wine) and assessment of environmental samples.

Brief description of drawings

The figure 1 shows the specificity of the reaction with the primer set (LGM1LB1)used for detectionSaccharomyces pastorianusin respect of defined nesenevich species. We used the following strains:Saccharomyces cerevisiaeNBRC10217,Saccharomyces bayanusNBRC11022,Saccharomyces pastorianusNBRC11024, NBRC11023 and NBRC10610,Saccharomyces cerevisiaevar.diastaticusDSM70487,Saccharomyces paradoxusNBRC10609,Saccharomyces cariocanusNBRC10947,Saccharomyces mikataeNBRC1815,Saccharomyces kudriavzeviiNBRC 1802,Saccharomyces exiguousNBRC1128,Saccharomyces servazziiNBRC1838,Saccharomyces unisporusNBRC0316,Saccharomyces dairenensisNBRC0211,Saccharomyces kluyveriNBRC1685, Nega: without the addition of genomic DNA.

The figure 2 shows the fitted curve constructed based on the number of colony forming unitsSaccharomyces pastorianusand time detection method LAMP using LGM1LB1. The threshold time is on the horizontal axis indicates the time of the reaction, when the turbidity exceeds 0.1.

The figure 3 shows the specificity of the reaction with the primer set (SSC1LB1)used for detection of the genusSaccharomycesin respect detected nesenevich species. We used the following strains:Saccharomyces cerevisiaeNBRC10217,Saccharomyces bayanusNBRC11022,Saccharomyces pastorianusNBRC11024, NBR11023 and NBRC10610, Saccharomyces cerevisiaevar.diastaticusDSM70487,Saccharomyces paradoxusNBRC10609,Saccharomyces cariocanusNBRC10947,Saccharomyces mikataeNBRC1815,Saccharomyces kudriavzeviiNBRC 1802,Saccharomyces exiguousNBRC1128,Saccharomyces servazziiNBRC1838,Saccharomyces unisporusNBRC0316,Saccharomyces dairenensisNBRC0211,Saccharomyces kluyveriNBRC1685, Nega: without the addition of genomic DNA.

The figure 4 shows the specificity of the reaction with the primer set (SBFY1LF1LB1)used for detection of bottom-fermented yeast, in relation to a detected nesenevich species. We used the following strains:Saccharomyces cerevisiaeNBRC10217,Saccharomyces bayanusNBRC11022,Saccharomyces pastorianusNBRC11024, NBRC11023 and NBRC10610,Saccharomyces cerevisiaevar.diastaticusDSM70487,Saccharomyces paradoxusNBRC10609,Saccharomyces cariocanusNBRC10947,Saccharomyces mikataeNBRC1815,Saccharomyces kudriavzeviiNBRC 1802,Saccharomyces exiguousNBRC1128,Saccharomyces servazziiNBRC1838,Saccharomyces unisporusNBRC0316,Saccharomyces dairenensisNBRC0211,Saccharomyces kluyveriNBRC1685, Nega: without the addition of genomic DNA.

Detailed description of the invention

Primers and sets of primers

The primer set for holding the LAMP in accordance with the present invention consists of 4 types of primers, denoted by FIP, F3, BIP and B3. These primers correspond to the 6 areas of mistaway nucleotide sequence. Specifically, the field F3c, F2c, F1c, B1, B2 and B3 are determined in this order from the 3'end to the 5'-end of mistaway nucleotide sequence. Further, whereas the data is 6 regions create 4 types of primers, denoted by FIP, F3, BIP and B3. In this document the areas of complementary areas F3c, F2c and F1c are F3, F2 and F1, respectively. In addition, regions, complementary areas B1, B2 and B3 are Us, B2C and Vs respectively.

FIP is a primer created in such a way that it has a region F2, the complementary region F2c mistaway sequence at the 3'end side, and has a sequence similar to the sequence region F1c mesiniaga gene on the 5'-terminal side. If necessary, in the area between regions F1c and F2 primer FIP can be equipped with the restriction site.

F3 is a primer created in such a way that it has a region F3, complementary region F3c mesiniaga gene.

BIP is a primer created in such a way that it has a region B2, the complementary region of the B2C mistaway sequence at the 3'end side, and has a sequence similar to the sequence region Vs mesiniaga gene on the 5'-terminal side. If necessary, in the area between regions Us and B2 BIP primer can be equipped with the restriction site.

B3 is a primer created in such a way that it has a region B3, the complementary region Vs mesiniaga gene.

If the primers FIP and BIP are the sites of the enzyme, after which onania reaction nucleic acid amplification method LAMP amplificatory product is treated with restrictase, so you can see that after the electrophoresis was formed of a single strip. In the case when misheneva sequence already contains a restriction site, the need for artificial embedding such a restriction site in the primers may not be.

If you are using a set of primers for holding the LAMP in accordance with the present invention, to accelerate the reaction nucleic acid amplification you can add one or two types of loop primers (primer LF or primer LB). This loop primer design so that he was annealed in order in the region between F1 and F2 or between B1 and B2, and then it is added to the reaction system for carrying out LAMP. Thus, these primers are associated with a loop areas that are not used in the process of nucleic acid amplification for the amplification reaction of nucleic acid amplification, using all the hinge parts as matrices, allowing you to accelerate the reaction nucleic acid amplification (e.g., tiled publication of Japanese patent No. 2002-345499).

Specifically, among sets of primers for holding the LAMP in accordance with the first embodiment a set of primers for holding a LAMP consisting of polynucleotides having the nucleotide sequence of SEQ ID no: 1-4, or homologous them polynucleate is s, may optionally contain as a loop primer polynucleotide (LB) c nucleotide sequence of SEQ ID no: 5 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence.

The primer set for holding the LAMP in accordance with the second embodiment may further comprise as a loop(s) primer(s) one or both polynucleotide selected from polynucleotide (LF) with nucleotide sequence SEQ ID no: 11 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence; and polynucleotide (LB) with nucleotide sequence SEQ ID no: 12 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotide having the sequence complementary to the given nucleotide sequence.

The primer set for holding the LAMP in accordance with the third embodiment may further comprise as a loop primer polynucleotide (LB) with nucleotide sequence SEQ ID no: 17 or polynucleotide, consisting of at least 10 bases, which g is bridesmade with polynucleotides, having a sequence complementary to a given nucleotide sequence.

In accordance with the present invention as primers or probes can be used not only polynucleotide having the nucleotide sequence of SEQ ID no: 1-5 and 7-30, but also polynucleotide, hybridization with polynucleotide having a sequence complementary to the given nucleotide sequences SEQ ID no: 1-5 and 7-30 (which in the present description can also be designated as "homologous polynucleotide").

In addition, in accordance with the present invention as primers for holding a LAMP primers for PCR and probes can be used polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotide having the nucleotide sequence of SEQ ID no: 6, and polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to the nucleotide sequence of SEQ ID no: 6.

The term "gibridizatsiya" in the present description I understand that certain polynucleotide hybridizes with Milenium polynucleotides, but it is essentially not hybridized with polynucleotide other than mesiniaga of polynucleotide. Such hybridization can be carried out the ü in tough conditions. In this document, "stringent conditions" can be defined depending on the Tm (°C) dual chain comprising the sequence of the primer and the complementary him the chain, the necessary concentration of salt, etc. the Method of selection of the sequence used as a probe, and then identifying the hard conditions suitable for this purpose are well known to specialists in this field (see, for example, J. Sambrook, E. F. Frisch, T. Maniatis; Molecular Cloning 2ndedition, Cold Spring Harbor Laboratory (1989), and so on). In respect of such hard conditions, the hybridization reaction is carried out at a temperature slightly lower than Tm, defined on the basis of the nucleotide sequence (for example, at the temperature of about 0-5°C lower than the Tm), in a suitable buffer solution commonly used in hybridization. In addition, in relation to other severe conditions, washing after the hybridization reaction is carried out at high concentrations of low-concentrated salt solution. Examples of such stringent conditions include washing conditions, in which washing is carried out in a 6-fold SSC/0.05 per cent solution of sodium pyrophosphate at 37°C (for oligonucleotide consisting of about 14 bases), 48°C (for oligonucleotide consisting of about 17 bases), 55°C (for oligonucleotide comprising from about 20 bases) and 60°C (for the oligonucleotide consisting of the example is about 23 bases).

Length of nucleotides homologous polynucleotide is at least 10 bases.

In the case of primers for holding the LAMP, the length of the nucleotides of each polynucleotide homologous FIP and BIP, may preferably be at least 30 nucleotides (e.g., from 30 to 60 nucleotides) and, more preferably, at least 42 nucleotides (for example, from 42 to 57 nucleotides).

In addition, the length of the nucleotides of each polynucleotide homologous F3, B3, LF and LB, preferably, may be at least 12 bases (for example, from 12 to 30 bases) and, more preferably, at least 18 bases (for example, from 18 to 25 bases and from 18 to 30 bases).

In the case of primers for PCR, the length in nucleotides of each polynucleotide homologous to polynucleotides having the nucleotide sequence of SEQ ID no: 23-30, preferably, may be at least 15 bases (for example, from 15 to 30 bases, more preferably at least 18 bases (for example, from 18 to 24 bases and from 18 to 30 bases) and, particularly preferably at least 20 bases (for example, from 20 to 25 bases and from 20 to 30 bases).

Such homologous polynucleotide can be polynucleotide containing at least 10, preferably at least 15, more predpochtite is) at least 18, particularly preferably at least 20 consecutive nucleotides of the corresponding nucleotide sequence.

Below are examples of polynucleotides homologous to polynucleotides having the nucleotide sequence of SEQ ID no: 1-5 and 7-30.

Polynucleotide homologous to polynucleotide FIP, having the nucleotide sequence of SEQ ID NO: 1: polynucleotide containing at least 42 (42 to 52) and, more preferably, at least 47 (47 to 52) consecutive nucleotides of SEQ ID NO: 1 (which can be embedded one or more mutations) (which is the length in nucleotides can be no more than 60 bases and preferably not more than 57 reasons).

Polynucleotide homologous to polynucleotide F3 having the nucleotide sequence of SEQ ID NO: 2: polynucleotide containing at least 15 (15 to 19) and, more preferably, at least 18 (18 or 19 consecutive nucleotides of SEQ ID NO: 2 (which can be embedded one or more mutations) (which is the length in nucleotides can be no more than 30 bases, preferably not more than 25 bases, and more preferably, not more than 21 bases).

Polynucleotide homologous to polynucleotide BIP, having the nucleotide sequence of SEQ ID NO: 3: polynucleotide containing at least 36 (36 to 42) is, more preferably, at least 38 (38 to 42) consecutive nucleotides of SEQ ID NO: 3 (which can be embedded one or more mutations) (which is the length in nucleotides can be no more than 60 bases, preferably not more than 53 bases and, more preferably, not more than 47 reasons).

Polynucleotide homologous to polynucleotide B3 having the nucleotide sequence of SEQ ID NO: 4: polynucleotide containing at least 19 (19 to 23) and, more preferably, at least 21 (21 to 23) consecutive nucleotides of SEQ ID NO: 4 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases, and more preferably, not more than 25 bases).

Polynucleotide homologous to polynucleotide LB having the nucleotide sequence of SEQ ID NO: 5: polynucleotide containing at least 18 (18 to 22) and, more preferably, at least 20 (20 to 22) consecutive nucleotides of SEQ ID NO: 5 (which can be embedded one or more mutations) (which is the length in nucleotides can be no more than 30 bases and preferably not more than 25 bases).

Polynucleotide homologous to polynucleotide FIP, having the nucleotide sequence of SEQ ID NO: 7: polynucleotide containing at least 38 (38 to 47) and, more PR is doctitle, at least 42 (42 to 47) consecutive nucleotides of SEQ ID NO: 7 (which can be embedded one or more mutations) (which is the length in nucleotides can be no more than 60 bases and preferably not more than 53 grounds).

Polynucleotide homologous to polynucleotide F3 having the nucleotide sequence of SEQ ID NO: 8: polynucleotide containing at least 18 (18 to 22) and, more preferably, at least 19 (19 to 22) consecutive nucleotides of SEQ ID NO: 8 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases, preferably not more than 25 bases, and more preferably not more than 23 bases).

Polynucleotide homologous to polynucleotide BIP, having the nucleotide sequence of SEQ ID NO: 9: polynucleotide containing at least 42 (42 to 57), more preferably at least 47 (47 to 57), particularly preferably at least 51 (51 to 57) and, most preferably, at least 53 (53 to 57) consecutive nucleotides of SEQ ID NO: 9 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 60 grounds).

Polynucleotide homologous to polynucleotide B3 having the nucleotide sequence of SEQ ID NO: 10: polynucleotide provided is at least 19 (19 to 25) and more preferably, at least 22 (22 to 25) consecutive nucleotides of SEQ ID NO: 10 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases).

Polynucleotide homologous to polynucleotide LF having the nucleotide sequence of SEQ ID NO: 11: polynucleotide containing at least 19 (19 to 25) and, more preferably, at least 22 (22 to 25) consecutive nucleotides of SEQ ID NO: 11 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases).

Polynucleotide homologous to polynucleotide LB having the nucleotide sequence of SEQ ID NO: 12: polynucleotide containing at least 19 (19 to 25) and, more preferably, at least 22 (22 to 25) consecutive nucleotides of SEQ ID NO: 12 (which may be integrated with one or more mutations) (in which the length of the nucleotides can be no more than 30 bases).

Polynucleotide homologous to polynucleotide FIP, having the nucleotide sequence of SEQ ID NO: 13: polynucleotide containing at least 42 (42 to 53) and, more preferably, at least 48 (48 to 53) consecutive nucleotides of SEQ ID NO: 12 (which may be integrated with one or more mutations) (which is the length in nucleotides which may be no more than 60 bases and, preferably, not more than 57 reasons).

Polynucleotide homologous to polynucleotide F3 having the nucleotide sequence of SEQ ID NO: 14: polynucleotide containing at least 18 (18 to 21) and, more preferably, at least 19 (19 to 21) consecutive nucleotides of SEQ ID NO: 13 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases, preferably not more than 25 bases, and more preferably not more than 23 bases).

Polynucleotide homologous to polynucleotide BIP, having the nucleotide sequence of SEQ ID NO: 15: polynucleotide containing at least 37 (from 37 to 44) and, more preferably, at least 42 (42 to 44) consecutive nucleotides of SEQ ID NO: 14 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 60 bases, preferably not more than 53 bases and, more preferably, not more than 47 reasons).

Polynucleotide homologous to polynucleotide B3 having the nucleotide sequence of SEQ ID NO: 16: polynucleotide containing at least 19 (19 to 25) and, more preferably, at least 22 (22 to 25) consecutive nucleotides of SEQ ID NO: 15 (which may be integrated with one or more mutations) (which is the length in nucleotides can with what amount to no more than 30 bases).

Polynucleotide homologous to polynucleotide LB having the nucleotide sequence of SEQ ID NO: 17: polynucleotide containing at least 14 (14 to 18) and, more preferably, at least 16 (16 to 18) consecutive nucleotides of SEQ ID NO: 16 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases, preferably not more than 25 bases, and more preferably, not more than 22 bases).

Polynucleotide homologous to polynucleotide FIP, having the nucleotide sequence of SEQ ID NO: 18: polynucleotide containing at least 38 (38 to 47) and, more preferably, at least 42 (42 to 47) consecutive nucleotides of SEQ ID NO: 18 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 60 bases and preferably not more than 53 grounds).

Polynucleotide homologous to polynucleotide F3 having the nucleotide sequence of SEQ ID NO: 19: polynucleotide containing at least 18 (18 to 20) and, more preferably, at least 19 (19 or 20) consecutive nucleotides of SEQ ID NO: 19 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases, preferably not more than 25 bases, and more preferred is entrusted, not more than 22 bases).

Polynucleotide homologous to polynucleotide BIP, having the nucleotide sequence of SEQ ID NO: 20: polynucleotide containing at least 36 (36 to 42) and, more preferably, at least 38 (38 to 42) consecutive nucleotides of SEQ ID NO: 20 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 60 bases, preferably not more than 53 bases and, more preferably, not more than 47 reasons).

Polynucleotide homologous to polynucleotide B3 having the nucleotide sequence of SEQ ID NO: 21: polynucleotide containing at least 18 (18 to 20) and, more preferably, at least 19 (19 or 20) consecutive nucleotides of SEQ ID NO: 21 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases, preferably not more than 25 bases, and more preferably, not more than 22 bases).

Polynucleotide homologous to polynucleotide LB having the nucleotide sequence of SEQ ID NO: 22: polynucleotide containing at least 18 (18 to 20) and, more preferably, at least 19 (19 or 20) consecutive nucleotides of SEQ ID NO: 22 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 is of Sevani, preferably, not more than 25 bases, and more preferably, not more than 22 bases).

Polynucleotide homologous to polynucleotide having the nucleotide sequence of SEQ ID NO: 23: polynucleotide containing at least 19 (19 to 23) and, more preferably, at least 21 (21 to 23) consecutive nucleotides of SEQ ID NO: 17 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases and preferably not more than 25 bases).

Polynucleotide homologous to polynucleotide having the nucleotide sequence of SEQ ID NO: 24: polynucleotide containing at least 20 (20 to 24) and, more preferably, at least 22 (22 to 24) consecutive nucleotides of SEQ ID NO: 18 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases and preferably not more than 25 bases).

Polynucleotide homologous to polynucleotide having the nucleotide sequence of SEQ ID NO: 25: polynucleotide containing at least 18 (18 to 21) and, more preferably, at least 19 (19 to 21) consecutive nucleotides of SEQ ID NO: 19 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases and preferably is, not more than 25 bases).

Polynucleotide homologous to polynucleotide having the nucleotide sequence of SEQ ID NO: 26: polynucleotide containing at least 14 (14 to 18) and, more preferably, at least 16 (16 to 18) consecutive nucleotides of SEQ ID NO: 20 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases, preferably not more than 25 bases, and more preferably not more than 23 bases).

Polynucleotide homologous to polynucleotide having the nucleotide sequence of SEQ ID NO: 27: polynucleotide containing at least 16 (16 to 20) and, more preferably, at least 18 (18 to 20) consecutive nucleotides of SEQ ID NO: 21 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases, preferably not more than 25 bases, and more preferably not more than 23 bases).

Polynucleotide homologous to polynucleotide having the nucleotide sequence of SEQ ID NO: 28: polynucleotide containing at least 16 (16 to 20) and, more preferably, at least 18 (18 to 20) consecutive nucleotides of SEQ ID NO: 22 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 OS is Avani, preferably, not more than 25 bases, and more preferably not more than 23 bases).

Polynucleotide homologous to polynucleotide having the nucleotide sequence of SEQ ID NO: 29: polynucleotide containing at least 16 (16 to 20) and, more preferably, at least 18 (18 to 20) consecutive nucleotides of SEQ ID NO: 23 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases, preferably not more than 25 bases, and more preferably not more than 23 bases).

Polynucleotide homologous to polynucleotide having the nucleotide sequence of SEQ ID NO: 30: polynucleotide containing at least 16 (16 to 20) and, more preferably, at least 18 (18 to 20) consecutive nucleotides of SEQ ID NO: 24 (which may be integrated with one or more mutations) (which is the length in nucleotides can be no more than 30 bases, preferably not more than 25 bases, and more preferably not more than 23 bases).

Polynucleotide in accordance with the present invention, consisting of at least 10 bases, hybridization with polynucleotide having the nucleotide sequence of SEQ ID NO: 6, and polynucleotide, consisting of at least 10 bases, hybridization with polynucleotide with serial is lnost, complementary to the nucleotide sequence of SEQ ID NO: 6, can be polynucleotide containing at least 10 consecutive nucleotides of a sequence complementary to the nucleotide sequence of SEQ ID NO: 6, and polynucleotide containing at least 10 consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 6, respectively.

If polynucleotide created on the basis of the nucleotide sequence of SEQ ID NO: 6, used as a primer for holding LAMP (FIP and BIP), as a primer you can use polynucleotide containing at least 42 (for example, from 42 to 57) consecutive nucleotides (which may be integrated with one or more mutations) nucleotide sequence of SEQ ID NO: 6 or a sequence complementary to it (where the length in nucleotides can be no more than 60 bases and preferably not more than 57 reasons).

If polynucleotide created on the basis of the nucleotide sequence of SEQ ID NO: 6, used as a primer for holding LAMP (F3, B3, LB, and LF), as a primer you can use polynucleotide containing at least 18 (for example, from 18 to 25 consecutive nucleotides (which may be integrated with one or more mutations) nucleotide sequence of SEQ ID NO: 6 or the sequence to plementary her (where the length in nucleotides can be no more than 30 bases and, preferably, not more than 25 bases).

If polynucleotide created on the basis of the nucleotide sequence of SEQ ID NO: 6, used as a primer for PCR, the primer can be used polynucleotide containing at least 15 (e.g., from 15 to 30), more preferably at least 18 (for example, from 18 to 24, 18 to 30) and, particularly preferably, at least 20 (e.g., from 20 to 25 and 20 to 30 consecutive nucleotides (which may be integrated with one or more mutations) nucleotide sequence SEQ ID NO: 6 or a sequence complementary to it (where the length in nucleotides can be no more than 30 bases, preferably not more than 25 bases, and more preferably, not more than 24 bases).

In accordance with the present invention on the basis of polynucleotide having the nucleotide sequence of SEQ ID NO: 6, can be selected primer pair for PCR for detectionSaccharomyces pastorianus. Specifically, the primers for PCR can be selected so that one of the two primers were paired with the nucleotide sequence of SEQ ID NO: 6, while the other primer was paired with a sequence complementary to the nucleotide sequence of SEQ ID NO: 6, and that one of the primers were paired with the growing chain, extendable with p the power of the other primer.

In addition, in accordance with the present invention on the basis of polynucleotide having the nucleotide sequence of SEQ ID NO: 6 may be selected primer set for holding the LAMP for detectionSaccharomyces pastorianus. Specifically developed 4 types of primers required for implementing the method LAMP, denoted by FIP, F3, BIP and B3, as described above, and, if necessary, you can also use loop primers, such as LF and LB.

In addition, each homologous polynucleotide and polynucleotide created on the basis of the nucleotide sequence of SEQ ID NO: 6, can be polynucleotide, the homology of which is at least 90%, preferably at least 95% with each corresponding nucleotide sequence. Quantitatively, the magnitude of the homology can be calculated in accordance with the algorithm, well known in this field. For example, to quantify the magnitude of the homology can be calculated using BLAST (http://www.ddbj.nig.ac.jp/search/blast-j.html).

Moreover, such a homologous polynucleotide and polynucleotide created on the basis of the nucleotide sequence of SEQ ID NO: 6, can be polynucleotide, which consists of a modified nucleotide sequence that embed one or more mutations compared to the corresponding Amu is ateneu sequence, and hybridized with polynucleotides having a sequence complementary to the corresponding nucleotide sequence.

In this document, the term "mutation", which may be the same or different, understand the substitution, deletion, insertion and addition. Such a mutation may be selected, preferably, from single nucleotide substitutions," in which a certain base is replaced by another base, "single nucleotide deletions," in which a certain base falls, "single nucleotide insertion, in which a certain base is embedded, and single nucleotide additive", in which a certain base is added. The number of mutated nucleotides can be from 1 to 6 bases, 1, 2, 3 or 4 bases, 1 or 2 of the base 1 or base.

In accordance with the present invention, the term "polynucleotide" understand DNA, RNA and PNA (peptide nucleic acid).

Polynucleotide, which is the set of primers in accordance with the present invention, can be obtained by chemical synthesis of nucleic acids according to the standard method such as the method of synthesis through a complex triavir phosphate (Hunkapiller, M. et al., Nature, 310, 105, 1984). Otherwise, you may receive the total DNA of strain in the form of detectable target, and then, if necessary, can be floor is Jong DNA fragment, containing the nucleotide sequence of interest, the PCR method or the like on the basis of the nucleotide sequences disclosed in the present description.

A particular variant of the method of detection in accordance with the present invention may include a method of detection, which includes amplification reaction of nucleic acid sample containing nucleic acid, the method LAMP and then the detection of the presence or absence of the amplification product of the nucleic acid. Specifically, the following methods.

In the first embodiment, the present invention relates to a method for determiningSaccharomyces pastorianusthat includes:

(a) conduct an amplification reaction of nucleic acids to nucleic acid contained in a sample, the method LAMP, using a set of primers for holding the LAMP in accordance with the first embodiment of the present invention; and

(b) determining the presence or absence of the amplification product,

where the education of the amplified product indicates the presence ofSaccharomyces pastorianus.

In the second embodiment, the present invention relates to a method of detectionSaccharomyces cerevisiaethat includes:

(C) carrying out amplification reaction of nucleic acid to nucleic acid, soderjaschiesya sample, way LAMP, using a set of primers for holding the LAMP in accordance with the second embodiment of the present invention; and

(d) determining the presence or absence of the amplification product,

where the education of the amplified product indicates the presence ofSaccharomyces cerevisiae.

In the third embodiment, the present invention relates to a method of detectionSaccharomyces bayanusthat includes:

(e) conducting the amplification reaction of nucleic acids to nucleic acid contained in a sample, the method LAMP, using a set of primers for holding the LAMP in accordance with a third embodiment of the present invention; and

(f) determining the presence or absence of the amplification product,

where the education of the amplified product indicates the presence ofSaccharomyces bayanus.

The sample subjected to the process of nucleic acid amplification method of a LAMP can be obtained by a method in which cultured cells contained in the sample, and a nucleic acid extracted from cultured cells, or a nucleic acid extracted without such cultivation process. Obtaining a sample containing nucleic acid, such as cell culture, extraction of nucleic acids will be described below.

In the process of amplification of nucleic acid is the acid method of LAMP reaction amplification carried out on the nucleic acid, contained in the sample. This reaction nucleic acid amplification method LAMP will be described below.

In the case where the detected mechaniy species is present in the sample, as a target amplificates specific region and formed product amplification. The formation of such a product amplification solution containing the sample is subjected to amplification reaction of nucleic acid, it becomes muddy. Thus, the presence or absence of the amplification product can be determined by measuring the turbidity of a solution containing the sample. The turbidity measurement method LAMP is well known. Turbidity can be measured using commercially available device for measuring the turbidity of the endpoint (for example, LA-100 manufactured by Teramecs Co., Ltd.) or instrument for measuring turbidity in real time (for example, LA-200 manufactured by Teramecs Co., Ltd.).

As described in the following examples, to determine the number of cells contained in the sample to be tested, measuring the time required to achieve a solution containing the sample, a certain turbidity. Specifically, in another aspect of the method of detection in accordance with the present invention it is proposed a method of quantitative evaluationSaccharomyces pastorianus,Saccharomyces cerevisiaeandSaccharomyces bayanusthat includes the reaction of signal amplification for mobile and nucleic acids in the sample, containing nucleic acid, the method LAMP, and simultaneously measuring the time required from the start of the amplification reaction of the nucleic acid until the solution containing the sample, a certain turbidity, and determining the number of cells contained in the sample based on the measured time. The way of estimating the present invention specifically the following.

In the first embodiment, the present invention relates to a method of quantitative evaluationSaccharomyces pastorianusthat includes:

(a) conduct an amplification reaction of nucleic acids to nucleic acid contained in a sample, the method LAMP, using a set of primers for holding the LAMP in accordance with the first embodiment of the present invention;

(b') is a measure of the time required from the start of the amplification reaction of the nucleic acid until the solution containing the sample, a certain turbidity; and

(b) determining the number of cells contained in the sample based on the measured time.

In the second embodiment, the present invention relates to a method of quantitative evaluationSaccharomyces cerevisiaethat includes:

(C) carrying out amplification reaction of nucleic acids to nucleic acid contained in a sample, the method LAMP, using a set of primers for LAMP in accordance with the second embodiment of the present invention;

(d') is a measure of the time required from the start of the amplification reaction of the nucleic acid until the solution containing the sample, a certain turbidity; and

(d) determining the number of cells contained in the sample based on the measured time.

In the third embodiment, the present invention relates to a method of quantitative evaluationSaccharomyces bayanusthat includes:

(e) conducting the amplification reaction of nucleic acids to nucleic acid contained in a sample, the method LAMP, using a set of primers for holding the LAMP in accordance with a third embodiment of the present invention;

(f) measuring the time required from the start of the amplification reaction of the nucleic acid until the solution containing the sample, a certain turbidity; and

(f) determining the number of cells contained in the sample based on the measured time.

In the method for quantitative evaluation in accordance with the present invention was previously constructed calibration curve using the number of cells and the time required to achieve a solution containing the sample, a certain turbidity. After that, on the basis of a calibration curve based on the measured time, you can get the number of cells contained in the sample. A calibration curve can be obtained, for example, the R, preparing samples by gradual cultivation of cells, and then performing amplification of nucleic acid in each sample according to the mode LAMP, and then plotting a graph of the time required from the start of the amplification reaction of nucleic acid to achieve a turbidity of 0.1 relative to the logarithm of the number of colony-forming cells.

In the method of detection and the method of quantitative evaluation in accordance with the present invention the primer set consisting of FIP, F3, BIP and B3, can be added(s) loop(s) primer(s) (LF and/or LB), after which the reaction nucleic acid amplification can be carried out by way LAMP. Specifically, in the method of detection and the method of quantitative evaluation in accordance with the first embodiment of the present invention, using a set of primers for holding a LAMP consisting of polynucleotides having the nucleotide sequence of SEQ ID nos: 1-4, or homologous them polynucleotides can be added and used as a loop primer polynucleotide with nucleotide sequence SEQ ID NO: 5 or a homologous him polynucleotide. In the method of detection and the method of quantitative evaluation in accordance with the second embodiment of the present invention can be added and used as the hinge(s) primer(s) one or both of the following polynucleotides polynucleotide with nucleotide sequence SEQ ID NO: 11 or homologous him polynucleotide, polynucleotide with nucleotide sequence SEQ ID NO: 12 or homologous him polynucleotide. In the method of detection and the method of quantitative evaluation in accordance with the third embodiment of the present invention can be added and used as a loop primer polynucleotide with nucleotide sequence SEQ ID NO: 17 or homologous him polynucleotide.

Sets of primers for holding the LAMP in accordance with the present invention can be used alone or in combination, depending on the specific circumstances. Using sets of primers in accordance with the present invention in combination, it becomes possible to accurately distinguish one from anotherSaccharomyces pastorianus,Saccharomyces cerevisiaeandSaccharomyces bayanus.

In addition, sets of primers for holding the LAMP in accordance with the present invention can be presented in the form of a kit, alone or in combination. Thus, the present invention relates to a kit for detection of yeasts of the genusSaccharomycesthat contains a set of primers selected from the group consisting of a primer set for holding the LAMP in the first embodiment of implementation; primer set for holding the LAMP according to the second variant of implementation; primer set for holding the LAMP according to the third variant of implementation; and combinations cha is ti or all of these sets of primers.

Set in accordance with the present invention, which contains a set of primers for holding a LAMP may include reagents (e.g., DNA polymerase Bst solution for mixing the reagents for the reaction) and consumables (such as a test tube for the reaction), are necessary to carry out the reaction nucleic acid amplification method LAMP.

Set in accordance with the present invention, which contains a set of primers for PCR, may include reagents (e.g., DNA polymerase, purified water) and consumables (such as a test tube for the reaction), which are necessary for the implementation of the amplification reaction of nucleic acid by PCR method.

The primer set for holding the LAMP in accordance with the first embodiment of the present invention is aimed at gene MET Lg-type, and perhaps it can react withSaccharomyces bayanusthat is not consistent with the terms of genomic structure. On the other hand, the primer set for holding the LAMP in accordance with a third embodiment of the present invention is aimed at geneSaccharomyces bayanushomologous RAD18 gene, which is absent inSaccharomyces cerevisiaeorSaccharomyces pastorianusand it enables us to determine theSaccharomyces bayanuswith high accuracy. Accordingly, when neo is needed to more accurately detect Saccharomyces pastorianusit is preferable to use a set of primers for holding the LAMP in accordance with the first embodiment of the present invention in combination with a set of primers for holding a LAMP used for detectionSaccharomyces bayanus(the preferred set of primers for holding the LAMP in accordance with the third embodiment). In this case, with the passage of reaction amplification with primer set for holding the LAMP in accordance with the first embodiment of the present invention, and primer set for holding the LAMP used for detectionSaccharomyces bayanusor , in the absence of such a reaction amplification with primer set for holding the LAMP in accordance with the first embodiment, but pass it with a set of primers for holding a LAMP used for detectionSaccharomyces bayanusyou can determine that the sample isSaccharomyces bayanus. Upon detection of amplification reaction primer set for holding the LAMP in accordance with the first embodiment of the present invention and the absence of such a reaction amplification with primer set for holding the LAMP used for detectionSaccharomyces bayanusyou can determine that the sample isSaccharomyces pastorianus.

Thus, the present invention relates to a kit for children who functions Saccharomyces pastorianusthat contains a set of primers for holding the LAMP in accordance with the first embodiment of the present invention in combination with a set of primers for holding a LAMP used for detectionSaccharomyces bayanus.

In addition, in accordance with the present invention, the method of detectionSaccharomyces pastorianusin accordance with the first embodiment of the present invention may optionally include the stage of the reaction nucleic acid amplification method LAMP primer set for holding the LAMP used for detectionSaccharomyces bayanus. This stage may include the stage of the reaction, amplification of nucleic acid in a sample containing nucleic acid, the method LAMP and the stage of determining the presence or absence of the amplification product of the nucleic acid.

In the above descriptions as a set of primers for holding a LAMP used for detectionSaccharomyces bayanuspreferred is a primer set for holding the LAMP in accordance with a third embodiment of the present invention.

In addition, if it is necessary to define preciselySaccharomyces pastorianususing a set of primers for holding the LAMP in accordance with the first embodiment of the present invention, it is preferable to use a set of primer is in for holding the LAMP in accordance with the first embodiment of the present invention in combination with a set of primers for holding a LAMP able to detectSaccharomyces cerevisiaeandSaccharomyces pastorianus. The primer set for holding the LAMP used for detectionSaccharomyces pastorianusin accordance with the first embodiment of the present invention may cross-interact withSaccharomyces bayanusthat is not consistent with the terms of genomic structure. The primer set for holding the LAMP used for detectionSaccharomyces cerevisiaeandSaccharomyces pastorianusinteracts with genomic sequenceSaccharomyces cerevisiaecontained inSaccharomyces pastorianusbutSaccharomyces bayanusno such genomic sequencesSaccharomyces cerevisiae. Thus, the primer set for holding the LAMP used for detectionSaccharomyces cerevisiaeandSaccharomyces pastorianusthat does not interact withSaccharomyces bayanus. In this case, with the passage of reaction amplification with primer set for holding the LAMP used for detectionSaccharomyces pastorianusin accordance with the present invention, and primer set for holding the LAMP used for detectionSaccharomyces cerevisiaeandSaccharomyces pastorianusyou can determine that the sample isSaccharomyces pastorianus. If the response amplification takes place with a set of primers for holding a LAMP used for detectionSaccharomyces pastorianusin accordance with the present invention, but such is the action of amplification fails with a set of primers for holding a LAMP used for detectionSaccharomyces cerevisiaeandSaccharomyces pastorianusyou can determine that the sample isSaccharomyces bayanus.

Thus, the present invention relates to a kit for detectionSaccharomyces pastorianusthat contains a set of primers for holding the LAMP in accordance with the first embodiment of the present invention in combination with a set of primers for holding a LAMP used for detectionSaccharomyces cerevisiaeandSaccharomyces pastorianus.

In addition, in accordance with the present invention, the method of detectionSaccharomyces pastorianusin accordance with the first embodiment of the present invention may optionally include the stage of the reaction nucleic acid amplification method LAMP primer set for holding the LAMP used for detectionSaccharomyces cerevisiaeandSaccharomyces pastorianus. This stage may include the stage of the reaction, amplification of nucleic acid in a sample containing nucleic acid, the method LAMP and the stage of determining the presence or absence of the amplification product of the nucleic acid.

In the above embodiments, the implementation of a set of primers for holding a LAMP used for detectionSaccharomyces cerevisiaeandSaccharomyces pastorianuspreferably contains the following polynucleotide:

polynucleotide (FIP) with the nucleotide placenta is the sequence SEQ ID NO: 18 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence;

polynucleotide (F3) with nucleotide sequence SEQ ID NO: 19 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence;

polynucleotide (BIP) with nucleotide sequence SEQ ID NO: 20 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence; and

polynucleotide (B3) with nucleotide sequence SEQ ID NO: 21 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides having a sequence complementary to a given nucleotide sequence.

The above set of primers for holding a LAMP used for detectionSaccharomyces cerevisiaeandSaccharomyces pastorianusmay optionally contain as a loop primer polynucleotide (LB) with nucleotide sequence SEQ ID NO: 22 or polynucleotide, consisting of at least 10 bases, which hybridizes with polynucleotides with posledovatel the face, complementary to the given nucleotide sequence.

Among the methods of detection in accordance with the present invention a particular variant of the method detection by PCR can include a method of detection, which provides for amplification reaction of nucleic acid in a sample containing nucleic acid, PCR method, and then the detection of the presence or absence of the amplification product of the nucleic acid.

Specifically, the invention relates to a method of detectionSaccharomyces pastorianusthat includes:

(g) a reaction for the amplification of nucleic acid in the nucleic acid contained in the sample, the PCR method using a primer set for PCR in accordance with the first embodiment, the third embodiment or the fourth embodiment of the present invention; and

(h) determining the presence or absence of the amplification product,

where the formation of amplification product indicates the presence of aSaccharomyces pastorianus.

As the sample subjected to the process of nucleic acid amplification method is PCR, can be cultured cells contained in the sample, and can be extracted nucleic acid, or this nucleic acid can be extracted without cultivation. Obtaining a sample containing nucleic acid, such as cell culture, or extraction of nucleic acids will be described next.

In the process of nucleic acid amplification method is PCR reaction amplification is performed on a nucleic acid contained in the sample. This reaction amplification of nucleic acid carried out by the PCR method, are widely known. Specialists in this field can appropriately determine the conditions for the PCR method or its modifications and can carry out the PCR method.

Among the methods of detection in accordance with the present invention a particular variant of the method detection using probe may include a method of detection, which provides for hybridization of a probe in accordance with the present invention with a sample containing nucleic acid, and then the detection of the presence or absence of the complex with the nucleic acid.

Specifically, the invention relates to a method of detectionSaccharomyces pastorianusthat includes:

(i) bringing into contact of a probe in accordance with the first embodiment of the present invention with a nucleic acid contained in the sample; and

(j) determining the presence or absence of the hybrid complex,

where the formation of a hybrid complex indicates the presence of aSaccharomyces pastorianus.

In this method of determining, using the onda river, before use, the probes may be labeled. Examples of labels are radioactive elements (such as32P and14C), fluorescent compounds (e.g., FITC) and molecules associated with the enzymatic reaction (e.g., peroxidase, alkaline phosphatase).

Hybrid complex can be determined by known methods, such as hybridization to Nozero, hybridization on Southern and hybridization of bacterial colonies.

If the reaction nucleic acid amplification is performed using the set of primers in accordance with the present invention, the yeast is of the genusSaccharomycesthat cause a decrease in the quality of alcoholic beverages or soft drinks, can be directly identified to species. Accordingly, the primer set and set in accordance with the present invention can be used for quality control of alcoholic beverages (e.g. beer, beer, low-malt, wines, fruit wines, Japanese rice vodka) and/or non-alcoholic drinks (e.g. fruit juice) and the evaluation of the sample from the environment (e.g., source water).

As a species of yeast, causing deterioration of quality in the process of beer production and beer, low-malt or their end products, can be detected Saccharomycespastorianus,Saccharomyces cerevisiae andSaccharomyces bayanus. Therefore, for quality control of beer and beer, low-malt possible, it is preferable to use a set of primers for holding a LAMP and a set of primers for PCR in accordance with the first embodiment; primer set for holding the LAMP in accordance with the second embodiment; set of primers for holding a LAMP and a set of primers for PCR in accordance with the third embodiment; primer set for PCR in accordance with the fourth embodiment; and a combination of some or all of these sets of primers.

As a species of yeast, causing deterioration of quality in the wine production process or the final product, can be foundSaccharomyces cerevisiaeandSaccharomyces bayanus. Therefore, for quality control of wine, it is preferable to use a set of primers for holding the LAMP in accordance with the second embodiment; primer set for holding the LAMP in accordance with a third embodiment; and their combination.

As a species of yeast, causing deterioration of quality in the production process of non-alcoholic beverages (fruit juice) or their end products, can be foundSaccharomyces cerevisiaeandSaccharomyces bayanus. Therefore, to control the quality of the soft NAP is tcov (in particular, fruit juice) can preferably be used a set of primers for holding the LAMP in accordance with the second embodiment; primer set for holding the LAMP in accordance with a third embodiment; and their combination.

The reaction nucleic acid amplification method LAMP

The primer set for holding the LAMP in accordance with the present invention can be used as primers for the amplification reaction of nucleic acid-way LAMP. The set of primers in accordance with the present invention can also be used as primers not only for the reaction nucleic acid amplification method LAMP, but also for the amplification reaction of nucleic acids modified way LAMP. The principle method LAMP and method for nucleic acid amplification with its use are well known. As reference material for the reaction nucleic acid amplification method LAMP you can use the descriptions set forth in the patent WO00/28082, and Notomi, T. et al., Nucleic Acids Research, 28(12), e63(2000).

The reaction nucleic acid amplification method LAMP can be performed using commercially available reagents for gene amplification method LAMP. The reaction nucleic acid amplification can be performed, for example, by mixing the DNA sample solution is, containing primers, and reagents that are included in commercially available reagents for gene amplification method LAMP (for example, set to Loopamp DNA amplification manufactured by Eiken Chemical Co., Ltd.) according to the instructions contained in the set, and then maintaining the resulting mixture at a certain temperature (60°C to 65°C), so that the reaction could last a certain period of time (usually 1 hour).

The reaction nucleic acid amplification method LAMP can be realized by the following processes.

(i) the DNA strand, complementary to the matrix DNA, synthesized using DNA polymerase activity by type displacement circuits using 3'-end region of F2 polynucleotide FIP as a starting point.

(ii) the F3 Primer annealed to the website outside of polynucleotide FIP, and DNA synthesis continues under the action of DNA polymerase activity by type of displacement of the chain, using its 3'-end as the starting point, as removal of the previously synthesized DNA chain with FIP.

(iii) Double chain is formed by a chain of DNA synthesized with primers F3 and DNA templates.

(iv) the DNA Chain, previously synthesized with FIP, is removed by a chain DNA with primers F3, thus, the DNA becomes single-stranded. However, this strand of DNA is complementary region F1c and F1 on the 5'-terminal stretch, and it causes smooth with education is the use of loops.

(v) BIP annealed to the DNA chain, which formed a loop in the above process (iv), and complementary DNA is synthesized using 3'-end of polynucleotide BIP as a starting point. In this process loop is moved and lengthened. Further, the B3 primer annealed to the outside of the BIP, and DNA synthesis continues under the action of DNA polymerase activity by type of displacement of the chain, using its 3'-end as the starting point, as removal of the previously synthesized DNA chain with BIP.

(vi) double-Stranded DNA is formed in the above process (v).

(vii) Because the DNA strand synthesized with BIP, which was removed in the above process (v)have complementary sequences at both ends, it causes smooth with the formation of the loop, so it gets a dumbbell structure.

(viii) Using as matrix the above chain DNA having a dumbbell structure, carry out the cycle of amplification of the desired DNA by annealing FIP and then annealing the BIP.

The person skilled in the art would understand how to carry out the reaction of the nucleic acid amplification method LAMP using appropriately modified the above processes. In this modified method it is also possible to use a set of primers in accordance with the present invention.

The set of Prime the ditch for holding the LAMP in accordance with the present invention causes the synthesis of the DNA strand at a temperature of from about 60°C to about 65°C (for example, 65°C)and annealing. The reaction is carried out for about 1 hour through the reaction annealing and synthesis of the DNA strand so that the nucleic acid can be amplified in 109-1010time.

If the primer set for holding the LAMP in accordance with the present invention is left to interact with nucleic acid from the sample under conditions suitable for the reaction nucleic acid amplification method LAMP, the detectable target amplificates misheneva the scope chain. If this reaction amplification occurs, the reaction solution becomes cloudy due to the influence of magnesium pyrophosphate produced as a by-product. Thus, on the basis of turbidity can visually determine the presence or absence of amplification. The presence or absence of amplification can also be determined optically by measuring turbidity using a device for measuring turbidity. Alternatively, for confirmation and detection of the presence or absence of a DNA fragment can be used agarose gel electrophoresis or the like.

Detection of nucleic acid amplification indicates the presence of mistaway nucleotide sequence, indicating that the strain as a detectable target primer set is positive (+). On the contrary, if the amplification of nucleic acid is not observed the W this means the absence of mistaway nucleotide sequence, indicating that the strain as a detectable target primer set is negative (-).

The reaction nucleic acid amplification by PCR method

The primer set for PCR in accordance with the present invention is used for identification of yeasts of the genusSaccharomycesusing the methods of nucleic acid amplification, such as PCR method, the method RT-PCR, the PCR method in the real-time PCR methodin situ.

Detection of nucleic acid amplification indicates the presence of mistaway nucleotide sequence, indicating that the strain as a detectable target primer set is positive (+). On the contrary, if the amplification of nucleic acid is not observed, this means the absence of mistaway nucleotide sequence, indicating that the strain as a detectable target primer set is negative (-).

In the method of PCR amplification product of the nucleic acid can be detected in accordance with known methods such as agarose gel electrophoresis. In addition, the PCR method in real-time such a product nucleic acid amplification can be detected during the time on the device, created by with the of thermal cycler with spectrophotofluorimeter, using intercalator or a fluorescently labeled probe.

Sample containing detektiruya target, and receive

Examples of the sample used as a detectable target primer set and set in accordance with the present invention include alcoholic beverages, such as beer, low-malt and wine; soft drinks such as cider, lemonade, and soda water; samples from the environment, such as water collected for use as raw materials and semi-finished products collected in the process of production of alcoholic drinks, soft drinks, etc.

If these products are used as samples for the method LAMP or the PCR method as a pre-treatment can be carried out such procedures as the concentration, isolation and cultivation of cells present in the sample, the selection of cells a nucleic acid and the concentration of nucleic acid. Methods of preconcentration and separation of cells present in the sample include filtration and centrifugation, and such methods, if necessary, can be selected. In addition, the cells are concentrated and separated from the sample, can be further cultured to increase the number of cells. The purpose of cultivation can use the th solid agar medium or liquid medium, suitable for proliferation mesiniaga yeast strain. In addition, for the selection mesiniaga yeast strain can be added to the agent, such as copper sulfate. To release the nucleic acid from the cells present in the sample liquid or the sample from the environment, or from cultured cells, it is possible to choose, for example, a method using a commercially available kit or method of treating the cells with an alkaline solution and then heating the cells to 100°C with the release of these nucleic acids. In addition, if you want to further purify the nucleic acid, it can be cleaned by treatment with a mixture of phenol/chloroform, ethanol precipitation, centrifugation, etc. and purified nucleic acid can finally re-dissolved in TE buffer or the like, so that it can be used in trials as a matrix DNA (European Brewery Convention: ANALYTICA-MICROBIOLOGICA-EBC, 2nded. 2005, Fachverlag Hans Carl, nürnberg; Rolf et al.: PCR-Clinical diagnostics and research, Springer-Verlag, Berlin, 1992; Yasuji Oshima et al.:Tanpaku kakusan koso(Proteins, Nucleic acids, Enzymes), Vol. 35, 2523-2541, 1990).

Detection of yeasts of the genusSaccharomycesyou can spend using the set of primers and a kit in accordance with the present invention, for example, as described below.

First, yeast of the genusSaccharomycesthat is supposed to be found in the sample, is cultivated in a suitable medium. ZAT is m from the colony, formed on the agar medium, isolated DNA and then the DNA used method LAMP or a PCR method using a primer set in accordance with the present invention, in order to amplify a specific region of the gene of yeast of the genusSaccharomyces. The presence of the amplification product of the gene indicates the presence of strain as the target primer set.

Examples

Later in this document, the present invention will be specifically described in the following examples. However, these examples are not intended to limit the scope of the present invention.

Example 1: Detection of yeasts of the genus Saccharomyces

(a)Extraction of genomic DNA

Cells cultured on a Petri dish with agar medium, were collected from the medium and then suspended in sterile distilled water. This suspension was centrifuged (15,000 rpm, 5 minutes), then remove the supernatant. To the precipitated cells were again added to sterile distilled water, then mixed solution of suspended and centrifuged. The supernatant was removed and then to the resulting cell solution was added PrepMan Ultra (manufactured by Applied Biosystems) in an amount of 100 μl. The mixture was heated at 95°C for 10 minutes. The resulting product was centrifuged at 15,000 rpm for 1 minute and the supernatant was used as the solution of the genomic DNA. In the m case, to the washed cells were added to 0.1 N NaOH solution in the amount of 100 μl, and then the mixture was heated at 95°C for 10 minutes. The resulting product was neutralized 1M Tris buffer (pH 7.0) and the supernatant was used as the solution of the genomic DNA.

(b)The primers used in LAMP

The primers used for different yeast strains of the genusSaccharomycesas described below, was synthesized using the database eGenome (http://genome.e-mp.jp/index.html), the company's products Fujitsu System Solutions Ltd., or a method equivalent to this, and then they were dissolved in TE buffer (pH 8.0) to a concentration of 100 μm. These solutions were mixed so that each of them had a pre-defined concentration (primers FIP and BIP: 16 μm; the primers F3 and B3: 2 μm; and the primers LF and LB: 8 μm) and then diluted.

[The set of primers used for detection of the bottom fermenting yeast (LGM1LB1)]

FIP:

CCTTCAGTGTTAAAGTCTGTGGGAAATGACTATCCGGGAAATACTATATGCC (SEQ ID NO: 1)

F3: TCACCATCGACATGCTGTC (SEQ ID NO: 2)

BIP: TCAGCCCCAGAAGCAAACTATCCAAATTCCGCCTCTGAGACG (SEQ ID NO: 3)

B3: CCATAGGAAATCACCGTACTTCG (SEQ ID NO: 4)

LB: ATGTTTATAAGCCAGATGGATG (SEQ ID NO: 5)

[The set of primers used for detectionSaccharomyces cerevisiae(SCM1LF2LB1)]

FIP:

GGCAGAACCTTGTGATTTTCTTCTACCAAAGTGGAACCTGCACATCG (SEQ ID NO: 7)

F3: TGACAAGTACGATTATCTGGCC (SEQ ID NO: 8)

BIP:

ACTGTCGATTATTGAAATAGACGAACTTAATGGAATACTGTTTAACCTGCTCGAACG (SEQ ID NO: 9)

B3: GTTGTATGGTACATTGTTTGCATCT (SEQ ID NO: 10)

LF: CACTTATATGTAGCTCTTTGTAGGC (SEQ ID NO: 11)

LB: AAAAATAAATCCATTGATCAATTGG (SEQ ID NO: 12)

[The set of primers used in isoamyl for detection Saccharomyces bayanus(SBR2LB1)]

FIP:

TCCCTCATTACCATCTTCATGAATATGCAACTGAAAATAAAAACCAGTTCGCC (SEQ ID NO: 13)

F3: CCAGGCTCATAAAGGAAGCAA (SEQ ID NO: 14)

BIP: CCGCAAGGTGTTCAAGAAACCTTCACCTCTTGTTCTTCTGTGAG (SEQ ID NO: 15)

B3: CTGCATCTGTTAAATCTTCATTTGG (SEQ ID NO: 16)

LB: CAAATGGAGGAGGGGCAA (SEQ ID NO: 17)

[The set of primers used for detectionSaccharomyces cerevisiaeandSaccharomyces pastorianus(SCC1LB1)]

FIP:

CCTCTTCCAGTTCTTGACTCTTTTCCTAAGATGAAAGTGCCGGGAGA (SEQ ID NO: 18)

F3: ACGAAGATGAGAAAGAGGCG (SEQ ID NO: 19)

BIP: TGACAGCAAGGAGAAGAGCACCCCTCGTTGTTTTCCTCCTCA (SEQ ID NO: 20)

B3: GTGCTGTATGCTCGTTTTCG (SEQ ID NO: 21)

LB: GAGCAAGGGGACGAAGGTGA (SEQ ID NO: 22)

(C)Obtaining a reaction solution for amplification method LAMP

For way LAMP as a set of reagents for amplification of genes used set for Loopamp DNA amplification manufactured by Eiken Chemical Co., Ltd. In a test tube for the reaction solution was added to the genomic DNA in the amount of 2.5 μl solution of primers in the amount of 2.5 μl of reaction buffer in a 2-fold concentration in the amount of 12.5 µl, DNA polymerase Bst in the amount of 1 ml and sterilized water in an amount of 6.5 μl and, thus, received the reaction solution in the total number of 25 ál.

(d)The LAMP reaction

For the reaction of the LAMP used nephelometer LA-200, operating in real time, the production company Teramecs Co., Ltd., or LA-320C manufactured by Eiken Chemical Co., Ltd. Put him in the reaction tube and the reaction solution was left for reaction at the post what annoy 65°C (cover: 75°C), and every 6 seconds was measured by the change in turbidity during the reaction. The reaction solution, the turbidity of which was raised, was defined as positive, and the reaction solution, the turbidity of which were not improved was defined as negative.

(e)Evaluation of the specificity of the primers used for the various strains of yeast,

As for primers, specific for bottom-fermented yeast,Saccharomyces cerevisiaeandSaccharomyces bayanusthat were received for the above yeast strains, their specificity was evaluated by way of a LAMP using standard yeast strains of the genusSaccharomycesincluding all strains taxonomic groupsSaccharomyces sensustricto. As a result, the increase in turbidity was observed during DNA amplification within 60 minutes after the start of the response inSaccharomyces pastorianus(bottom fermenting yeast) in the case of LGM1LB1,Saccharomyces cerevisiaeandSaccharomyces cerevisiaevar.diastaticusin the case of SCM1LF2LB1,Saccharomyces bayanusin the case of SBR2LB1 andSaccharomyces cerevisiaeandSaccharomyces pastorianus(bottom fermenting yeast) in the case of SCC1LB1 (table 1). In addition, if the primer is left to interact with the strain used as targets for detection, amplification occurred within 60 minutes after start of the reaction, and turbidity in the reaction tube was increased (figure 1).

Table 1
Evaluation of primers using a large number of standard yeast strains of the genusSaccharomyces(the number in each cell of the table: the reaction time necessary for carrying out amplification; -: no amplification in the course of 80 minutes; nt: not tested)
Standard yeast strains of the genusSaccharomycesLGM1LB1SCM1LF2LB1SBR2LB1SCC1LB1
S.cerevisiaeNBRC10217-40 min-20 min
S.bayanusNBRC11022--30 min-
S.bayanusNBRC1948--40 min-
S.bayanusNBRC0615--40 min-
S.bayanusNBRC10563--40 min -
S.pastorianusNBRC1102440 min--20 min
S.pastorianusNBRC1102340 min--30 min
S.pastorianusNBRC1061040 min--30 min
S.diastaticusDSM70487-40 min-20 min
S.paradoxusNBRC10609----
S.paradoxusNBRC0259----
S.paradoxusNBRC10695----
S.cariocanusNBRC10947---S.mikataeNBRC1815----
S.kudriavzeviiNBRC1802----
S.exiguusNBRC1128----
S.servazziiNBRC1838----
S.unisporusNBRC0316----
S.dairenensisNBRC0211----
S.kluyveriNBRC1685----

In addition, to assess the specificity of different primers, such as LGM1LB1, SCM1LF2LB1 and SBR2LB1, used a large number of standard yeast strains the yeast strains used in Beers is the jam, the yeast strains wild type, selected at the brewery and yeast strains wild type isolated from wine. As a result, strains of yeast that is used as a detected target the above-mentioned primers, amplification is practically not observed (tables 2, 3 and 4).

Table 2
Evaluation of primers using a large number of standard types of yeast strains (the number in each cell of the table: the reaction time necessary for carrying out amplification; -: no amplification within 80 minutes)
Standard strains of yeastLGM1LB1SCM1LF2LB1SBR2LB1SCC1LB1
PichiaanomalaNBRC0127----
WilliopsissaturnusNBRC0941----
Kluyveromyces lactisNBRC1090----
Candida utilisNBRC0988----
C.boidiniiATCC48180----
Zygosaccharomyces bailiiNBRC1137----
Dekkera anomalaDSM70727----
D.bruxellensisDSM70001----
D.bruxellensisATCC64276----
D.custersianaDSM70736----
Brettanomyces naardenensisNBRC1588----

Table 3
Evaluation of primers using a large number of types of yeast strains used in brewing, and yeast strains wild type, selected at the brewery (the number in each cell of the table: the reaction time necessary for carrying out amplification; -: no amplification within 80 minutes)
Brewer's yeast, brewer's yeast wild-typeLGM1LB1SCM1LF2LB1SBR2LB1SCC1LB1
Bottom fermenting yeast BFY6140 min--20 min
Bottom fermenting yeast BFY7040 min--20 min
Bottom fermenting yeast BFY8440 min--20 min
Bottom fermenting yeast BFY44850 min--20 min
-40 min-20 min
Verabradley yeast TFY23-40 min-20 min
Trichosporon cutaneumWY54----
C.intermediaWY55-1----
Debaryomyces hansenii WY69----
P.membranifaciensWY75----
Rhodotorula graminisWY93----
D.bruxellensisWY97----
S.cerevisiaeWY101-40 min-20 min
S.diastaticusWY126-50 min-20 min

Table 4
Evaluation of primers using yeast strains wild type, selected from a great number of wines (the number in each cell of the table: the reaction time necessary for carrying out amplification; -: no amplification within 80 minutes)
Wine yeast wild-typeLGM1LB1SCM1LF2LB1SBR2LB1SCC1LB1
Z.bailii WLY9----
S.cerevisiae WLY10-40 min-20 min
P.membranifaciens WLY13--- -
Lodderomyces elongisporusWLY14----
Aureobasidium pullulansWLY15----
Rhodosporidium fluvialeWLY16----
P.anomalaWLY17----
P.guilliermondii yeastWLY18----

The above results showed that the sets of primers in accordance with the present invention, designed for different yeast strains of the genusSaccharomyces, can accurately determine the quality of detected targets yeast of the genusSaccharomycesto type. According to previous messages, using the same primers in yeast were amplified fragments of genes and then using the profile splitting restrictase, DGGE, etc. in many cases was analyzed Otley is their nucleotide sequences. Using the primers in accordance with the present invention, however, it is possible to identify and define only 3 types of yeast strains belonging to the genusSaccharomycesconfirming the presence or absence of gene amplification.

Example 2: Limit of sensitivity of the method LAMP

To analyze the efficiency of the amplification method LAMP cage bottom fermenting yeast (BFY70,Saccharomyces pastorianus),Saccharomyces cerevisiaeNBRC10217 andSaccharomyces bayanusNBRC1948, which were cultivated in a Petri dish with agar medium, serially diluted with sterile water and then was extracted DNA of the above-mentioned method. Extracted DNA was subjected to way LAMP. As a result, in the case of using the method of LAMP amplification was observed even with small amounts of cells, such as the level of 102up to 103SOME.

In addition, when using genomic DNA extracted from a dilute solution of cells at each stage of cultivation, the time during which the turbidity in the reaction LAMP more than 0.1 were defined as detective time and build a graph based on the logarithm of the detected time of each primer and the number of formed colonies. In the exponential approximation can be approximated build schedule high correlation coefficient (R2=0,98-0,99). The figure 2 shows aproximar the bathing schedule LGM1LB1. In addition, there is a relationship between the limit of sensitivity of each primer and the correlation coefficient of the calibration graph, as described below. It is shown that by building such a calibration curve, it is possible to quantify the presence of yeast of the genusSaccharomycescontained in the sample, in the range from 102up to 107SOME or from 103up to 107SOME.

[The limit of sensitivity of each primer and the correlation coefficient of the calibration curve]

The limit of sensitivityThe approximated formula of the calibration curveThe correlation coefficient of the calibration curve (R2)
LGM1LB1of 5.2×102SOME of y=h-2,40390,992
SCM1LF2LB1of 4.4×103SOME of y=h-1,89590,981
SBR2LB1of 1.9×102SOME of y=1431,3-1,83610,982

Example 3: Detection of cells in the wine and beer

In the process of wine production, as a rule, to fruit juice for fermentation add a significant amount of yeast of the genusSaccharomycesused is as wine yeast. The number of yeast cells, which condominium fruit juice from the outside, much less than the number of yeast of the genusSaccharomyces. Thus, in the fault suspended considerable amount ofSaccharomyces cerevisiaeand then it was mixed with a dilute solution of cellsSaccharomyces bayanusNBRC1948 received by the breeding wine, with subsequent collection and washing of the cells. After that, the cells were collected and then they were extracted DNA. Using SBR2LB1 as a set of primers was carried out by way LAMP and, thus, analyzed the possibility of detectionSaccharomyces bayanus. In the result it was found that regardless of the inhibition reaction wine and presenceSaccharomyces cerevisiaeyeastSaccharomyces bayanuscan be determined with almost the same limit of sensitivity that you suspendirovanie them in sterile water. In addition, the same results were obtained even when suspendirovanie of the bottom fermenting yeast in the beer and add there a dilute solution of cellsSaccharomyces bayanus.

The limit of sensitivitySaccharomyces bayanus
Wine +Saccharomyces cerevisiae(5×107cells)3,9×102SOME
Beer + bottom fermenting yeast (1×107/sup> cells)of 3.2×102SOME

Example 4: Evaluation of primers described in patent publication

(a)The primers described in patent publication

To obtain solutions of primers used in the method LAMP similar to that described in example 1(b), apply the following set of primers used for detection of the genusSaccharomyces(SSC1LB1), and the set of primers used for detection of the bottom fermenting yeast (SBFY1LF1LB1), which were described in the patent publication Tsuchiya et al. (WO2005/093059). The set of primers used for detection of the genusSaccharomyces(SSC1LB1), aimed at the region D2 rRNA gene, whereas the set of primers used for detection of the bottom fermenting yeast (SBFY1LF1LB1), aimed at gene melibiase.

[The set of primers used for detection of the genusSaccharomyces(SSC1LB1)]

FIP: TGCGAGATTCCCCTACCCCAGACATGGTGTTTTGTGCC (SEQ ID NO: 31)

F3: AGACCGATAGCGAACAAGTA (SEQ ID NO: 32)

BIP: CTGTGGGAATACTGCCAGCTGGCCGTGTTTCAAGACGGGCGG (SEQ ID NO: 33)

B3: CTTGGTCCGTGTTTCAAGAC (SEQ ID NO: 34)

LB: CAAGGATGCTGGCATAATGGTT (SEQ ID NO: 35)

[The set of primers used for detection of the bottom fermenting yeast (SBFY1LF1LB1)]

FIP: GCAATTGCTCACTGACGTCGCACACCCCTCAAATGGGTTGG (SEQ ID NO: 36)

F3: CCGAGTTACAATGGCCTTGG (SEQ ID NO: 37)

BIP: ACCGCTGACCGGATTTCTGAAAACTAGACCAGCAGTCATCCA (SEQ ID NO: 38)

B3: CCTTGTCTGCAACGAGTGT (SEQ ID NO: 39)

LF: GGCAAATGTGTTCCAATTGTC (SEQ ID NO: 40)

LB: GGACTAAAGGATTTGGGTTACAC (SEQ ID NO: 41)

As described in examples 1(C) and (d)using the above on the ora of primers, way LAMP has detected a large number of strains. The results are presented in figures 3 and 4.

(b)Assessment primer

In the result it was found that SSC1LB1 participated in the reaction with almost all of the evaluated cell yeast strains of the genusSaccharomycesand therefore it cannot be used for identification of yeasts of the genusSaccharomyces. In addition, SBFY1LF1LB1 participated in the reaction withSaccharomyces bayanusand with bottom fermenting yeast. This set SBFY1LF1LB1 constructed on the basis of gene melibiase of the bottom fermenting yeast. Because in the field, used when creating a set of primers was attended by the nucleotide sequence homology with the genomeSaccharomyces bayanusis 96%, thought that was a cross reaction.

Example 3: Evaluation of primers for PCR used for areas chromosomal translocation Sc-type-Lg-type

As indicated above, the chromosome XVI Sc-type bottom fermenting yeast was transnacionales with the participation of Lg chromosome-type inside the area from the ORF of the gene GPH1, located in the right shoulder, to the ORF of the gene QCR2. Chromosome III Lg-types of bottom fermenting yeast was transnacionales when part of a chromosome Sc-type locus MAT right shoulder to its end. In addition, chromosome VII Lg-type bottom fermenting yeast was transnacionales when part of a chromosome Sc-type OF gene KIM the left shoulder to the end. The primers used for the PCR method was developed on the basis of the nucleotide sequence of the chromosome Sc-type and nucleotide sequence of the chromosome Lg-type so that the position of chromosomal translocation chromosome III chromosome chromosomes VII and XVI of the bottom fermenting yeast can be planirovati with them. The primers were evaluated using a large number of species of yeast of the genusSaccharomyces.

In the PCR method used polymerase Ex Taq manufactured by Takara Bio Inc. The following is the nucleotide sequence of primers used for PCR.

[The set of primers used for the region of the translocation chromosome III (amplificatory product: approximately 3.2 so-called)]

IIIjunc1 (for Lg chromosome-type): TGTTGGGGTGTACTATGGTCTTT (SEQ ID NO: 23)

IIIjunc2 (for chromosome Sc-type): ACAAAGAATGATGCTAAGAATTGA (SEQ ID NO: 24)

[The set of primers used for the region of the translocation chromosome VII (amplificatory product: approximately 350 BP)]

VIISL1 (for Lg chromosome-type): CGACTCAAACTGTATTACTCC (SEQ ID NO: 25)

VIISL2 (for chromosome Sc-type): AATTTTGATGTTCAAGCG (SEQ ID NO: 26)

[The set of primers used for the region of the translocation chromosome XVI (amplificatory product: XVISL1-2 of about 720 BP; XVISL3-4 of about 630 BP)]

XVISL1 (for Lg chromosome-type): CGACAGAGTTGACCAGTTTG (SEQ ID NO: 27)

XVISL2 (for chromosome Sc-type): GTTCTTCTTGCAAGATGTGG (SEQ ID NO: 28)

XVISL3 (for Lg chromosome-type): CCTTGGCAGATGTGTTGTAT (SEQ ID NO: 29)

XVISL4 (for chromosome Sc-type): CTTGCCCTTCTTCAAATCCG (SEQ ID NO: 30)

These reagents were mixed with each other according to the instructions on the application of polymerase Ex Taq manufactured by Takara Bio Inc. (total: 15 μl)and the mixture is then placed in thermal cycler. Temperature program: 94°C for 30 seconds, 55°C-30 seconds, and 72°C-1 minute (in the case of the primer used for the region of the translocation chromosome III, 72°C-2 minutes) was repeated 30 times in order to carry out the PCR reaction. In the result, found the band with the expected molecular weight when using each set of primers for PCR in relation to the bottom fermenting yeast. Table 5 shows the presence or absence of the amplification product.

Table 5
Evaluation of primers using a large number of species of yeast strains of the genusSaccharomyces(+: presence of amplification; -: no amplification)
IIIjunc1-2VIISL1-2XVISL1-2XVISL3-4
Bottom fermenting yeast BFY70++++
Bottom fermenting yeast BFY84+++
Bottom fermenting yeast BFY85++++
Bottom fermenting yeast W34/70++++
Bottom fermenting yeast BFY427++++
Bottom fermenting yeast BFY253++++
S.cerevisiaeS288C----
S.bayanusNBRC11022----

1. The primer set for holding the LAMP used for the detection of Saccharomyces pastorianus, which contains the following polynucleotide:
polynucleotide (FIP)with the nucleotide sequence of SEQ ID NO:1,
Pauline is created (F3), having the nucleotide sequence of SEQ ID NO:2,
polynucleotide (BIP), which has the nucleotide sequence SEQ ID NO:3, and
polynucleotide (B3)having the nucleotide sequence of SEQ ID NO:4.

2. The primer set for holding the LAMP according to claim 1, which further comprises polynucleotide (LB)having the nucleotide sequence of SEQ ID NO:5.

3. The primer set for PCR used for detection of Saccharomyces pastorianus, which contains the following polynucleotide:
polynucleotide having the nucleotide sequence of SEQ ID NO:25, and
polynucleotide having the nucleotide sequence of SEQ ID NO:26.

4. The primer set for PCR used for detection of Saccharomyces pastorianus, which contains the following polynucleotide:
polynucleotide having the nucleotide sequence of SEQ ID NO:27, and
polynucleotide having the nucleotide sequence of SEQ ID NO:28.

5. The primer set for PCR used for detection of Saccharomyces pastorianus, which contains the following polynucleotide:
polynucleotide having the nucleotide sequence of SEQ ID NO:29, and
polynucleotide having the nucleotide sequence of SEQ ID NO:30.

6. Kit for the detection of Saccharomyces pastorianus, which contains a set of primers according to claim 1 or 2 in combination with a set of primers for holding the LAMP used for the detection of Saccharomyces bayanus.

. Kit for detection according to claim 6, where the primer set for holding the LAMP is used for the detection of Saccharomyces bayanus and contains the following polynucleotide:
polynucleotide (FIP)with the nucleotide sequence of SEQ ID NO:13,
polynucleotide (F3)having the nucleotide sequence of SEQ ID NO:14,
polynucleotide (BIP), which has the nucleotide sequence SEQ ID NO:15, and
polynucleotide (B3)having the nucleotide sequence of SEQ ID NO:16.

8. Kit for detection according to claim 7, where the primer set for holding the LAMP further comprises polynucleotide (LB)having the nucleotide sequence of SEQ ID NO:17, as a primer for holding the LAMP used for the detection of Saccharomyces bayanus.

9. Kit for the detection of Saccharomyces pastorianus, which contains a set of primers for holding a LAMP according to claim 1 or 2 in combination with a set of primers for holding the LAMP used for the detection of Saccharomyces cerevisiae and Saccharomyces pastorianus.

10. Kit for detection according to claim 9, in which the primer set for holding the LAMP used for the detection of Saccharomyces cerevisiae and Saccharomyces pastorianus, contains the following polynucleotide:
polynucleotide (FIP)with the nucleotide sequence of SEQ ID NO:18,
polynucleotide (F3)having the nucleotide sequence of SEQ ID NO:19,
polynucleotide (BIP), which has the nucleotide sequence SEQ ID NO:20, and
polynucleotide (B3)having a nucleotide placentas is the activity of SEQ ID NO:21.

11. Kit for detection of claim 10, which further comprises polynucleotide (LB)having the nucleotide sequence of SEQ ID NO:22, as a primer for holding the LAMP used for the detection of Saccharomyces cerevisiae and Saccharomyces pastorianus.

12. The method of detection of Saccharomyces pastorianus, which comprises carrying out the reaction nucleic acid amplification method LAMP, using the primer set according to claim 1 or 2.

13. The method of detection according to item 12, which further comprises carrying out the reaction nucleic acid amplification method LAMP, using a set of primers for holding the LAMP used for the detection of Saccharomyces bayanus.

14. The method of detection according to item 13, in which the primer set for holding the LAMP used for the detection of Saccharomyces bayanus, contains the following polynucleotide:
polynucleotide (FIP)with the nucleotide sequence of SEQ ID NO:13,
polynucleotide (F3)having the nucleotide sequence of SEQ ID NO:14,
polynucleotide (BIP), which has the nucleotide sequence SEQ ID NO:15, and
polynucleotide (B3)having the nucleotide sequence of SEQ ID NO:16.

15. The method according to 14, which further comprises polynucleotide (LB)having the nucleotide sequence of SEQ ID NO:17, as a primer for holding the LAMP used for the detection of Saccharomyces bayanus.

16. The method of detection according to item 12, which further includes conducting Rea is the nucleic acid amplification method LAMP, using a set of primers for holding a LAMP for the detection of Saccharomyces cerevisiae and Saccharomyces pastorianus.

17. The method of detection according to clause 16, in which the primer set for holding the LAMP used for the detection of Saccharomyces cerevisiae and Saccharomyces pastorianus, contains the following polynucleotide:
polynucleotide (FIP)with the nucleotide sequence of SEQ ID NO:18,
polynucleotide (F3)having the nucleotide sequence of SEQ ID NO:19,
polynucleotide (BIP), which has the nucleotide sequence SEQ ID NO:20, and
polynucleotide (B3)having the nucleotide sequence of SEQ ID NO:21.

18. Method detection by 17 which further includes polynucleotide (LB)having the nucleotide sequence of SEQ ID NO:22, as a primer for holding the LAMP used for the detection of Saccharomyces cerevisiae and Saccharomyces pastorianus.

19. The method of detection of Saccharomyces pastorianus, which comprises carrying out the reaction nucleic acid amplification by the PCR method using a primer set for PCR according to any one of p-5.



 

Same patents:

FIELD: medicine.

SUBSTANCE: what is presented is a method for Apo2L/TRAIL sensitivity prediction of a malignant tissue or cell sampled from a mammal, involving the stages as follows: sampling a malignant tissue or cell from a mammal; analysing the sample malignant tissue or cell for detecting expression of one or more biomarkers selected from a group of fucosyl transferase 3, fucosyl transferase 6, sialyl-Lewis A and/or X antigen (antigens) where expression of one or more specified biomarkers is an indicator of the fact that the specified sampled tissue or cell is sensitive to apoptosis-inducing activity Apo2L/TRAIL. Also, what is described is a method of apoptosis induction in the sampled malignant tissue or cell of a mammal. What is offered is a method of treating a malignant tumour in a mammal. The inventions enables using the detection of expression of one or more biomarkers as the indicator of the fact that a sample is sensitive to apoptosis-inducing agents, such as Apo2L/TRAIL and DR5 agonist antibodies. Specific biomarkers to be examined include fucosyl transferases, particularly fucosyl transferase 3 (FUT3) and/or fucosyl transferase 6 (FUT6), as well as sialyl-Lewis A and/or X antigens.

EFFECT: method improvement.

35 cl, 22 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: cell suspension under investigation is incubated with biochip, containing immobilised on biochip antibodies, which have specificity to superficial antigens of investigated cells. After incubation, biochip is washed from non-specifically bound cells. Cells, which remain bound with biochip, are subjected to processing with labelled polynucleotide probes of one or several types with further hybridisation. Reading and processing of results are performed by presence of cell binding in area of biochip sites, containing immobilised antibodies, presence in them of determined superficial antigens is detected, and presence and character of binding of labelled polynucleotide probes are used to determine genetic signs in the same cells.

EFFECT: method application makes it possible to increase quantity of simultaneously determined superficial antigens on different cells with application of non-conjugated with label antibodies, simultaneously reducing number of used antibodies.

9 cl, 2 dwg, 2 ex

Biomarkers // 2429297

FIELD: medicine.

SUBSTANCE: what is offered is applying an analysis of p53(TP53) gene status and/or expression level as a biomarker while evaluating sensitivity of an individual suffering a proliferative disease to treatment by an mTOR inhibitor combined with a cytotoxic agent or while selecting individuals sensitive to the specified combined therapy for the following treatment of the disease by this method. Thus sensitivity to treatment of the proliferative disease by the mTOR inhibitor combined with the cytotoxic agent is predicted if wild-type functionally active p53 gene is found in a sample taken from the patient.

EFFECT: higher analysis accuracy.

14 cl, 5 ex

FIELD: medicine.

SUBSTANCE: what is offered is a method of structure stabilisation of thrombin binding DNA-aptamers, and also DNA-aptamers stabilised in such a way. The presented method provides formation of an additional base-stacking system by means of heterocycles or their analogues by means of increasing a surface of an aromatic system of heterocycles or their analogues, owing to using methods of determining a tertiary structure or molecular simulation with stating the fact of contact formation of the aromatic system of heterocyclic bases or their analogues with a G-quadruplex quartet which is related to a lateral loop.

EFFECT: method allows more effective assembly of antithrombin DNA-aptamers and improved structural stability under physiological conditions.

7 cl, 7 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method involves allele-specific Nested-PCR with primers which are matched with nucleotide sequences coding amino acids in positions 70-71 of the amino acid sequence. The allele-specific primers E70f1 - 5'-AGAAGGAGATCCTGGAGGATAG - 3' and R71r1 - 5'-CCTGTCCACCTCGGCCCGCCTATC - 3' are matched with a part of BoLA-DRB3 gene located on chromosome 23 (localisation 23q21). They interact only with the nucleotide sequences coding alleles *11, *23, *28 =*7A causing genetic stability to cattle leukaemia. Then sequencing primer Zond 70/71 5'-GCCCGGCTACACCTGT - 3' is used to identify homo- or heterozygosity of an individual by the given alleles. If observing the primers interacting with alleles *11, *23, *28 =*7A, animals are considered to be leukaemia stable, while the absence of interaction with the same alleles can enable to refer to leukaemia unstable, and to neutral.

EFFECT: invention can be used for mass genetic typing of BoLA-DRB3 leukaemia tolerable animals in livestock and commodity economies for animal selection in a nuclear stock.

2 dwg, 4 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: set contains species-specific oligonucleotide primer pairs and appropriate fluorescent-marked probes for conducting one-stage instant identification of several human-pathogenic Orthopoxviruses (VARV, MPXV, CPXV and VACV) by means of real-time multiplex PCR.

EFFECT: invention is intended for instant diagnostics of human and animal Orthopoxvirus infections by real-time multiplex PCR.

10 dwg, 2 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: tissue is homogenised in a buffer and centrifuged at 105000 g for 60-90 min at 0-4°C to produce a cytoplasmic fraction which is then incubated with 10 mM of phosphocreatine and 10 mcg/ml of phosphocreatine kinase for 25-45 minutes at 35°C. Cytoplasmic fraction proteins are divided by ammonium sulphate at three stages, at the first stage ammonium sulphate is added to 38% of saturation and centrifuged to isolate a precipitate containing a 26S-proteasome pool, at the second stage, a supernatant is added with ammonium sulphate to 42 % of saturation and centrifuged to isolate a precipitate containing ballast proteins, at the third stage to the supernatant is added with ammonium sulphate to 70 % of saturation and centrifuged to isolate a precipitate containing a 20S-npoteasome pool. Ammonium sulphate is added in portions during 20 min on a magnetic stirrer and further mixed for 20 minutes.

EFFECT: invention allows dividing native 26S- and 20S-proteasomes and isolating them in those amounts they exist in living cells, with preserving at most an undamaged 26S-proteasome structure.

3 cl, 1 ex

FIELD: medicine.

SUBSTANCE: there are offered versions of antibodies and their antigen-binding IL-13, particularly human IL-13 specific fragments. There are described: a pharmaceutical composition, a pharmaceutical compound of the antibody, versions of coding and hybridising nucleic acids and expression vectors. There are offered versions of: cells and methods of producing the antibody, methods of treating IL-13 associated disorders. A method of IL-13 detection in a sample is described.

EFFECT: use of the invention provides new IL-13 antibodies with KD about 10-10 M which can be used for diagnosing, preventing or treating one or more IL-13 associated diseases.

87 cl, 37 dwg, 5 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: method includes analysing aliquots of said sample by one or more methods of protein description specified in the chromatography. The method is based on genetic analysis techniques specified in RFLP and T-RFLP. These methods can be applied both separately, and in a combination. The offered methods allow obtaining the information on the presence and fractions of various individual proteins or coding sequences. The obtained information can be used for evaluating stability of a polyclonal cell line in process, and also estimating a structure of various parties of end polyclonal products.

EFFECT: methods allow describing the composition consisting more than of 10, 20 or greater number of antibodies.

16 cl, 18 dwg, 18 tbl, 14 ex

FIELD: medicine.

SUBSTANCE: composition includes at least three oligonucleotide probes and enables simultaneously determining a level of PSMB4, FCER2 and POU2F2 genes expression. The oligonucleotide composition under the invention is presented to be used, including as a part of a microchip, in a method for prediction of a developing disease in a subject suffering chronic lymphatic leukemia that involves analysing a level of expression of at least three named genes in patient's blood samples.

EFFECT: higher efficacy of the composition.

8 cl, 5 dwg, 16 tbl, 5 ex

FIELD: medicine, psychiatry.

SUBSTANCE: one should isolate DNA out of lymphocytes of peripheral venous blood, then due to the method of polymerase chain reaction of DNA synthesis one should amplify the fragments of hSERT locus of serotonin carrier gene and at detecting genotype 12/10 one should predict the risk for the development of hallucino-delirious forms of psychoses of cerebro-atherosclerotic genesis.

EFFECT: more objective prediction of disease development.

3 ex

FIELD: biotechnology, medicine, proteins.

SUBSTANCE: invention describes new polypeptide in isolated form relating to subfamily of superfamily human immunoglobulins (Ig-Sf). This polypeptide shows at least 70% of homology level with amino acid sequence of murine molecules CRAM-1 or CRAM-2 regulated by the confluence of adhesive (figures 3, 6 are represented in the claim). Also, invention relates to antibodies showing specificity with respect to the polypeptide. Antibodies and soluble polypeptide can be used for treatment of inflammation and tumors. Invention describes polynucleotide or oligonucleotide encoding the full-size polypeptide or its moiety and represents primer, probe, anti-sense RNA and shows the nucleotide sequence that is identical conceptually with human CRAM-1. Invention provides preparing new adhesive proteins from superfamily Ig-Sf that are regulated at the transcription level in endothelium by effect of tumors. Invention can be used for treatment of different diseases, in particular, inflammatory responses.

EFFECT: valuable medicinal properties of polypeptide.

19 cl, 33 dwg, 1 ex

FIELD: biotechnology, genetics.

SUBSTANCE: invention relates to methods used for detecting low frequency mutations occurrence in gene encoding cytochrome b. Method involves isolation of DNA from known fungi for constructing oligonucleotide probe or primer. Then polymerase chain reaction (PCR) is carried out for assay of binding the nucleotide probe with amplicon generated by this reaction, or the presence of amplicon is detected that is generated as result of PCR using indicated primers. Invention provides rapid and precise detection of mutations conferring resistance of fungus against fungicide.

EFFECT: improved diagnostic methods for detecting mutations.

24 cl, 18 dwg, 14 tbl, 18 ex

FIELD: genetic engineering, molecular biology, pharmacy.

SUBSTANCE: invention relates to methods of genome screening and can be used for identification of pharmacological agent in vegetable extract. Method is realized by treatment of cells with a vegetable extract, isolation of protein or RNA from these cells, identification of isolated protein or RNA wherein their concentration differs from that in untreated cells and detection of compound(s) in indicated vegetable extracts. Then cells are treated with the found compound(s), protein or RNA are isolated from cells treated with this compound(s) and compound(s) are identified that cause the stimulation or inhibition of expression of protein or RNA wherein their concentration differs from that in untreated cells. Invention provides carrying out the characterization of biological properties of vegetable extract and to detect the individual compound(s) that elicit unknown or disclosed biological property of this extract.

EFFECT: improved identifying method.

6 cl

Thrombopoietin // 2245365

FIELD: medicine, molecular biology, polypeptides.

SUBSTANCE: invention describes homogenous polypeptide ligand mpI representing polypeptide fragment of the formula: X-hTPO-Y wherein hTPO has amino acid sequence of human fragments TPO (hML); X means a amino-terminal amino-group or amino acid(s) residue(s); Y means carboxy-terminal carboxy-group or amino acid(s) residue(s), or chimeric polypeptide, or polypeptide fragment comprising N-terminal residues of amino acid sequence hML. Also, invention relates to nucleic acid encoding polypeptide and expressing vector comprising nucleic acid. Invention describes methods for preparing the polypeptide using cell-host transformed with vector, and antibodies raised against to polypeptide. Invention describes methods and agents using active agents of this invention. The polypeptide ligand mpI effects on replication, differentiation or maturation of blood cells being especially on megacaryocytes and progenitor megacaryocyte cells that allows using polypeptides for treatment of thrombocytopenia.

EFFECT: valuable medicinal properties of polypeptide.

21 cl, 92 dwg, 14 tbl, 24 ex

FIELD: medicine, biology, molecular biology.

SUBSTANCE: invention proposes a new method for differential diagnosis of representatives of family Chlamydiaceae. Method involves isolation of DNA of pathogen, amplification using real-time polymerase chain reaction (PCR) and primers CM1 and CM2 exhibiting specificity to 5'-terminal fragment of gene omp1 followed by post-amplification analysis of curves of PCR-products melting in the presence of nonspecific fluorescent dye SYBR Green I for separation of Chlamydia species and electrophoretic separation of PCR-products. Identification of species is carried out on the basis of differences in PCR-products melting point wherein melting point curves of all fragments of omp1 are characterized by the presence of two peaks reflecting two-stage dissociation of DNA chains in sites with different A/T-saturation degree. Proposed method provides carrying out the differentiation of all species of Chlamydia that are pathogenic for humans. Except for, method provides carrying out the differentiation of Chlamydiaceae causing diseases in animals and also method is simple, rapid and can be used for direct diagnosis of clinical material samples. Invention can be used in medicine, veterinary science and virology for differential diagnosis of representatives of family Chlamydia.

EFFECT: improved method for diagnosis.

2 ex

FIELD: medicine, biology, molecular biology.

SUBSTANCE: invention proposes a new method for differential diagnosis of representatives of family Chlamydiaceae. Method involves isolation of DNA from pathogen, amplification of target using primers CM1 and CM2 showing specificity to 5'-terminal fragment of gene omp1 and electrophoretic separation of polymerase chain reaction (PCR) products. Electrophoresis is carried out in agarose gel with addition of sequence-specific DNA-ligand - bis-benzimide-PEG. The species belonging of PCR-products is determined by comparison of the migration rate of PCR-products in gel with electrophoretic mobility of control. Proposed method provides carrying out the differentiation of all species of family Chlamydiaceae and method is simple and rapid and can be used for direct diagnosis of clinical material samples also. Invention can be used in medicine and virology for differential diagnosis of representatives of family Chlamydiaceae.

EFFECT: improved method for diagnosis.

2 dwg, 2 ex

FIELD: molecular biology, medicine, biochemistry.

SUBSTANCE: invention proposes a method for assay of mononucleotide changes in the known sequences of nucleic acids. Method involves hybridization with PCR-amplified matrix DNA and the following ligation a tandem on its consisting of tetranucleotide that comprises the diagnosed change and two oligonucleotides of the size 8-10 nucleotides being one of that is immobilized on surface of a solid-phase carrier through a 5'-phosphate linker, and the second oligonucleotide is labeled by 3'-end with biotin label. Then tetranucleotide is hybridized with the matrix DNA chain between two oligonucleotides directly that can be ligated with immobilized oligonucleotide through the 5'-end and with non-immobilized oligonucleotide through the 3'-end. The ligation product is detected by its transformation to enzyme label through the complex with high-affinity enzymatic catalyst followed by development of enzyme label in the presence of chromogenic, luminogenic or fluorogenic substrates. Applying a method provides preparing the simple and highly selective agent used for detection of known changes in gene structure.

EFFECT: improved assay method.

8 cl, 3 dwg, 30 ex

FIELD: genetic engineering, biotechnology, biochemistry, agriculture, food industry, medicine.

SUBSTANCE: invention relates to the transformation of plant with nucleic acid encoding enzyme Δ6-desaturase in C. elegans that results to preparing a plant with enhanced content of gamma-linolenic acid and resistance to cold. Desaturase extracted from the plant can be used for preparing a drug used for treatment of disorder in body associated with deficiency of gamma-linolenic acid in it.

EFFECT: valuable biological properties of genes and desaturases.

36 cl, 9 dwg, 2 ex

FIELD: medicine, hematology.

SUBSTANCE: one should isolate DNA out of peripheral blood lymphocytes due to polymerase chain reaction (PCR) technique of DNA synthesis, carry out genotyping for polymorphism of promoter area of TNF-alpha and TNF-beta gene. While detecting genotype LT*22 being characterized by availability of gene TNF-beta mutation in homozygous state, detect persons predisposed to the development of chronic lympholeukosis, and at certain combinations of genotypes TNF*22/LT*22 or TNF*12/LT*11 in patients with chronic lympholeukosis on should predict an aggressive flow of this disease.

EFFECT: higher accuracy of prediction.

3 ex, 3 tbl

Up!