Method of structural description of recombinant polyclonal protein or polyclonal cell line

FIELD: medicine.

SUBSTANCE: method includes analysing aliquots of said sample by one or more methods of protein description specified in the chromatography. The method is based on genetic analysis techniques specified in RFLP and T-RFLP. These methods can be applied both separately, and in a combination. The offered methods allow obtaining the information on the presence and fractions of various individual proteins or coding sequences. The obtained information can be used for evaluating stability of a polyclonal cell line in process, and also estimating a structure of various parties of end polyclonal products.

EFFECT: methods allow describing the composition consisting more than of 10, 20 or greater number of antibodies.

16 cl, 18 dwg, 18 tbl, 14 ex

 

The scope to which the invention relates

The present invention relates to a method structural characteristics of the recombinant polyclonal protein or polyclonal cell line producing such protein, to confirm the composition of different batches of final products, as well as the stability of the composition during one of the production cycles. In particular, the present invention relates to a method of characterizing a recombinant polyclonal antibodies.

Prior art

It has long been known that the introduction of antibodies for prophylactic or therapeutic purposes (so-called passive immunization) may enhance the ability of the immune system to eliminate infectious agents. Such therapeutic antibodies have historically been made from human plasma (and therefore the composition of the antibodies was called “immunoglobulin” or “gamma globulin”). To obtain these antibodies blood immunogenic people-donors were combined and the resulting immunoglobulin fraction was extracted and purified. Specificity to a specific antigen has only one fraction of immunoglobulin. Therapeutic use of immunoglobulin has certain difficulties in connection with certain restrictions, such as limited number of donors,expensive procedure of obtaining immunoglobulin, the risk of transmission of infectious contamination from donors, the inevitable difference of one party from another, and the complexity of modes of administration.

Recently received recombinant monoclonal antibodies, which are alternative products of immunoglobulin. However, they are directed only against one target, and therefore may not be effective against complex or dynamic targets, such as infectious agents. To solve this problem, there are several examples of mixing monoclonal antibodies (for example, Novakowski et al., 2002, Proc. Natl. Acad. Sci., USA, 99, 11346-11350 and U.S. patent No. 5126130).

Recently the technology was developed recombinant production of highly specific polyclonal antibodies suitable for prophylactic and therapeutic injection (WO 2004/061104). Recombinant polyclonal antibody (rpAb) can be isolated from industrial bioreactor in the form of a single drug without separation, processing, refining, or characteristics of the individual members constituting the recombinant polyclonal protein. However, this method of obtaining requires the procedure of confirmation of identity and the corresponding composition of the obtained complex mixture of molecules of antibody throughout the production cycle.

In addition, to obtain the permission of the National and Supranational bodies on Prov is doing research on the development and therapeutic use of medicines polyclonal antibody the obtained recombinant method, must be, to some extent, characterized. Because the technology for producing recombinant polyclonal antibody is a brand new concept, never before attempts were made to characterize the sample containing many different but highly homologous proteins from the point of view of relative ratios of the individual proteins in the sample. For example, permission to use isolated from the blood immunoglobulin usually come only after obtaining data on non-clinical and clinical efficacy of the product, and in most cases, after obtaining the prior data about its safety, and after analysis of the chemical structure of the crude product, evaluation of process data and control (CMC) parameters such as purity, the titer of binding and the absence of extraneous agents. Of course, such a simplified approach is not applicable to proteins produced by recombinant means. Therefore, Regulators have ruled that each antibody component that is included in the mixture of several monoclonal antibodies, should be described separately in accordance with known methods of chemical characteristics in combination with biological analyses. However, as yet non-existent is there technically feasible or appropriate way to determine the true composition of the polyclonal composition, consisting of more than 10, 20 or even more different antibodies.

The invention

The present invention relates to a method structural characteristics carried out to determine the composition of the different homologous proteins, such as recombinant polyclonal protein, and in particular recombinant polyclonal antibody produced polyclonal cell line.

Description of the invention

A necessary requirement for the industrial production of recombinant polyclonal protein for prophylactic and therapeutic applications is maintaining its clonal diversity in the process of expression. Therefore, a very important factor is the ability to monitor and determine the clonal diversity polyclonal cell line producing a polyclonal antibody, as well as the possibility of obtaining relative playback of individual proteins in the polyclonal protein at any desired time and in any relevant sample that would allow for analysis on the stability of the expression system in the production process of one party, as well as to assess differences between batches of the final product.

Composition of homologous proteins, such as recombinant polyclonal antibody or a recombinant poly is lonely T-cell receptor (R), consist of various proteins with very similar physico-chemical properties. This is an advantage for the purification of the polyclonal protein produced by recombinant means, such as the treatment can be carried out in the same way as in the case of a single protein, but without loss of diversity in the composition of the polyclonal protein in the process of cleaning. However, this similarity of physico-chemical properties associated with certain difficulties that arise in characterizing the relative distribution of individual members of the polyclonal protein, because this similarity makes it difficult differentiation of one specific member of this composition from another.

More specifically, upon receipt of the recombinant polyclonal protein to its original composition is known as the sequence encoding this polyclonal protein, were selected, skanirovaniya and sequenced to obtain the polyclonal cell line producer, used for production of recombinant polyclonal protein. Description of the receipt of such cell lines can be found in the application WO 2004/061104, which are listed in the present application by reference. With rare exception, there may be situations, when to obtain a recombinant polyclonal antibody is directly used nasenyana or newtop the fair library, for example, received from the recovering patient.

To ensure that after the cultivation and purification of the resulting product (recombinant polyclonal protein) on the diversity will be the same as the original product (the library of coding sequences), you must obtain information about the relative proportion of individual members of the polyclonal protein and/or coding sequences in the polyclonal cell line-producer. The present invention relates to a method of structural characteristics on the basis of genetic analyses, and to methods for protein characterization, which provide information about the diversity of polyclonal cell lines and polyclonal protein.

Definitions

The term “antiidiotypic antibody” means a full-sized antibody or its fragment (e.g., Fv, scFv, Fab, Fab' or F(ab)2), which are specifically associated with the variable part of the individual member of the polyclonal protein. Preferably antiidiotypic antibody of the invention specifically binds to the variable part of the individual member polyclonal antibodies or polyclonal TcR. This antiidiotypic antibody preferably has specificity to the antigen-specific part of the individual member polyclonal antibodies or recloning T-cell receptor, i.e. the so-called V-region. However, it may be specific to certain subpopulations of individual members, for example to a specific family of the VH genes present in this mixture.

The term “antiidiotypic peptide” means a specific peptide ligand that can specifically bind and thereby to identify a specific member of the protein in a mixture of homologous proteins. While it is preferable that antiidiotypic peptide according to the invention is specifically associated with an individual member of a polyclonal antibody or polyclonal R. Antiidiotypic peptides according to the invention are preferably directed against the antigen-specific part of the sequence specific antibodies or specific T-cell receptor. One such antiidiotypic peptide may also be specific to certain subpopulations of individual members.

The term “group” N-terminal sequencing” means N-terminal sequencing of the protein present in the sample, containing a number of variants of homologous protein molecules, for example a polyclonal protein. This group sequencing allows you to get information about the sequences of all the different proteins simultaneously present in the sample. In positions where individual members in the sample differ in amino the PCI-e slot structure, they can be quantified, and these various quantities of individual amino acids at variable positions can provide information on subpopulations of protein with specific modifications. If proteins subjected to N-terminal sequencing, contain more than one subunit, to reduce their variability preferably before sequencing they were selected; for example, if the specified pattern is a polyclonal antibody, before sequencing of its heavy chains can be separated from the light chain.

The term “clonal diversity” or “polyclonality” means the variability or diversity of the polyclonal protein, nucleic acid sequences encoding these proteins, or polyclonal cell lines that produce these proteins. This variability is characterized by differences in amino acid sequences or nucleic acid sequences between individual members of the polyclonal protein or a library of coding sequences. For polyclonal cell lines clonal diversity can be measured by the variability of the sequences of nucleic acids present in cell lines, such as their single-site integration into the genome of individual cells. However, such clonal which diversity can be measured as the variability of amino acid sequences, presented on the surface of cells in this cell line.

The term “epitope” means a portion of an antigenic molecule, which binds the T-cell receptor or antibody. The antigen or antigenic molecule, essentially simultaneously several or even many epitopes.

The term “immunoglobulin” is commonly used as a General name for a mixture of antibodies found in blood or serum. Therefore, serum polyclonal antibody is often referred to as globulin and gamma-globulin. However, the term “immunoglobulin” may also be used to designate a mixture of antibodies derived from other sources, such as recombinant immunoglobulin.

Used herein, the term “individual clone” means isogenic population of cells expressing a particular protein such as a monoclonal antibody. These individual clones can be, for example, obtained by transfection of a host cell of the desired nucleic acid, and after selection on positive transfectants single clone may be reproduced or can be picked up and reproduced several individual clones. Polyclonal cell line can be obtained by mixing the individual clones expressing various individual members of the polyclonal protein.

The terms “individual member” what if “distinguished member” means a protein molecule of the protein composition, contains different, but homologous to each other molecules, where the individual protein molecule is homologous to the other molecules of the composition, and containing one or more fragments of the polypeptide sequence, which are characterized by the fact that the amino acid sequences of individual members of the polyclonal protein are different from each other, and which are also called variable regions. For example, a polyclonal antibody, consisting of Ab1-Ab50, all proteins with a sequence of Ab1 will be considered as a separate member of the polyclonal antibodies and protein Ab1 may, for example, differ from protein Ab2 sequence in the CDR3 region. A subpopulation of individual members may, for example, consist of antibodies, such as Ab1, Ab12 and Ab33.

The term “polyclonal antibody” means a composition of different antibody molecules which are able to bind or react with several different specific antigenic determinants on the same or other antigens. The variability of polyclonal antibodies is observed in the so-called variable regions of the individual antibodies comprising the polyclonal antibody, and in particular in the complementarity-determining regions (CDR1), CDR2 and CDR3.

The term “polyclonal cell line-producer”, “Bank polyclonal host cells, (rmsw)and what the Bank polyclonal working cell, (WDC)” are used interchangeably and refer to a population of protein-expressing cells, which transferout library of interest variants of nucleic acid sequences. Preferably the individual cells, which collectively comprise the recombinant polyclonal cell line producing, carrying only one copy of a separate interest nucleic acid sequence that encodes one member representing the interest of the recombinant polyclonal protein, but each copy is integrated into the same site of the genome of each cell. Cells, which may represent such a cell line producing, can be, for example, the cells of bacteria, fungi, eukaryotic cells such as yeast, insect cells or mammalian cells, and in particular an immortalized mammalian cell lines, such as cells, Cho cells, COS cells, KSS, myeloma cells (e.g., cells, Sp2/0, NS0)cells, NIH-T, cells OF/0 and immortalized human cells, such as cells La, SOME cells 293 or cells R.6.

Used herein, the term “polyclonal protein” means a protein composition comprising different, but homologous protein molecules, and preferably molecule selected from the superfamily of immunoglobulins. More preferred are analogichnye protein molecules, which are antibodies or T-cell receptors (R). Thus, each protein molecule is homologous to the other molecules such compositions, and also contains one or more fragments of variable polypeptide sequence, which are characterized by the fact that the amino acid sequences of individual members of the polyclonal protein are different from each other, and which are also referred to as a separate variable members of the polyclonal protein. Known examples of such polyclonal proteins are antibodies, T-cell receptors and b-cell receptors. Polyclonal protein may consist of a specific subpopulation of protein molecules and is determined by their common characteristics, such as total activity of binding to the desired target, for example, in the case when a polyclonal antibody directed against the desired target antigen. Recombinant polyclonal protein usually consists of a specific subpopulation of molecules, where the sequence of each such member is well known. Only in rare cases, the recombinant polyclonal protein may resemble serum immunoglobulin in the sense that this recombinant polyclonal protein also contains a significant amount of proteins is not specific to this target.

The term “polyclonal who-cell receptor (R)” means a composition of different molecules R, the ability to communicate or react with several different specific antigenic determinants derived from the same or from different antigens. Variability polyclonal R observed in the so-called variable regions of individual molecules R comprising polyclonal R, and in particular in the regions CDR1, CDR2, and CDR3 CDR4. Molecules R according to the invention are constructed soluble dimers having alpha-beta chain or gamma-Delta circuit. These are designed R described, for example, in the literature (Willcox, B.E., et al., 1999, Protein Sci. 8, 2418-2423).

The term “protein” refers to any amino acid chain, regardless of its length or post-translational modifications. Proteins can exist as monomers or multimers containing two or more polypeptide chains combined with each other, as well as their fragments, polypeptides, oligopeptides or peptides.

The term “protein-indicator” means a separate component polyclonal protein whose presence can be detected in the process of production of a polyclonal protein or in different batches. The constant presence of the protein of the indicator in a series of related samples reflects the stability of expression of the polyclonal protein in the different parties or within one production cycle. In addition, the presence of the influence of this protein indicates the preservation of diversity in the process of further processing, such as clearing recombinante produced polyclonal protein.

The term “unique peptides markers” means the number of peptides derived from the variable regions of the individual components of the polyclonal protein. Such peptides are preferably treated with protease or other methods of fragmentation of proteins and peptides, which can be uniquely identified as a separate component of the polyclonal protein, called unique peptides-markers.

Description graphic material

Figure 1: Chromatogram obtained by cation-exchange chromatography, the composition of recombinant polyclonal antibodies against RhD (anti-RhD rpAb), isolated from an aliquot 3948 and 3949 after cultivating for 9 weeks. The bottom chromatogram corresponds to the aliquot 3949, and the upper chromatogram corresponds to the aliquot 3948. The Y-axis upper chromatogram is shifted to separate it from the bottom chromatogram. Peaks A-J refer to antibodies that differ in the total charge, and specific antibodies have different charges.

Figure 2: Photograph of a gel illustrating theHinfIanalysis by RFLP-PCR product obtained from an aliquot 3948+ and 3949+ (FCW065) polyclonal cell line producing anti-RhD rpAb, after cultivation for 11 weeks. Identified bands that can be Prip is Sana specific clones.

Figure 3: the T-RFLP profiles of the light chains of antibodies against the rhesus factor D, derived from a polyclonal cell culture expressing the anti-RhD rpAb, consisting of eight different antibodies against the RH factor D. the Arrows indicate the peaks, which are assigned eight different clones of antibodies against the RH factor D.

Figure 4: the T-RFLP profiles obtained at this time for the variable regions of the heavy chains of antibodies against the rhesus factor D, derived from a polyclonal cell culture expressing the anti-RhD rpAb, consisting of twenty-five different antibodies against the RH factor D. the Arrows indicate the peaks, which are assigned twenty-five different clones of antibodies against the RH factor D.

Figure 5: Distribution of cDNA assessed by T-RFLP-profiles of the sequences encoding the heavy chain of eight different antibodies against rhesus factor D and derived from a polyclonal cell culture, cultivated for five weeks.

6: Shows the relative content (%) anti-RhD rpAb, consisting of eight different antibodies, and analyzed using cation exchange chromatography. Integrated chromatographic peaks were assigned specific antibodies based on their retention time, and the profiles of the peaks obtained from the individual antibodies were analyzed separately with IP is the use of cation-exchange chromatography under identical conditions.

Fig.7: Cation-exchange chromatogram of anti-RhD rpAb, consisting of twenty-five separate components for the sample obtained after culturing for 4 weeks. Peaks AC1-25 refer to antibodies that differ in the total charge, and specific antibodies have different charges.

Fig: elution Profiles during cation-exchange chromatography of recombinant polyclonal antibodies against RhD, consisting of ten individual members. Letters shows peaks subjected to FROM-HPLC held on the second parameter.

Figure 9: Shows the elution profile of fraction B5 shown on Fig, which was obtained during the ON-HPLC.

Figure 10: Illustrates the composite 2-dimensional (2D) LC-analysis of recombinant polyclonal antibodies against RhD, consisting of ten individual members, visualized on the map of the protein with the specified color codes (represented in gray scale).

11: Shows the elution profile obtained during cation-exchange chromatography Asp-N digests, purified by liquid chromatography (LC) of the recombinant polyclonal anti-RhD antibodies, consisting of eight individual members. Bold horizontal lines indicate the fraction subjected to analysis of MALDI-TOF for identification of marker peptides.

Fig: Shows overlapping chromatogram OD80 -Ioch obtained for the anti-RhD rpAb, consisting of twenty-five individual members, with ELISA data were obtained from three separate ELISA assays using antiidiotypic peptides RER, RER and RER. ELISA assays were performed for each fraction obtained by ion-exchange chromatography. ELISA data were normalized to % of the total OD for these three ELISA-analysis conducted using RER, RER and RER respectively, can be compared with each other.

Fig: Shows the distribution of the three antibody-indicators against RhD162, 202 and 305 in different periods of cultivation in the fermentation process. G8 corresponds to the day 8 after inoculation the contents of the bioreactor.

Fig: FACS data for the three cell lines, painted tetramera RER. (A) RER-negative cell line RhD162. (C) cell line RhD202, (C) - 50%mixture of cell lines RhD162 and RhD202 (corresponding to a mixture of (a) in the experiment). In the first panel, and presents a scatter graphs FSC-SSC, where R1 is discriminatory window for live and healthy cells, selected by size (FSC) and granularity (SSC). The histogram in the middle panel illustrates the fluorescence intensity of the cells. Discriminatory window R6 covers the surrounding cells stained with the tetramer. The last panel shows the percentage of cells in the R6 uses is in my calculations.

Fig: Profiles chromatograms recorded during cation-exchange chromatography for samples at various stages during subsequent processing of the sample anti-RhD rpAb containing 25 individual members, presents material collected after elution with capture (A), on Sephadex G-25 (B), DEAE-sepharose (C) and MEP Hypercel (D).

Fig: ZIOC profiles for three representative monoclonal anti-RhD antibodies, representing three different distribution profile of the charge. (A) a homogeneous profile, (B) profile with the “3 peaks”, (C) a comprehensive profile.

Fig: ZIOC analysis RhD189 and options RhD189E with a modified residue in the position of Glu.

Fig: Activity binding option RhD189E modified Glu and its natural analogue RhD189. Binding of antibodies to RhD-positive red blood cells was determined using FACS analysis, and the mean fluorescence intensity (MFI) is presented depending on the antibody concentration.

Detailed description of the invention

In one of its aspects the present invention relates to a method of structural features to obtain information about the relative number of individual members in the samples containing (i) the different homologous proteins having different variable regions, or (ii) cell lines producing such proteins. This method of characteristics can be used for the evaluation of the various aspects during production or purification, or during long-term storage of the composition, contains different homologous proteins. Preferably the above characteristics according to the invention is used to perform one of the following purposes: (i) to evaluate the relative performances of individual members or of some of the individual members to each other in one sample, (ii) to assess the relative amount of one or more individual members in different samples in order to determine the composition of various parties and (iii) to assess the actual content of one or more individual members. This can be compared, but not necessarily, with a library of vectors, usually used for production of polyclonal cell line producer. This method features may be, in particular, used to monitor clonal diversity polyclonal cell lines and/or for playback of individual proteins in the polyclonal protein produced by this cell line. Can be monitored stability of the composition of various parties in the process of individual production cycles and the composition of the product in these parties. The alternative procedure of this method can be applied for treatment of various compositions of mixtures of homologous proteins, including polyclonal protein or a mixture of monoclonal antibodies, for example for evaluation will continue the major maintain the stability of individual members in such a composition.

In one embodiment, the present invention relates to a method of characterizing samples containing different homologous proteins having different variable regions, or cells producing such proteins to obtain data on the relative content or the presence of individual members of the specified protein or their coding sequences, where the method includes the analysis of the aliquot of these samples one of several methods of characterization of proteins and/or one or more methods of genetic analysis of protein coding sequences.

In another embodiment, the present invention method structural characteristics consists of a number of analytical methods selected from the methods of characteristics, and genetic analyses. Thus, the indicated method of structural features can consist of any number of individual options described in the following sections. While this might be sufficient for data sample by holding only one of the analytical methods described in the above embodiments. However, for the development of the method of characteristics, it is preferable to obtain data by performing at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 of these analytical methods with subsequent merging of the individual options provided by the who. The combination of several analytical techniques allows to obtain a series of mainly descriptive data about the relative or absolute polyclonal composition of the mixture. Data obtained by these methods can be quantitative and qualitative in nature, and when combined, they give a full description of the analyzed samples.

In preferred embodiments of the invention one of the analytical methods is a method for protein characterization, and other analytical method is the genetic analysis.

The term “genetic tests” means such methods as the analysis of the polymorphism of the lengths of restriction fragments (RFLP), terminal RFLP (T-RFLP)analysis micromission, quantitative PCR, such as PCR, carried out in real time, and sequencing of nucleic acids.

The term “methods of protein characterization” means the methods commonly used in the field of proteomics for the characterization of unknown proteins, such as (i) chromatographic analyses, which allow you to separate proteins according to their physico-chemical properties, (ii) analysis of proteolytic cleavage of homologous proteins, (iii) “group” N-terminal sequencing, and (iv) analysis using specific detector molecules for homologous proteins.

In accordance with the present invention was developed to complement the supplemented flax concept which can be applied in combination with the above-described analytical methods to characterize complex pool of homologous proteins. This concept is based on the selection of the number of proteins indicators present in this pool of homologous proteins (e.g., polyclonal antibodies or polyclonal R) or on the surface of a pool of cells that produce these homologous proteins (e.g., polyclonal cell line producer). Proteins are the indicators subject to quantitative and qualitative characteristics to confirm that this subpopulation protein is present in an appropriate amount, or in the supernatant polyclonal cell cultures, or cell surface in the process of production of these proteins. Proteins indicators can be, for example, analyzed using crystal molecules, which are specific to individual members of the homologous proteins, such as antiidiotypic molecules. The concept of protein-indicator can also be used to assess the constancy of the composition of different batches of cell cultures. The concept of protein-indicator can also be extended to a unique peptides derived from the polyclonal protein as a result of his treatment with protease, where these proteins indicators preferably contain part of the DR in the case if the specified polyclonal protein is a polyclonal antibody or R. In the analyses carried out at the genetic level, can also be used the principle of protein-indicators based on unique sequences of nucleic acid isolated from individual members of the library that encodes a polyclonal protein. In particular, nucleic acid sequence corresponding to the CDR regions of the antibodies or R, can be selected as the indicator sequences of nucleic acids, and most preferred region is the CDR3 region. In each individual analytical method, sequences of proteins of indicators, peptides or nucleic acids can vary depending on the individual members of the polyclonal protein or nucleic acid sequences encoding these proteins, and these sequences can be identified, selected analytical methods.

Genetic analysis at the clonal diversity of the polyclonal cell line producer

Some variants of the present invention includes monitoring polyclonality in the expression system, producing polyclonal protein, by assessing the number of cells that encode a specific member of the polyclonal protein, and/or the levels of mRNA coding individual p the e the members of the polyclonal protein. Such monitoring may be conducted at the level of mRNA or genomic level using, for example, RFLP and T - RFLP analysis, analysis of oligonucleotide micromission, quantitative PCR, such as real-time PCR, and sequencing of nucleic acids of the variable regions of gene sequences obtained from the cell line producer. Alternatively, such methods can be used for qualitative assessment of the diversity of proteins in the polyclonal cell line. Monitoring of nucleic acid sequences encoding the polyclonal protein can be carried out on samples obtained from the same polyclonal cell cultures in different periods of cultivation, and thus, can be monitored relative quantities of individual coding sequences in the process of the production cycle to assess their compositional stability. Alternatively, it may be monitored sequences of nucleic acids encoding a polyclonal protein in samples obtained from different polyclonal cell cultures in specific time periods of cultivation, and thus, can be monitored relative quantities of individual coding sequences in different batches of the product to assess changes in e is their various parties.

The preferred sample used in genetic analyses, is the fraction of the cell culture enriched in cells of this culture, for example, by deposition. This sample is usually obtained by collecting fractions of the cell culture in a necessary period of time with subsequent destruction of the environment, for example, by centrifugation. Samples to compare the composition of different batches, preferably, obtained from cellsin vitrowhen a certain limit of their age cells for production.

RFLP/T-RFLP

RFLP and T-RFLP analysis can be carried out on the genomic level or at the level of mRNA. If polyclonal cell line producing was obtained so that each cell contains only one copy of interest sequence, the analysis at the genomic level provides data about the relative number of cells in the cell line-producer, producing individual member of the polyclonal protein. On the other hand, the analysis at the level of mRNA allows to obtain data on potential levels of expression of individual members of the polyclonal protein. Analysis at the level of mRNA is usually carried out by reverse transcription of mRNA with obtaining cDNA followed by restriction analysis. However, it can be also carried out the analysis directly on the mRNA.

In RFLP analysis to zeway sequence, straight(s) and/or reverse(e) primer(s)used(e) for PCR or RT-PCR, mark with getting labeled at the ends of the PCR fragments. After hydrolysis of the corresponding restricteduse enzymes receive fragments of various sizes, and these fragments can be separated by electrophoresis, and preferably capillary electrophoresis, after which the resulting fragments can be detected using a labeled amplicon (Liu et al., 1997, Applied and Environmental Microbiology 63, 4516-4522). Suitable labels can serve as signals determined by the intensity of fluorescence, radioactivity, color properties, x-ray diffraction or absorption, magnetism or enzymatic activity, and such labels are, for example, fluorophores, chromophores, radioactive isotopes (in particular,32R33R35S and125I), electron-dense reagents, enzymes, and ligands having specific binding partners. As the label is preferably used fluorophore.

When using the polyclonal cell line producer with extensive clonal diversity may not be able to get a unique restriction fragment for each coding sequence. If this situation occurs, the sequence indicator nucleic acids can be selected by the La monitoring clonal diversity polyclonal cell line producer. Alternatively, the fragments that cannot be separated by size, can be sequenced to estimate the distribution of all individual coding sequences.

Analysis of oligonucleotide micromission

Oligonucleotide micromissile, such as DNA chips can be used to measure levels of genomic DNA or mRNA levels in polyclonal cell lines by determining the level of hybridization of labeled DNA generated from cell lines, with the probe associated with a solid surface (Z. Guo et al., 1994, Nucleic Acids Res. 22, 5456-5465).

Such probes can be either double-stranded cDNA sequence, characteristic sequences, which are present in the polyclonal cell line (either occur from the polyclonal cell line, or from a library of cDNA used for transfection of host cells contained in the polyclonal cell line), or sense oligonucleotides (length 20-90 nucleotides). The probes attached to a solid surface such as glass, plastic or gel matrix, and the use of double-stranded probe its denatured prior to analysis. In the analysis of the polyclonal cell line expressing homologous proteins, for example, a polyclonal antibody or polyclonal R, preference is sustained fashion to use precisely designed oligonucleotide probes to prevent unwanted cross-hybridization between the probe and the labeled cDNA, derived from the polyclonal cell line. Such probes designed based on comparison of sequences encoding the variable region, which were used to generate polyclonal cell line producer in order to design specific probes for each individual member polyclonal product. Coding sequences for antibodies differ mainly in their CDR regions, with the highest degree of variability is the CDR3 region. For constructing semantic oligonucleotide probes is preferable to use the area with the greatest variability. While it is preferable that the sequence of these probes were complementary to the individual members present in the polyclonal cell line, and, if possible, was significantly different from the sequences of other members of this cell line. Can be used one or more probes specific for each variable regions. For purposes of standardization can be used probes, hybridizers with sequences in the constant region. These probes or cause spots directly on the surface used for hybridization or synthesizein situon this surface (Pease et al., 1994. PNAS 91:5022-5026, Singh-Gasson et al., 1999, Nature Biotech. 17:974-978).

Mechano the analyzed DNA obtained by collecting and polyclonal populations of cells and receipt of these cells genomic DNA, full-length DNA or mRNA. When using genomic DNA tagging carried out by PCR amplification, the respective coding sequences, or by using appropriately labeled primers or labeled nucleotides. When using a full-sized RNA or mRNA labeled cDNA can be obtained by reverse transcription carried out separately or in combination with stage PCR carried out using labeled primers or nucleotides. Suitable labels can serve as signals, detected by fluorescence, radioactivity, color properties, x-ray diffraction or absorption, magnetism or enzymatic activity, and such labels are, for example, fluorophores, chromophores, radioactive isotopes (in particular,32R33R35S and125I), electron-dense reagents, enzymes, and ligands having specific binding partners. As a label it is preferable to use the fluorophore. If the analyzed coding sequences are cDNA encoding the heavy and light chain antibodies, cDNA first receive chain by reverse transcription using hybridization with antimyeloma primers located in the constant region, located in the 3'-position on the RH is increased by variable regions. If additional PCR is not performed, the synthesis is preferably carried out using labeled nucleotides. If after reverse transcription carried out PCR, using a set of semantic primers that will ensure the implementation of the amplification of all members of the family variable regions. Alternatively, it may be used semantic primers, hybridization with regions that are identical in all mRNAs (for example, 5'-noncoding region, or a sequence encoding a signal peptide). This method can be used to sense and/or antisense primers, which can be fluorescently labeled, or labeled nucleotides.

Upon receipt of the probes and the labeled cDNA analysis micromission carried out by hybridization of denatured labeled DNA with immobilized oligonucleotides under conditions optimized to achieve low background and high specific signal. After washing each of the hybridized probes measure and calculate the amount of specific transcripts.

Quantitative PCR

PCR methods have been previously adapted for the detection and quantification of nucleic acid sequences in the sample, see, for example, Higuchi R. et al., 1993. Kinetic Biotechnology 11, 1026-1030; Holland, P.M. et al., 1991. NAS 88, 7276-7280; Livak, K.J. et al., 1995 PCR Methods Appl. 4, 357-362. In these methods are direct and reverse primers, as in standard PCR, and one or more additional nucleic acid sequences that hybridize with amplificare nucleic acid. This additional nucleic acid sequence, called the “probe”, hybridized area amplificare nucleic acid located between the parts, for hybridization with the two primers, and labeled so that each subsequent PCR cycle led to modification of the sequence of the probe or its label. This modification of the probe or its label leads to the activation or stimulation of the label to a certain extent at which it will be contacted with a variety of additional copies of the amplified nucleic acid during each cycle of PCR. Such methods are usually referred to as PCR “real-time” and allow the detection of the increasing number of PCR product by combining the procedures for periodically conducting thermal cycles with the procedure of detection of the label. In a specific embodiment, real time PCR, modification of the probe or its label occurs in ectonucleoside activity of the polymerase, such as Taq polymerase, and therefore this method is usually referred to as Taq or TaqMan RT-PCR in real time the Yeni (for example, Holland, P.M. et al., 1991, PNAS 88, 7276-7280).

Suitable labels can serve as signals, detected by fluorescence, radioactivity, color properties, x-ray diffraction or absorption, magnetism or enzymatic activity, and such labels are, for example, fluorophores, chromophores, radioactive isotopes (in particular,32R33R35S and125I), electron-dense reagents, enzymes, and ligands having specific binding partners. The most commonly used label for the probe is a fluorescent label, producing a fluorescent signal. This can be achieved by using a probe, which was double-labeled fluorescent reporter dye at one end, usually at the 5'end and a quenching dye at the other end, i.e. at the 3'-end (e.g., Livak K.J. et al., 1995, PCR Methods Appl. 4, 357-362). If this probe is intact, the proximity of the quenching dye to the reporter dye suppresses the intensity of fluorescence of the reporter dye. Suitable dyes are described in the publication J. Wilhelm & Pingoud, A., 2003. Chembiochem. 4, 1120-1128. During each cycle of PCR, the 5'→ 3' and Exo-nuclease activity of the DNA polymerase leads to the cleavage of the probe separates the reporter dye from the quenching dye. This separation leads to an increase in the fluorescence intensity of reporter dye is I.

During PCR, if the sample is of interest target, the probe specifically hybridizes between sites forward and reverse PCR primers. Specified and Exo-nuclease activity of the DNA polymerase leads to the cleavage of the probe between the reporter and quenching dyes only if the specified probe hybridized with molecule-target. Such probes are often referred to as TaqMan probes. The increase in fluorescence intensity is detected only if the specified sequence is complementary target specified probe and amplified in the PCR process. In accordance with such requirements nonspecific amplification will not be detected. That is only amplificatoare products containing the sequence complementary to the specified probe, detected by the presence of a fluorescent signal, resulting in the elimination of certain items identified in this analysis as a false positive. In addition, to limit the amplification introduced transcription products can be used with one or more other enzymes.

This type of quantitative PCR allows normalization for making mistakes and volume changes, which can be done by dividing the fluorescence intensity of the reporter the Oh molecules on the intensity of the passive standard, contained in each reaction mixture, to determine the normalized reporter signal for each individual reaction. To estimate the increase in fluorescence intensity from cycle to cycle and comparing these data with those standards in order to determine the number of original copies for conducting absolute quantitative evaluation or comparison of these data with data from other unknown samples for relative quantitative evaluation can be used in a computer program.

In particular, it was found that the PCR reaction in real time using TaqMan conducted in accordance with the present invention, is suitable for the characteristics of the polyclonal cell line. Thus, when using such PCR to cell lines expressing polyclonal antibody, this method allows quantification of the relative content of the sequences encoding the individual antibodies as unique TaqMan probe may be designed for the heavy chain and/or light chain of each member represented in the polyclonal cell line. For designing TaqMan probe preferably select one of the CDR regions, CDR1, CDR2 or CDR3. It is most preferable to design the TaqMan probe is chosen region CDR3. Examples of TaqMan probes, sconst wirowanych based on the CDR3 of the variable region of the heavy chain, can be found in the publication Rassmussen, T et al., 2000, Exp. Hematol. 28, 1039-1045, which is introduced in the present description by reference.

Sequencing of nucleic acids

Sequencing of nucleic acids is a well-known method that can be applied in the present invention for qualitative assessment of the variability of the polyclonal cell line producer. Such sequencing can be carried out on individual cells, derived from a polyclonal cell lines by cloning of a single cell, or it can be carried out on the raw sample, variants, cells derived from a polyclonal cell line producer.

Sequencing at the level of a single cell provides data about the relative number of cells in the cell line-producer, which produces a separate member of the polyclonal protein. In this procedure, a sample of the polyclonal cell line producer get the desired period of time, and cells containing the sequence encoding characterized polyclonal protein is subjected to cloning at the level of single cells, for example by limiting dilution or by cell sorting device, such as a FACS Aria. The number of individual cells, which must be obtained from the sample polyclonal cell line depends on diversity is posledovatelnostei, presumed to be present in the indicated cell lines. While it is preferable that the number of separate coding sequences in the beginning of the cycle of generation of the cell line at least 3 times the number of sequences into one sorted cell and to the possibility of their full rediscovery in the test sample was 95%. Thus, when generating cell lines used library from 25 different coding sequences for sequencing of this sample should be obtained at least 75 individual cell clones, provided that 25 other sequences represented in equal numbers. This is to ensure that most of the individual coding sequences presented in this polyclonal cell line, are among the individual cell clones, if they were not lost in the process of production. These single cells are cultivated until confluently in separate holes, and aliquots taken from each of the wells used in the sequencing reactions of nucleic acid as the matrix. Sequencing can be carried out at the level of mRNA or genomic level using reaction RT-PCR or in the stage PCR amplification, respectively, which is carried out before seque is the key. Sequence data obtained at the level of mRNA or genomic level, allow us to determine the percentage of cells that produce each of the individual antibodies components. In addition, sequence data obtained at the level of mRNA can be used to assess the level of expression of each individual antibody present in this polyclonal composition. In addition to sequencing to obtain data on the potential level of expression of a single cell clone can be carried out PCR using TaqMan real-time on the mRNA level. RFLP and T-RFLP analyses, described above, can be similarly carried out at the level of a single cell.

Sequencing reprezentirovannoe sample variants of cells derived from a polyclonal cell line producer allows also to obtain data on the potential level of expression of the individual member of the polyclonal protein produced from this cell line, based on the relative level of mRNA coding sequences of individual members of the polyclonal protein. In this procedure, a sample of the polyclonal cell line producer receives at the right time. RT-PCR is carried out directly on lysed cells present in the sample. For the implementation of the RT-PCR reaction design nab the R primers, used in this PCR reaction, so that this set of primers guaranteed the expected amplification of all coding sequences with the same efficiency in the case where the sense and antisense primers hybridize to regions that are identical in all mRNAs (for example, it may be, but not necessarily, used sense primer 5'-noncoding region or sequence that encodes a signal peptide, and antisense primer in the sequence of the constant region). Amplificatoare PCR fragments clone in sequenase vector and transferred into a cell of the host, preferably in theE. coli. Plasmid DNA from single colonies, representing individual coding sequences originating from the polyclonal cell line producer is sequenced, and the content of the received individual coding sequences will depend on the level of mRNA of each coding sequence in this polyclonal cell lines, as well as from the potential level of expression of individual members of a protein.

In another embodiment of the present invention described above, the genetic tests are applied as separate analyses. One or more of these tests are preferably carried out on the aliquot taken from the same about what Azza, in order to obtain, if possible, as much information as possible about the clonal diversity of this cell line. Alternative these genetic tests can be combined in a multivariate analysis, for example, after this analysis can be conducted analyses of micromission on RFLP - or T-RFLP-fragments or RFLP fragments can be sequenced after conducting RFLP assays. In particular, it may be preferable to carry out sequencing RFLP fragments that represent more than one separate component and which cannot be separated because of the identity of the sizes of restriction fragments.

Methods characteristics of proteins to assess polyclonality

In embodiments of the present invention monitor polyclonality pool homologous proteins or expression system for the production of homologous proteins through one or more characteristics of proteins. The term “method of characterizing protein” means any method, which separately or in combination with other methods allows to obtain information about the presence and relative number of individual members of a mixture of monoclonal proteins or recombinant polyclonal protein in solution or on the surface of cells present in the polyclonal cell line. In the head of the dependence on the complexity of the composition of the recombinant polyclonal protein can be applied to one or more of the following ways: (i) methods of chromatographic separation, (ii) analysis of proteolytic hydrolysates polyclonal protein to identify a unique marker peptide representing individual members of the polyclonal protein, (iii) “three-dimensional” N-terminal sequencing, and (iv) analysis using specific detector molecules, for example, to characterize protein-indicators that are components of the polyclonal protein.

Sample containing different homologous proteins, may be a mixture of purified monoclonal proteins or polyclonal protein. Polyclonal protein can be, for example, obtained from the supernatant of cell culture, isolated from a polyclonal cell culture, for example, in the form of raw supernatant, which was only separated from the cells, for example, by centrifugation, or supernatants that have been purified, for example, by affinity purification on protein And, thus, or gel filtration. However, these stage pre-treatment are not part of the method of characterizing a recombinant polyclonal protein, as they do not provide any separation of different homologous proteins in this composition. Preferably, the sample is subjected to characteristic in accordance with the present invention, was subjected to at least one stage of cleaning. Most preferred the equipment are samples, containing homologous proteins, peeled 90%, 95% or 99%.

Samples obtained from the same polyclonal cell culture, may be subject to monitoring on different homologous proteins, members of the polyclonal protein at different time points during cultivation, and thereby monitoring the relative content of individual members of the polyclonal protein for one production cycle to assess the compositional stability of this polyclonal protein. Alternatively, samples obtained from different polyclonal cell cultures, may be subject to monitoring on different homologous proteins, members of a polyclonal protein, in a given time, and therefore can be monitored relative content of individual coding sequences in various parties to assess the constancy of composition of different batches of product.

Methods chromatographic separation

Chromatographic separation of individual members of the polyclonal protein can be based on differences in their physico-chemical properties, such as (i) the total charge (for example, when ion-exchange chromatography (ZIOC)), (ii) hydrophobicity (for example, when reverse-phase chromatography (RP-HPLC) and hydrophobic chromatography carried out using Chennai the salt concentration (GFH)), (iii) isoelectric point (value of PI)(for example, when chromatofocusing) or (iv) affinity (for example, by affinity chromatography using antiidiotypic peptides/antibodies or by chromatography on L-protein for the separation of light chains Kappa and lambda antibodies). The fifth well-known chromatographic method based on a physico-chemical property, such as size. However, this method is not suitable for the characteristics of homologous proteins, such as a polyclonal antibody or polyclonal R, because all their members are mostly the same size. The split size can be completely excluded from the described method of characteristics. Some of the above chromatographic methods were used for isolation of immunoglobulin classes such as IgA, IgG and IgM (P. Gallo et al., 1987, J. Chromatogr. 416, 53-62) or such subclasses as IgG1, IgG2, IgG3 (O. Scharf et al., 2001, J. Virol. 75, 6558-6565) from human serum. However, the separation on the basis of diversity of individual antibodies isolated from the serum immunoglobulin or recombinant polyclonal antibody have never been implemented.

a)Ion-exchange chromatography

In the variants according to the invention for the separation of individual members of a recombinant polyclonal protein or subpopulations of individual members of the polyclonal protein PR is changing ion-exchange chromatography. Separation using ion-exchange chromatography carried out on the basis of the total charge separate proteins shared composition. Depending on the values of PI of the recombinant polyclonal protein, pH values and salt concentrations in the selected column buffer, individual members of the recombinant polyclonal protein can be separated, at least to some extent, using either anion exchange or cation-exchange chromatography. For example, all individual members of the recombinant polyclonal protein are usually associated with a negatively charged cation-exchange medium, provided the pH is significantly below the lowest value PI of the individual members of the composition of the recombinant polyclonal protein. Individual members associated recombinant polyclonal protein can then be suirvey with columns, depending on the total charge of individual proteins using, typically, the increasing gradient of salt (e.g. sodium chloride) or increasing pH. In the process of elution can be obtained several factions. One fraction preferably contains a separate member of the polyclonal protein, but it may also contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more individual members of the polyclonal protein. General principles of cationic and anionic exchange well-known work, istam, and columns for ion exchange chromatography are commercially available.

b)Chromatofocusing

In other embodiments according to the invention for the separation of individual members of a recombinant polyclonal protein or subpopulations of individual members of the polyclonal protein used chromatofocusing. Separation by chromatofocusing based on the differences in the PI values of individual proteins and is carried out using column buffer which has a pH value exceeding the value PI of the recombinant polyclonal protein. Recombinant polyclonal protein, some members of which have a relatively low value of PI will be connected with a relatively weakly charged anion-exchange environment. Individual members associated recombinant polyclonal protein can then be suirvey with a column depending on the value PI of the individual members by creating a decreasing pH gradient in the column using polybuffer obtained so that the interval of pH values covered interval values PI of the individual members. In the process of elution get several factions. One fraction preferably contains a separate member of the polyclonal protein, but it may also contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more other members of the polyclonal protein. General principles chromatofocusing what I'm using-exchangers are well known in the art, and columns for anion exchange chromatography are commercially available. Chromatofocusing using kationoobmennikom also well known in the art (see publication Kang X. & Frey D.D. 2003, J. Chromatogr. 991, 117-128, which is introduced in the present description by reference).

(C)Hydrophobic interactive chromatography

In other embodiments of the present invention for the separation of individual members of a recombinant polyclonal protein or subpopulations of individual members of the polyclonal protein is used hydrophobic interactive chromatography. Separation using hydrophobic chromatography is based on differences in hydrophobicity of the individual proteins in the partial composition. Recombinante produced polyclonal protein is associated with the chromatographic medium, the modified hydrophobic ligand in the buffer, which favors hydrophobic interactions. This is usually accomplished in a buffer containing a low percentage of organic solvent (RP-HPLC), or in buffer containing high concentration of salt selected (GFH). Individual members associated recombinant polyclonal protein will then buyouts with columns, depending on the hydrophobicity of the individual members, usually in an increasing gradient of organic solvent (RP-HPLC) or in sysaudits is the gradient of the selected salt (GFH). In the process of elution can be obtained several factions. One fraction preferably contains a separate member of the polyclonal protein, but it may also contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more other members of the polyclonal protein. General principles hydrophobic chromatography is well known to specialists, and columns for RP-HPLC, and GFH are commercially available.

d)Affinity chromatography

In other embodiments of the present invention for the separation of individual members of a recombinant polyclonal protein or subpopulations of individual members of the polyclonal protein is used affinity chromatography. Separation using affinity chromatography based on differences in affinity towards a specific detection molecule, ligand or protein. The detector molecule, ligand or protein or more of these molecules (hereinafter all these options will be called one by the term “ligand”) immobilized on the chromatographic medium and on the affinity column put a recombinant polyclonal protein under conditions conducive to the interaction between individual members and the immobilized ligand. Proteins, not finding affinity to the immobilized ligand, going in the flowing column, and proteins with affinity to the immobilized ligand, then elute from the column in the circumstances, which do not favor the binding (for example, at low pH, high salt concentration or high concentration of ligand). In the process of elution can be obtained several factions. One fraction preferably contains a separate member of the polyclonal protein, but it may also contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more other members of the polyclonal protein. Ligands that can be used to characterize the recombinant polyclonal protein are, for example, antigens of the target, antiidiotypic molecules or L protein to separate antibody light chain Kappa or lambda.

Affinity chromatography with antigens on target is particularly suitable in the case when the recombinant polyclonal protein has an affinity to more than one epitope. Such a target can be, for example, a cancer cell or a virus, or a combination of targets containing multiple epitopes. These epitopes can be synthesized artificially and can be immobilized on the chromatographic medium. Can be developed by analysis with a single epitope on a column or multiple different epitopes on the column, which allows for the characterization of mixtures of recombinant polyclonal proteins from the point of view of the distribution of individual members in relation to specific epitopes. Alternatively, normalisations environment can be immobilized whole antigens or molecules of the target.

Affinity chromatography with antiadiotipiceskih molecules (for example, antiadiotipiceskih peptides or antiadiotipiceskih antibodies)that specifically associated with the individual members of the polyclonal protein or subpopulation of such individuals, may be carried out to obtain information about the relative number of selected member of the recombinant polyclonal protein (also called protein-indicator) or subpopulations of its individual members. In the ideal case, each individual antiidiotypic molecule specifically binds to only one individual member and not associated with other members of the recombinant polyclonal protein, although the present invention is also used antiidiotypic molecule that binds to a specific subpopulation of these members. While it is preferable that antiidiotypic molecules were developed for all individual members, in order to characterize an entire polyclonal composition. If the specified recombinant polyclonal protein is a polyclonal antibody or R, antiidiotypic molecules directed against the antigen-specific part of the sequence of the antibody or T-cell receptor. Antiidiotypic molecules can be immobilized on chromatogr the specific environment separately, so that one column contained one antiidiotypic molecule that allows you to get information about a specific member of the protein or subpopulations such proteins. Then, an output stream can be fed to the second column with the second immobilized antiidiotypic molecule, etc. alternatively, several different antiidiotypic molecules immobilized on the same chromatographic medium, applied to the column. Then carry out elution under conditions that allow individual proteins to buyouts in different fractions, for example, by adding increasing amounts of free idiotypical molecules in the column or use the corresponding gradient of pH or salt. This method allows you to receive content data of several members of the polyclonal protein by conducting univariate analysis.

If the specified recombinant polyclonal protein is a polyclonal antibody, it may consist of separate members that contain either the light chain Kappa or light chain lambda. Antibody light chain lambda contained in this polyclonal antibody can be separated from the antibody light chain Kappa due to the absence of the antibody with a light chain lambda affinity for L-protein. Thus, the subpopulation members of this antibody containing light chain lambda,can be separated from the subpopulation members antibodies containing light chain Kappa, using affinity chromatography on L-protein. Subpopulations of antibodies to Kappa and lambda can be then further characterized alternative chromatographic methods for the quantitative evaluation of specific antibodies, for example, as described above.

Multidimensional chromatography

Depending on the number of different variants of homologous proteins in the analyzed sample, for example, in recombinant polyclonal protein, it may be desirable to combine the two or more chromatographic methods described above in paragraphs (a)to(d), two-dimensional, three-dimensional or multidimensional format. All of these formats instead of two-dimensional gel electrophoresis, it is preferable to use liquid chromatography. However, this does not preclude the use of gel electrophoresis or precipitation in one or more formats of the characteristics of the recombinant polyclonal protein.

Liquid two-dimensional chromatography is described, for example, in the publication, D.M. Lubman et al., 2002, J. Chromatogr. B. Analyt. Technol. Biomed. Life Sci. 782, 183-196; WO 01/58925 and in WO 01/58926. This method was used to compare the expression level of the protein in normal cells and in cancer cells, thereby generating differential display at the protein level. In addition, in WO 03/102539 was described three-dimensional chromatograph is I, where the third parameter is the size, and which was used for separation of proteins, for example, in cell extracts, and thereby, to generate a differential display.

In other embodiments of the present invention multidimensional chromatography is used to describe different homologous proteins in the sample. In particular, using multidimensional chromatography can be characterized samples of homologous proteins having different variable regions, such as antibodies and T-cell receptors. Preferably an additional characteristic is performed on the fractions collected during elution in previous formats. However, the output stream can also be used for subsequent analysis by other parameters. This is especially preferred if such previous format is affinity chromatography.

In one embodiment of the present invention for separation of antibody molecules by their variability either polyclonal antibodies (serum immunoglobulin or recombinant antibody)or of a mixture of monoclonal antibodies used multidimensional chromatography. Preferred multidimensional chromatography is liquid chromatography.

In another embodiment of the present invention mmogamer the Yu chromatography is used to separate molecules of T-cell receptor on their variability or of polyclonal T-cell receptor, or of a mixture of monoclonal T-cell receptors. Preferred multidimensional chromatography is liquid chromatography.

In General, an attempt was made to use chromatographic methods based on different physico-chemical properties, in various embodiments, multidimensional chromatography, for example, the division in charge in the first embodiment, the separation by hydrophobicity in the second variant, and split by affinity in the third embodiment. However, some chromatographic methods can give more separation in their application in the following ways, even if they are based on similar physical-chemical properties of the protein. For example, the separation can be achieved if after chromatofocusing conduct ion exchange chromatography or subsequent affinity chromatography with various ligands.

Table 1 presents five cases in which chromatographic methods can be applied as part of the method features of the present invention. However, the number of cases should not be regarded as mandatory. When splitting, which turned out to be sufficient to characterize the recombinant polyclonal protein and which was reached after conducting one-dimensional, two-dimensional, three-dimensional iliketrains chromatography chromatography, of which the following may be omitted. Therefore, if the separation is achieved using ion-exchange chromatography (ZIOC)is a sufficient, not necessary to make chromatofocusing, RP-HPLC, etc. on the other hand, if the conduct of five-dimensional separation was insufficient, there may be an additional division of the next order. In addition, table 1 should not be construed as an exhaustive list of the possible combinations of chromatographic methods, or as an exhaustive list of these methods.

In preferred embodiments of the present invention specified multidimensional liquid chromatography (LC) is a two-dimensional LC, selected from the first two options listed in table 1.

In other preferred embodiments of the present invention specified multidimensional liquid chromatography (LC) is a three-dimensional LC, selected from the first three options listed in table 1.

Alternatively, multidimensional LC to characterize the recombinant polyclonal protein can be used immunoprecipitate in combination with a suitable electrophoresis method such as gel electrophoresis or capillary electrophoresis with subsequent quantification of antigens. This method assetstore suitable for the characterization of recombinant polyclonal antibodies, directed against a complex antigen. Recombinant polyclonal antibody directed against, for example, integrated viral antigen, can be subjected to thus using a labeled mixture of antigens and spheres with protein A. Then such antigens can be separated using isoelectric focusing and two-dimensional electrophoresis with LTO-SDS page, followed by a quantitative assessment of individual antigens, allowing to measure the amount of antibodies in a recombinant polyclonal antibody directed against specific antigens.

Elimination of heterogeneity of the N-terminal charge in recombinant proteins

Methods characteristics of the proteins described above, the heterogeneity of individual protein in a pool of homologous proteins can further complicate the description, since one protein can give several peaks, for example, in ZIOC profile. Heterogeneity in antibodies and other recombinant proteins is a common phenomenon, which is due to enzymatic or non-enzymatic post-translational modifications. These modifications can lead to heterogeneity of size or charge. Standard post-translational modifications are N-glycosylation, oxidation of methionine, proteolytic fragmentation and desametasone. Heterogeneity can be also caused by the modification at the genetic level, such as mutations introduced during transfection (J.R. Harris et al., 1993, Biotechnology 11, 1293-7) and crossover event occurs between the genes for the variable regions of the heavy and light chains in the process of transcription (Wan, M. et al., 1999, Biotechnol. Bioeng. 62, 485-8). These modifications are epigene and cannot be predicted on the basis of the genetic structure of individual design.

Some of these post-translational modifications, which can lead to heterogeneity can be solved before the performance. The change of the charge resulting from the enzymatic removal of the C-terminal lysine, can be prevented with the use of specific inhibitors of carboxypeptidase or treatment of antibody-carboxypeptidase to simplify the overall procedure specifications (M. Perkins et al., Pharm. Res. 17, 1110-7). Resizing caused by differences in the nature of glycosylation can also be prevented by carrying out enzymatic deglycosylation using, for example, Praz F, endo-H, O-glycosidase or neuraminidase.

It was shown that the chemical degradation of proteins, such as desametasone in the process of obtaining and storing protein, is associated with serious problems and can lead to heterogeneity of charge. Desametasone Asn with the formation of Asp and ISO-Asp (isopentyl-peptide bonds) going on the t in mild conditions (D.W. Aswad et al. 2000, J. Pharm. Biomed. Anal. 21, 1129-36). Such rearrangements occur most often in the sequence Asn-Gly, Asn, Ser and Asp-Gly, where there is a high degree of local flexibility of polypeptide chain.

Another reason for the heterogeneity of the charge may be N-terminal blocking pyroglutamic acid (PyroGlu), resulting from cyclization of N-terminal glutamine residues (desametasone). Such post-translational modifications have been described for IgG and other proteins. Partial cyclization of N-terminal sequence of the antibody, especially if it affects the national Assembly and line with an may lead to heterogeneity of charge and give a complex profile of IOC. Potential profiles ZIOC, resulting from the formation of N-terminal PyroGlu on one or more chains of VH and VL of the antibody presented on Fig. If a sample containing different homologous proteins having different variable regions, such as recombinant polyclonal antibody, characterized methods, based on the total charge, it is obvious that such an analysis would be difficult, even if several components of this sample have ZIOC profiles shown in figv and, as in this case will be masked clonal diversity in ZIOC profile, for example, the composition of polyclonal antibodies. This problem cannot be solved with the use of the cation-specific enzyme Pyroglutamate-amino peptidases, first, because the lock is held on the restored and alkyl antibodies in order to obtain high outputs released antibodies (Mozdzanowski, J. et al., 1998 Anal. Biochem. 260, 183-7) is incompatible with subsequent ioch-analysis, and secondly, because it is impossible to achieve 100%cleavage of all antibodies.

Therefore in another aspect the present invention relates to a method for eliminating the charge heterogeneity caused by cyclization of N-terminal glutamine residues. This aspect of the present invention is particularly preferred, if the cyclization is carried out in combination with any of the previously described methods of characteristics, based on a physico-chemical property, as the total charge, for example, in combination with ion exchange chromatography and chromatofocusing. To prevent the formation of N-terminal residues PyroGlu can only be guaranteed if the polypeptide chain does not contain N-terminal glutamine, for example, by replacing the indicated N-terminal glutamine residue by another amino acid. If the specified protein is heteromeric protein consisting of different subunits, preferably, all of the N-terminal Gln residues were replaced by other residues. The antibodies Gln residues substituted at the N-Terminus of the heavy chain and/or light chain. This achieves what I'm using site-directed mutagenesis of nucleic acid sequences, encoding polypeptides with N-terminal glutamine. While it is preferable that the N-terminal glutamic residues were replaced by glutamic acid residues, since glutamic acid is uncharged derivative of glutamine. In recombinant polyclonal protein a separate sequences encoding these members must be replaced and again incorporated in the expression vector to generate a new cell line expressing a modified protein. Then, this cell line can be included in the set of cells that produce the polyclonal protein.

Analysis of the proteolytic cleavage of the variable regions of homologous proteins

The protein sample containing different homologous proteins having different variable regions can be characterized, as described above, based on the physico-chemical properties of intact proteins using various chromatographic methods. Data obtained from the above analyses can be supplemented with data obtained from analysis of the proteolytic cleavage of homologous proteins. Proteolytic cleavage is preferably carried out on the aliquot of the same sample that was used in the chromatographic analysis of intact proteins.

In other embodiments of the present invention identification, the Yu unique marker peptides derived from the variable regions of the individual members of the composition of homologous proteins used for the qualitative characteristics of the composition of proteins in the presence of individual members of this composition. These unique marker peptides produced by proteolytic cleavage of the protein composition (sample)containing(his) different homologous proteins.

To implement peptide mapping variable regions of a mixture of homologous proteins, it is important that the part or parts of the variable regions, which allow to distinguish the individual members of this mixture from the other members remained intact after such proteolytic cleavage. Therefore, one or more proteases must be chosen so that for each individual member of the recombinant polyclonal protein could be obtained, at least one unique sequence, also called a marker peptide. If a mixture of homologous protein is a recombinant polyclonal antibody or a recombinant polyclonal R, sequences that allow to distinguish the individual members of this mixture from the other members, usually characterized by regions CDR. The choice of proteases or chemical compounds used for producing unique marker peptides, carried out on the basis of and is Aliza protein sequences, the components of the sample homologous protein. Typically, these protease or chemical compounds should cleave the protein at specific sites with high specificity. Such protease proteolytic specificity are well known in the art, and examples of such proteases may serve as trypsin, endo-Glu-C, leilajapanese, endo-Arg -, endo-Asp-N or endo-Asn-C. These proteases are given only as examples and should not be construed as a limitation of this variant of the invention.

If the sample polyclonal protein break down one or more selected proteases, can be obtained from a pool of peptides originating from both the constant and variable regions of all individual members of this protein. Part of the unique marker peptides according to their physico-chemical properties will be different from the main population of peptides, derived from constant regions. Therefore, a unique marker peptides may be selected using one of the above chromatographic methods. To allocate unique peptides from the main fraction of peptides constant region, it is preferable to use ion-exchange chromatography or RP-HPLC, specially designed for the separation of peptides. In a similar way to separate the unique marker peptides can also be applied to methods m is gomeroi chromatography described above. After the separation of one or more parameters to identify different peptides can be applied mass spectrometry (MS). MS methods known to experts in the field of proteomics can be used to identify peptides. Preferred MS methods is the matrix UV-laser desorption/ionizing (MALDI), time-of-flight (TOF) mass spectrometry and time-of-flight mass spectrometry with ionization by elektrorazpredelenie (ESI-TOF).

Alternative proteolytic cleavage can be carried out on intact proteins separated by one-dimensional or multidimensional chromatography described above in paragraphs (a)to(d) and in section “Multidimensional liquid chromatography, with subsequent proteolytic cleavage of the selected protein fractions. These hydrolysates can then be analyzed using MS (Kachman M.T. et al., 2002, Anal. Chem. 74, 1779-1791). This method may be preferred for the characterization of very complex polyclonal protein, because he can be selective with respect to the part of the fractions obtained by univariate or multivariate analysis of intact proteins, carried out for their additional features.

This may be effected by an additional proteolytic cleavage to highlight the N-terminal marker, pepti is s, if they contain a unique variable regions. N-terminal peptides can be isolated essentially as described in the publication Gevaert K. et al., 2003. Nat. Biotechnol. 21, 566-569, which is introduced in the present description by reference. Briefly, the free amino group in the recombinant polyclonal protein block, for example, by acetylation, and then the mixture of proteins were cleaved with a suitable protease. As a result of this splitting is formed of a free N-terminal amino group on the internal peptides, which then block the connection, allowing to separate the internal peptides from the N-terminal peptides. Such compounds may be (i) 2,4,6-trinitrobenzenesulfonic acid (TNBS)as described Gevaert, which can be used for separation by hydrophobic interactions, (ii) Biotin, which is then removed after its binding to the immobilized streptavidin, or (iii) pre-activated matrix (for example, NHS-activated matrix, CNBr-activated matrix, ECH-sepharose or bis-acrylamide media UltraLink with azlactone groups), which is then centrifuged to separate the associated internal peptides from the acetylated N-terminal peptides present in the supernatant. Selected acetylated N-terminal peptides can then be analyzed using a one-dimensional is whether multimeric liquid chromatography, held in conjunction with MS analysis, as described above. Alternative N-ends of intact peptides block the connection, allowing their specific division, and internal peptides formed after cleavage, acetimidoyl or block the second connection.

In addition, the identification of a unique marker peptides after proteolytic cleavage can be carried out using the characteristic functional groups of the side chain of amino acids. This may be applied(a) one method or combination of methods, based on the difference in the affinity and including the capture of peptides containing specific amino acid residues with relevant modifications of the side chain of amino acid residues or without such modifications. Peptides containing, for example, cysteine, methionine, tryptophan, histidine and tyrosine, can be purified using a column of material or immobilized areas with specific affinity labels that capture peptides, containing mentioned amino acid residues (Bernhard O.K. et al. 2003, Proteomics 3, 139-146; D. Chelius & T.A. Shaler, 2003. Bioconjug. Chem. 14, 205-211; Gevaert K. et al. 2002. Mol. Cell Proteomics 1, 896-903; S.P. Gygi et al., 1999. Nat. Biotechnol. 17, 994-999). Unique peptides variable region containing cysteine and tyrosine, can be, for example, immobilized on a column with streptavidin after Biotin is investing cysteine residue with subsequent elution cysteine-containing peptides which can be applied either on the column or on areas that are specifically associated with tyrosinemia remains. Such capture of peptides based on the affinity to specific amino acid residues, can be implemented as an additional method to the previously described chromatographic methods such as RP-HPLC and ion exchange chromatography. First proteolytic hydrolysate recombinant polyclonal protein is subjected to chromatography on one or more parameters, and then in the final stage carry out specific capture of amino acids at one or more fractions with subsequent analysis using MC. Selection of peptides based on the functional groups of the side chains may be optionally carried out in combination with the method of selection of the N-terminal peptide.

If the recombinant polyclonal protein, analyzed by proteolytic cleavage followed by separation of the peptide, is a multimeric protein, to facilitate the analysis of proteolytic hydrolysate method “fingerprints”, the separation of the subunits preferably before proteolysis. This can be accomplished, for example, by restoring and alkylation of free cysteine residues, followed by gel-filtration to separate subunits, n is an example of the separation of heavy chains light chains or alpha-chains from the beta-chains, if polyclonal protein is an antibody or R respectively. Alternative proteolytic cleavage can be carried out in natural conditions. This splitting is especially suitable alternative to antibodies, because the Quaternary structure of antibodies is the reason for their high resistance to proteolytic cleavage in the constant regions. Thus, proteolytic cleavage of intact unrestored polyclonal antibodies can also be implemented to generate peptides, mainly from variable regions.

The above-described method of proteolytic hydrolysis can also be applied in accordance with the concept of indicator proteins by a selection indicator peptides, which can be characterized in proteolytic hydrolysate.

“Bulk” N-terminal sequencing

As described above, the N-terminal sequence may be selected and used for analysis of proteolytic hydrolysate polyclonal protein by the method of “fingerprints”. Alternatively, the N-terminal sequence can be sequenced directly from the intact protein, without conducting hydrolysis step. “Three-dimensional” analysis of N-terminal sequence in the protein sample containing different homologous proteins, and Elsie variable regions, can be used for comparison of treated products of this party, for example, recombinant polyclonal protein. If polyclonal protein is a recombinant polyclonal antibody or R, “bulk” N-terminal sequencing preferably takes place in a pool of separated heavy and light chains or separated alpha and beta chains, respectively. For example, in a pool of homologous heavy chains of the amino acids in certain positions can be fully conservative, whereas in other positions they can vary, and this can be determined by comparing the amino acid sequences by aligning them. Thus, several different amino acids can be obtained during separate rounds of sequencing. For example, in the 4-position polyclonal sample can be five different amino acids, as previously determined by comparison of homologous sequences. In the process of analysis by volume sequencing N-terminal sequence of these varying amino acids can be quantified, and different amounts of individual amino acids, for example, in position 4 of recombinant polyclonal antibodies, can be used to compare the relative composition of R is slichnih samples.

Characterization of complex mixtures of homologous proteins using specific detector molecules

In the way of features according to the invention also apply specific detector molecules, each of which is able to identify a specific member of the protein in a complex mixture of homologous proteins, thereby, allows to monitor the presence of this particular member in the sample. Such specific detector molecules can be, for example, specific ligands, such as small organic molecules, peptides or proteins having specificity to an individual member of the polyclonal protein. Particularly preferred variants of the present invention are peptides or protein ligands, such as antiidiotypic peptides or antiidiotypic antibodies. The present invention also uses a detector molecule that binds to a specific subpopulation of a complex mixture of homologous proteins.

Specific detector molecules can be used to characterize complex mixtures of homologous proteins because (i) they allow to determine the concentration or relative amount of one or more individual proteins in a sample containing a complex mixture of homologous proteins; (ii) they serve as updat the additional parameter to measure in chromatographic analyses; (iii) they allow to determine the concentration of individual proteins in the samples obtained in the fermentation process of a complex mixture of homologous proteins; (iv) they allow to detect cells producing separate protein polyclonal cell lines, such as the job Bank, cell or sample of cells in the bioreactor, and expressing a mixture of homologous proteins. Stage (iv) can be carried out either polyclonal cell line, or on the individual cells, which were attributed to the individual tubes of the polyclonal cell line with their subsequent cultivation.

For producing specific peptide ligands that are able to identify individual members of a protein in a complex mixture of homologous proteins can be affinity skanirovaniya extensive library of expression vectors derived from filamentous phages representing alien oligomeric peptides on the surface of the virion, followed by purification of phages, which are alien peptide to bind to the antibody R or other desired by an individual member of a given protein (Scott & Smith, 1990, Science 249, 386-90). In EP 1106626 specifically described the generation of peptides able to bind with anti-RhD antibodies and used for immunization. Presents peptide libraries have a length of from about 5 to 50 amino acids, is preferably from 7 to 20 amino acids, even more preferably from 8 to 15 amino acids, and most preferably from 9 to 12 amino acids. If you have identified relevant peptides, they can be synthesized.

Generating antiidiotypic antibodies essentially known in the art. Briefly, mice are subjected to immunization antibody against whom need antiidiotypic antibodies. After generating monoclonal antibodies from immunogenic mice their sceneroot on producing antiidiotypic antibodies with the desired specificity, for example, the hybridoma method or by the method of phage view. Antiidiotypic peptides or antiidiotypic antibodies should be characterized in terms of their specificity and potential cross-reactivity. This analysis allows us to confirm that recognizes whether antiidiotypic peptide or antiidiotypic antibody specific member or, alternatively, a subpopulation of closely related members of the polyclonal protein (antibodies related members can be, for example, a family of specific genes VH).

Antiidiotypic peptides/antibodies can be used in immunodetection assays, such as ELISA, FLISA, or RIA used for direct quantitative evaluation of individual members of the protein (for example, specific antibodies or specific R). And iterative antiidiotypic peptides/antibodies can be used in affinity chromatography or separately, either as a first or additional option after other chromatographic separations described above. Immunoprecipitate is an optional procedure, in which the detector molecule can be used to separate and characteristics of individual members of the polyclonal protein. In addition, antiidiotypic peptide or antiidiotypic antibody can be used to select and/or identify cells that produce an individual protein in a polyclonal cell line. The methods described in the publications Borth N. et al., 2000-2001., Biotechnol. Bioeng. 71, 266-273 and Brezinsky, S.C. et al., 2003, J. Immunol. Methods 277, 141-155, are used to highlight cells that produce separate the protein from cell culture.

In principle, for the full features, you can produce specific detector molecules for each and every individual member of the polyclonal protein. However, in accordance with the present invention for monitoring the stability of the expression or composition of the various parties is sufficient to identify the number of individual members, the so-called protein-indicators, recombinant polyclonal protein for quantitative and/or qualitative characteristics conducted to ensure that the aggregate of individual members of the protein will be expressed at the same level and prists who participate in its pure form in various parties recombinante produced polyclonal protein. This approach can be, in particular, used to facilitate the complex characteristics of the pool of protein molecules. The concept of protein-indicators as representatives of the recombinant polyclonal protein can be applied not only for a specific detector molecules, and in fact this concept proteins indicators or peptides may be used in any of the methods previously described characteristics or combinations thereof. In addition, proteins indicators may vary in different methods. Some specific members of the polyclonal protein can be, in particular, are separated based on differences in their physico-chemical properties, however, for the separation of proteins with identical physicochemical properties especially suitable are antiidiotypic peptides with high affinity.

In some embodiments of the present invention for monitoring the relative amount of one or more proteins detectors in samples containing different homologous proteins having different variable regions, using one or more specific detector molecules. A constant amount of one or more proteins indicators in a series of related samples will reflect the compositional stability of expression of the polyclonal protein in different parties, as well as throughout the straps production during one cycle. In addition, compositional stability can be evaluated during long-term storage of the recombinant polyclonal protein or a mixture of monoclonal proteins.

In preferred embodiments of the present invention proteins are indicators of the recombinant polyclonal protein is subjected to characteristic one or more of the following methods, such as (i) affinity chromatography on antiidiotypic the peptide/antibody; (ii) immunodetection using antiidiotypic peptides/antibodies; (iii) extraction by multidimensional chromatography of intact members on their specific physico-chemical properties, (iv) mapping of proteolytic peptides using chromatography and MS.

The composition of the mixture of different characterized homologous proteins

The sample is characterized in accordance with the method of the present invention contains a specific subpopulation of different homologous proteins having different variable regions, for example a polyclonal protein or antibody with various CDR regions (for example, a polyclonal antibody or a mixture of monoclonal antibodies or T-cell receptors with various CDR regions (e.g., polyclonal R or a mixture of monoclonal R). While it is preferable that the different homologous proteins having different vari is belinya region, were recombinant proteins. In addition, it is preferable that individual members of the polyclonal protein or a mixture of monoclonal proteins were identified by their common characteristics, such as the activity of binding to the desired target, for example, in the case of antibodies or R directed against the desired target antigen. Typically, polyclonal protein analyzed in accordance with the method of characteristics according to the invention is composed of at least, 3, 4, 5, 10, 20, 50, 100, 1000, 104, 105or 106the different members. Usually none of the various members is not more than 75% of the total number of other members in this composition polyclonal protein. Preferably none of the individual members does not exceed 50%, more preferably 25%, and most preferably 10% of the total number of individual members in the final polyclonal composition.

In the case of antibodies on the number of different members in the composition of the polyclonal protein, characterized in accordance with the method of the present invention, will affect the composition of the antigen(s)target(s). Small or not very complex targets, such as small protein target for the characteristics can be selected composition polyclonal proteins containing from 3 to 100 different individual members, and it is preferable that the number of these options does not exceed 90, or even 8 or 70. In many cases, the number of individual cases should not exceed 60 or 50, and it is preferable that the number of such options was in the range of 5 to 40, for example from 5 to 30. In contrast to more complex targets, such as viruses with complex or interchangeable surface proteins or targets, covering several viruses of subtypes can be carried out by the characteristic composition of the polyclonal protein, containing from 20 to 500 different members. For very complex targets, where the antigen contains many different molecules, in accordance with the present invention may have a characteristic composition of the polyclonal protein, containing from 50 to 10,000 different components.

In one embodiment of the present invention a sample containing different homologous proteins having different variable regions, is a polyclonal antibody. This polyclonal antibody can consist of one or more antibodies of different isotypes, such as human isotypes IgG1, IgG2, IgG3, IgG4, Da and Da, or murine isotypes IgG1, IgG2, IgG2b, IgG3 and IgA.

In one embodiment of the present invention a sample containing different homologous proteins having different variable regions, is polyclonal R.

Examples

In the following examples to illustrate the JV is soba structural features according to the invention were used in different compositions of recombinant polyclonal antibodies against RhD (anti-RhD rpAb), consisting of various individual anti-RhD antibody-components, or cell lines that produce anti-RhD rpAb. A separate anti-RhD-specific antibodies and cell lines producing these antibodies, consistent with these antibodies and cell lines described in the assigned patent application Denmark RA 2004 01133, filed July 20, 2004. Briefly, a combinatorial library of phage represent the variable regions of the heavy chain and light chain Kappa/lambda antibody was obtained from a negative rhesus factor D donors, immunogenic RhD-positive erythrocytes. This library was subjected to panning on clones producing specific anti-RhD antibody. Pairs of gene variable regions of the heavy and light chains derived from antigen-specific phages, was transferred into the expression vector mammal. These vectors mammals individually transferred into the cell line SLEEP Flp-In (Invitrogen, CA) site-specific method using recombination Flp-FRT. Nucleic acid sequence (nucleotides), and protein (amino acids) for full-length light chains (LC), and variable regions of the heavy chains (VH) identified by the number of identical sequences (SEQ ID), presented in table 2. These numbers correspond to the sequences SEQ ID nos given in perusta is certain International patent application PCT/D2005/000501, entitled “ANTI-RHESUS D RECOMBINANT POLYCLONAL ANTIBODY AND METHODS OF MANUFACTURE” and filed on July 18, 2005. Identification numbers (SEQ ID) in table 2 should differ from SEQ ID NO: this application because they are not identical. Constant region heavy chain corresponds to human IgG1.

Example 1

This example illustrates the generation of a polyclonal cell line producer and characteristic changes in various parties at the protein level using the chromatographic method of separation of one parameter and at the genetic level using RFLP analysis.

Obtaining cell lines producer to generate recombinant polyclonal antibodies against the RH factor D

We selected ten cell lines, each of which in the specific site of the genome expressed different from other recombinant antibody against rhesus factor D (RhD157.119D11, RhD158.11906, RhD159.11909, RhD161.11909, RhD163.11902, RhD190.119F05, RhD191.119E08, RhD192.119G06, RhD197.127A08 and RhD204.12803), and these cell lines were mixed to obtain a cell line producing recombinant polyclonal antibody. RhD197 and RhD204 are clones lambda, and the rest are clones of the Kappa.

After cell culture expressing specific antibodies against the RH factor is ora, were fully adapted for cultivation in serum-free suspension culture in shaker flasks, they were mixed in equal cell ratio, which produced a polyclonal cell line Cho-Flp-In (019). The mixed cell culture was centrifuged and frozen in the aliquot of 10×106cells/tube.

Two tubes (3948 FW065 and 3949 FW065) was thawed and was separately cultured for 11 weeks in a 1000-ml shaker flasks containing 100 ml of serum-free medium Excell302 with neomycin.

The supernatant was collected and filtered, followed by purification of the anti-RhD rpAb.

Clonal diversity

Clonal diversity was analyzed at the protein level, but also at the level of mRNA. A sample of the supernatant used for analysis of the composition of the antibodies, were taken after culturing for 9 weeks, and the sample cells used for analysis of the composition of mRNA, were taken after culturing for 11 weeks.

Composition of antibodies:

Antibody rpAb against RhD expressed from a polyclonal cell line Cho-Flp-In (019), is an antibody isotype IgG1. Anti-RhD rpAb was isolated from both aliquot (3948 and 3949) on a column with immobilized protein A. the Individual antibodies interacted with immobilized protein And at pH 7.4, and impurity proteins were washed from the column. Then include the specific antibodies were suirable from the column at low pH (pH of 2.7). Fractions containing antibody were detected by measuring the optical density at 280 nm, were then combined and were dialyzed against 5 mm sodium acetate, pH 5.

The composition of the anti-RhD rpAb obtained from an aliquot 3948 and 3949 (FW065) after 9 weeks of cultivation, were analyzed using cation exchange chromatography. Anti-RhD rpAb, purified on protein A, was applied on the column PolyCatA of 4.6×100 mm) in 25 mm sodium acetate, 150 mm sodium chloride, pH 5.0, at a flow rate of 60 ml/h-1and at room temperature. Then antibodies components were suirable linear gradient 150-350 mm sodium chloride in 25 mm sodium acetate, pH 5.0, at a flow rate of 60 ml/h-1. Antibodies components were detected by spectrophotometer at 280 nm. Then built the chromatogram (figure 1), and to quantify the antibody components used area of individual peaks A-J (table 3). The total area of the peaks was taken as 100%. Chromatogram obtained from two aliquot was found identical to the distribution of the peaks, as well as similar concentrations of components in each peak. Based on these data we can conclude that the aliquots from the same polyclonal cell lines cultivated under identical conditions, has produced an anti-RhD rpAb with the same distribution of individual antibody-components.

Some members of the anti-RhD rpAb were attributed to one or not is how many specific peaks (the data are summarized in table 3). This assignment was made based on the chromatograms obtained for the individual antibodies analyzed in identical conditions. For Ab RhD158 was not obtained the individual chromatogram, and therefore this clone was not attributed to any of the peaks. However, it is assumed that RhD158, in all probability, refers to the peak D, but such an antibody can also be presented in some other peaks, due to its heterogeneity. In particular, the antibody derived from clone RhD197, found a high degree of heterogeneity in the ioch-profile. Ab RhD190 should be observed at the retention time of 15.3 minutes But it was not detected, which indicates that this clone was either lost or alternative he was producyrovtsa in recombinant polyclonal cell line-producer in the number of detected below the limit. Loss of clone RhD190 indicates a 10%decrease in diversity, which is considered acceptable in the final composition of the anti-RhD rpAb.

Table 3
PeakThe number 3948 (% area)The number 3949 (% area)The designation AbComments
And5,1 5,1RhD157This Ab is also present in the peak
Into 12.010,2RhD157
RhD159
RhD192
This peak represents at least three different Ab
5,25,3RhD191
D1,20,8(RhD158)Not actually assigned this peak, but he probably corresponds to this peak. RhD158 can also be represented in other peaks
E10,914.4VRhD204
F24,323,0RhD197
G13,612,5RhD197This clone is divided into several peaks, due to its heterogeneity
3,34,0RhD197
I14,013,7RhD161
J10,510,5RhD163
RhD190This Ab was not detected

Composition mRNA:

Clonal diversity in the polyclonal cell line Cho-Flp-In (019) after 11 weeks of cultivation was estimated using RFLP-analysis by RT-PCR. Briefly, cell suspension consisting of 200 cells were subjected to the procedure of freezing and thawing, and these lysates were used as template in RT-PCR performed using the set for one-step RT-PCR (Qiagen) using primers for amplification of the light chain. Used the primers had the following sequences:

Direct primer: 5'-TCTCTTCCGCATCGCTGTCT (SEQ ID NO:1)

Reverse primer: 5'-AGGAAAGGACAGTGGGAGTGGCAC (SEQ ID NO:2)

RT-PCR products hydrolyzed by the enzymeHinfI, analyzed by electrophoresis on AG is different gel and restriction product was visualized by staining ethidiumbromid (2)

The estimated size of the restriction fragments obtained byHinfI-hydrolysis of light chains, amplified using RT-PCR, are shown in table 4 for each individual clone. Six unique fragments on the gel, which can be attributed to individual members of the genes encoding polyclonal antibody against rhesus factor D, is shown in bold. Not all unique fragments could be identified on the gel, and these fragments are shown in italics. However, we cannot exclude that these clones are actually present in the culture, as these fragments may not be fully separated from other identifiable fragments, or alternatively, the concentration may be too small compared with the concentration of fragments corresponding to the brighter bands. This may be more typical of short fragments, because they are associated with fewer molecules ethidiumbromid, and are therefore less visible.

Table 4
RhD #157158159161163190 191192197204
The size of the HinfI fragment825671505696505502475671743521
138138320138166191268149138167
7612613812615413813813885138
76777613812685 767688
22767676

Two aliquots (3948 and 3949) from the same polyclonal cell lines were found similar profile of expression in the gel, although the intensity of these bands are not completely identical. This indicates that the aliquots from the same polyclonal cell lines cultivated under identical conditions, produce anti-RhD rpAb with the same clonal diversity.

Conclusions

Ten cell lines, each of which is expressed monoclonal anti-RhD antibody was mixed to generate cell lines that produce anti-RhD rpAb, and this cell line after cultivation for 9 weeks still retained 90% of its original clonal diversity. After 11 weeks of cultivation mRNA isolated from six different clones could be uniquely identified, and several other clones, probably present in the band of about 500 BP

The fact that two aliquo the s polyclonal cell lines Cho-Flp-In (019) found similar results in relation to clonal diversity, indicates that the various parties can be obtained with replicable results.

Example 2

This example illustrates the characterization of the polyclonal cell culture and eight members within a certain period of time. Clonal diversity of culture was evaluated at the genetic level using RFLP analysis and on the protein level using chromatography by separation on one parameter.

RFLP analysis for the assessment of clonal diversity in the polyclonal cell cultures

The distribution of individual clones in a polyclonal cell culture expressing eight different antibodies against rhesus factor D, was estimated using RFLP-terminal sequence analysis (T-RFLP)-PCR products derived from the polyclonal cell line. In the T-RFLP procedure, direct and/or reverse primers are fluorescently labeled, and therefore part of the restriction fragments generated from amplicons will contain the label. Labeled fragments can then be separated using capillary electrophoresis and detected by fluorescence intensity. Such analysis may be performed on the sequences encoding the light chain and the variable region of the heavy chain, depending on the primers used.

Briefly, cell suspension, status is asuu of 200 cells, once washed in PBS and subjected to the procedure of freezing and thawing, and the resulting lysate was used as template in RT-PCR amplification carried out using a set of one-step RT-PCR (Qiagen) and appropriate primers.

RT-PCR was performed in a standard thermoacetica as follows:

Reverse transcription: 55°C for 30 minutes

Denaturation: 95°C for 15 minutes

The initial round (35 cycles)

Denaturation: 95°C for 30 sec.

Annealing: 60°C for 30 sec.

Elongation: 72°C for 5 minutes

Final round:

Elongation: 72°C for 15 minutes

Final stage: always at 8°C

For the analysis of light chain using RT-PCR amplification used the following primers. The reverse primer was labeled 6-carboxyfluorescein (F), and these primers had the following sequences:

VL: Direct primer: 5'-TCTCTTCCGCATCGCTGTCT (SEQ ID NO:1)

CL: Reverse primer: 5'-AGGAAAGGACAGTGGGAGTGGCAC (SEQ ID NO:2).

20 ál of RT-PCR product hydrolyzed in 1 unit NheI, 1 unitPstI and 1 unitHinfI (all enzymes were supplied by New England Biolabs) in N1 within 2 hours.

Labeled fragments were detected using a fluorescent capillary electrophoresis on AU (Aplied Biosystems) at the State serum Institute, Copenhagen, Denmark (Statens Serum Institute, Copenhagen, DK).

The expected fragments for each cell clone, roguerouge anti-RhD antibody, are given in table 5, and F-labeled fragments are shown in bold.

Table 5
RhD #191196201203244306319324
The size of the NheI/ > PST /HinfI fragment475696516422690682761513
210138166318138138138166
13876138138767676138
7667767667676776
67597667415976
586718181767
18

T-RFLP profile is presented in figure 3, and all eight clones producing antibody against rhesus factor D, assigned to a specific peaks. If we assume that in the process of RT-PCR is not a competition matrix with primer, the relative peak area will correspond to the relative amount of mRNA transcribed from the gene light chain of each of the antibodies present in polyclonal cleoc the second line.

For the analysis of the variable regions of the heavy chain in the same polyclonal cell line was performed RT-PCR-amplification using VH-specific primers. These primers had the following sequences:

VH: Direct primer: 5'-F-CGTGCTCTTTTAAGAGGTG (SEQ ID NO:3)

VH: Reverse primer: 5'-NEH-ACCGATGGGCCCTTGGTGGA (SEQ ID NO:4).

20 ál of RT-PCR product hydrolyzed in 1 unitRsaI and 1 unitNdeI (all enzymes were supplied by New England Biolabs) in N2 within 2 hours.

Labeled fragments were detected using a fluorescent capillary electrophoresis on AV. The analysis was carried out at the State serum Institute, Copenhagen, Denmark (Statens Serum Institute, Copenhagen, DK).

The estimated T-RFLP profiles are presented in table 6, where F-labeled fragments are shown in bold and fragments labeled NEH (Succinimidyl ether 6-carboxy-2',4,4',5,7,7'-hexachlorofluorescein), are underlined.

Table 6
RhD #191196201203244306319324
203429186350435328232266
1661428879118157
63792279
2299
9

Polyclonal cell line were cultured for 5 weeks and the week via samples were taken for T-RFLP analysis. The analysis was performed on the variable regions of the heavy chain, but can also be performed on a light chain, if necessary.

After capillary electrophoresis of restriction fragments of the relative peak areas summarized and used to evaluate the clonal diversity polyclonal cell culture. The relative amount received for a certain period of time, are given in figure 5.

Based on these data we can conclude that during this period the number of RhD196 is increased, and the number RhD203 reduced. A number of other clones remained stable during the period of cultivation, and all eight cDNA can be detected after cultivation for five weeks.

By conducting T-RFLP analysis on the light chain and heavy chain, as well as at the level of mRNA and DNA, you can get an accurate fingerprint clonal diversity in a polyclonal cell culture, for example, for cellsin vitroat a certain phase of their development or currently in the process of cultivation.

Therefore, this method can be used to monitor the stability of clonal diversity in cell culture in a certain period of time producing antibodies. This method can also be used to monitor the composition of the various PA is involved for example, in various frozen ampoules obtained from the same Bank polyclonal working cell (WCB), or in cells collected after two or more production cycles.

Analysis using cation-exchange chromatography for estimation of clonal diversity in the polyclonal cell culture

Anti-RhD rpAb obtained from the same polyclonal cell culture, which was used in T-RFLP analysis described above was analyzed using cation exchange chromatography. Recombinante produced polyclonal antibody, purified on protein A, was applied on the column PolyCatA of 4.6×100 mm) in 25 mm sodium acetate, 150 mm sodium chloride, pH 5.0, at a flow rate of 60 ml/h-1and at room temperature. Then antibodies components were suirable linear gradient 150-350 mm sodium chloride in 25 mm sodium acetate, pH 5.0, at a flow rate of 60 ml/h-1. Antibodies components were detected by spectrophotometer at 280 nm and built the chromatogram, then the area of individual peaks used for quantification of antibody components. The relative amount received during certain time periods, are given in Fig.6.

Conclusions

Conducted comparing the results obtained at the genetic level using RFLP analysis and at the protein level with POM is using cation exchange chromatography. Figure 5 and 6 clearly illustrates that the majority of individual clones in the polyclonal cell line, as well as a separate antibodies that are included in these polyclonal antibodies expressed from the indicated cell lines were found similar profiles for all 5 weeks of culture. Thus, the analyses carried out at the genetic level and at the protein level showed good compliance with the terms of compositional diversity cell line at the genetic level, and compositional diversity of the recombinant polyclonal protein produced from this cell line.

Example 3

This example illustrates the characterization of the polyclonal cell culture, consisting of twenty-five members, within a certain period of time. Clonal diversity of culture was evaluated at the genetic level using T-RFLP analysis and on the protein level using chromatography by separation on one parameter.

T-RFLP analysis of gene variable regions of the heavy chain, derived from a polyclonal cell culture expressing twenty-five different antibodies against rhesus factor D for a cultivation period of 5 weeks

Polyclonal cell culture measured in this example, consists of a mixture of cell cultures, expr shirouma twenty-five different antibodies against rhesus factor D (received as described in example 1). Polyclonal cell culture were cultured for 5 weeks and one week samples were taken for T-RFLP analysis.

RT-PCR was performed using VH-specific primers described in example 2, and similarly fragmentation was performed restricteduse enzymes.

Polymorphism of the lengths of the restriction of sequence end of sequence (T-RFLP), coding twenty-five different antibodies against rhesus factor D, in the presence of all genotypes will lead to the formation of seventeen different FAM-labeled fragments. Some fragments will represent up to three different genotypes, and other fragments will be represented by one genotype. The estimated size of FAM-labeled fragments are given in table 7 together with the relative amounts of various F-labeled fragments, measured over a certain period of time. In addition, one sample T-RFLP profile is given in figure 4.

Table 7
RhD #The size ofRsaI/NdeI-FAM-fragment (BP)GroupWeek 1
Area, %
Week 2
Area, %
Week 3
Area, %
Week 4
Area, %
Week 5
Area, %
Rhd1576319,55,05,34,84,6
Rhd159631
Rhd191631
Rhd31911820,80,20,20,20,0
Rhd20118631,50,80,91,10,7
Rhd1921873
Rhd19920340,9 0,30,30,40,4
Rhd16226057,43,61,71,00,0
Rhd32426661,00,80,60,50,0
Rhd306328710,38,07,27,97,8
Rhd20335086,03,4the 3.85,98,9
Rhd3053508
Rhd19735695,1 1,81,71,81,3
Rhd20235910the 3.84,35,65,23,7
Rhd240369113,31,81,30,80,0
Rhd2074141211,710,5the 10.19,911,1
Rhd1604261311,317,1of 17.518,117,2
Rhd29342613
Rhd19642613
Rhd245 429146,57,18,311,016,8
Rhd321432156,89,48,37,5a 4.9
Rhd241435164,813,712,57,24,0
Rhd189438179,412,314,816,818,7
Rhd30143817
Rhd31743817

Restriction fragments can be separated to the extent that it allows to obtain data on twenty separate clones of twenty-five clones that make up this tile is Chou line. Other fractions can be subjected to sequencing for more information about these remaining clones.

Analysis using cation-exchange chromatography for estimation of clonal diversity in the polyclonal cell culture expressing twenty-five different antibodies against rhesus factor D

Anti-RhD rpAb obtained from the same polyclonal cell culture, which was used in T-RFLP analysis described above was analyzed using cation exchange chromatography. Recombinante produced polyclonal antibody, purified on protein A, was applied on the column PolyCatA of 4.6×100 mm) in 25 mm sodium acetate, 150 mm sodium chloride, pH 5.0, at a flow rate of 60 ml/h-1and at room temperature. Then antibodies components were suirable linear gradient 150-350 mm sodium chloride in 25 mm sodium acetate, pH 5.0, at a flow rate of 60 ml/h-1. Antibodies components were detected by spectrophotometer at 280 nm and built the chromatogram, then the area of each peak was used to quantify different antibodies components. Figure 7 presents the chromatogram, built according to the sample obtained after 4 weeks, where the antibody-containing peaks are numbered from 1 to 25. These data coincide with the data of the chromatogram, which the number of peaks is identical to the number of individual antibodies in the analyzed polyclonal antibody. Table 8 shows the relative percentage of all antibodies components (AC1-AC), as well as the representation of individual antibodies, each antibody component (peak). The assignment of individual antibodies integrated chromatographic peaks are conducted on the basis of their retention time and the profiles of the peaks obtained from monoclonal antibodies, and analyzed using cation-exchange chromatography under identical conditions.

Table 8
PeakPresents Ab RhD #Week 1
Relates. area, %
Week 2
Relates. area, %
Week 3
Relates. area, %
Week 4
Relates. area, %
Week 5
Relates. area, %
AC 1293,319to 2.062,31,71,060,81
AC 2157,2933,633,833,973,89 3,06
AC 3157,1922,662,82,892,832,34
AC 4159,189,1996,115,525,14,12,99
AC 53192,181,941,331,081,26
AC 6241,1916,016,46,325,424,1
AC 7189, 192,199, 2013,894,213,382,952,63
AC 816012,115,7718,7117,5915,56
AC 9203,1912,653,893,693,994,14
AC 10162,202of 6.7810,2213,5212,299,75
AC 11203, 306, 3012,863,634,353,663,92
AC 122451,431,631,52,272,02
AC 13301, 3212,53,353,924,16of 3.64
AC 143052,442,613,124,236,07
AC 1519, 197, 240, 305, 3218,337,22of 7.368,494,01
AC 161973,822,712,15to 1.867,86
AC 17196, 240, 324EUR 7.575,124,866,897,79
AC 18197, 3212,27the 1.441,511,392,83
AC 19196, 240the 3.82,632,873,986,35
AC 203174,581,390,770,710,86
AC 21317 2,860,590,360,830,42
AC 222072,072,611,581,651,93
AC 232073,33a 3.872,562,412,87
AC 242072,463,481,731,521,92
AC 25Unknown1,580,8320,750,87

Cation-exchange chromatography allows you to select specific antibodies components of polyclonal antibodies due to differences in the total charge of these individual members, and in addition, it allows you to select the form of separate antibodies that detect heterogeneity in charge. Therefore, several antibodies submissions to the s in one peak, for example, in the peak AC1 containing RhD293 and RhD319 (see table 8), and some individual antibodies were also presented in several chromatographic peaks, for example RhD319, which is present in AC1 and AC (see table 8).

Peaks containing more than one separate the antibody may be subjected to additional chemical characterization at the level of proteins, such as quantitative analysis using antiidiotypic peptides mapping of proteolytic peptides, N-terminal sequencing or chromatography according to the second parameter.

Conclusions

This example illustrates the combined use of T-RFLP analyses and cation exchange chromatography to estimate the distribution of primary transcripts and antibody components, respectively, during the whole period of cultivation. T-RFLP analysis allows unique identification of 12 individual clones of the 25 clones expressed in the polyclonal cell line, and in this example it is shown that these 12 clones can be detected within 4 weeks of cultivation using T-RFLP analysis. In principle, many clones can be identified by analysis of the sequence fragments from more than one clone. The distribution of antibody components was analyzed using cationorm is authorized chromatography and this example shows that the distribution of the 25 analyzed components in the process of cultivation is relatively stable. Although the unique identification of all individual antibodies is difficult, due to the inherent expressed antibody heterogeneity in relation to the charge, but in this example it was demonstrated that the antibody-part 8 representing the antibody RhD160, producirovanie at the highest level in the process of cultivation, which is consistent with the high levels of T-RFLP obtained for a group of 13, representing clones RhD160, 293 and 196. In addition, the component RhD207 that was uniquely identified in the T-RFLP analysis, as well as using cation-exchange chromatography, was found T-RFLP-levels, components of 10-11% and slightly lower levels of 5.5-10%, obtained at the level of the antibodies. In General, these two methods in combination with each other demonstrated relatively stable production at the mRNA level and at the level of antibodies in the cultivation process, however, as you can see, these two methods are in principle different from each other, what the data indicates about the obvious decline in levels of transcription of some clones after 5-week cultivation, which differ from the data obtained on the level of antibodies. Thus, this example confirmed the additional option of using both methods to determine the intervals of cultivation, during which can be maintained stable production difficult polyclonal protein.

Example 4

This example illustrates the composite analysis polyclonal anti-RhD antibodies, consisting of ten individual members, originating from a polyclonal cell culture. Clonal diversity of the sample polyclonal antibodies were evaluated using two-dimensional liquid chromatography, which allows you to split antibodies based on the difference between the total charge and hydrophobicity, namely by using cation-exchange chromatography for separation in the first dimension and reversed-phase (RP)-HPLC for the separation of the second parameter, respectively.

Sample polyclonal anti-RhD antibodies, consisting of ten individual members, was obtained from a polyclonal cell culture. Anti-RhD rpAb was isolated from the supernatant on a column of protein A (column with protein And HiTrapTM, Amersham GE Healthcare Biosciences, England).

The first chromatography was performed by applying a purified polyclonal antibodies on the column ProPac WCE10 (4×250 mm) in 25 mm sodium acetate, 150 mm sodium chloride, pH 5.0, at a flow rate of 60 ml/h-1and at room temperature, is installed on the system Ettan LC (Amersham Biosystems, GE Healthcare, England). Then antibodies components were suirable linear gradient 150-350 mm Nl in 25 mm sodium acetate, pH 5,, at a flow rate of 60 ml/h-1. Antibodies components were detected by spectrophotometer at 280 nm and the fractions corresponding to the specific peaks were collected, concentrated and then analyzed using RP-HPLC.

Fractions presented on Fig, optionally separated by the second parameter by using RP-HPLC. A second chromatography was performed on a HPLC-system Summit (Dionex, CA) using column Bond Poroshell 300SB-C8 (2,1×75 mm (5 μm)), and this HPLC system was constructed in accordance with the instructions of the manufacturer Poroshell columns (Agilent Technologies, CA). Antibodies components collected after cation-exchange chromatography was applied to a column (5 μl) in 10% SN3CN with 0.1% TFA, 0.3% PEG at a flow rate of 120 ml/h-1, and was suirable linear gradient to 90% of CH3CN, AND 0.08% TFA, 0.3% PEG. Column chromatography was carried out at 70°C. All samples containing antibodies components, gave the chromatograms one or two narrow peak. RP-HPLC profile of the component-B5 antibodies presented on Fig.9.

Conclusions

Since the cation exchange chromatography is carried out to separate the first option allows you to divide separate antibodies that differ in their total charge, as well as specific antibodies that detect heterogeneity in charge, several antibodies can be represented in a single peak.

Several of the Academy of Sciences is ITIL components were separated with a more complex profile, shown in Fig. As illustrated in examples 2 and 3, it is possible to identify the individual components in each peak by comparative analysis of monoclonal antibodies, and analyzed under identical conditions. However, this analysis was not performed in this experiment, because its purpose is to obtain a fingerprint for comparison of samples with each other without identification of each monoclonal antibody in rpAb. Thus, the combination of cation exchange chromatography and subsequent RP-HPLC allows to obtain data on the two parameters, and can be compiled detailed maps of the protein with the specified color codes (software ProteoVue, Eprogen, USA), as shown in figure 10, to estimate the composition of the various parties, it is not necessary to carry out the analysis of monoclonal antibodies for characterization of individual members of the complex rpAb.

Example 5

This example illustrates the characterization of polyclonal anti-RhD antibodies, consisting of eight individual members and derived from a polyclonal cell culture. Clonal diversity of polyclonal antibodies was evaluated using a “bulk” analysis of N-terminal sequence.

N-terminal sequence of the individual members present in the sample polyclonal anti-RhD antibodies, which were about analiziropany in this example, presented below in table 9. The sequence of the light chain lambda shown in italics.

Purified on protein And anti-RhD rpAb were analyzed by electrophoresis in pampering SDS page with LTOs (NuPAG 4-12%). Polypeptides were subjected to electrophoretic analysis on a PVDF-membrane, and then stained Kumasi blue in accordance with the manufacturer's instructions.

One band of approximately 53 kDa, corresponding to the heavy chain (HC), and two bands of approximately 25 and 30 kDa, corresponding light chains Kappa and lambda + Kappa, respectively, were clearly visible on PVDF-membrane, colored Kumasi blue. These bands were cut out and their N-terminal sequences were analyzed on a sequencing machine proteins the abi Procise (Aplied Biosystems, CA) using standard programs. The sequencing systematized below in table 10.

Table 10
Cycle #NALine with an (~25 kDa)Line with an (~30 kDa)
1Q, EE, DE, D, Q
2V II, T
3QV QV Q
4LL, ML, M, V
5VTT
6EQND
7SSND
ND = not determined

Sequences of the heavy chains are identical except for the first residue, whereas the light chain Kappa are conservative residues 2, 5, 6 and 7, and a light chain lambda are conservative residues 1, 5 and 6 (see table 9).

The data obtained in the sequencing of the heavy chains correspond to the expected sequences presented in table 10. Data obtained for a sequence strip light chain Kappa size of ~25 kDa, indicated the presence of antibodies to N-terminal sequence EIVLTQS (SEQ ID NO:7)corresponding to RhD191, 324, 201 and 306, and antibodies with N-terminal p is a sequence of DIQMTQS (SEQ ID NO:8), the corresponding RhD244 and 196. However, this method cannot determine whether this sample polyclonal antibodies all individual members of this antibody. Sequencing of the strip line with an size of ~30 kDa showed the presence of antibodies RhD319, which was indicated the presence of Val in the third and fourth cycles. The presence of antibodies RhD203 was not detected (not detected neither S nor And the second and third cycles, respectively). However, ion-exchange chromatography and analysis of the N-terminal sequence of this recombinant monoclonal antibodies, give grounds to assume that the line with an antibody RhD203 is partially blocked by the N-end. Thus, by analyzing the N-terminal sequence it is impossible to determine whether the specified antibody analyzed in this mixture. In addition, it is believed that the band size 30 kDa also contains a number of light chains Kappa, as in cycle 1 are residues E and D, and in cycle 4 is the remainder of M

In General, the mass analysis of the N-terminal sequence can be used to identify the presence of specific antibodies, if they differ in their sequences of heavy and light chains and are not blocked at its N end. This method allows a quantitative assessment, provided that N is the ends of the individual who's the polypeptides are not partially blocked.

Example 6

This example illustrates the characterization of polyclonal anti-RhD antibodies, consisting of eight individual members and produced a polyclonal cell culture. Clonal diversity of the antibodies was analyzed by allocating a unique marker peptides derived from the variable regions, using RP-HPLC or ion-exchange chromatography (IOC) for the separation of peptides.

The generation of peptides by hydrolysis of selected heavy chains and light chains

Sample polyclonal anti-RhD antibodies, consisting of eight individual members, was isolated from the supernatant polyclonal cell culture using affinity chromatography on columns with recombinant protein And Nchar. Liofilizovannye material was dissolved in 6M the hydrochloride of guanine, 0.5 M EDTA, 0.2m Tris-HCl, pH 8,4, restored (DTT) and subjected to carboxymethylamino (iodixanol acid). Heavy and light chains were separated by gel-filtration on a column of supersol (Suerose 12)(10/300 supplied by Amersham Bioscience, GE Healthcare) in 6 m guanine-HCl, 50 mm sodium phosphate, pH 8,4, the system Ettan LC (Amersham Bioscience, GE Healthcare, England). Separated heavy chain (HC) (~3.5 mg/ml) and light chain (line with an)(6,5 mg/ml) hydrolyzed in endoproteinase Asp-N (Roche, 1054589) at a concentration of enzyme:substrate = 1:500 in phosphate, pH 8.

Ejecta is a unique peptides using RP-HPLC

Aliquots of individual Asp-N hydrolysates allocated to the national Assembly and line with an obtained from a sample polyclonal antibodies were applied to the system Agilent 1100 LC/MSD SL, equipped with a 5 μm-column Bond 300SB-C18 (2,1×150 mm)connected with protecting column (Bond 300SB-C8, and 2.1×12.5 mm, 5 μm), equilibrated in 0.1% FA, at a flow rate of 0.2 ml/min, the Peptides were suirable linear gradient of 0.08% FA, 70% acetonitrile. Peptides were detected by spectrophotometer at 220 nm and analyzed using MS online (at atmospheric pressure ionisation elektrorazpredelenie (API). For signal amplification in the sliding phase after its exit from the column was added a mixture of 75% propionic acid/25% isopropanol. The obtained mass spectra were analyzed using Chemstation (Agilent Technologies, CA) and BioLynx software (Micromass, Water Corporation, MA).

The results obtained from the MS analysis of the Asp-N hydrolysates of the national Assembly and line with an, were systematized in tables 11 and 12 respectively. In these tables show theoretical and detected mass, which are presented as the average mass.

/tr>
Table 11
The results for the heavy chain
RhD#PeptidesTheoretical mass (Da)Found mass (Yes) theoretical index HPLCRetention time (min)
191D25891,65891,3156,5137,0
D84208,84208,4133,8110
196D15795,6a∗5795,1196,7of 161.7
D1-26297,16296,7179,1158,0
D74196,7b4196,4114,698,1
201D64196,77b4196,4114,698,1
D15710,55709,5184,8 159
203D15840,65840,4188,0156, 3mm
D64196,8b4196,5111,295,1
244D15795,6and∗5795,1194,9of 161.7
D1-26644,56644,0210,5171,2
D74196,7b4196,4114,698,1
306D15796,6a∗5795,1196,7of 161.7
D1-26694,56693,9198,2 162,5
D84168,64168,4118,494,7
319D15809,65809,2201,6162,5
D1-26659,56659,1191,5159,6
D74196,7b4196,4114,698,1
324D15919,85919,4183,7146,3
D1-26729,76729,3181,7KZT 166.5
D74224,84224,6111,396,1
a)Different peptides with the same mass.b)Peptides (four identical and one different) with almost the same mass. ∗ indicates N-terminal cyklinowanie Gln (PyroGlu).

Table 12
The results for the light chain
RhD#PeptidesTheoretical mass (Da)Found mass (Yes)theoretical index HPLCRetention time (min)
191d16537,36537,2167,574,2
d1-27530,37530,2168,971,7
d1-410281,410281,1259,091,0
d1-613719,313718,8367,2109,8
d5-63455,93455,5114,895,1
196d27151,07150,7186,693,9
d34649,24648,8150,484,8
201d18504,58504,1229,782,5
203d56356,16355,6168,590,6
244d2-37165,17164,7of 180.588,2
d44520,14520,0122,2to 75.2
306d1-d26565,66565,2 231,790,2
d1-d511727,211726,8380,0105,2
d23206,73206,5152,980,3
319d18668,7∗8668,2255,1to 85.2
part d1(7-83)8029,08028,6246,884,3
324d18518,5not defined232,8not defined
d24862,5not defined164,2not defined

As can be seen from table 11, thirteen peptides derived from the variable regions of the national Assembly, and sixteen peptides derived from the variable regions line with an, can be identified as the unique marker peptides and some peptides from the variable regions of the national Assembly (for example, D1 from RhD196, RhD244 and RhD306 markeda)have the same mass, and therefore these masses cannot be uniquely identified. However, because other masses can be unambiguously attributed to the unique peptides, in all cases was achieved positive identification of all eight antibodies. For a line with an unique peptides were assigned to seven of the eight antibodies (table 12). Antibody, which is not line with an information was received, was antibody RhD324. Thus, the combined MS data for NA and line with an demonstrated that all eight antibodies can be identified in the sample of anti-RhD rpAb due to the detection of unique peptides derived from each of these antibodies.

Selection of unique peptides using cation-exchange chromatography

Asp-N-hydrolysates of the national Assembly and line with an separated using cation exchange chromatography on a strong Latinoamerica as follows. Aliquots of individual Asp-N hydrolysates allocated to the national Assembly and line with an derived from polyclonal antibodies, as described above, was applied on the column with polysulphate And (2,1×100 mm)equilibrated in 10 mm potassium phosphate, 20% (V/V) acetonitrile, pH 3.0, at a flow rate of 0.2 ml/min and at room temperature for the system Ettan LC (Amersham Bioscience, GE Healthcare, England). Then peptides were suirable linear gradient of 0-500 mm KCl in 10 mm potassium phosphate, 20% or 30% (vol./about.) AC is lonitrile, pH 3.0. Polyuretane peptides were detected in a spectrophotometer at 215 nm and fractions were collected during fractionation. Aliquots (1 μl) of the fractions were mixed with 1 μl of a solution of α-cyano-4-hydroxyanisol acid (20 mg/ml) in 70% acetonitrile/30%, 0,1% FA, inflicted on MS-target and washed with 0.1% FA. The samples were analyzed using MALDI-TOF on the device Autoflex TOF (Bruker Daltronics, Bremen, Germany), and the external calibration of the mass was performed using calibration mixtures from Bruker Daltronics (Bremen, Germany). MALDI spectra were analyzed (by searching on the mass and internal calibration) using the GPMAW program 6.1 (Lighthouse data, Odense, Denmark).

A representative chromatogram containing several peaks from Asp-N digests line with an presented figure 11. The results of MALDI-TOF analysis of fractions Asp-N hydrolysates line with an and NA are given in tables 13 and 14, respectively. Theoretical and found masses are given as monoisotopic masses for the masses <3500 and as the average mass for the masses >3500 Yes.

Table 13
The results for the light chain
RhD#PeptidesObserved mass (Da)Theoretical mass (Da)The SCX fraction No.Theoretical PI
191d41365,541365,53B104,15
d31419,74a1419,72B10a 3.87
part d3-6 (part)3090,333090,31B33,42
d6 (part)1256,601256,59B93,0
d21010,451010,44B7? 7.04 baby mortality
d6 (part)1858,05b1858,04B710,10
d16536,306537,33B1 and B210,28
d1+d2 (part)7530,257530,34B1to 9.91
196d3 (part)1858,05b1858,04B710,10
201d31844,01c1844,02B7 and B810,15
203d42251,112251,11B67,03
d31068,571067,57B410,15
d22756,422756,41B29,44
d4+d5 (part)2566,232566,21B74,11
244d4 (part)1858,05b1858,04B710,10
d44519,42 4520,10B1for 9.47
306d52771,212771,18B95,27
d3-42423,212423,20B84,11
d13374,773374,75B76,55
d41419,74a1419,72B10a 3.87
d61844,01c1844,02B7 and D810,15
d2 (part)1794,911794,90B28,91
319
324d2 (part) 1858,05b1858,04B710,10
a)The same peptides.b)The same peptides.C)The same peptides.

Table 14
The results for the heavy chain
RhD#PeptidesTheoretical mass (Da)Observed mass (Da)The SCX fraction No.Theoretical PI
191D41953,01953,01B36,98
part D2-4 (46-89)5134,765136,35C1 and C410,08
196part D6 (99-113)b1888,891888,93B19,51
part D1-4 (6-72)7343,217344,01 C49,41
D51981,951981,95B67,01
201D41995,97a1995,98B6 and B77,01
203D41995,97a1995,98B6 and B77,01
244D41982,951982,94B1? 7.04 baby mortality
D62002,972002,94B1 and B310,12
306D41809,901809,91B610,23
319D62401,032401,01B59,27
D41995,97a1995,98B6 and B77,01
324
a)The same peptides.b)Confirmed by the identification of identical peptides with oxidized Met.

As can be seen from tables 13 and 14, fifteen peptides derived from the variable regions line with an, and nine peptides derived from the variable regions of the national Assembly, can be identified as a unique peptide markers, and some peptides derived from the variable regions of the national Assembly, and on line with an, have the same mass and cannot be uniquely identified. Thus, a unique peptides for the NS RhD201, RhD203 and RhD324 and line with an RhD201 and RhD319 cannot be identified using cation-exchange chromatography on a strong Latinoamerica.

Conclusions

The results obtained from tests on two different marker peptides are sufficient to demonstrate that the combined data obtained by MS analysis of the national Assembly and line with an allow us to identify unique peptides derived from the variable regions in all the seven antibodies the components of the anti-RhD rpAb, and selected using RP-HPLC. Using cation exchange chromatography on a strong Latinoamerica could be identified, six of the eight individual members in the composition of the anti-RhD rpAb. The results of the MS analysis still has not been fully analyzed, but only partially, as shown in tables 11-14.

Example 6A

This example illustrates the characterization of the recombinant polyclonal anti-RhD antibodies, consisting of 25 individual members, derived from a polyclonal cell culture (loop bioreactor). Clonal diversity of this antibody was analyzed by allocating a unique marker peptides derived from the variable regions or line with an NA, with the use of RP-HPLC in combination with mass spectrometry to identify peptides.

The generation of peptides by hydrolysis of selected heavy chains and light chains

Sample polyclonal anti-RhD antibodies, consisting of 25 individual members, was isolated from the supernatant polyclonal cell cultures obtained during one cycle of operation of the bioreactor. Purification was performed using affinity chromatography on a MabSelect column (Amersham Bioscience, GE Healthcare), and then absoluely on a G25 column (Amersham Bioscience, GE Healthcare). Liofilizovannye material was dissolved in 6M the hydrochloride of guanine, 0.2m Tris-HCl, pH 8,4, reset nawiliwili (DTT) and subjected to carboxymethylamino (iodixanol acid). Heavy and light chains were separated by gel-filtration on a column of supersol (Suerose 12)(10/300 supplied by Amersham Bioscience, GE Healthcare, 6M in guanine-HCl, 50 mm sodium phosphate, pH of 8.4. Separated heavy chain (HC) and light chain (line with an) hydrolyzed in endoproteinase Asp-N (Roche, 1054589) at a concentration of enzyme:substrate = 1:200 in 1 M urea, 50 mm sodium phosphate, rn, over night at 37°C.

Selection of unique peptides using LC-MS

Aliquots of individual Asp-N hydrolysates allocated to the national Assembly and line with an obtained from a sample polyclonal antibodies were applied to the system Agilent 1100 LC/MSD SL, equipped with a 5 μm-column Bond 300SB-C18 (2,1×150 mm)connected with protecting column (Bond 300SB-C8, and 2.1×12.5 mm, 5 μm), equilibrated in 0.1% FA, 14% ACN, at a flow rate of 0.2 ml/min, the Peptides were suirable linear gradient of 0.08% FA, 70% acetonitrile. Peptides were detected by spectrophotometer at 220 nm and analyzed using MS online (at atmospheric pressure ionisation elektrorazpredelenie (API). For signal amplification in the sliding phase after its exit from the column was added a mixture of 75% propionic acid/25% isopropanol. The obtained mass spectra were analyzed using Chemstation (Agilent Technologies, CA) and the GPMAW program 6.2 (Lighthouse data, Odense, Denmark).

The results obtained from the MS analysis of the Asp-N hydrolysates of the national Assembly and line with an, were systematized in table 14A, where theoretical and electrovanne mass are presented as the average mass.

Table 14A
Identification of unique hydrophobic peptides originating from 25 antibody present in the anti-RhD rpAb by Asp-N digestion and LC-MS analysis
RhD#PeptidesandTheoretical mass (Da)Found mass (Yes)Retention time (min)
157d17358,27357,2211
159d44483,04482,2213
160d25585,35584,5216
162d24322,04321,1245
189d18536,58535,3203
191d1 6537,36536,4179
192d25667,45665,5217
196D1-D2∗b6297,16295,8303
197d1∗8696,88695,5206
199d25709,45708,6212
201d18504,58503,3202
202d16448,26447,3188
203d56356,16355,4184
207d1∗8626,78625,5198
240d27056,07054,9235
241d16464,46463,4215
245d25749,45748,6226
293D15854,75854,1277
301d44559,34558,5221
305d44510,14509,3187
306d23206,73206,1189
317d16364,26363,2225
319d1∗668,7 8667,4210
321d74945,64944,9222
324D15919,85919,3280
a)D and D denote peptides derived from NA and line with an and obtained by Asp-N hydrolysis, respectively, and these peptides are numbered from N-Terminus to C-end of the predicted sequences. Therefore, d4 indicates the peptide obtained by splitting a 3-m and 4-m Asp-N-the website of the polypeptide line with an.b)This peptide does not contain the cleavage site. * means N-terminal cyklinowanie Gln (PyroGlu).

As can be seen from table 14A, 22 peptide, derived from the variable regions line with an, and 3 peptide, derived from the variable regions of the national Assembly, can be identified as a unique marker peptides. Thus, the MS data for NA and line with an unequivocally demonstrated that all 25 of antibodies can be identified in the sample of anti-RhD rpAb due to the detection of unique peptides derived from each of these antibodies.

Example 7

This example illustrates the generation of antiidiotypic Pat the species with specificity to individual members of the recombinant polyclonal anti-RhD antibody, as well as the assessment of the concentration of one individual member of a recombinant polyclonal antibody.

Generation of anti-RhD antibodies specific to the peptide-ligands

For affinity selection of peptides that bind with a separate anti-RhD antibodies used phage library, representing the seven amino acids, arranged in random order in a sequence at the N-Terminus R (New England Biolabs). For selection used both linear and conformationally restricted variant peptide library. Microtiter plates (Maxisorb, NUNC) were senzibilizirani at 4°C for 12-16 hours with purified monoclonal anti-RhD antibody at a concentration of 10 μg/ml in a volume of 100 μl per well. For screening antiidiotypic peptides used all twenty five separate antibodies contained in the recombinant polyclonal anti-RhD antibody. However, if the recombinant polyclonal antibody contains a large number of individual members (e.g., greater than 50), for screening can be selected antibody-indicators. Preferably choose the number of antibody-indicators comprising at least 4% of the total number of antibodies included in the recombinant polyclonal protein, and more preferably selected antibodies indicators comprising at least, 8%, 12%, 16%, 20%, 30% or 50% of the total number of antibodies in Odesa in recombinant polyclonal protein. Sensitized tablets were washed in PBS, 0.05% tween-20, and then blocked with 2% separated milk/PBS. For each round of panning used bacteriophages in the amount of ~1011boe/100 μl. Conformationally restricted and linear libraries were mixed and subjected to joint panning in the form of a mixture of 2% separated milk/PBS. After incubation for 1 hour at room temperature, the bound phages were suirable glycine/HCl, pH 2.2, while for 10 minutes, and then neutralized Tris-HCl, pH to 9.0. After conducting 3-4 rounds of panning single clones were isolated and DNA was extracted and sequenced in the area corresponding randomized peptide region. In the following table 15 illustrates the alignment of amino acid sequences selected from single clones.

Three synthetic peptide with a specific affinity for antibodies against RhD162, 202 or 305, respectively, were synthesized in accordance with the derived consensus amino acid sequence of groups of related sequences. Each synthetic peptide was added to the Biotin at the C-end.

The specificity of each peptide were tested using ELISA. Briefly, ELISA-plates were senzibilizirani by streptavidin at a concentration of 5 μg/ml in a volume of 100 m is l/well at 4°C for 12-16 hours. Then the peptide was added, diluted to ~10 mg/ml in PBS, and incubated for 1 hour with subsequent removal of excess peptide by washing. After that, the plates were blocked in 2% separated milk/PBS and three times washed in PBS. Every single anti-RhD antibody was added separately at different dilutions ranging from 10 μg/ml of Bound antibody was detected using a conjugate antibodies against human IgG (CalTag, cat # H10307). Tablets five times washed and were detected by adding 25 µl of Chromogen (TMB, Kem-En-Tech). 15-25 minutes the reaction was completed by addition of 25 μl of 1M H2SO4. The total optical density was measured at 450 nm. Testing of each peptide specificity panel of monoclonal anti-RhD antibodies showed that this reactivity is specific for the respective individual protein components. Therefore, RER associated only with anti-RhD162 antibody RER associated only with anti-RhD202 antibody and RER associated only with anti-RhD305 antibody, where the signal-to-noise ratio greater than 10.

The determination of the number of anti-RhD305 antibodies in the recombinant polyclonal anti-RhD antibody

By appropriate dilutions of purified monoclonal anti-RhD305 antibodies, used as standard, you can determine the amount of anti-RhD305 antibodies n is the total number of antibodies in the mixture of recombinant polyclonal anti-RhD antibodies. Briefly, ELISA-plates were senzibilizirani with streptavidin and incubated with RER, diluted to ~10 mg/ml in PBS, for 1 hour. After incubation the excess peptide was removed by washing. Then the plates were blocked in 2% separated milk/PBS and three times washed. Recombinant polyclonal anti-RhD antibody, consisting of 25 separate anti-RhD antibodies (sample), was added at dilutions from 1× 16384×. The sample was analyzed with four replications. To plot a standard curve in the individual wells of the same tablet was added to serial dilutions (with three replications) monoclonal anti-RhD305 antibodies from 10 µg/ml as reference samples. Bound antibody was detected using a conjugate antibodies against human IgG (CalTag, cat # H10307). Tablets five times washed and were detected by adding 25 µl of Chromogen (TMB, Kem-En-Tech). 15-25 minutes the reaction was completed by addition of 25 μl of 1M H2SO4. The total optical density was measured at 450 nm.

A standard curve was directly proportional to the concentration in the following interval:

Monoclonal anti-RhD305 Ab antibody (µg/ml)0,1560,0780,0390,0195
OD4501,5090,9900,5670,338

These data were derived from the standard curve equation y=0,h-0,0256 and R2=0,9812.

The concentration of anti-RhD305 antibody in the sample of recombinant polyclonal anti-RhD antibody was calculated by the equation defined on the basis of the standard curve, and the ratio of dilution of the sample.

When a 32-fold dilution average OD450 measured for this sample was 1,24±0,14, which corresponded to the concentration of anti-RhD305 antibodies in a polyclonal anti-RhD antibody, a component of 3.8±0.5 μg/ml Total concentration of antibody in the sample of recombinant polyclonal anti-RhD antibody was 100 µg/ml Thus, anti-RhD305 antibody in the sample polyclonal antibody was 3.8%.

Example 8

This example illustrates the use of antiidiotypic peptides for identification of antibody-indicators in specific fractions/peaks after the separation of one parameter by analyzing recombinant polyclonal anti-RhD antibodies by liquid ion-exchange chromatography.

Recombinant polyclonal anti-RhD antibody, consisting of 25 separate anti-RhD antibodies were separated using cation exchange chromatography and fractions were collected. Each fraction was evaluated by ELISA using three antiidiotypic peptides (described in example 7) for detecting the presence of specific anti-RhD antibodies in each fraction. Overlapping data from the chromatogram, with ELISA data analysis carried out for each fraction showed that this method can be used to identify individual antibodies specific faction (Fig). Thus, by comparing the optical density in a particular synergy with the data of the ELISA can be performed semi-quantitative assessment of complex mixtures of homologous proteins.

Example 9

Compositional stability is a key factor in ensuring the possibility of industrial production of polyclonal proteins for their use as medicines. Specific peptide ligands, allowing identification of individual protein components in a complex mixture of homologous proteins can be used to monitor the compositional stability of the polyclonal protein at the time of its receipt by the sampling medium in the fermentation process at different points in time production and implementation of quantitative detection, for example, ELISA methods described in example 7.

In this example, the actual number of three proteins-indicators, namely antibodies PR is against RhD162, RhD202 and RhD305, was evaluated during perfusion fermentation cells WCB producing recombinant polyclonal anti-RhD antibody, consisting of the 25 unique anti-RhD antibodies. On Fig illustrates the distribution of the three antibody-indicators (antibodies against RhD162, 202 and 305) at various stages of cultivation in the fermentation process, while the G8 means the 8th day after inoculation of the bioreactor.

Example 10

This example illustrates the method of identifying cells that produce specific anti-RhD antibody in the mixture of cell cultures. In this example, a mixture of two different antibody-producing cell lines, were analyzed using antiidiotypic peptide and flow cytometry for detection.

Two separate cell lines producing antibodies against RhD, namely against RhD162 and RhD202, mixed in a certain ratio. The percentage of clone RhD202 are given in table 16.

Biotinylated peptide 202 (RER, obtained as described in example 7) were incubated with streptavidin, conjugated with phycoerythrin (SA-PE) was obtained peptide tetramer. These tetramer incubated with mixtures of cell lines for 20 minutes at room temperature and the cells were passed through the flow cytometer FAS libur (Becton Dikinson). Positive on tetramer cells were sorted as p is shown on R1 Fig. Also measured individual unmixed cell lines (figa In).

Characteristic observed for cell lines producing anti-RhD antibody, is present in this cell line cells expressing and not expressing the antibody. To estimate the number RER-positive cells in the mixture it is necessary to determine the total number of expressing cells. In this example, the authors proceeded from the assumption that the proportion of cells in a mixture of cell clones expressing RhD162 and RhD202, identical to the percentage of cells in only one RhD202-expressing clone. This can be determined by dual staining of cells with peptide RER and anti-IgG antibody (did not). However, the obtained results confirmed the correctness of this assumption. The percentage of cells RhD202 associated with tetramer RER, in these mixtures was calculated by the percentage of cells in discriminatory box 6 (R6), as shown in Fig.

The percentage RhD202-expressing cell line in the mixture (a) was calculated by the following equation, illustrated by measurements for the mixture (a).

Table 16
MixtureTrue % RhD202Measured % RhD202
the 5045
b8379
c9687
d1715

Example 11

This example illustrates the application of real time PCR to estimate the distribution of individual clones or for selective screening of these clones in a polyclonal cell culture.

This method is based on the differences in nucleic acid sequences encoding the individual antibodies. Due to the diversity of sequences encoding individual antibodies can be constructed unique TaqMan probe for the heavy chain and/or light chain for each member represented in the polyclonal cell line. For the design of TaqMan probe select one of the CDR regions CDR1, CDR2 or CDR3. It is preferable to design the TaqMan probe is chosen region CDR3.

Design of oligonucleotides

Were designed preferred primers, such as amplicon consisting of 70-150 nucleotides. Some of the possible structures of the primers are: forward primer derived from the consensus pic is egovernance and used for hybridization with FR3-scope variable regions of the heavy and light chains; and a reverse primer designed for hybridization with a constant area. For each interest clone designed TaqMan probe specific to the part of the CDR region, which ranged from two separate members in the sample, preferably within the CDR3 region.

Potential series of primers and probes for the analysis of the polyclonal cell line expressing the following eight anti-RhD antibodies can be constructed as described below.

Forward and reverse primer for all clones:

Direct primer: CAC GGC TGA GTA TTA CTG TGC (SEQ ID NO:24)

Reverse primer: TTG GTG GAG CCA CTC GA (SEQ ID NO:25)

The TaqMan probes for all individual clones are presented in table 17.

Table 17
RhD#The TaqMan probes
191AGA AAT TTG TTC GGT GAC TAC GAT CTT AAG TCC (SEQ ID NO:26)
196AGA GAA TTG AGC ACG CAA CGT GGA TAC A (SEQ ID NO:27)
201AGA GAG AGT ACT CTA TAT AGC AGC AGC TGG TAC A (SEQ ID NO:28)
203GAT GGT CTC CTA TAG CAG CAG CTG GTA CC (SEQ ID NO:30)
244GAG AGA CTC TGT TCG GGG AGT CAG TAG AT (SEQ ID NO:30)
306GGG TAC TCT GTA TAG CAG CAG CTG GTA CA (SEQ ID NO:31)
319AGA GAC CTA CAA GGG TAT AGA AGC AGC TGG TAC (SEQ ID NO:32)
324CCG ACG ATT TTT GGA GTG GGC C (SEQ ID NO:33)

Design alternative primers for sequences encoding heavy chain, namely the direct primer, hybridization in the joint area between the VN-DNand reverse primer, hybridities with a constant region, and the TaqMan probe for the field joint JN-Described in the publication Rasmussen, et al., 2000, Exp. Hematol., 28, 1039-1045.

Quantitative real-time PCR

mRNA, or genomic DNA was extracted from the cell debris. If the matrix using mRNA before conducting real-time PCR it is subjected to reverse transcription to obtain cDNA. The number of PCR reactions in real time corresponds to the number of analyzed clones.

The analyses carried out in real-time, optimized the concentrations of primers and TaqMan probe. Reactions were carried out with three replicates in 96-well tablets, sealed optical adhesive coatings. PCR reactions were carried out in commercially available uterine PCR mixture and held on the device the abi Prism 7000 (Aplied Biosystems), after which the mixture was analyzed with use the of unit the abi Prism 7000 SDS and computer programs.

Analysis of clonal diversity

Value WithTfor different clones were compared with each other and determined the distribution of each clone in the polyclonal cell line. This method can be applied to estimate changes between individual parties, as well as clonal stability during the whole time of individual production cycle.

Example 12

This example illustrates the estimation method and demonstrated polyclonal nature of the polyclonal cell line (for example, WCB), capable of producing recombinant polyclonal antibody, through DNA sequencing, gene variable regions of the heavy and/or light chain of the antibodies in one cell clones, derived from the polyclonal cell line.

Cloning from one cell

Vials of cells WCB thawed and cultured for several days in complete medium for recovery of good cell viability. Then received single-cell clones by limiting dilution and cells were planted in 96-well tablets at a density of 1 cell/well in complete culture medium for culturing cells. These cells were incubated at 37aboutC, 5% CO2within 10-20 days, after which the tablets were visually evaluated under a microscope for the presence of wells with single colonies of Alternative single-cell clones from cell line WCB received using a cell sorting device FAS. Viable cells WCB selected and sorted in 96-well tablets, pre-filled with 100 μl of conditioned complete medium at a density of 1 cell/well. These cells were incubated and evaluated on a single colonies as described above.

Sequencing of nucleic acids

When a single cell colonies cultured in the hole, reached confluently, aliquots (10-20 µl) from each of the desired hole (for example, from 100 holes) was transferred into a new 96-well plates, used in reactions of DNA sequencing as a matrix. Sequencing was performed either at the mRNA level or at the level of genomic DNA using 1-100 or 1-1000 cells, respectively. In the first case, the PCR fragment covering a sufficient portion of the variable region to identify different genes of the heavy and light chains of the antibodies present in WCB (usually, at least the CDR3 region)were generated using standard RT-PCR technology, for example using a commercially available kit for carrying out one-step RT-PCR Qiagen according to the manufacturer's instructions. Before performing PCR cells were subjected to lysis. The obtained PCR fragment was subjected to gel purification, for example, by using a kit for gel extraction, Qiagen Qiaquick and used as template in a standard reaction sequence D Is For subsequent analysis by automated DNA sequencing machine, such as genetic analyzer the abi PrismTM3100 (Aplied Biosystems). Alternative DNA sequencing was performed on genomic DNA as described above, except that the stage of reverse transcription did not.

To characterize the recombinant polyclonal anti-RhD antibodies used the following primers:

PCR primers for amplification of VH:

RhD#001: 5'TCTCTTCCGCATCGCTGTCT (SEQ ID NO:34)

RhD#007: 5'AGGAAAGGACAGTGGGAGTGGCAC (SEQ ID NO:35)

PCR primers for amplification of VL:

RhD#005: 5'CGTTCTTTTTCGCAACGGGTTTG (SEQ ID NO:36)

RhD#008: 5'AAGACCGATGGGCCCTTAGGTGGA (SEQ ID NO:37)

For sequencing the primers used were:

VH: 5'AACGGGTTTGCCGCCAGAACA (SEQ ID NO:38)

VL: 5'CCGAGGGACCTGAGCGAGT (SEQ ID NO:39)

ELISA conducted on single cells using antiidiotypic peptides

In addition to the sequencing of nucleic acids can be assessed clonal composition of the mixture of antibody-producing cells, such as Bank polyclonal working cell using ELISA for antiidiotypic peptides.

Sorted single cells were cultured for approximately 14 days, resulting from single clones were obtained isogenic cell culture. The supernatant from these cultures can be analyzed for the presence of specific anti-RhD antibodies using antiidiotypic peptides in ELISA analysis as described in example 7. As a result, produces the t information on the number of clones producing a discrete component. When comparing the number of separate components with the total number of antibody-producing cells (for example, by measuring IgG in all isogenic cell cultures) can be carried out a quantitative assessment of the fraction of cells that produce a separate anti-RhD antibodies in a polyclonal cell culture.

Example 13

This example illustrates the use of cation exchange chromatography for estimation of clonal diversity recombinant polyclonal antibodies during sequential processing (DSP).

Sequential processing

A sample of the anti-RhD rpAb containing 25 individual members, taken from the experimental bioreactor during the production cycle, was purified by carrying out the following stages DSP:

1) immobilization of antibodies on the column bSelect;

2) inactivation of viruses at pH 3;

3) replacement of the buffer on a column of Sephadex G-25;

4) anion exchange chromatography on a column with D-separate;

5) filtration of the virus through the filter Planova 15N;

6) hydrophobic chromatography with induction of charge on the column MEASURES Hypercel; and

7) ultrafiltration/diafiltration using filter illipore Biomax.

Analysis of clonal diversity after conducting separate stages DSP

Cation exchange chromatography was used the La analysis of clonal diversity composition of recombinant polyclonal antibodies during sequential processing (DSP). Samples taken after 1, 3, 4, and 6 stage DSP anti-RhD rpAb was applied on the column PolyCatA of 4.6×100 mm) in 25 mm sodium acetate, 150 mm sodium chloride, pH 5.0, at a flow rate of 60 ml/h-1and at room temperature. Then antibodies components were suirable linear gradient 150-500 mm sodium chloride in 25 mm sodium acetate, pH 5.0, at a flow rate of 60 ml/h-1. Antibodies components were detected by spectrophotometer at 280 nm and the chromatogram was compared (Fig) to detect possible loss of clonal diversity in the process DS. In this example, demonstrated that when conducting cation-exchange chromatography clonal diversity of recombinant polyclonal antibodies basically does not change during sequential processing (DS).

Example 14

IOC-analysis of more than 40 antibodies against RhD revealed that the majority of individual antibodies find profiles of the 3 peaks, as shown in figv. Treatment with carboxypeptidase B, as well as the analysis of carbohydrates showed that the heterogeneity of charges is not caused by removing C-terminal lysine or the presence of sialic acid (data not shown).

This example demonstrated that the heterogeneity of charges due to the formation of PyroGlu and to obtain a homogeneous ZIOC profiles can be used site-directed the mutagen is.

Expression and purification of antibodies

Stable cell lines (obtained as described in the patent application Denmark RA 2004 01133, filed July 20, 2004), each of which expresses a separate recombinant monoclonal antibody against rhesus factor D of the specific site of the genome of these cells were adapted to suspension culture in serum-free medium Excell 302 (JRH Bioscience, Andover, UK), to which were added 4 mm L-glutamine (Invitrogen) and the agent for preventing aggregation (Invitrogen)diluted 1:250, after which these cell lines were propagated and stored in a Bank of cells at -150°C in accordance with standard procedures of freezing.

Before being placed in a cell Bank for storing supernatant cell cultures were collected and filtered, after which carried out the purification of monoclonal anti-RhD antibodies using affinity chromatography (protein A), essentially as described in example 1.

Cation-exchange chromatography on a strong Latinoamerica

Monoclonal antibodies purified in the previous stages were subjected ZIOC on strong ion exchangers, basically as described in example 1. In table 18 in the column “IOC” indicates the number of peaks present in the ioch-profiles of selected antibodies, such as the IOC-profiles are also shown in Fig.

Analysis of the N-terminal sequence

Analysis of the N-terminal on which sledovatelnot separate peaks, by using ion-exchange chromatography 2 selected antibodies (RhD198 and RhD307), carried out in solution by sequencing Adminu on the sequencing machine Procise 494 Sequencer (Aplied Biosystems, CA) according to manufacturer's instructions. The sequence analysis demonstrated that the heterogeneity of the charge due to partial cyclization of N-terminal Gln heavy chain (HC) (see table 18). Thus, the first peak corresponded to the antibodies completely blocked N-terminal heavy chain (N-ends of the national Assembly had charge of 0); the second peak corresponded to the antibodies, in which one of the N-terminal heavy chain was blocked (N-ends of the national Assembly had the charge +1)and the third peak, in all probability, consistent with the antibodies, in which the N-terminal Gln heavy chain was not modified (N-ends of the national Assembly had charge of +2). Cyclization of N-terminal glutamine residue with the formation of PyroGlu is not possible to carry out sequencing of Admino.

Analysis of the N-terminal sequence of a number of other anti-RhD antibodies that detect such “profile of the 3 peaks” or “profile of 1 peak”, was performed similarly using electrophoresis in LTO-page and then subjected to electroblotting to PVDF-membranes. The NA - line with an-stripes on these blots were subjected to sequencing by Admino.

It was shown that several antibodies with N-terminal Gln to NA (RhD162, RhD240), were full of the TEW blocked in accordance with their ioch-profiles (a profile from one peak), and it was found that antibodies (RhD196, RhD305 and RhD306) “profiles of the 3 peaks, as expected, were partially blocked (see table 18). This interpretation is based on sequencing data sequence, and data on the relative percentage of variants with different charges (0, +1 and +2) ioch-profile.

Table 18
RhD#Sequence analysis of the NAandSequence analysis of the NAandIOC-profileComments
162bQVQLV;not sequencedd, SEQ ID NO:40DIQLT;DIQ, SEQ ID NO:421 peakCompletely blocked N-ends HC
196bQVQLV;QVQLV, SEQ ID NO:40n.d.3 peakPartially blocked N-ends NA
306bQVQLV;QVQLV, SEQ ID NO:40EIVLTOS;EIVLTQS, SEQ ID NO:73 peakactiono blocked N-ends NA
240bQLQLQ;not sequencedd, SEQ ID NO:41DIQMT;DIQMT, SEQ ID NO:431 peakCompletely blocked N-ends HC
305bQVQLV;QVQLV, SEQ ID NO:40n.d.3 peakPartially blocked N-ends HC
198bP1: QVQLV;not sequenceddP2: QVQLV;QVQLV; SEQ ID NO:40P1: DIQMT;DIQMT
P1: DIQMT;DIQMT, SEQ ID NO:43
3 peakCompletely blocked and partially blocked N-ends HC represented by P1 and P2, respectively
307bP1: QVQLV;not sequenceddP2: QVQLV;QVQLV; SEQ ID NO:40P1:DIQLT;DIQLT
P1:DIQLT;DIQLT, SEQ ID NO:42
3 peakCompletely blocked and partially blocked N-ends HC represented by P1 and P2, respectively
a)Expected and obtained N-terminal sequence shows the normal and bold, respectively.b)the data, received from the blot.C)Data obtained from selected fractions (peak 1 and 2), the IOC-analysis (carried out in solution).d)Cyclization of N-terminal glutamine residue with the formation of PyroGlu is not possible to carry out sequencing of Adminu; n.d. not determined.

Site-directed mutagenesis

Site-directed mutagenesis was used to eliminate the heterogeneity of charge of the selected antibodies by replacing the N-terminal residue Gln-Glu residue. This used the expression plasmid RhD189 encoding a full-sized antibody with N-terminal Gln in the heavy chain and N-terminal Glu in the light chain. The VH region in this plasmid flanked bysI-site in the 3'-end region that encodes a signal peptide and silentXhoI-site in the J region.

Mutagenesis was performed using the following primers:

Direct primer RhD189: TGGGCGCGCCGAGGTGCAGCTGGTGGAGTCTGG (SEQ ID NO:44)

Reverse primer RhD189: GGAGGCGCTCGAGACGGTGACCGTGGTCCC (SEQ ID NO:45)

sI-site in the forward primer andXhoI-site in the reverse primer are underlined, while the Glu codon (GAG) in the N-end of the VH region marked in bold. Plasmid RhD189 was used as template in PCR reactions using the above primers. PCR reaction was performed using a DNA polymerase Phusion (Finnzymes, Finland) in 25 cycles in accordance with the instructions is proizvoditeli. VH-band of approximately 400 BP was purified on 1% agarose gel, incubated with DNA polymerase BioTaq was again purified on agarose gel and cloned in the vector R2.1 (Invitrogen, CA) according to manufacturer's instructions. Clones containing the VH-insert was confirmed by sequencing. The original VH fragment was cut out from plasmid RhD189 enzymessI andXhoI and instead built the mutated fragment from plasmid R2.1. To confirm the presence of the correct fragment of plasmid preparation Midiprep (Macherey-Nagel, Germany), containing no endotoxin was obtained from positive colonies by cloning and sequencing.

The antibody was subjected to electrophoresis in LTO-SDS page, electroblotting, and then N-terminal sequencing of the NA-strip to confirm the replacement of Gln to Glu (data not shown).

Replacement of the N-terminal Gln to Glu heavy chain antibodies RhD189 detecting ZIOC profile of the 3 peaks, led to the significant change this profile to a profile with only one peak (Fig). Thus, by replacing the N-terminal Gln residue at the residue Glu was successfully eliminated the heterogeneity of the charge.

Analysis of binding

In order to determine whether N-terminal mutation on the functional properties of antibodies of the native antibody, RhD189, and it mutated to Glu-similar, RhD189, analyzed for binding to RhD erythrocytes.

Erythrocytes were obtained from whole blood collected from the blood Bank at the clinic, Aalborg Hospital, DK, obtained from healthy donors with informed consent by 3 times washing the blood in PBS (Gibco, Invitrogen, United Kingdom)containing 1% bovine serum albumin (BSA, Sigma-Aldrich, Germany). Erythrocytes resuspendable and kept at 4°C in a 10% solution in ID-Cellstab (DiaMed, Switzerland).

The binding ability of the antibodies was determined using RhD-positive red blood cells at a density of 5·104cells/μl in PBS, 1% SA. Dilution of antibodies was obtained in PBS, 1% SA with three replicates in 96-well plates (Becton Dickinson Labware, NJ, USA). 50 μl of the antibody solution was mixed with 50 µl of erythrocytes and incubated at 37°C for 40 minutes. Cells two times washed (300 g, 2 min) in PBS, 1% SA. In each sample was added 80 μl conjugated with phycoerythrin goat antibodies against human IgG (Beckman Coulter, CA, USA)diluted 1:20 in PBS, 1% SA, the sample was kept at 4°C for 30 minutes. The samples were washed in PBS, 1% SA and reagent FacsFlow (Becton Dickinson, Belgium) (300 g, 2 min) and resuspendable in 200 ál of FACSFlow. The samples were passed through the cell sorters FACSCalibur (Becton Dickinson, CA, USA) and data analysis was performed using CellQuest Pro and Excel.

As shown in Fig, no significant differences in the ability of Glu-option and its native counterpart contact with RhD-positive erythrocytes h is observed.

Conclusions

The heterogeneity observed in the ioch-profiles many of the anti-RhD antibodies, due to partial cyclization of N-terminal Gln residue in these antibodies. Replacement of the N-terminal Gln residue at the Glu residue of the heavy chain of anti-RhD antibodies leads to the elimination inherent to these antibodies heterogeneity of charge at the N-Terminus and, as expected, does not affect the efficiency of binding to RhD-positive erythrocytes.

1. Method sample characteristics polyclonal cell line containing cells producing various known homologous recombinant antibodies with different variable regions, where recombinant antibodies bind to a given target antigen, wherein receiving information about the relative proportions of protein-coding sequences of these individual homologous antibodies specified pattern, where the specified pattern polyclonal cell line is a fraction of a cell culture containing the cells of this culture, and this method includes the analysis of the aliquot of the specified sample polyclonal cell line using one or more methods of genetic analysis of protein coding sequences, and these methods of genetic analysis selected from RFLP and T-RFLP that is performed on the mRNA level, and where the specified one of the multiple methods of genetic analysis is performed on the samples, containing a mixture of populations of cells without releasing a single cell.

2. Method sample characteristics, containing various known homologous recombinant antibodies with different variable regions, and these antibodies are produced polyclonal cell line and associated with a given target antigen, wherein receiving information about the relative proportions of individual homologous antibodies specified sample, where the method includes the analysis of the specified aliquot of the sample using one or more methods of protein characterization, selected from chromatographic analyses, separates proteins according to their physico-chemical properties.

3. The method according to claim 2, where the specified chromatographic analyses based on any physico-chemical properties, in addition to size.

4. The method according to claim 3, where the specified individual chromatographic analysis is based on physico-chemical properties selected from (i) the total charge, (ii) hydrophobicity, (iii) isoelectric points, and (iv) affinity.

5. The method according to any of claim 3 or 4, where these chromatographic analyses performed using multidimensional chromatography.

6. The method according to claim 2, including additional analysis of proteolytic hydrolysates homologous antibodies with the aim of identifying N-terminal marker peptides or peptides is characteristic with the mi functional groups of the side chains of amino acids.

7. The method according to claim 2, including additional analysis, which uses specific detector molecules for homologous antibodies.

8. The method according to claim 7, where these specific detector molecules are antiidiotypic peptides or antiidiotypic antibodies.

9. The method of claim 8, where the specified antiidiotypic peptide or antiidiotypic antibody is used to identify the individual antibody-producing cells in the polyclonal cell line.

10. The method according to claim 2, where the specified pattern obtained from the supernatant of cell culture.

11. The method according to any one of claims 1 to 10, where this characteristic further includes the analysis of one or more proteins indicators or sequences of nucleic acids of indicator present in the specified pattern.

12. The method according to any one of claims 1 to 10, where for analysis of these samples using at least two of the analytical method.

13. The method according to item 12, where one of the analytical methods is a method of characterizing a protein according to claim 2, and other analytical method is the genetic analysis according to claim 1.

14. The method according to any one of claims 1 to 10, where these samples are obtained from one polyclonal cell culture at different time points during cultivation, and compare the relative number of said Department who were homologous antibodies and/or coding sequences.

15. The method according to any one of claims 1 to 10, where these samples are obtained from different polyclonal cell cultures at specific points in time and compare the relative number of said separate homologous antibodies and/or coding sequences.

16. The method according to any one of claims 1 to 10, where different variable regions of the antibodies are different areas of the CDR.



 

Same patents:

FIELD: medicine.

SUBSTANCE: CD4+ lymphocyte or CD8+ lymphocyte expressing superficial marker CD69 are counted prior to and after mitogenetic stimulation. The related value reaching a 10-fold or maximum 30-fold limit is a sign of Alzheimer's disease (AD). A kit containing necessary components for diagnosing Alzheimer's disease (AD) is presented.

EFFECT: invention allows presenting the instant diagnostic test for Alzheimer's disease.

2 cl, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: peripheral blood thrombocytes of women suffering gestosis of various severity levels on their 32-38 weeks of pregnancy are analysed for the activity of glutathione reductase (GY), NADF-dependent glutamate dehydrogenase (NADFGDG) and NADF-dependent isocitrate dehydrogenase (NADFICDG). A nicotine amide adenine dinucleotide phosphate transfer coefficient (NTC) represented by the relation of the GY activity to a product of the NADFGDG and NADFICDG activities is calculated. At the NTC value is equal to 1.3 and lower, the newborn's Apgar score is predicted to be equal to 6 and less, and the NTC value exceeding 1.3 provides the Apgar score being 7-10 points.

EFFECT: more accurate prediction of the newborn's state.

2 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: clinical investigation is supplemented with simultaneously testing monoamine oxidase (MAO) activity in thrombocytes in nmole of benzaldehyde per 1 mg of protein an hour and semicarbazide-dependent amine oxidase (CAO) activity in blood serum in nmole of benzaldehyde per one ml of blood serum an hour. The blood serum CAO to thrombocyte MAO activity relation is calculated. If the value exceeds 0.6, a positive result of atypical antipsychotic drug treatment in schizophrenia is predicted.

EFFECT: more precise and objective prediction, reduced length of treatment in schizophrenics.

2 ex

FIELD: medicine.

SUBSTANCE: inventions concern methods and analyses for studying expression of one or more biomarkers in a mammal's tissue or cell sample; study kits and products are presented also. Identifying expression of GalNac-T14 molecules predicts sensitivity or specifies that the tissue or cell sample is supposed to be sensitive to apoptosis inducing agents, such as Apo2L/TRAIL.

EFFECT: information obtained by the analysis aiming at identifying GalNac-T14 expression in the tissue or the cell sample in a mammal can provide an attending physician with the information which can be used for prescribing an optimum treatment regimen for the patients suffering such diseases as pancreatic cancer, lymphoma, non-small cell carcinoma of lung, colon cancer, rectal cancer, melanoma or chondrosarcoma.

22 cl, 50 dwg, 6 tbl

FIELD: medicine.

SUBSTANCE: five-percent placental tissue extract is analysed for the concentration of arginine and histidine to be related, and if the relation is lower than 0.86, development of cerebral affection in a newborn is predicted.

EFFECT: more precise and specific prediction of perinatal CNS affection in the newborn and enabled well-timed pathogenetic therapy.

3 dwg, 1 tbl

FIELD: medicine.

SUBSTANCE: patient's blood serum is treated with 7% solution of polyethylene glycol-6000, incubated and with dye Sudan B at 40°C for 1 hour, separated electrophoretically in agarose gel. After that, additionally, before treatment of blood serum with 7% PEG-6000 to 0.6 ml of sample 0.2 ml of 0.1% tritone X-100 solution is added, incubated for 15 minutes at 20°C, after which mixture is mixed by shaking 120 times per 1 minute. Application of method makes it possible to detect additional intensive minor fraction of modified LP(a).

EFFECT: increase of diagnostics accuracy.

3 dwg, 1 tbl

FIELD: medicine.

SUBSTANCE: method of determination of triterpene saponins in vegetable raw material and medications includes dissolution of saponin-containing fraction in mixture water-ammonium buffer, determination of its optic density and calculation of saponin content in terms of oleanolic acid, under specified conditions.

EFFECT: claimed method represents express method, facilitates analysis and increases degree of reliability of obtained results.

2 ex

FIELD: medicine.

SUBSTANCE: in order to estimate efficiency of treating ischemic nephropathy in newborn babies in early neonatal period activity of gamma-glutamyltransferase and cholinesterase in child's urine is determined in dynamics of treatment. If activity of said enzymes decreases with respect to initial level, treatment is estimated as efficient, if activity increases or does not change - as inefficient.

EFFECT: application of method makes it possible to increase accuracy of estimation of ischemic nephropathy treatment in newborns, carry out correction of therapeutic measures in due time and improve disease outcome.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: in a first trimester of pregnancy, the microalbuminuria level is determined. If the value is 45 mg\l and more, placental insufficiency is predicted.

EFFECT: method enables early prediction of placental insufficiency by a simple quantitative estimation and thereby ensures early adequate preventive treatment.

3 ex

FIELD: medicine.

SUBSTANCE: detecting expression of GalNac-T14 molecules enables to predict sensitivity or indicates that a tissue or cell sample is sensitive to apoptosis inducing agents, such as DR4 or DR5 agonist antibodies. The information obtained by the analysis aimed at detecting GalNac-T14 expression in the mammal's tissue or cell sample can provide a hospital doctor with data which can be used for prescribing an optimal treatment schedule for patients suffering such diseases as pancreas cancer, lymphoma, non-small cell carcinoma of lung, colon cancer, rectal cancer, melanoma or chondrosarcoma.

EFFECT: expanded scope of the compounds.

16 cl, 53 dwg, 14 tbl

FIELD: medicine.

SUBSTANCE: immunoglobulin-A is sorbed in microplate wells, then after incubation and treatment, a solution containing a proteolytic enzyme is introduced in the microtablet wells. It is followed with incubation; the contents of the wells are poured out, and then an enzyme conjugate, e.g. peroxidase, with immunoglobulin-A Fc-fragment antibodies and a substratum of this enzyme are introduced. After incubation of a reaction mixture, reaction results are accounted by a spectrophotometre. IgA-protease activity is calculated by the amount of hydrolysed substratum of the enzymatic reaction.

EFFECT: use of the invention allows facilitating determination of the IgA-protease activity level, the method exhibits good result reproducibility, high sensitivity, low substratum consumption and the absence of necessity to use of immunoglobulins of certain specificity.

1 dwg, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: what is offered is a method for prediction of developing pathological cicatrisation shown by preoperative venous blood examination. An electrophoresis method is used to analyse blood serum proteins and to record Igl fraction concentration of alpha-2 globulins. Also, the diastasis value L of the maxillary dental arch fragments is measured. A score of the derived values is used to predict three possible outcomes: favourable course of postoperative cicatrisation, a moderate risk of developing pathological cicatrisation, a high risk of developing pathological cicatrisation.

EFFECT: method for prediction enables higher aesthetic and functional effects of the complex treatment, and early effective orthodontic treatment that minimises adult skeletal deformations.

3 ex

FIELD: medicine.

SUBSTANCE: blood plasma is analysed for a cardiolipin antibody level. If at least two studies has shown an upper limit of the reference blood plasma cardiolipin antibody limits exceeded by 10-20%, the one-vascular stenotic lesion is predicted. The multivascular stenotic bed lesion is proven by at least two studies showing an upper limit of the reference blood plasma cardiolipin antibody limits exceeded by more than 21%.

EFFECT: use of the method allows predicting a severity of bed lesion in a patient, sizing the possibilities of subsequent treatment.

4 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: invention represents a method of evaluating functional activity of Clr2s2 subcomponents of the first component of a human complement involving sorption in microplate wells of a classical complement cascade, introduction of a solution containing porpoise serum and sodium ethylene diamine tetraacetate; then incubation and drying of the plate is followed by introducing the analysed sample containing the Clr2s2 complex of the human complement of unknown activity, and a pseudoglobulin fraction of human blood serum prepared by distilled water dialysis (R1), and also a buffer solution containing calcium and magnesium ions, incubation, and after washing and drying of the plate, introduction of a enzyme conjugate with human C3 component and substratum antibodies into the wells, calculation of Clr2s2 subcomponent activity by an amount of the produced enzyme reaction product, differing by the fact that the classical complement cascade is derinate, and also a kit for functional activity assay on Clr2s2 subcomponents of the first component of the human complement.

EFFECT: invention provides developing the method of functional activity assay on Clr2s2 complex of the human complement showing good reproducibility.

2 ex, 1 dwg

FIELD: medicine.

SUBSTANCE: method of blood plasma proximate analysis for cardiomyoglobin by means of an electrochemical immunosensor consists in the fact that a blood plasma sample is applied on a surface of a main electrode pre-modified by colloidal gold and monoclonal cardiomyoglobin antibodies; the prepared sample immunosensor is kept, preincubated in a buffer solution; cardiomyoglobin is electrochemically recorded in the sample by the prepared calibration diagram under certain conditions.

EFFECT: more sensitive analysis procedure, and reduced analysis time.

2 dwg, 2 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: invention describes a method of evaluating an immunosuppressive response rate in children with chronic glomerulonephritis characterised by determining the peripheral blood cell kinetics by flow DNA-cytometry; evaluating a cell fraction in a proliferation phases not less than 0.74% enables to consider the immunosuppressive therapy to be prescribed, and observing a decreased cell level in proliferation phases in 2-3 weeks after the beginning of administration at least in 2 times, the therapy is considered to be effective; the absence of positive dynamics requires dosage change or preparation replacement.

EFFECT: higher accuracy and reduced number of research injures, derived clinical laboratory criteria of immunosuppressive prescription and prediction of a therapeutic effect.

4 dwg, 1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention describes a method of evaluating the heparin concentration in puerperants underwent acute herpes viral infection in the third trimester, characterised by the fact that a piece of placenta is sampled from the puerperants, homogenate is prepared and processed for glycosaminoglycans recovery. Thereafter, the prepared glycosaminoglycans extracts are separated by gel electrophoresis in a polyacrylamide gel, and a heparin percentage is calculated by optical density sensitometry; a herpes viral infective episode is stated by spectrophotometry and shown by increasing titre of herpes virus antibodies.

EFFECT: higher analysis accuracy.

1 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely, to immunology and clinic laboratory diagnostics, and can be used to predict course of acute respiratory viral infections (ARVI) in children in the first days of disease and timely administration of immunomodulating medications. For this purpose by means of ELISA immunologic indices of spontaneous and induced interferon-γ in vitro (IFH-γ) are determined. Index of interferon-γ stimulation (IS IFH-γ) is calculated by division of index of induced level by index of spontaneous level of interferon-γ. Also carried out is calculation of lymphocyte activation index (LAI IFH-γ) per 1000 lymphocytes by division of index of induced interferon-γ by absolute number of patient's lymphocytes. Additionally in blood plasma determined is content of interleukin-10 (IL-10). If values of IS IFH-γ are higher than 3, LAI IFH-γ equals or is higher than 40, IL-10 is from 30 to 60 pg/ml favourable outcome of disease is predicted with therapeutic treatment which does not include immunomodulators. If IS IFH-γ is lower than 3, LAI IFH-γ is lower than 40, IL-10 is from 60 to 100 pg/ml, predicted are severe course of disease and development of complications, which requires urgent treatment by immunomodelling therapy. If IS IFH-γ is lower than 3, LAI IFH-γ is lower than 30, IL-10 is higher than 100 pg/ml, predicted are severe course of disease with development of bronchopulmonary complications and possible chronisation of pathologic process and recurrent ARVD, which requires additional introduction of immunomodelling medications.

EFFECT: increase of accuracy of early prediction of disease course severity and development of complications in children with ARVI, including those from 1 month old, which makes it possible to carry out necessary anti-viral and immunomodelling therapy, aimed at strengthening immunity cell responses, in due time.

3 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: analysed human blood serums are brought in wells of 96-well polystyrene plates with an immobilised complex of pertussis microbe antigens, added with a human IgG3 antibody peroxidase conjugate, added with a substrate mixture that is followed with recording the optical density of the mixture to derive a titre of immunosorbent attached human IgG3 antibodies. The substrate mixture is a ready form of tetramethylbenzidine and hydrogen peroxide. The human antibody titre 1:40 is accepted as pertussis related.

EFFECT: higher sensitivity and specificity of pertussis diagnostics.

1 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: not less than twice a week for the first month following the liver transplantation, recipient's peripheral blood is examined for the concentration of circulating stem haemopoetic cells CD 34+ to find its average values for the first 10 and the following 20 days, and if their value is less than 0.1% in the second or both time intervals, a risk of post-transplantation complications is predicted in the recipient.

EFFECT: invention provides high accuracy of prediction of the risk of early, most dangerous post-transplantation liver rejection.

2 ex, 1 dwg

FIELD: medicine.

SUBSTANCE: composition includes at least three oligonucleotide probes and enables simultaneously determining a level of PSMB4, FCER2 and POU2F2 genes expression. The oligonucleotide composition under the invention is presented to be used, including as a part of a microchip, in a method for prediction of a developing disease in a subject suffering chronic lymphatic leukemia that involves analysing a level of expression of at least three named genes in patient's blood samples.

EFFECT: higher efficacy of the composition.

8 cl, 5 dwg, 16 tbl, 5 ex

Up!