Set of oligonucleotide primers and fluorescent-marked probes for species-specific instant identification of orthopoxvirus by real-time multiplex pcr

FIELD: medicine.

SUBSTANCE: set contains species-specific oligonucleotide primer pairs and appropriate fluorescent-marked probes for conducting one-stage instant identification of several human-pathogenic Orthopoxviruses (VARV, MPXV, CPXV and VACV) by means of real-time multiplex PCR.

EFFECT: invention is intended for instant diagnostics of human and animal Orthopoxvirus infections by real-time multiplex PCR.

10 dwg, 2 tbl, 4 ex

 

The invention relates to molecular biology, Virology and medical biotechnology, and is intended for the rapid diagnosis of orthopoxvirus infections of humans and animals based multiplex real-time PCR.

The refusal of vaccination against smallpox gradually led to the formation of large layer of people, are sensitive both to the variola virus (VARV), and other orthopoxviruses. Numerous reports of cases of destruction of a person these virus - outbreaks Monkeypox (MPXV) were registered in 2003 in the United States [36], in the period 2001-2004 in the Democratic Republic of the Congo [29]in October 2005 in Sudan [15], is unprecedented for smallpox cows (CPXV) this disease outbreak in December 2008 - January 2009 in France and Germany [13, 25] indicate more widespread in the human population previously relatively non-threatening infections type of Monkeypox and smallpox of the cow. Moreover, increasingly VARV considered as a possible agent bioterroristic attacks [11, 35]. In all of the above is an obvious need for an effective, highly sensitive and highly specific methods for rapid diagnosis and species identification of orthopoxviruses pathogenic for humans.

Classical methods of identification of orthopoxviruses are the definition of morpol the GII pock marks on chorioallantoic shell (HAO) developing chick embryos (RCA) or plaques on cell cultures and the definition of temperature limit the propagation of viruses in these biological systems, assessment hemagglutinine virus activity (as an additional test) [2, 3]. These tests take a long time (3 to 6 days) and are associated with the need to work with dangerous viruses. Express diagnostics of orthopoxviruses possible electron microscopic visualization of virions, as well as using a number of serological methods. These procedures usually take a couple of hours, but they make it possible to identify, as a rule, only tribal affiliation viruses and their sensitivity is not always sufficient in the analysis of clinical samples [3]. It has been shown [17, 23]that the restriction analysis of viral DNA with high enough reliability to perform species identification of orthopoxviruses. However, this requires elaborate preparation of the virus and to clean it, which requires specially equipped rooms for work with particularly hazardous viruses and takes a long time.

The appearance of the method of amplification of DNA fragments by polymerase chain reaction (PCR) [11] has created preconditions for the development of options procedures rapid identification of orthopoxviruses. Currently, there are different approaches to the use of PCR for the diagnosis of orthopoxvirus infections. The most simple variant - specific PCR involves the use of primers complementary is s specific DNA sequences characteristic of a specific species of orthopoxvirus. The existence of four pathogenic for humans orthopoxviruses (VARV, MPXV, CPXV, and vaccinia virus - VACV), with different pathogenicity and epidemiological significance, indicates the appropriateness of the indication methods using PCR, allowing both to detect and to characterize the species of virus. To solve this problem was developed one-step rapid method of identification of four species of orthopoxviruses pathogenic for humans, based on multiplex PCR [1, 33, 4], based on the analysis of length polymorphism fragments (RFLP analysis). The developed method is sensitive and specific, can be identified and differentiated in one sample of such a human pathogenic orthopoxviruses, as variola, Monkeypox, smallpox cows and ospowiki. A similar method was proposed in Czub with co-authors [7]. However, methods based on RFLP analysis, a rather time-consuming and requires skills of interpretation of the results MPCR.

For the diagnosis of a human pathogenic orthopoxviruses also proposed methods based on microarray technology [5, 6]. However, despite all the advantages of microarray technology, it is not widely used in practical diagnosis.

is currently in practical health implemented a new technology of PCR Real-time PCR. An important advantage of the method compared to standard PCR is the speed of analysis, which is achieved mainly with the exception of the amount procedures are usually used for detection of amplification products (electrophoresis and visualization), which among other things reduces the risk of contamination and, as a consequence, the number of false-positive results.

Based on this method have been developed various modifications of the methods for detecting DNA orthopoxviruses[14, 20, 21, 22, 26, 27, 28].

The closest analogue (prototype) is a system of real-time PCR for detection of orthopoxviruses and simultaneous identification of variola virus [27].

However, still using multiplex real-time PCR was not asked a single technical solution that allows you to simultaneously detect and differentiate between all pathogenic species of orthopoxviruses (VARV, MPXV, CPXV, and VACV). Each of the described method allows to detect DNA orthopoxviruses and differentiate only one of the above types of viruses. Development of a method based on multiplex PCR in real time, will provide a convenient, accurate, rapid method for detection and differentiation.

The technical result of the invention is the creation of tools on which I conduct one-step rapid identification of multiple pathogenic human orthopoxvirus (VARIOLA, MPXV, CPXV, and VACV) using multiplex real-time PCR.

This technical result is achieved by the fact that the set of species-specific oligonucleotide primers and the corresponding fluorescencebased probes for routine identification of four species of orthopoxviruses pathogenic for humans, when performing multiplex real-time PCR:

This approach will help to improve (to adapt) the technique of real-time PCR for routine use in the diagnosis of orthopoxvirus infections due to the use of only one multiplex PCR (MPCR) analysis in real-time. MPCR in real time will allow to identify and to differentiate viral material four pathogenic for humans orthopoxviruses in the same reaction mixture without the use of additional analyses, thereby reducing the time of diagnosis, the size of the financial costs and the percentage technological errors.

The choice of primers is limited by several criteria such as the length of the amplification product is not more than 250 BP, and the presence in the sequence of product species-specific differences (deletions, insertions, substitutions) [8].

The estimated pairs of primers and the corresponding probes in the future is analyzed, using "Oligo" (version 3.3) [12, 18].

Then the sequence of the oligonucleotides were calculated for each species of orthopoxviruses, were tested for the presence of homology/complementarity between themselves and with the sequences of other poxviruses, taken in GenBank. The lack of homology with other species of orthopoxviruses and genera of poxviruses was one of the criteria for the selection of oligonucleotides.

Thus, for each species of orthopoxviruses was selected primer pair and the corresponding fluorescently probe with species specificity. Sequences of primers and their corresponding estimated length amplification products are shown in Table 1.

The invention is illustrated in the following graphics.

Figure 1. Scheme of genome organization orthopoxviruses. TIR-reversed (inverted) terminal repeats. Terminal harping loop - facing end of the hairpin sequence of about 100 not fully paired nucleotides [2].

Figure 2. Graphical alignment of the left () and right () end species-specific regions of the genome of poxviruses cows CPXV-GRI, ospowiki VACV-COP, smallpox VARV-IND and Monkeypox MPXV-ZAI. Arrows indicate the direction and size of ORT, inside of which was conducted species-specific real-time PCR. Over the arrows shows the names of the appropriate the appropriate ORT. Thin lines indicate regions of deletions in the DNA of some viruses relative to the others. Circles marked the end studs of viral DNA.

Figure 3. Comparison of the nucleotide sequence of the fragment ORT A38R VARV, strain India-1967 (sub variola major) [30] (VAR-IND)with the corresponding regions of the genome VARV strains Bangladesh-1975 [24] (VAR-BSH), Garcia-1966 [32] (VAR-GAR); MPXV, strains: Zaire-96-I-16 [35] (MPV-ZAI), USA_2003_044 [EMBL: DQ011153] (MPV-USA); CPXV, strains: Brighton [EMBL: CV32634] (CPV-BRI), GRI-90 [31] (CPV-GRI); VACV strains: Copenhagen [EMBL: M35027] (VAC-COP), Tian-tan [EMBL: AF 095689] (VAC-TT), Ankara [EMBL: U9488] (VAC-ANK); smallpox camels strains: M96 [EMBL: AF438165] (CmPV-M96), CMS [EMBL: AY009089] (CmPV-CMS); virus ectromelia, strain Moscow (ECT-MOS). Identical nucleotides in the two sequences of the viral genome in relation to the sequence ORT A38R VARV-IND indicated by dots, deletions - dash. Numbers on the left and right of the nucleotide sequences indicate the position of the nucleotides in the analyzed segment of DNA. Bold italics are sequences of oligonucleotide primers VARV_A38R_upper and VARV_A38R_lower and species-specific for smallpox probe VARV_A38R_probe.

Figure 4. Graphs of the fluorescence from the number of cycles in real-time PCR. Data received on the device Real-Time PCR System 7500 (Applied Biosystems, USA) using oligonucleotide primers (VARV_A38R_upper, VARV_A38R_lower)calculated for the district ORT A38R VARV-Ind, and probe, specificnuggets VARV (VARV_A38R_probe). Analyzed amplificate obtained on DNA 25 strains of orthopoxviruses, presented in Table 2. Registers a signal dye FAM conjugated with VARV-specific probe. Curves (I) correspond to the positive result and reflect the level of accumulation of the product in the PCR reaction for DNA VARV strains, II - for all other types of OPV (see Table 2) and NTC. Cycle Number cycle number. Rn - value of the fluorescence signal.

Figure 5. Comparison of the nucleotide sequence of the fragment ORT B7R MPXV strain Zaire-96-I-16 [34] (MPV-ZAI), with the corresponding region of the genome MPXV strain USA_2003_044 [EMBL: DQ011153] (MPV-USA); VARV strains: India-1967 (sub variola major) [30] (VAR-IND), Bangladesh-1975 [25] (VAR-BSH), Garcia-1966 [32] (VAR-GAR); CPXV, strains: Brighton [EMBL: CV32634] (CPV-BRI), GRI-90 [31] (CPV-GRI); VACV strains: Copenhagen [EMBL: M35027] (VAC-COP), Tian-tan [EMBL: AF 095689] (VAC-TT), Ankara [EMBL: U9488] (VAC-ANK); smallpox camels strains: M96 [EMBL: AF438165] (CmPV-M96), CMS [EMBL: AY009089] (CmPV-CMS); virus ectromelia, strain Moscow (ECT-MOS). Identical nucleotides in the two sequences of the viral genome in relation to the sequence ORT B7R MPXV-ZAI indicated by dots, deletions - dash. Numbers on the left and right of the nucleotide sequences indicate the position of the nucleotides in the analyzed segment of DNA. Bold italics are sequences of oligonucleotide primers MPXV_B7R_upper and MPXV_B7R_lower and species-specific for Monkeypox virus probe MPXV_B7R_probe.

6. Gr is feke dependence of fluorescence from the number of cycles in real-time PCR. Data received on the device Real-Time PCR System 7500 (Applied Biosystems, USA) using oligonucleotide primers (MPXV_B7R_upper, MPXV_B7R_lower)calculated for the district ORT B7R MPXV-ZAI, and probe specific for MPXV (MPXV_B7R_probe). Analyzed amplificate obtained on DNA 25 strains of orthopoxviruses, presented in Table 2. Registers a signal dye TAMRA conjugated with MPXV-specific probe. Curves (I) correspond to the positive result and reflect the level of accumulation of the product in the PCR reaction for DNA MPXV strains, II - for all other types of OPV (see Table 2) and NTC. Cycle Number cycle number. Rn - value of the fluorescence signal.

7. Comparison of the nucleotide sequence of the fragment ORT B10R VACV strain Tian-tan [EMBL: AF 095689] (VAC-TT), with the corresponding region of the genome VACV strains Copenhagen [EMBL: M35027] (VAC-COP) and Ankara [EMBL: U9488] (VAC-ANK); CPXV, strains: Brighton [EMBL: CV32634] (CPV-BRI), GRI-90 [31] (CPV-GRI). Identical nucleotides in the two sequences of the viral genome in relation to the sequence ORT B10R VACV-TT indicated by dots, deletions - dash. Numbers on the left and right of the nucleotide sequences indicate the position of the nucleotides in the analyzed segment of DNA. The other members of the genus orthopoxvirus in the area observed the deletion. Bold italics are sequences of oligonucleotide primers VACV_B10R_upper and VACV_B10R_lower and videospirit knogo for Monkeypox virus probe VACV_B10R_probe.

Fig. Graphs of the fluorescence from the number of cycles in real-time PCR. Data received on the device Real-Time PCR System 7500 (Applied Biosystems, USA) using oligonucleotide primers (VACV_B10R_upper, VACV_B10R_lower)calculated for the district ORT B10R VACV-COP, and a probe specific for VACV (VACV_B10R_probe). Analyzed amplificate obtained on DNA 25 strains of orthopoxviruses, presented in Table 2. Registers a signal dye Cy5 conjugated with VACV-specific probe. Curves (I) correspond to the positive result and reflect the level of accumulation of the product in the PCR reaction for DNA VACV strains II - for all other types of OPV (see Table 2) and NTC. Cycle Number cycle number. Rn - value of the fluorescence signal.

Fig.9. Graphs of the fluorescence from the number of cycles in real-time PCR. Data received on the device Real-Time PCR System 7500 (Applied Biosystems, USA) using oligonucleotide primers (CPXV_D11L_upper, CPXV_D11L_lower)calculated for the district ORT D11L CPXV GRI-90, and a probe specific for CPXV (CPXV_D11L_probe). Analyzed amplificate obtained on DNA 25 strains of orthopoxviruses, presented in Table 2. Registers a signal of JOE dye conjugated with CPXV-specific probe. Curves (I) correspond to the positive result and reflect the level of accumulation of the product in the PCR reaction for DNA CPXV strains, II - for all other species the OPV (see Table 2) and NTC. Cycle Number cycle number. Rn - value of the fluorescence signal.

Figure 10. Graphs of the fluorescence from the number of cycles in real-time PCR. Data received on the device Real-Time PCR System 7500 (Applied Biosystems, USA) using a mixture of oligonucleotide primers (VACV_B10R_upper, VACV_B10R_lower, MPXV_B7R_upper, MPXV_B7R_lower, VARV_A38R_upper, VARV_A38R_lower, CPXV_D11L_upper, CPXV_D11L_lower) and a mixture of species-specific oligonucleotide fluorescencebased probes (VACV_B10R_probe, MPXV_B7R_probe, VARV_A38R_probe, CPXV_D11L_probe). The results of amplification indicated by figure 1, obtained using oligonucleotide primers (CPXV_D11L_upper, CPXV_D11L_lower)calculated for the district ORT D11L CPXV GRI-90, and a probe specific for CPXV (CPXV_D11L_probe), registered signal of JOE dye conjugated with CPXV-specific probe. A positive signal is observed only for CPXV DNA. The results of amplification indicated by figure 2, obtained using oligonucleotide primers (VACV_B10R_upper, VACV_B10R_lower)calculated for the district ORT B10R VACV-COP, and a probe specific for VACV (VACV_B10R_probe), registers the signal of the dye Cy5 conjugated with VACV-specific probe. A positive signal is observed only for VACV DNA. The results of amplification indicated by figure 3, obtained using oligonucleotide primers (VARV_A38R_upper, VARV_A38R_lower)calculated for the district ORT A38R VARV-Ind, and probe specific for VARV (VARV_A38R_probe), registered C is cash dye FAM, conjugated with VARV-specific probe. A positive signal is observed only for VARV DNA. The results of amplification indicated by figure 4, obtained using oligonucleotide primers (MPXV_B7R_upper, MPXV_B7R_lower)calculated for the district ORT B7R MPXV Zai, and probe specific for MPXV (MPXV_B7R_probe), registers the signal of the dye TAMRA conjugated with MPXV-specific probe. A positive signal is observed only for DNA Monkeypox virus. Cycle Number cycle number. Rn - value of the fluorescence signal.

Species-specific differences orthopoxviruses are determined by the integral of variable regions of the viral genome, whereas the Central part is a highly conservative nucleotide sequence (figure 1). That is why in the end areas and managed to find potential areas for species-specific amplification of segments of viral DNA (figure 2).

So, for VACV district for PCR was selected area open frame broadcast (ORT) B10R (item genes of vaccinia virus strain Copenhagen) variable on the right end of the genome orthopoxviruses. For MPXV - district ORT B7R (item genes of Monkeypox virus strain Zaire-96-I-16). For CPXV - district ORT D11L (item genes smallpox cows strain GRI-90) variable on the left end of the genome orthopoxviruses. In the case of VARV, was selected area ORT A38R (nomenc is the atur genes variola virus strain India). The area is conservative Central district of orthopoxvirus genome and has a few short deletions and single nucleotide polymorphisms. This fact made it possible to calculate species-specific probe to VARV (figure 3). Due to the presence of other species of orthopoxviruses small insert in the area of the selected primers, and single replacement, when conducting real-time PCR fluorescent signal is detected only for VARV DNA (figure 4).

Figure 5 shows the plot of the alignment of the nucleotide sequence of a human pathogenic orthopoxviruses with a schematic depiction of the locations of hybridization of the primers and probe selected for species-specific detection of MPXV, and figure 6 - the results of the real-time PCR with matched pair of primers and a probe.

In the case of VACV selected district ORT B10R, among pathogenic for humans orthopoxviruses similar sequence has only CPXV. As seen in figure 7, the region of hybridization of the probe VACV_B10R_probe has three nucleotide substitutions relative to the sequence CPXV DNA and amplification with the calculated species-specific for VACV oligonucleotide probe fluorescent signal is observed only for VACV DNA (Fig).

The area frame D11L (item genes CPXV GRI-90), selected as targets for oligonucleotide primers - CPXV_D11L_upper, CPXV_D11L_lower and probe CPXV_11L _probe, is unique. In its structure this sequence contains only CPXV, the other is a human pathogenic orthopoxviruses this nucleotide sequence no. The results of PCR in real time with this pair of primers and a probe presented on Fig.9.

Designed oligonucleotides were synthesized on an automated synthesizer ABI 3400 DNA/RNA synthesizer (Applied Biosystems) using standard phospholidine procedure.

Testing the designed set of primers and probes (table 1) was performed on the full-length DNA 22 different strains of poxviruses (table 2). For this MPCR in real-time used simultaneously all four pairs of primers with the appropriate species-specific fluorescent probes (table 1). In the composition of species-specific probes include fluorophores with non-overlapping spectra of radiation that made it possible to identify the samples belonging to one species of orthopoxviruses pathogenic for humans: on the FAM channel to VARV, TAMRA channel to MPXV, channel JOE to CPXV, on the Cy5 channel to VACV (Fig 1). Each of the strains listed in Table 2 were tested in at least three independent experiments for each mixture, the results MPCR in real time showed high specificity of the definition.

For a better understanding of the invention below must be followed in the career of its implementation.

Example 1. The method of obtaining a set of oligonucleotides for the differential diagnosis of orthopoxviruses

On the basis of theoretical study of the available nucleotide sequences of DNA of different strains of CPXV, and VACV, MPXV, VARV were synthesized primers and fluorescencebased oligonucleotide probes for carrying out multiplex PCR in real time (table 1).

The working conditions of amplification were performed using DNA of 22 strains of different species of poxvirus (table 2). As negative controls were used DNA virus myxoma rabbit, strain Lausanne (genus Leporipoxvirus), smallpox chicken, strain FP9 (genus Avipoxvirus), and the DNA of pathogens such as viruses herpes simplex 1-St and 2-nd type viruses varicella (table 2). When analyzing the material in MPCR in real time in all cases, DNA was detected orthopoxviruses, any extraneous PCR amplification have been identified. Different strains of VARV, MPXV, CPXV, and VACV were successfully identified. All results amplification expected.

Butler
Table 2
The list of different strains of viruses whose DNA was used in a multiplex real-time PCR
StrainSource DNA
The smallpox of the cowGRI-901
OPV-Claus2
88-Lunge2
OPV 90/22
OPV-90/52
OPV-89/32
OPV-89/42
OPV-98/52
Vaccinia virusLIIT1
Elestree 33991
Western Reserve1
The Monkeypox virusCDC#v79-I-0053
CDC#v97-I-0043
Variola virusNgami1
65/581
1
Congo 91
Virus ectromeliaEct-K1/21
MP-22
The smallpox virus camelsCP-52
Virus myxoma rabbitsLausanne4
The smallpox virus of birdsFP95
The varicella zoster virusVZV No. 46
Herpes simplex virus type IHF6
Herpes simplex virus type IIMS6

1. Viral DNA isolated from strains from the collection of the fsri SRC VB “Vector”.

2. Viral DNA courtesy of Meyer (Germany).

3. Viral DNA courtesy of Gaspesie (USA).

4. Viral DNA courtesy of Macfadden (Canada).

5. Viral DNA courtesy of Mskinner (England).

6. In the originate DNA courtesy of M.A. Susloparov, fsri SRC VB “Vector”, Koltsovo, Russia.

Example 2. Setting real-time PCR

The composition of the reaction mixture

The components of the mixtureThe number ál 25 ál of the reaction mixture
Buffer 1xTaqMan® Buffer A2,5
A solution of MgCl2(5 mm)5
dNTP(10 mm)1
A solution of AmpliTaq Gold® DNA polymerase0,12 (0.5 units)
The solution primer (300 nm)8 (1 of each)
The solution probe (250 nm)4 (1 of each)
The DNA solution1
Water3,38

The conditions of the reaction

PCR measurement of fluorescence intensity on the device Real-Time PCR System 7500 (Applied Biosystems, USA) was performed according to the following algorithm:

1 cycle95°C - 10 min
40 cycles 95°C - 20
58°C - 60 C*.

* Measurement of fluorescence was performed at 58°C on the channels FAM, JOE, TAMRA and Cy5.

Example 3. Analysis of the results

Analyze the results of amplification following sections of DNA orthopoxviruses: ORT B10R for VACV, OPT D11L for CPXV, OPT A38R for VARV and OPT B7R for MPXV. The accumulation of product amplification plots VARV DNA detected on the channel detection of the fluorophore FAM, the accumulation of amplification product MPXV - channel for detection of the fluorophore TAMRA, the accumulation of amplification product CPXV - channel for detection of fluorophore JOE, the accumulation of amplification product VACV - channel for detection of the fluorophore Cy5. It is recommended that the results obtained on the instrument Real-Time PCR System 7500 (Applied Biosystems, USA), analyzed using a software instrument Real-Time PCR System 7500.

Example 4. Holding MPCR in real time with samples containing DNA of smallpox cows

1. Two groups of mice of BALB/c, male, weighing 18 to 22 g, 5-6 weeks of age, were infected intranasally with different doses of smallpox cows (strain GRI-90): first - 103 PFU/mouse, second - 105 PFU/mouse. The volume of inoculum was 30 ál. The control group was administered the same volume of saline solution, which was prepared by dilution of the virus suspension.

Blood samples and organs were obtained on the third with the TCA after infection. Blood was obtained from retroorbital sine mice, after which the animals were killed by decomposition of the cervical vertebrae and aseptically received the samples of internal organs of mice: lung, liver, spleen.

2. Lungs, spleen, or liver homogenized in a solution containing 200 ál lyse buffer (100 mm Tris-HCl (pH 8.0), 100 mm EDTA, 100 mm NaCl, 1% SDS) and 20 μl of a solution of proteinase K (10 mg/ml).

3. Incubate 10 min at 56°C.

4. Centrifuged for 7 min at 18000 g.

5. To the supernatant add 400 μl of a mixture of phenol/chloroform (1:1).

6. Mix on Vortex for 1 min, then centrifuged material at 450 g for 1 minute

7. The aqueous phase (top) are taken into new tubes, then the remains of the phenol is extracted with isoamyl alcohol.

8. Add 1/10 volume of 3 M sodium acetate solution (pH 5.5) and two volumes of ethanol (96%).

9. Centrifuged with the subsequent removal of the aqueous phase.

10. The tube is turned upside down and dry the precipitate at room temperature for 20 minutes.

11. The precipitated DNA was dissolved in 15 μl of water.

12. All DNA samples was carried out MPCR in real-time. All samples were positive for all observed signals in MPCR in real time.

Thus, for the first time developed a kit that allows one-stage multiplex polymerase chain reaction to detect and differentyou the ü all four species of orthopoxviruses, pathogenic for humans: variola, Monkeypox, smallpox cows and ospowiki in real-time. The main advantages of the proposed set are:

- high reliability of the method, thanks to selective detection of unique sequences of four pathogenic for humans orthopoxviruses;

- the speed of analysis, as a number of procedures needed to register the amplification products in classical PCR;

- easy-to-follow techniques, eliminating the need to attract highly qualified personnel;

- the relative cheapness of the method, due to the possibility of indication and identification 4 is a human pathogenic orthopoxviruses at the same time.

A set of oligonucleotide primers and fluorescencebased of species specific probes for rapid identification of orthopoxviruses-based multiplex real-time PCR, including:
sequence, species-specific for vaccinia virus
5'→3' 5' ggcaatggattcagggatatac 3'
3'←5' 5' atttatgaataatccgccagttac 3'
Cy5-5' caatgtgtccgctgtttccgttaataat 3'-BHQ3;
sequence, species-specific for smallpox cows
5'→3' 5' aaaactctccactttccatcttct 3'
3'←5' 5' gcattcagatacggatactgattc 3'
JOE is 5' ccacaatcaggatctgtaaagcgagc 3'-BHQ1;
on sledovatelnot, species-specific for smallpox
5'→3' 5' tctgtactatgtgttaaaagattctacaa 3'
3'←5' 5' aatgtatctgttatagtcagcataccc 3'
Cy5-5' cgttgatggacaccacgtttgttatta 3'-BHQ3;
the sequence for species-specific virus Monkeypox
5'→3' 5' acgtgttaaacaatgggtgatg 3'
3'←5' 5' aacatttccatgaatcgtagtcc 3'
TAMRA-5' tgaatgaatgcgatactgtatgtgtggg 3'-BHQ2.



 

Same patents:

FIELD: medicine.

SUBSTANCE: tissue is homogenised in a buffer and centrifuged at 105000 g for 60-90 min at 0-4°C to produce a cytoplasmic fraction which is then incubated with 10 mM of phosphocreatine and 10 mcg/ml of phosphocreatine kinase for 25-45 minutes at 35°C. Cytoplasmic fraction proteins are divided by ammonium sulphate at three stages, at the first stage ammonium sulphate is added to 38% of saturation and centrifuged to isolate a precipitate containing a 26S-proteasome pool, at the second stage, a supernatant is added with ammonium sulphate to 42 % of saturation and centrifuged to isolate a precipitate containing ballast proteins, at the third stage to the supernatant is added with ammonium sulphate to 70 % of saturation and centrifuged to isolate a precipitate containing a 20S-npoteasome pool. Ammonium sulphate is added in portions during 20 min on a magnetic stirrer and further mixed for 20 minutes.

EFFECT: invention allows dividing native 26S- and 20S-proteasomes and isolating them in those amounts they exist in living cells, with preserving at most an undamaged 26S-proteasome structure.

3 cl, 1 ex

FIELD: medicine.

SUBSTANCE: there are offered versions of antibodies and their antigen-binding IL-13, particularly human IL-13 specific fragments. There are described: a pharmaceutical composition, a pharmaceutical compound of the antibody, versions of coding and hybridising nucleic acids and expression vectors. There are offered versions of: cells and methods of producing the antibody, methods of treating IL-13 associated disorders. A method of IL-13 detection in a sample is described.

EFFECT: use of the invention provides new IL-13 antibodies with KD about 10-10 M which can be used for diagnosing, preventing or treating one or more IL-13 associated diseases.

87 cl, 37 dwg, 5 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: method includes analysing aliquots of said sample by one or more methods of protein description specified in the chromatography. The method is based on genetic analysis techniques specified in RFLP and T-RFLP. These methods can be applied both separately, and in a combination. The offered methods allow obtaining the information on the presence and fractions of various individual proteins or coding sequences. The obtained information can be used for evaluating stability of a polyclonal cell line in process, and also estimating a structure of various parties of end polyclonal products.

EFFECT: methods allow describing the composition consisting more than of 10, 20 or greater number of antibodies.

16 cl, 18 dwg, 18 tbl, 14 ex

FIELD: medicine.

SUBSTANCE: composition includes at least three oligonucleotide probes and enables simultaneously determining a level of PSMB4, FCER2 and POU2F2 genes expression. The oligonucleotide composition under the invention is presented to be used, including as a part of a microchip, in a method for prediction of a developing disease in a subject suffering chronic lymphatic leukemia that involves analysing a level of expression of at least three named genes in patient's blood samples.

EFFECT: higher efficacy of the composition.

8 cl, 5 dwg, 16 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: method provides recovery of DNA of an analysed strain followed by PCR with using nucleotide primers of terC, ilvN and inv genes of the following sequences: 89-S - AATCAAATCTCGCCCAGC, 89-As -GCTGCGTATCATTTCACC; 45-S - AGTGGTCTGCTTCTCTGG, 45-As -CGGCATACACAGAATACC; inv839 - TACCTGCACTCCCACAAC, inv1007 -CCCATACGCTGATCTACC. The analysed strains are differentiated by matching the sizes of the derived fragments of terC, ilvN and inv genes with the similar fragments in typical strains of principal and nonprincipal plague agents.

EFFECT: invention allows quick, effective and reliable differentiation of the strains.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: what is offered is a method of marking a human 7th chromosome providing in situ hybridisation of metaphasic or interphasic cell chromosomes of a tested sample and a DNA probe presented by a marker plasmid alpha R1-13 which consists of EcoR 1-EcoR l DNA fragment of a pBR 325 vector of the value 5966 base pairs and EcoRl-EcoRl alphoid DNA fragment of the human 7th chromosome of the value 680 base pairs. The testing environment in which the used DNA-probe specifically interacts with a centromeric region of the 7th chromosome without cross hybridisation with other human chromosomes are developed.

EFFECT: more efficient identification of the presented chromosome and enabled application of the new method in medical diagnostics.

4 ex

FIELD: medicine.

SUBSTANCE: reactions are conducted in the same PCR-microtube on walls of which there is a probe immobilised. In comparison with standard, the PCR-tubes used have a feature of construction: an extended internal surface, and as consequence - a great sorption capacity. A process of selective amplificate sorption on the test tube walls occurs after each anneal stage: temperature decreasing leads to hybridisation of amplicon chain not only among themselves, and with probes preliminary immobilised on the test tube walls. Using the similar PCR-microtubes enables increasing sensitivity of an immune-enzyme assay of amplicons and decreasing a number of polymerase chain reaction cycles. The fixed analytical signal will characterise both the presence of the required DNA, and show its concentration in the sample.

EFFECT: offered test system can be adapted for any existing PCR-technique, does not require special instrumentation and is reliable, simple and efficient for all parameters.

6 cl, 1 dwg, 1 tbl, 1 ex

New corn plants // 2423528

FIELD: agriculture.

SUBSTANCE: during selection by markers, a set of alleles related to loci of quantity tokens (QTL) that contribute to expression of certain phenes of economic value is introduced into a corn idioplasm. The criteria are selected among grain crop capacity, grain moisture when picked, early and late root fit, stem drowning, frequency of common rust, frequency of ear rotting caused by Fusarium (ear wilt), resistance to Sulcotrione and panicle structure. Invention also relates to the method of such plants production, and also to methods of analysis and screening to identify plants with a required profile of alleles.

EFFECT: improved method of new corn plants production.

33 cl, 1 dwg, 19 tbl

FIELD: medicine.

SUBSTANCE: synthetic oligonucleotides for indentifying DNA of Torque teno virus of all known genotypes are disclosed. Primers are combined in a set for DNA identification in blood and other biomaterials of the infectious agent of the latent viral infection Torque teno virus of Circoviridae family by polymerase chain reaction.

EFFECT: invention allows reliable identification of said virus in a biological material.

FIELD: medicine.

SUBSTANCE: analysed sample is studied simultaneously by two methods: the first one is a indirect immunofluorescence (IIMF) reaction, while the second one involves a polymerase chain reaction (PCR); the IIMF provides using monoclonal antibodies "BCKK" (P-384D and 434D). The antibodies interact with the capsular antigen F1 specific for Y.pestis species, or the plasmid-temperature-independent surface protein PFV which is found in all Y.pestis strains and rare R-form Y.pseudotuberculosis strains. The bacteria luminescence shows the presence of native or fraction-less Y.pestis bacteria, or typical and PFV-atypical Y.pseudotuberculosis strains in the sample. The PCR is conducted by two pairs of primers vlm33for/ISrevl754 - specific for Y.pestis species, and JS - specific for Y. pseudotuberculosis species. The values derived with the first pair of the primers are estimated as positive if observing the amplicons in 400 bps, and with the second pair if observing the amplicons in 223 bps; the analysed sample is identified by the matching the IIMF and PCR values with the reference strains.

EFFECT: method provides quick identification and high-reliability differentiation of all strains.

7 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention is related to preparation of protein, binding tumour necrosis factor (TNF), and may be used in medicine. Strain-producer of baculovirus BvG2RIgG is created with the help of recombinant plasmid DNA pFastBac-G2R-IgG with size of 6444 p.n. and molecular mass 4.18 mDa, which bears fragment of smallpox virus genome of strain India-1967, which codes protein that binds TNF, and fragment of human genome, which codes fragment of heavy chain of human antibody G. Produced strain produces soluble chimeric protein, which consists of smallpoz virus protein, which binds TNF, and fragment of heavy chain of human antibody G.

EFFECT: wider spectrum of new generation preparations intended for treatment of human diseases related to hyperproduction of tumour necrosis factor.

2 cl, 3 dwg, 1 tbl, 8 ex

FIELD: molecular biology, gene engineering, medicine.

SUBSTANCE: disclosed is method for determination of different orthopoxviruses based on one-step PCR followed by hybridization of obtained fluorescence labeled amplicones with DNA microarray containing discriminating orthopox- and herpesvirus-hybridization probes.

EFFECT: method for express-diagnosis of orthopoxviruses and discrimination thereof from herpesviruses.

3 cl, 14 dwg, 3 tbl, 4 ex

FIELD: biotechnology, in particular gene engineering.

SUBSTANCE: Gene of B9R protein having high homology with extracellular segment of interferon-gamma receptor is isolated by PCR method from Mankeypox virus genome of strain Zaire-96-1-16. Then said protein is cloned in donor plasmid pFastbAC and via site-specific transposition recombinant bacmid is constructed. Said bacmid is used for pest cell transfection to generate target strain.

EFFECT: new drugs for treatment of human diseases associated with hyperproduction of interferon-gamma.

2 cl, 3 dwg, 6 ex

FIELD: biotechnology, protein engineering.

SUBSTANCE: claimed library represents E.coli TGI cells wherein each cell contains fragmid DNA providing biosynthesis of filamentous bacteriophages exposing unique human single-stranded antibody on surface thereof. Also disclosed is recombinant fragmid pHEN-2A8 DNA containing artificial gene of human single-stranded antibody under control of lactose operon promoter providing synthesis of human single-stranded antibody in composition of chimerical protein with membrane pIII protein of M13 bacteriophage in E.coli cells. Also disclosed is method for production of artificial human single-stranded 2A8 antibody by using such fragmid DNA.

EFFECT: fragmid library useful in medicine.

3 cl, 7 dwg, 10 ex

FIELD: biotechnology, virology, medicine.

SUBSTANCE: invention relates to attenuated virus derived from modified Ankara vaccina virus. Said virus are not able for reproduction by replication in human cell lines. Also disclosed are application of virus or recombinant variants thereof as drug or vaccine, as well as method for inducing of immune response in patients with defected immunity, in patients having immunity to vaccine virus, or in patient during antiviral therapy.

EFFECT: variant of Ankara vaccina virus effective in medicine and veterinary.

86 cl, 15 dwg, 1 tbl, 2 ex

FIELD: genetic engineering, virology, pharmacy.

SUBSTANCE: invention proposes the recombinant modified virus OF VACCINE Ankara able to express structural antigens of hepatitis C virus. Virus comprises DNA sequences encoding structural antigens of hepatitis C virus or their functional regions or epitopes of hepatitis C virus structural antigens. Also, invention proposes a pharmaceutical composition comprising such virus, eucaryotic cell infected with such virus, a method for preparing such virus and a method for preparing hepatitis C virus structural polypeptides. Invention can be used in virology and medicine for preparing hepatitis C virus antigen.

EFFECT: valuable properties of virus.

20 cl, 14 dwg, 1 tbl

The invention relates to genetic engineering and can be used to produce medicines new generation to fight with severe human diseases associated with overproduction of tumor necrosis factor-alpha (TNF-alpha)

FIELD: genetic engineering, virology, pharmacy.

SUBSTANCE: invention proposes the recombinant modified virus OF VACCINE Ankara able to express structural antigens of hepatitis C virus. Virus comprises DNA sequences encoding structural antigens of hepatitis C virus or their functional regions or epitopes of hepatitis C virus structural antigens. Also, invention proposes a pharmaceutical composition comprising such virus, eucaryotic cell infected with such virus, a method for preparing such virus and a method for preparing hepatitis C virus structural polypeptides. Invention can be used in virology and medicine for preparing hepatitis C virus antigen.

EFFECT: valuable properties of virus.

20 cl, 14 dwg, 1 tbl

FIELD: biotechnology, virology, medicine.

SUBSTANCE: invention relates to attenuated virus derived from modified Ankara vaccina virus. Said virus are not able for reproduction by replication in human cell lines. Also disclosed are application of virus or recombinant variants thereof as drug or vaccine, as well as method for inducing of immune response in patients with defected immunity, in patients having immunity to vaccine virus, or in patient during antiviral therapy.

EFFECT: variant of Ankara vaccina virus effective in medicine and veterinary.

86 cl, 15 dwg, 1 tbl, 2 ex

FIELD: biotechnology, protein engineering.

SUBSTANCE: claimed library represents E.coli TGI cells wherein each cell contains fragmid DNA providing biosynthesis of filamentous bacteriophages exposing unique human single-stranded antibody on surface thereof. Also disclosed is recombinant fragmid pHEN-2A8 DNA containing artificial gene of human single-stranded antibody under control of lactose operon promoter providing synthesis of human single-stranded antibody in composition of chimerical protein with membrane pIII protein of M13 bacteriophage in E.coli cells. Also disclosed is method for production of artificial human single-stranded 2A8 antibody by using such fragmid DNA.

EFFECT: fragmid library useful in medicine.

3 cl, 7 dwg, 10 ex

Up!