Recombinant plasmid dna containing sequence of mature staphylokinase staphylococcus aureus with replacement of codons k74, e75 and r77 with triplets coding ala, strains of escherichia coli mz09 and method of obtaining recombinant protein, containing sequence of mature staphylokinase gene with replacement of codons k74, e75 and r77 with ala-coding triplets

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of biotechnology and deals with recombinant plasmid DNA, which contains sequence of gene of mature staphylokinase Staphylococcus aureus with replacement of codons K74, E75 and R77 with triplets, which code Ala, of strain Escherichia coli MZ09 and method of obtaining recombinant protein, which contains sequence of gene of mature staphylokinase with replacement of codons K74, E75 and R77 with Ala-coding triplets. Essence of method includes recombinant plasmid DNA, which codes sequence of gene of mature protein of staphylokinase from Staphylococcus aureus staphylokinase with replacement of codons K74, E75 and R77 with Ala-coding triplets, which has nucleotide sequence, given in dwg.1. Invention also includes strain Esherichia coli MZ09, producent of recombinant staphylokinase, with sequence, given in dwg.1, as well as method of its obtaining.

EFFECT: invention makes it possible to obtain staphylokinase protein which possesses high fibrinogenic activity, with output of recombinant protein to 20% from total amount.

3 cl, 2 dwg

 

The invention relates to the field of microbiological pharmaceutical industry.

Staphylokinase (Sak) is a protein, the secretory some strains of Staphylococcus aureus, which consists of 136 amino acid residues. Clinical interest in this bacterial protein called because of its ability to convert plasminogen (inactive proferment the fibrinolysis system) into plasmin. Sak is an effective and specific thrombolytic agent.

Recombinant staphylokinase developed by several companies of the world, but they differ from each other in the structure of genes (see, for example, US 6010897, 01.04.2000; US 5801037, 01.09.1998; US 6902733, 07.06.2005; US 6383483, 05.07.2002; US 5951980, 14.09.1999; US 5695754, 09.12.1997, and others).

Studies of recombinant staphylokinase showed that some patterns of staphylokinase prone to the formation of dimers and polymers. The formation of polymers increases the immunogenicity of staphylokinase.

The proposed derivative staphylokinase, not prone to the formation of dimers and with bifunctionality thrombolytic and anticoagulative agent. These derivatives differ from staphylokinase wild-type and the fact that one or more amino acid residues between amino acid residues 104 and 113 staphylokinase wild-type replaced by other amino acids with the formation of the RGD sequence or sequences KG. Designed the way they are received (EN 2283863, 20.09.2006).

The disadvantage of this technical solution is the inability of the drug on this basis at the stage of pre-hospital thrombolysis in connection with an increased risk of bleeding. This is because the sequence RGD and KGD have additional anticoagulant effect.

The closest to the proposed solution is the invention according to EN 2156299, 20.09.2000, which describes a recombinant DNA containing the full sequence staphylokinase and leader peptide with a block of 6 his-tag residues, the E. coli strain SA 9325, which is the producer of recombinant protein containing the full sequence staphylokinase of S.aureus.

The invention according to EN 2156299 allows to obtain a highly active protein having fibrinolytic activity, with the release of the recombinant protein 20-26% of the total number of proteins.

However, the known solution has the disadvantage, as mentioned producing strains encodes a protein consisting of 163 amino acids (so-called immature form) and which is only in its active form is transformed into a protein, which consists of 136 amino acids (the so-called Mature form).

In this regard, the present invention is the creation of recombinant plasmid DNA containing the sequence staphylokinase of 136 amino is the slot and leader peptide, which have increased activity, as well as the creation of new efficient producer strain on the basis of E. coli and development of the process of isolation and purification of the target product with high yield and purity.

The problem is solved by a group of inventions.

The proposed recombinant plasmid DNA that contains the gene sequence of a Mature staphylokinase Staphylococcus aureus with substitution of codons K, E75 and R77 decrease under the triplets encoding Ala, and having the nucleotide sequence shown in figure 1.

A strain of Escherichia coli MZ09 - producer of recombinant protein containing the gene sequence of a Mature staphylokinase Staphylococcus aureus with substitution of codons K74, E75 and R77 decrease under the triplets encoding Ala, and having the amino acid sequence shown in figure 1.

In addition, the method for obtaining a recombinant protein containing the gene sequence of a Mature staphylokinase Staphylococcus aureus with substitution of codons K74, E75 and R77 decrease under the triplets encoding Ala characterized by the amino acid sequence shown in figure 1, which includes the synthesis of recombinant plasmid DNA, cloning of the synthesized sequence using vector pQE30, transformation of recombinant plasmids into cells of Escherichia coli M15Rep4 containing a plasmid with the gene of the lactose repressor of the operon, livelounge in terms of expression of DNA selection of clones with optimal staphylokinase activity, highlighting the Mature staphylokinase with the replacement of codons K74, E75 and R77 decrease under the triplets encoding Ala.

The figure 1 presents the nucleotide sequence of the gene recombinant staphylokinase and the corresponding gene amino acid sequence of the recombinant protein staphylokinase, including amino acids methionine (ATG) and glycine (GGA). The figure 2 presents the scheme of obtaining the plasmid with the gene recombinant staphylokinase consisting of the Mature protein staphylokinase and leader peptide with the substitution of codons K74, E75 and R77 decrease under the triplets encoding Ala (a), and the sequence of primers used for amplification of a DNA fragment containing the gene of Mature staphylokinase.

The peculiarity of this sequence Sak is the presence of the dipeptide at the N end of the protein MG. Also changed amino acids at positions 74, 75 and 77. As the expression vector is used, the promoter of phage T5, the use of which ensures maximum quality and quantity (yield) of the claimed product. When introduced into the protein sequence substitutions are intended to reduce its property to polymerization, i.e. to form dimers and other polymeric forms, which can result in reduced solubility of the protein and increased immunogenicity.

the detailed description of obtaining the target product are described below and are explained with the help of the figures.

To obtain the recombinant DNA was used vector plasmid pQE30, which comes in a set of "High-level expression and purification of 6XHis-tagged proteins and has a Replicator plasmid ColEl, the promoter of bacteriophage T5, two operators of the lac operon of E.coli, the terminator T1 of the rrnB operon of E. coli and t0bacteriophage lambda. The strain containing the plasmid pQE30 resistant to ampicillin at a concentration of 100 μg/ml DNA Fragment EcoRI-BamHI size 57 i.e. the plasmid pQE30 encoding the amino acid sequence of 6 His, was replaced by the fragment size 30 n / a

WHF 5' ttcgaattcattaaagaggagaaattaact 3'

WHR 5' gttggatcccatagttaatttctcctct 3'

In the resulting plasmid was cloned DNA fragment size 426 BP genome of staphylokinase Staphylococcus aureus with substitution of codons K74, E75 and R77 decrease under the triplets encoding Ala. The obtained plasmid was named pZT11. Then the DNA of the recombinant plasmid was transformed into E.coli cells M15Rep4 containing plasmid (pRep4) with the gene of the lactose repressor feathered providing inducibility synthesis of the cloned protein. From the obtained transformants was selected clone with optimal staphylokinase activity.

The nucleotide sequence of the gene of staphylokinase Staphylococcus aureus and the corresponding amino acid sequence staphylokinase, including amino acids methionine (ATG) and glycine (GGA), as illustrated in figure 1. Other reading frames of klonirovan the second DNA fragment does not contain.

Polymerase chain reaction was performed in standard buffer: 50 mm KCl, 10 mm Tris-HCl, pH of 9.0, 2.5 mm MgCl2

PCR was performed using as matrix sak gene DNA plasmids with full sak gene from a strain of S. aureus. As a negative control was used chromosomal DNA of E. coli. Plasmid DNA was isolated using the kit for DNA extraction company Promega, in accordance with the attached Protocol.

The DNA fragment of the expected length was detected in all samples except the control, which contained the DNA of E.coli.

Next, we used all amplicons sak gene.

Cloning sak gene in multicopying vector under a strong promoter of bacteriophage T5.

The restriction and ligation of DNA amplicon DNA vector was performed by standard methods. The scheme of constructing recombinant plasmids are presented in figure 2.

Received subsidized mixtures containing DNA recombinant plasmid was used to transform cells of the host strain E. coli M15REP4. Strain M15REP4 supplied by the company QIAGEN in the set of "High-level expression and purification of 6XHis-tagged proteins" for producing large quantities of recombinant proteins. The present system provides that the recipient strain F-, lac-mtl-, thi-, nals, strs, rifs, KmR, AmpRmust contain a plasmid carrying the gene for lactose operon laci and stable marker is ivoti to kanamycin (gene KAP). The product of this gene suppresses the work of the promoter, which controlled the composition multicopying vector pQE30 will be cloned gene. The effect of repression due to the fact that the promotor region pQE30 in addition to the promoter of phage T5 carries two lac operator sequences, which is the object of the action of protein-Lacl repressor. The action of the repressor in inducible systems is removed by the operation of the inductor, which, in this case, you may be lactose or IPTG.

The present system provides a high level of protein synthesis. In addition, the nucleotide sequence of the plasmid pQE30 contains encoding Ala triplets, substituting codons K, E75 and R77 decrease under. Vector pQE30 contains a marker for selection - bla gene, encoding resistance to ampicillin (Apr).

Getting the producer strain.

Transformation was performed by the following method:

A) Preparation of competent cells: cells of the host strain M15[REP4] were grown to early logarithmic phase (OD=0,4) in 200 ml LB-broth in chachalacas flask, then besieged by centrifugation at 3 tycobrahe (centrifuge K-23) for 10 minutes at 4°C, resuspendable in 2/3 of the original volume, cooled to 0 1M CaCl2and incubated for 40 minutes in ice at 4°C, then centrifuged at 3 tycobrahe (centrifuge K-23) for 10 minutes at 4°C. the Supernatant was decanted, and Osada resuspendable in 10 ml of 0.1 m CaCl 2. To the resulting suspension was added 1.5 ml of chilled glycerol and were Packed up in Eppendorf 100 μl and stored at -70°C.

As necessary, the competent culture used in the following way. To 0.1 ml of competent cells M15Rep4 was added the required amount legirovannoi mixture or plasmids.

DNA and the mixture is incubated in an ice bath at 4°C for 40 minutes Then preincubating the mixture was subjected to thermal shock in a water bath for 60 seconds at a temperature of 42°C. was Added 0.25 ml of LB medium and incubated at 37°C for one hour, then were sown on plates with selective medium: LB containing 50 μg/ml ampicillin and 25 μg/ml kanamycin. After one day of incubation increased Arch (ampicillin-kanamycin) resistant clones were once cleared on the selective medium and subjected to further analysis.

B) Analysis of transformants.

The obtained transformants were increased in 5 ml of LB medium containing 50 μg/ml ampicillin and 30 μg/ml kanamycin to an optical density of 0.4 and added IPTG. After 3-4 hours of additional incubation obtained culture liquid was centrifuged, the precipitate resuspendable in 100 μl of N2Oh, and destroyed by ultrasound. The resulting lysate was applied onto nutrient agar containing 30% of human blood plasma (plasma before adding the agar was kept for 20 minutes at 56°C) cells. P the following 4 hours of incubation was installed, what part of the lysates analyzed clones formed around the drip sieving zone of lysis. This positive signal testified that transformants inherited intact copy of the sak gene encoding the active form of staphylokinase (protein plasminogen activator).

The results of the analysis for further work were selected 2 clone, which showed maximum zone of lysis.

B) Electrophoretic control protein content of staphylokinase.

150 μl of culture fluid was boiled on a water bath for 5 minutes followed by centrifugation for 5 minutes at 15,000 rpm in the Eppendorf centrifuge. 5 μl of the supernatant was applied in the presence of protein dye 12% acrylamide gel. As control of molecular weight was used, the molecular weight marker protein of the firm "Fermentas." It was found that the number of identified protein is 15-20% of the total number of proteins in the cells.

G) Fermentation.

Fermentation of the recombinant strain was performed in a 10-liter fermenter.

The nutrient medium composition, g/DM3: tripton to 15.0; yeast extract - 7,5; potassium phosphate (K2HPO4) - 1.0; sodium chloride (NaCl) - 10,0; glucose - 3,0; ampicillin sodium salt - 0,075; kanamycin - 0,025; distilled water to 1 liter, pH before sterilization is to 7.0, and 7.1.

Sterilization assests is whether at 116°C for 40 minutes The control of the cultivation process was carried out according to readings of the optical density of the medium. When reaching a density of 2.0-2.5% in the fermenter was made alcohol solution inductor: isopropyl-beta-D-thiogalactoside (IPTG) of 48 mg/DM3. Upon reaching an optical density of 4.5-5.0 carried out the separation. The obtained cells were washed, suspended in buffer, was destroyed in the homogenizer and centrifuged.

Microbiological characteristics of the obtained recombinant.

Morphological features. Cells are rod-shaped, gram-negative, risperadone.

Cultural characteristics. Cells grow well on simple nutrient media. On agar Difco" cells form a smooth round colonies with smooth edges. With the growth in liquid nutrient medium intensive form a smooth suspension.

Physico-chemical properties. Cells grow in the temperature range from 8 to 40°C, the optimum pH 7.4. As sources of nitrogen, carbon, and other necessary components are mineral salts, casein, peptone, yeast autolysate, etc.

Resistance to antibiotics. Cells are resistant to kanamycin and ampicillin.

Storage of the recombinant strain. Requirements for genetic engineering of the parent microbial strain and the recombinant plasmid is stored separately from each other to avoid with Antonych mutations. The accumulated amount of plasmids stored at 20°C in buffer TE (10 mm Tris, 1 mm EDTA, pH 8.0). The parent strain is kept according to generally accepted methods of preservation of microbial strains.

As can be seen from the description above, the resulting strain producing a hybrid protein with staphylokinase activity, called by us E.coli MZ09.

In accordance with the foregoing, the proposed invention has solved the problem of creating a recombinant DNA that encodes a protein having staphylokinase activity, which can be isolated using affinity chromatography. The coding sequence of staphylokinase shown in figure 1.

The invention helped to create producing strains of staphylokinase E.coli MZ09 with high fibrinolytic activity and providing the output of the recombinant protein to 20% relative to the total number of proteins.

1. Recombinant plasmid DNA containing the gene sequence of a Mature staphylokinase Staphylococcus aureus with substitution of codons K74, E75 and R77 decrease under the triplets encoding A1A, and having the nucleotide sequence shown in figure 1.

2. The strain Escherichia coli MZ09 - producer of recombinant protein containing the gene sequence of a Mature staphylokinase Staphylococcus aureus with substitution of codons K74, E75 and R77 decrease under the triplets encoding A1A, having the amino acid series is here, shown in figure 1, including the amino acid methionine (ATG) and glycine (GGA).

3. A method of obtaining a recombinant protein containing the gene sequence of a Mature staphylokinase Staphylococcus aureus with substitution of codons K74, E75 and R77 decrease under the triplets encoding Ala characterized by the amino acid sequence according to claim 2, which is shown in figure 1, and contains a methionine (ATG) and glycine (GGA), including the synthesis of recombinant plasmid DNA, cloning of the synthesized sequence using vector pQE30, transformation of recombinant plasmids into cells of Escherichia coli M15Rep4 containing a plasmid with the gene of the lactose repressor of the operon, the cultivation in the conditions of the expression of DNA, the selection of clones with optimal staphylokinase activity, highlighting the Mature staphylokinase with substitutions codons K74, E75 and R77 decrease under the triplets encoding Ala.



 

Same patents:

FIELD: medicine, microbiology.

SUBSTANCE: invention concerns biotechnology. The pharmaceutical composition, possessing thymidine kinase activity containing the allocated enzyme vegetative thymidine kinase or a polynucleotide coding it as the active beginning is described. The method of sensibilisation of a cell to a promedicine is revealed. The method of phosphorylation of nucleoside analogue-monophosphate is offered. The method of inhibition of the pathogenic agent in an organism of a warm-blooded animal is opened. The method of control or updating of growth of a plant is described. The agent including nucleoside analogue and thymidine kinase, or the gene coding specified obtained from plant thymidine kinase, or the vector including the specified gene, coding specified obtained from a plant thymidine kinase, in the form of a combination for simultaneous, separate or consecutive introduction is offered at cancer treatment. Described new thymidine kinases, received of a pine or rock cress. The given invention allows receiving new vegetative thymidine kinase, useful to transformation of nucleoside analogues in toxic substances, and useful to transformation nucleoside analogues in hydrophosphates, and hydrophosphates of nucleoside analogues in corresponding diphosphates.

EFFECT: obtaining of new vegetative thymidine kinases, useful to transformation of nucleoside analogues in toxic substances and for transformation of nucleoside analogues in hydrophosphates, and hydrophosphates of nucleoside analogues in corresponding diphosphates.

33 cl, 6 ex, 9 tbl, 2 dwg

FIELD: biotechnologies.

SUBSTANCE: A description is given of extracted molecules of the Corynebacterium glutamicum nucleic acids that encode polypeptides having activity of the II ABC saccharose-specific component. The invention relates as well to recombinant expression vectors comprising the described nucleic acids molecules. A method for producing a host cell containing the described expression vectors is exposed therein. The present invention relates as well to a method for producing the described polypeptide by means of cultivating said host cell. A method of testing patients for Corynebacterium glutamicum comprising the detection of the described nucleic acids molecules is exposed therein.

EFFECT: diversification of the nucleic acids molecules encoding proteins of the phosphoenolpyruvate- sugar-phosphotransferase system.

27 cl, 4 dwg, 13 tbl

FIELD: biotechnology.

SUBSTANCE: invention relates to method for DNA amplification, method for cloning of second DNA and method for DNA reverse transcription. In each method heat stable DNA polymerase is used which encoded by SEQ ID NO:7, derived from Anaerocellum thermophilum or recombinant R.coli strain, transformed by vector containing SEQ ID NO:7. DNA polymerase catalyzes matrix-targeted DNA polymerization, has 5'-3'-activity and reverse transcriptase activity, and has no 3'-5'-endonuclease activity in presence of magnesium ions and in absence of manganese ions. DNA polymerase retains at least 90 % of its activity after incubation for 30 min at 80°C in absence of stabilizing detergents and has apparent molecular mass between of approximately 96 kDa and approximately 100 kDa. Magnesium-dependent reverse transcriptase activity of DNA polymerase is more than 30 % of DNA polymerase activity, and manganese-dependent reverse transcriptase activity of said polypeptide is more than 60 % of DNA polymerase activity.

EFFECT: increased precision of matrix RNA transcrption at high temperatures.

7 ck, 5 dwg, 7 ex

FIELD: biothechnology, medicine.

SUBSTANCE: invention relates to new mutant forms of multisubstrate deoxyribonucleoside kinase of Drosophila melanogaster (Dm-dNK) having altered kinetic properties compared with wild type enzyme. Expression of said forms in cell makes it possible to reduce of cell mortal dose (LD100) at least one nucleoside analog used as prodrug and selected from group: AZT, aga-A, aga-C, ddC, ddA, and 2 CdA. Described are nucleotide sequences encoding Dm-dNK variants, vector constructs including the same, method for production of enzyme mutant forms and uses of new proteins and polynucleotides in pharmaceutical compositions.

EFFECT: cytotoxic and antiviral agents of increased effectiveness and selectivity.

7 cl, 5 dwg, 2 tbl, 4 ex

FIELD: medicine, genetics, biochemistry.

SUBSTANCE: invention relates to new NOS-variants or mutants that comprise structural modifications in site Akt-dependent phosphorylation. Modified NOS-proteins or peptides, in particular, human proteins or eNOS-peptides having change of amino acid residue corresponding to S/T in motif of the consensus-sequence RXRXXS/T of NOS-polypeptide of wild type and nucleic acid molecules encoding thereof can be used in genetic therapy and proteins and NOS-peptides can be used in screening methods of agents modulating activity of NOS. The advantage of invention involves the creature of new NOS-variants or mutants that can be used in genetic therapy.

EFFECT: valuable medicinal properties of mutants.

25 cl, 1 tbl, 9 dwg, 3 ex

FIELD: genetic engineering, in particular genes for cell cycle controlling point.

SUBSTANCE: polynucleotide encoding rad3 polypeptide ATR homologue is cloned into expression vector, having functionality in eucariotic cells. Polypeptide of rad3 polypeptide ATR homologue is obtained by cultivation of eucariotic cell culture, transformed by vector. Monoclonal antibody to rad3 polypeptide ATR homologue is obtained by hybridoma technologies. Polyclonal antibodies are obtained by inoculation of rad3 polypeptide ATR homologue in host animal. Polynucleotide presence in animal tissue sample is detected by contacting of this sample containing DNA or RNA with polynucleotide encoding rad3 polypeptide ATR homologue under hybridization conditions. Polypeptide in biological sample is detected by sample contact with monoclonal or polyclonal antibodies. Substances having anticancer activity are screened on the base of reduced activity of ATR polypeptide on substrate or reduced chelating of ATR homologue in presence of candidate substance. Present invention makes it possible to produce human or S.pombe rad3 polypeptide ATR homologue and is useful in investigation ATR role as gene for cell cycle controlling point in cell culture in vivo or in vitro.

EFFECT: new anticancer substances.

24 cl, 1 dwg

The invention relates to the field of genetic engineering and molecular biology and can be used in the development and implementation of many methods of DNA analysis

The invention relates to the field of molecular biology and genetic engineering and can be used in various methods of analysis of nucleic acids associated with the synthesis of complementary DNA sequences

The invention relates to the field of Enzymology and genetic engineering and provides native or recombinant forms of thermostable DNA polymerase used in diagnostic and other studies based on PCR amplification of nucleic acids

FIELD: medicine.

SUBSTANCE: agent contains mutant luciferase of glowworms Luciola mingrelica (SEQ ID No:2), recovered from recombinant cells E.coli transformed by plasmid pETL7, luciferin, magnesium sulphate, tris-(oxymethyl)-aminomethane, acetic acid, sodium ethylene aminotetraacetate, dithiotreitol, bovine serum albumin, sucrose and water.

EFFECT: higher sensitivity of ATP test, lower enzyme consumption.

2 cl, 3 dwg, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: recombinant plasmid pETPHOFus enabling synthesis of an anthrax lethal factor substratum as a part of one polypeptide with a mutated reporter enzyme of alkaline phosphatase Escherichia coli. Said fused polypeptide represents a new high-sensitivity anthrax lethal factor substratum. Besides, an Escherichia coli BL-PHOFus strain being a producer of the fused polypeptide is offered. The strain provides a no-fermentation high-yield synthesized protein not less than 30 mg in 1 litre of a liquid culture. The prepared anthrax lethal factor substratum shows hypersensitiveness and high specificity to LF splitting and is able to detect proteolytic activity of the anthrax lethal factor in concentration up to 1 pM.

EFFECT: invention can find application in clinical recognition of anthrax disease; for detecting hot spots of anthrax, for screening the compound libraries and searching anthrax lethal factor activity inhibitors.

2 cl, 4 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: invention represents a method of producing a recombinant antibody or its fragment that involves transforming E.coli cell which does not have a pyrC coding gene, or its homologue; a vector including the gene coding said recombinant antibody or its fragment and the wild E.coli pyrC gene, cultivation of specified said E.coli cell in a pyrimidine restriction environment and recovery of said antibody or its fragment.

EFFECT: invention allows high effective production of recombinant antibodies.

10 cl, 5 dwg, 5 ex, 5 tbl

FIELD: medicine.

SUBSTANCE: plasmid vector pE-Trx-Aur is constructed for expression of aurelin in cells of Escherichia coli in composition of hybrid protein Trx-Aur, consisting of two DNA fragments, whose nucleotide sequence is given in description. By means of said vector parent strain of Escherichia coli is transformed, obtaining strain-producent of hybrid protein Trx-Aur. In order to obtain peptide aurilin cultivation of cells of obtained strain-producent is carried out, after that, performed are: cell lysis, affine purification of hybrid protein Trx-Aur on metal-chelate carrier, decomposition of hybrid protein Trx-Aur with bromine cyan by residue of methionine, introduced between sequences of aurelin and thioredoxin, and purification of target peptide by method of reversed-phase HPLC.

EFFECT: invention makes it possible to obtain biologically active aurelin by simplified technology and without application of hard-to-obtain natural raw material.

3 cl, 4 dwg, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: there is constructed recombinant plasmid protein-coding DNA pET22b(+)/"вд"-Links 1, which contains Ndel/BamHI -fragment of DNA of pET22b(+) plasmid and artificial DNA sequence, coding Ndel/BamHI fragment, which includes synthetic gene of human water-soluble domain Links 1, containing unique sites of recognition by restriction endonucleases, which have the following coordinates: Xhol - 158, Hindlll - 173, EcoRI - 192, BamHI - 198, Ndel - 430, Bglll - 534, Mlul - 1256, Pstl - 4495. Strain - protein-producent is obtained by transformation of competent cells of Escherichia coli BL21 (DE3) with recombinant plasmid pET22b(+)/"вд"-Links 1.

EFFECT: invention allows to obtain protein with structure and properties identical to structure and properties of natural water-soluble domain of human protein Links 1 in sufficient amount, measured in milligrams.

2 cl, 1 tbl, 4 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: invention can be used in medical and biologic industry for preparing antineoplastic drugs. Plasmid DNA pFK2 providing synthesis of recombinant analogue of human kappa casein fragment, in Escherichia coli cells is designed; and a method for preparing a recombinant product with using it is described. The recombinant analogue of human kappa-casein fragment recovered from Escherichia coli cells transformed by recombinant plasmid DNA pFK2 has molecular weight of approximately 16 kDa; consists of residual methionine, human kappa-casein fragment with 24 on 134 amino acid residue and C-terminal histidine path and exhibits apoptotic activity in relation to malignant cells.

EFFECT: higher anticancer activity of the compounds.

3 cl, 6 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: invention represents plasmid DNA pD4spGBD enabling the expression of a recombinant antigen - protein LigA L. interrogans domain 4 in chimeric protein D4-GBD and 1,3-β-glucan-binding domain (GBD), and a method for making a based subunit engineered leptospirosis vaccine.

EFFECT: invention allows ensuring the development of an intensive immune response and high level of antibodies synthesis with no additional adjuvants.

6 cl, 1 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: invention represents plasmid DNA pD5spGBD enabling the expression of a recombinant antigen - protein LigA L. interrogans domain 5 in chimeric protein D5-GBD and 1,3-β-glucan-binding domain (GBD), and a method for making a based subunit engineered leptospirosis vaccine.

EFFECT: invention allows ensuring the development of an intensive immune response and high level of antibodies synthesis with no additional adjuvants.

6 cl, 1 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: recombinant plasmid DNA pTrcIFdL coding polypeptide with human gamma interferon activity of molar mass 3.06 Md (4.642 "т.п.о."), and physical map presented on dwg 1. is engineered. Said plasmid DNA pTrcIFdL is used to prepare BL21 (DE3)/pTrcIFdL strain, a producer of polypeptide with human gamma interferon activity.

EFFECT: invention allows preparing polypeptide with biological activity of human gamma interferon and improved thermal stability, and increasing its biosynthesis level.

2 cl, 2 dwg, 5 ex

FIELD: biotechnologies.

SUBSTANCE: recombinant DNA is produced, which codes functionally active hybrid protein (BrdGl7ACA-cbd), consisting of amino-acid sequence of acylase glutaryl-7- aminocephalosporanic acid of strain Brevundimonas diminuta All-Russian collection of industrial microorganisms B-1297 and chitin-binding domain of chitinase Al Bacillus circulans. Recombinant plasmid pSVH0108 is constructed for expression of BrdGl7ACA-cbd in cells E.coli, containing sequence of recombinant DNA that codes hybrid protein under control of promotor and terminator of RNA-polymerase of phage T7. As a result of E.coli strain tranformation with this recombinant plasmid and selection of transformed clones, a new strain E.coli BL21(DE3)/pSVH0108 cbd is produced - producer of hybrid protein BrdGl7ACA-cbd.

EFFECT: high yield of recombinant ferment.

4 dwg, 2 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention relates to new staphylokinase derivatives which represent expression products in heterogeneous system of mutant genes obtained by local gene PCR-mutagenesis ← wild type enzyme and differ from respective native staphylokinase form in one or more amino acid substitutions between 104 and 113 amino acid residues that leads to formation of RGD or KGD sequence in said site. Obtained recombinant staphylokinase derivatives (RGD/KGD-Sak), as well as variants thereof having deletions of 1-16 amino acids from NH2-terminal combine properties of thrombolitic and antocoagulating agents and are characterized by decreased polymerization ability and immunogenicity in contrast to wild type enzyme.

EFFECT: new effective agents for thrombosis preventing and treatment.

25 cl, 3 dwg, 3 tbl, 2 ex

Up!