Method of bacteria recovery and identification

FIELD: medicine.

SUBSTANCE: method involves bacteria transfer from a sample in phosphate-buffered saline, addition of a magnetic particle suspensions with antibodies fixed thereon to certain types of bacteria, incubation with mixing. A magnetic sampler probe with a replaceable nonmagnetic tip is introduced into an incubating tank where a magnetic field generated by the magnetic sampler probe makes the complexes of magnetic particles - antibodies - bacteria to be collected on the tip; the sampler probe is transferred to a distilled water tank for washing from bacteria not bonded with antibodies. Final re-slurrying is ensured by transferring the sampler probe into the distilled water tank and separating the nonmagnetic tip from the magnetic probe; mixed magnetic particles and complexes of a magnetic particle - an antibody - bacteria are transferred in an aqueous medium which is placed in a measuring cell of an electro-optical analyser wherein a variable electric field is generated to record changes of optical properties of the suspension, in the form of a frequency dispersion of anisotropy of polarizability (FDAP) which provides a basis to state the presence or absence of target bacteria in the sample in case of the presence or absence of a FDAP peak ranging within 100 to 10000 kHz respectively.

EFFECT: invention allows simplifying and accelerating a bacteria identification process, and carrying it out in an automatic mode.

2 dwg, 2 ex

 

The invention relates to the field of biotechnology, Microbiology and medicine and relates to the identification of bacteria Bobadilla infectious diseases.

The prior art.

In medicine, sanitation, microbiological and other industries that use biotechnological processes, the challenge is more rapid identification of microorganisms present in the sample. Now the problem is solved mainly by two methods: DNA analysis (PCR) and analysis of the results of the reaction of antigen-antibody (immunohistochemistry method). PCR is highly sensitive, however, the preparatory procedures (isolation and purification of DNA) is quite laborious and time consuming (Maccready BJ., Chimera D.A. Detection and identification of pathogens by molecular methods. Molecular clinical diagnostics. Methods // M.: Mir, 1999, S-506). Immunochemical method is developing rapidly in terms of its automation. Developed installation to create biochips (calligrapher) and their analysis (readers). Immunochemical method for identifying bacteria can methodologically be divided into two stages : the selection of the designated microorganisms from a sample and detection of selected biological agents. Identification of target bacteria in the sample is carried out using antibodies that either St is explained with the stationary phase (column, the surface of the biochip), which allows subsequent washing or sewn to the magnetic particles, which also suggests the possibility that in the presence of a magnetic field washing from unbound components of the sample. Definition contacting antibodies of the microorganisms is carried out usually by using fluorescent labels (e.g. fluorescein isothiocyanate - FITS), pre-sewn to the antibodies. To do this, use fluorescent microscope - fluorimeter or created specifically for biochips "reader". You can also use a radioactive label (Vdialog. Enzyme-linked immunosorbent assay. // Soros educational journal, 1999, No. 12, P.9-15).

To find the bacterial cells in the sample, and to determine the concentration and descriptions morphometric properties of microorganisms applied electro-optical analysis method. This method does not require any fluorescent or radioactive labels for the detection of bacteria.

Based electro-optical analysis is the Kerr effect. The essence of the effect is to change the optical properties of suspensions, in particular suspensions of cells, when exposed to an electric field.

The influence of electric fields on cell suspension causes the appearance of suspended cells induced charges. Their distribution and magnitude opredelyaytes the current mechanism of polarizability (Segnato, Agualusa, Vdin, IAATO. Electro-optical analysis in Microbiology. // Obolensk: fsri SRC MBP, 2007, 159 C.). Surround mechanism polarizability induced charges appear on the boundary of two media with different complex dielectric permittivity. The boundary of the cell structures are surface contact of the electrical double layer and the cell wall, the cell wall and the cytoplasmic membrane cytoplasmic membrane and cytoplasm. Value induced at the boundaries of the sections of charges is proportional to the intensity of the electric field and depends on the ratio of the dielectric permittivity of the structures. Integral parameter describing the process of the polarizability is a tensorandthe polarizability of the cell. The tensor polarizability of non-spherical cells has at least two different components. The longitudinal component coincides with the long axis of the cells, and cross - orthogonal axes. Distributed over the volume of the cells induced charges of opposite signs form a dipole. The dipole interacts with the electric field and causes a torque. Occurs predominant direction of orientation of the cells, which changes the uniform distribution of cells on the orientation angles described by a Boltzmann function. the goal orientation of the cells is measured from the direction of incident light flux to the direction of the long axis of the cell.

When this change occurs all the optical characteristics of suspensions: the magnitude of the birefringence, the nature of light scattering and the total optical density of the suspension due to changes section G(t) of the scattering cell. When the intensity E of the electric field corresponding to a weak orientation of the cells, the dependence of the optical density of the square of the intensity has a linear character.

Depending on the frequency of the electric field and the electrical properties of the cells in the direction of predominant orientation of the cells may coincide with the direction of the vector of the electric field or to be orthogonal to him. The orientation of the cell long axis along the length of the thread will lead to an increase in the scattering cross-section and reduce the intensity of the light flux, and orientation across the light flux to the reduction of the scattering cross-section and, accordingly, to increase the luminous flux.

There is a method of electro-optical analysis of cells in suspension and device for its implementation. Patent RU 2070919 of July 27, 1996

The method is as follows: to the suspension effect alternating electric field, characterized by a constant tension F and frequency f and a variable frequency F changes the direction of the electric field intensity vector discrete 90° about the F minto Fmaxaccording to the formula:

Fi±1=Fi±1/2Mwhere i(0,..., i-1), (j-1,..., 0), j=1/M*log2(Fmax/Fmin),

and at the same time with the electric influence is passed through the specified suspension of luminous flux, measures the intensity passed through the suspension of the light fluxes and determine their difference as the magnitude of the electro-optic signal and then determining the dependence of the anisotropy of the polarizability of cells from the frequency f of the electric field. This dependence is very characteristic of living bacterial cells in the range 100-10000 kHz and absent in the homogeneous particles.

The disadvantage of this method, from the point of view of identification of microorganisms is weak variability of frequency dispersion of the anisotropy of the polarizability (CDAP) for different species of bacteria.

Closest to the proposed method is a method of isolation and identification of bacterial cells. Patent RU 2330292 from July 27, 2008

The method is as follows: the prepared material add 0.1 ml of a suspension containing ferromagnetic particles, the surface of which is fixed immunoglobulins to their respective bacterial infections, and nointention stirred for 50-60 C. After addition of the suspension of ferromagnetic particles with fixed immunol what boyname material incubated at room temperature, nointention mix on a shaker for 30-60 min and then precipitated within 20-30 minutes, placing the tube in a magnetic tripod with integrated permanent magnet.

After preparing the specimen in the test tube is injected magnetic probe sampler having a core with a permanent magnet and a removable non-magnetic tip, the surface of which is fixed immunoglobulins, similar fixed on the surface of the ferromagnetic particles. Under the action of the magnetic field of the core probe sampler to the surface of the tip are drawn all entered in the sample of ferromagnetic microparticles. On its surface are recorded only particles formed a complex with bacterial cell, which occurs due to the unused links cells with immunoglobulin. The remaining particles are retained at the surface of the tip is only due to the action of a magnetic field. Next, the probe sampler tolerate filled in phosphate-salt buffer wash capacity and create a vortex flow of the fluid. At the bottom of the wash tank has a permanent magnet. After removing the magnetic core all ferromagnetic microparticles that are not associated with bacterial cells and through them with the surface of the tip, separated from it by a flow of liquid under the action of the magnetic field is collected at the bottom of the washing capacity.

Extracted from the wash tank, the probe tip of the sampler, the surface of which was fixed ferromagnetic particles having radioactivity and associated with the appropriate bacterial cells, are transferred to the recording device, radioactive radiation, which concludes that from the diagnostic sample selected bacterial cells, which cause the infectious diseases.

The disadvantage of this method is the complicated procedure preparation of samples for identification of the bacteria, and the use of radioactivity as an identifying agent, which severely limits its use.

The technical result of the invention is the simplification of the mode of indication of infectious diseases.

The technical result is achieved by the fact that the proposed method includes the transfer of bacteria from the sample in phosphate-saline buffer solution, adding thereto a suspension of magnetic particles with fixed them with antibodies to certain types of bacteria, incubation under stirring, the introduction of magnetic probe sampler with replaceable non-magnetic tip in the incubation vessel with subsequent washing of the magnetic tip of the probe sampler together with focused and on the surface of magnetic particles, and complexes of magnetic particle-antibody-antigen in distilled water, then the probe sampler is transferred into a vessel with 3 ml of distilled water, non-magnetic tip is separated from the magnetic probe and the mixture of magnetic particles and complexes of magnetic particle-antibody-antigen pass into the aquatic environment, which is placed in the measuring cell electro-optical analyzer, where under the influence of an alternating electric field detect changes in optical properties of the suspension in the form of frequency dispersion of the anisotropy of the polarizability (CDP), on the basis of which to judge the presence or absence in the sample of the target bacteria in the appearance or absence of the peak at CDAP in the range from 100 to 10000 kHz, respectively.

The method is as follows.

The original sample by centrifugation or by washing the filter was transferred to phosphate-saline buffer (pH 7.4) and the volume adjusted to 1 ml of this add 50 μl of the suspension of magnetic particles, the surface of which is covalently bound purified antibody of interest bacteria. During incubation at 37°C. antibodies fixed on the particles, specifically associated with the target bacteria. Then in the incubation container is injected magnetic probe sampler with replaceable non-magnetic tip. Under the influence of a magnetic field probe sampler ferromagnetic particles gather in one place and easily suleka is conducted from the environment. Next, the probe sampler is transferred into a container of distilled water rinse, which removes bacteria, not contacting antibodies on magnetic particles. For the final resuspendable probe sampler is transferred into a vessel with 3 ml of distilled water and a removable non-magnetic tip is cut off from the magnetic probe sampler. This leads to the fact that the complex magnetic particle-antibody-bacteria is separated from the surface of the tip and transferred to the aqueous environment. The resulting suspension is placed in a measuring cell electro-optical analyzer, where it is exposed to an alternating electric field intensity 700-7000/m in the frequency range 10-30000 kHz. At the same time through the cell transmit light (λ=640 nm).

Electro-optical analysis is the detection of optical changes occurring in the studied suspensions under the influence of an alternating electric field. Actually measuring the optical density of the suspension at a wavelength of 640 nm in the time of inclusion, actions, and disable the voltage on the electrodes of the measuring cell. Such measurements are performed in a wide range of frequencies supplied electric field (10-30000 kHz). A further object of the analysis is thus obtained frequency dispersion of anisotropy is yarismasi (CDAP). Field parameters (frequency, intensity, duration) are determined by the electro-physical and morphometric characteristics of the target bacteria. Since the electro-optic signal in the range from 100 to 10000 kHz at uniform mechanical particles (which are magnetic particles with attached antibodies) is virtually absent, his appearance speaks of the presence of a suspension of bacteria.

Example 1. Detection of cells of Salmonella enteriditis

1) To 1 ml of a suspension of Salmonella enteriditis in phosphate-buffered saline add 50 μl of the suspension of magnetic particles coated streptavidin with covalently sewn antibodies to Salmonella Enteriditis. The resulting mixture is incubated for 20 minutes at 37°C. with mild stirring. Then in the incubation container is injected magnetic probe sampler with replaceable non-magnetic tip is made from a polymeric material, which collect the magnetic particles. After washing with water, the tip is transferred into a vessel with 3 ml of distilled water, where separate it from the magnetic probe sampler. In the absence of magnetic fields of all particles from the surface of the tip moving in aqueous suspension. The resulting suspension is placed in a measuring cell electro-optical analyzer. Under the action of an alternating electric field (intensity E=1000 V/m; the time steps t=2 seconds; the range is often the f=10-30000 Hz) changes in optical properties of the suspension, which register in the form CDP.

2) a Similar procedure was performed with a suspension of bacteria Escherichia coli and the same magnetic particles with their associated antibodies to Salmonella enteriditis.

3) a Similar procedure was performed with magnetic particles in distilled water - that is, in the absence of any microorganisms.

The results CHDAP magnetic particles associated with antibodies to Salmonella enteriditis, after their incubation with bacteria is presented in figure 1.

1 - magnetic particles - cells Salmonella enteriditis

2 - magnetic particles - cells of Escherichia coli

3 - clean the magnetic particles

Figure 1 shows that the electro-optic signal in the range from 100 to 10000 kHz allows us to determine the presence of target bacteria (in this case, Salmonella enteriditis) and indicates their absence as in the case of pure magnetic particles, and the presence of extraneous microflora.

Example 2. Detection of Escherichia coli cells

1) To a 1 ml suspension of E. coli bacteria in phosphate-buffered saline, dobavlat 50 μl of the suspension of magnetic particles coated streptavidin with covalently sewn antibodies to Escherichia coli. The resulting mixture is incubated for 20 minutes at 37°C and a light stirring. Then in the incubation container is injected magnetic probe sampler with replaceable non-magnetic tip is made from a polymeric material, which collect the magnetic particles. After washing with water, the tip is transferred into a vessel with 3 ml of distilled water, where separate it from the magnetic probe sampler. In the absence of magnetic fields of all particles from the surface of the tip moving in aqueous suspension. The resulting suspension is placed in a measuring cell electro-optical analyzer. Under the action of an alternating electric field (intensity E=1000 V/m; the time steps t=2 sec; frequency range f=10-30000 Hz) changes in optical properties of the suspension, which register as CDP.

2) a Similar procedure was performed with a suspension of Salmonella enteriditis and the same magnetic particles with their associated antibodies to Escherichia coli.

3) a Similar procedure was performed with magnetic particles in distilled water, i.e. in the absence of any microorganisms.

The results CHDAP magnetic particles associated with antibodies to Escherichia coli after incubation with bacteria presented in figure 2.

1 - magnetic particles - cells of Escherichia coli

2 - magnetic particles - cells Salmonella enteriditis

3 - clean the magnetic particles

Figure 2 shows that the electro-optic signal in the range from 100 to 10000 kHz allows us to determine the presence of target bacteria (in this case Escherichia coli) and indicates their absence, as in the case of pure magnetic particles, and in case the e presence of foreign microflora.

Thus, the proposed method allows you to select the target bacteria from the sample and to quickly determine the presence of electro-optical method without the use of fluorescent or radioactive labels.

Isolation and identification of bacteria, including the transfer of bacteria from the sample in phosphate-saline buffer solution, adding thereto a suspension of magnetic particles with fixed them with antibodies to certain types of bacteria, incubation under stirring, characterized in that the magnetic probe sampler with replaceable non-magnetic tip is introduced into the incubation vessel, where under the influence of a magnetic field probe sampler complexes magnetic particle - antibody - bacteria gather at the tip, then the tip of the sampler is transferred into a container of distilled water for washing from not contacting antibodies bacteria, for final resuspendable probe-robotronic transferred into capacity with 3 ml of distilled water and a non-magnetic tip is separated from the magnetic probe, and the mixture of magnetic particles and complexes of magnetic particle - antibody - bacteria pass into the aquatic environment, which is placed in the measuring cell electro-optical analyzer, where under the influence of an alternating electric field detect changes in the optical properties of suspense and, in the form of frequency dispersion of the anisotropy of the polarizability (CDP), on the basis of which to judge the presence or absence in the sample of the target bacteria in the appearance or absence of the peak at CDAP in the range from 100 to 10000 kHz, respectively.



 

Same patents:

FIELD: medicine.

SUBSTANCE: method involves DNA genome recovery of an examined woman followed by PCR analysis of site of MTHFR and PAH genes by mixing the components and adding oligoprimers, and analysis of polymorphism of restriction fragment lengths and visualisation of electrophoregram in a polyacrylamide gel. For amplification for the purpose of analysis of the site of MTHFR gene, an upstream primer CCAGTCCCTGTGGTCTCTTCAT and a downstream primer AGGGAGCTTATGGGCTCTCCT are used; for the purpose of analysis of the site of PAH gene, an upstream primer CAGAGAGAGTCTGGCCACGT and a downstream primer CGTGATTGTCTAGGTTTTGTCTGTCTAGG are used. If observing the MTHFR 677T/T and/or PAH -675 4G/4G, a risk of gestosis is predicted.

EFFECT: higher accuracy of prediction of risk of gestosis.

2 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: patient is examined for a level of D-dimer one day before and after consistently alternating pneumatic compression (CAPC) of lower extremities. If observing the level of D-dimer increased in a second sample, the presence of latent intravascular fibrin formation is diagnosed.

EFFECT: use of the technique allows detecting high risk of thromboses at the early stages of thrombogenesis in the patients with thromboses of any localisation in past history and differentiating approaches to prescribing a therapy in such patients.

2 ex

FIELD: medicine.

SUBSTANCE: method includes using a monoclonal A3 antibody for detection of a proliferation marker - nucleolar protein A3 followed by visualisation of positive focuses. A process of proliferation is shown by increasing focuses of A3 antigen localisation from one in G0 phase to 8-10 focuses in an S-period of a cell cycle.

EFFECT: invention allows evaluating effectively a condition of proliferative activity of human lymphocytes.

2 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: method for producing EHF Diagnosticum by reproduction of four hantaviruses - Puumala strain PUU-TDK/VERO, Dobrava strain DOB-EAT-VERO, Hantaan strain Ussuri-4590 and Seoul strain SK-515/Georgia-88, in a monolayer passaged cell culture of VERO-line grass monkey kidneys, followed by virus-specific antigen concentration test, polyvalent antigen production, antigen fixation on a slide and UV processing.

EFFECT: invention provides a more sensitive diagnostic test, presenting a low-price production process and more effective use of the EHF Diagnosticum.

4 cl, 2 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: on 5-7 day after pelvis trauma blood serum is analysed and concentration of polypeptides of type 1 collagen (CICP, ng/ml), concentration of osteotropic cytokine - osteprotegerin (OPG, pmol/k) and prothrombin by Quick (%) are determined. Values of prothrombin by Quick and OPG concentration are used to calculate value of discriminant function: F(Y1, Y2) = 0.170767466 · Y1 - 2.15811515 · Y2 - 13.11227538 (1) where Y1 is prothrombin value bu Quick, %, Y2 is Ln (natural logarithm) of OPG concentration in blood serum, pmol/l. If CICP value constitutes less than 146 ng/ml, and value F>0, absence of complications in post-operation period is predicted. If CICP value is higher than 146 ng/ml, and value F<0, patient is referred to group of risk on development of complications in post-operation period.

EFFECT: application of method makes it possible to predict risk of developing complications of traumatic disease course in post-operation period before surgery.

1 tbl

FIELD: medicine.

SUBSTANCE: claimed is method of obtaining antigen diagnosticum with application of species-specific membrane proteins of Y. Pseudotuberculosis, sensibilised on acrolein polymer spheres, for detection of antibodies to causative agent of pseudotuberculosis of the most epidemically essunsial serovars, spread among people. As sensitin used is pool from 10 protein antigens with molecular weight within 28-80 kDa and total protein concentration 0.9-1.3 mg/ml, isolated from coarse protein membranes. As sensitin carrier used are spherical polymer particles with diameter 1.5 mcm, which contain 1.3 mM/g of aldehide groups.

EFFECT: method improvement.

5 cl, 6 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: in children with congenital heart disease 10-14 days before carrying out cardiosurgical correction of defect, levels of interleukin-6, interleukin-10 and subclass of immunoglobulins G2 are determined. If it is determined that interleukin-6 level is from 8.25 to 15.20 pg/ml, interleukin-10 from 3.21 to 5.12 pg/ml and immunoglobulin G2 from 2.31 to 3.22 g/l, high risk of developing infectious-inflammatory complications is predicted. If it is determined that interleukin-6 level is from 6.12 to 8.22 pg/ml, interleukin-10 from 6.31 to 10.25 pg/ml and immunoglobulin G2 from 3.70 to 4.90 g/l, low risk of developing infectious-inflammatory complications at early stages of post-operation period is predicted.

EFFECT: application of method makes it possible to increase accuracy of predicting risk of developing infectious-inflammatory complications in case of congenital heart disease in children at early terms of post-operation period after cardiosurgical operation.

1 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: what is offered a method for prediction of a clinical course of autoimmune pemphigus including biopsy of an intact skin differing by the fact that a biopsy material is examined by direct ELISA; it involves determining a localisation pattern of fixed immunoglobulin class G which is when observed as granular depositions in intracellular spaces enables to predict a severe course of pemphigus. Grid-like immunoglobulin G found in intercellular spaces provides predicting a favourable course of pemphigus.

EFFECT: more accurate prediction of clinical current of autoimmune pemphigus and reduced potential complications.

2 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: for oestrogen β (ORβ) receptor analysis, single-cell suspensions of a tumour tissue and a reference culture which is a monolayer culture of MCF-7 line human breast cancer are prepared in solid tumours. The cells are fixed in 4 % formaldehyde, incubates with Tween 20, washed by means of phosphate buffer pH 7.4. Then they are incubated with primary and secondary antibodies, twice washed by means of phosphate buffer pH 7.4, and fluorescence is measured in a flow cytofluorimetre. The data are analysed by calculating the D value of a Kolmogorov-Smirnova statistical test. A percentage of specifically coloured cells is the D value multiplied by 100.

EFFECT: invention enables differential and strictly quantitative evaluation of ORβ expression in tumour tissue.

2 dwg

FIELD: medicine.

SUBSTANCE: diagnostic technique for pseudotuberculosis involving infectious agent antibody determination in patient's blood serum by enzyme-linked immunosorbent assay with using the diagnostic antigen - a species-specific thermostable lethal toxin Y. pseudotuberculosis of certain molecular weight, estimated analysis result shown by optical density.

EFFECT: method enables reducing the analysis stages and providing more rapid diagnostics of pseudotuberculosis.

4 dwg, 1 tbl

FIELD: food industry.

SUBSTANCE: nutritive medium contains a mixture of extract of sweet potato with yeast or tomato extract, substances simplifying identification of Candida genus microorganisms chosen from the group of chromogenic and/or fluorogenic substrates, indicators or colouring agents represented in the nutritive medium by preferably 5-bromine-4-chloride-3-indoxyl-myo-inositolphosphate, methyl-umbelliferyl-α-D-glucopyranoside, 5-bromine-4-chloride-3-indolyl-N-acetyl-β-D-glucopyranoside, 6-chloride-3-indoxyl-β-D-glucopyranoside, 4-methyl-umbelliferyl-N-acetyl-β-D-galactosaminide, 5-bromine-4-chloride-3-indoxyl-N -acetyl-β-D-glucosaminide, hydrobromide L-proline-7-amido-4-methyl-cumarin, para - nitroanilide L-proline, bromocresol purple, bromthymol blue, carbon sources represented by glycerine or separated milk, chromogenic reactions activators represented in the medium by glycerine or maltose or trehalose, additional nitrogen sources represented by glycine or bacterial peptone or fermentative casein hydrolysate, bacteria inhibitors represented in the medium by nalidicsic acid or tea rose extract or sodium deoxycholate or sodium sulphite or ammonium-bismuth citrate or triphenyltetrazolium chloride, pH - regulating substances, ferments activators represented in the medium by potassium monophosphate or potassium diphosphate or 3-morpholinopropanesulphonic acid or magnesium sulphate, agar and distilled or deionised water at preset components ratio.

EFFECT: invention allows to simultaneously extract and identify relevant Candida genera and reduce the terms of Candida genus microorganisms extraction, identification and differentiation.

12 cl, 32 tbl, 22 ex

FIELD: medicine.

SUBSTANCE: nutrient medium containing twice-substituted potassium phosphate 0.5 g, magnesium sulphate 0.5 g, L-asparagin 4.0 g, chemically pure glycerine 40.0 g, malachite green 20.0 ml, citric acid 2.0 g, citric ammonium iron 0.05 g, agar 10.0 g, hard-boiled yolk 250.0 g and distilled water to 1000 ml is inoculated by a preprocessed diagnostic material. Atypical mycobacteria are differentiated from tuberculosis mycobacteria by observing growth after 1-2 weeks of cultivation, while avian and bovine tuberculosis mycobacteria are differentiated from human mycobacteria after 3 weeks of cultivation. If observing no growth within 10 weeks of cultivation or poor growth, the presence of human tuberculosis mycobacteria are detected and differentiated from bovine tuberculosis mycobacteria by required supplementary cultivation on sodium salicylate medium and TSN medium and gas-liquid chromatography.

EFFECT: simplified method with higher efficiency of differentiation.

3 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: method involves collecting dust samples with a sterile cotton wool wad from 10-20 cm2 of any surface or the sterile cotton wool filter of a vacuum cleaner. The dust samples are put into a sterile physiological solution, followed by extraction for 30-60 minutes at room temperature while stirring. The supernatant liquid is collected and multiple cultures of the obtained extract are prepared from the liquid. The obtained cultures are sown in a semi-liquid thioglycol medium and modified thioglycol medium obtained by adding defibrinated blood to the thioglycol medium in a given amount. Culturing is performed for 10 days at temperature 37°C and daily visual monitoring, followed by determining the number of microbial cells which are calculated from the McCready probability table, which is compiled based on data on growth properties of microorganisms and tinctorial properties of the bacterial community of the dust sample are determined through microscopic examination of smears of the mixed culture mass which is gram-stained.

EFFECT: simultaneous quantitative determination of the total bacteria number and obtaining cultural, morphological, tinctorial and haemolytic characteristics of the bacterial community of dust samples from buildings.

FIELD: oil and gas production.

SUBSTANCE: samples from oil contaminated surface are chosen for selection of strains of micro-organisms-destructors of oil and oil products. There are selected pure cultures of hydrocarbon containing bacteria and they are cultivated on dense growth medium. There is determined catalase activity of grown strains of micro-organisms. Further, they are used for preparation of one billion microbe suspension which is mixed with Raymond liquid medium at ratio 1:150. As a sole source of carbon there is added oil or oil products from a place of contamination at 1 cm3 per 1 dm3 of Raymond medium and there is carried out incubation during 12 days. Further, culture is sown on dense growth medium and cultivated. Upon completion of cultivation there is determined catalase activity of studied strains. At its decrease in comparison to a source at 30 % and more analysed strain of micro-organism is chosen as active destructor of oil and oil product.

EFFECT: selection of strains of micro-organisms-destructors among aboriginal micro-flora most actively decomposing oil and oil products facilitating efficient measures for purification of water and soil ecotopes contaminated with oil and oil products.

3 ex

FIELD: medicine.

SUBSTANCE: invention refers to preparation and use of a microbiological selective differential-diagnostic medium for recovering an anthrax agent Bacillus anthracis and related Bacillus cereus bacilli. The medium contains Hottinger's agar as a nutrient base (1), ceftazidime (18-22 mg) and amphotericin B (8-12 mg) for associated microflora growth inhibition and para-Nitrophenylphosphate (p-NPP) disodium salt which is a substratum for alkaline phosphatase enzymosis as a differential-diagnostic additive in the amount 490-510 mg. Differentiation is shown by the condition of the nutrient medium: colour of agar surrounding the Bac. anthracis colonies does not change, whereas the thickness of agar surrounding related colonies gets sharp yellow colour.

EFFECT: invention allows higher selectivity of Bacillus cereus growth and differentiating properties of the medium, eliminated irritant action of ammonia vapour on the researching personnel, facilitating result record.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: blood serum is diluted with physiologic saline in the ratio 1:2, 1:5, 1:10, 1:20 and 1:50, and tracheobronchial aspirates are diluted with physiologic saline in the ratio 1:2, 1:4, 1:8, 1:16 and 1:32. A solid nutrient medium of the following composition is prepared: a nutrient microbiological dry agar 26.5 g, a nutrient yeast extract 1.22 g, lactose 10.7 g, disodium phosphate 0.48 g, anhydrous sodium sulphite 0.83 g, sodium carbonate 0.03 g, sodium hydroxide 5.0 g, distilled water 1000 ml, pH 8.0 which contains the test strain Micrococcus lysodeiktikus 2665 in the concentration 50 million microbial cells in 1 ml of the medium. Simultaneously with the material being analysed, a reference concentration 5 mcg/ml is introduced in the wells of the diameter 8 mm on each Petri dish. In 18 hours of the incubation procedure at 37°C, a diameter of test strain growth retardation zone surrounding the wells are measured. The vancomycin concentration, mcg/ml is determined by a calibration curve of growth retardation zone diameter to the reference vancomycin concentration.

EFFECT: use of the declared method allows determining the vancomycin concentration in the biological fluids and ensuring higher clinical effectiveness.

2 ex

FIELD: medicine.

SUBSTANCE: nanobacteria are counted in a human nephrolith. A fixed mass is separated from the latter, mechanically powdered and divided into j=5 weight fractions pj. The powder is poured into j=5 sterile cells, water infiltrate at pore size not exceeding 0.05 mcm is added. The concentrations of nanobacteria is set between 102 to 106 cells in 1 ml by varying the water volume Vj or weight fractions pj of a powder mineral mass in each cell with using the formula. It is followed with mixing poured into j measuring cells. A nutrient medium - calves' fetal serum is added in the ratio 1:9. Two electrodes are inserted in each cell, then the measuring cells with the mixture is placed in an autoclave wherein constant temperature within 30°C≤T≤40°C is maintained. A mixture impedance (R) is periodically measured, and a point of measurement time (t) is determined until a mixture impedance slump is observed. A calibration diagram of an impedance variation time (timpj) to the concentration of nanobacteria in an initial sample (timpj) is presented. Thereafter, the above-stated stages of the method are conducted for analysed water as well. The derived impedance time (timpj) values are projected on the calibration diagram on the axis (timpj), then on the axis (lgnj).

EFFECT: invention allows evaluating the water concentration of nanobacteria.

3 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: offered is a method of analysing a virus particle image which involves an electron microscopy technique of virus particle imaging. The first virus particle is characterised as primary maturing, while the second virus particle - as secondary maturing. The first image and the second image are transformed respectively to the first and second profiles of a brightness scale on the basis of pixel data. The first and second profiles of the brightness scale are saved then in the form of the first and second matrixes respectively. The third virus particle is identified in the third image. The third image is transformed to the third profile of the brightness scale. The third brightness scale is correlated with the first and second matrixes to determine a maturing stage of the third virus particle.

EFFECT: method improvement.

4 cl, 7 dwg

FIELD: medicine.

SUBSTANCE: invention represents a synthetic oligonucleotides kit for DNA detection of the parodontopathogenic microorganism Actinobacillus actinomycetemcomitans.

EFFECT: invention can be used in medicine for diagnosing oral diseases.

FIELD: medicine.

SUBSTANCE: invention represents a synthetic oligonucleotides kit for DNA detection of the parodontopathogenic microorganism Porphyromonas gingivalis.

EFFECT: invention can be used in medicine for diagnosing oral diseases.

FIELD: biotechnology, microbiology.

SUBSTANCE: method for preparing liquid lactobacterin involves regeneration, culturing passages of lyophilized culture and culturing ferment of lactobacilli in liquid lyophilized nutrient medium containing dry defatted milk enzymatic hydrolyzate with the content of amine nitrogen 1 485 mg%, 30.0 ± 3.0 g/l; yeast concentrated autolyzate, 110.0 ± 10 g/l; food agar, 0.8 g/l, and distilled water, up to 1 l. Culturing ferment is carried out up to accumulation of biomass of lactobacilli 109-1010 CFU/ml. Then 10-30% of supernatant liquid is removed from the ready product and replaced it with equal volume of fresh nutrient medium. Invention provides simplifying technology in preparing liquid lactobacterin and to elevate the storage period of viable lactobacilli. Invention can be used in producing probiotic preparations.

EFFECT: improved preparing method.

1 tbl, 3 ex

Up!