Akt activity inhibitors

FIELD: chemistry.

SUBSTANCE: described are novel substituted naphthyridines of general formula E: (radicals R1 and R3 are described in the claim), pharmaceutically acceptable salts thereof, a pharmaceutical composition containing said compounds, and use of the novel compounds to prepare a medicinal agent for treating or preventing malignant tumours in mammals.

EFFECT: compounds inhibit Akt acitivity, in particular, the compounds selectively inhibit one or two isoforms of Akt and can be used in medicine.

5 cl, 14 tbl, 9 ex

 

The level of technology

The invention relates to substituted compounds naphthiridine, which are inhibitors of the activity of one or more isoforms of serine/ser / thr kinase, Akt (also called PKB; hereafter referred to as "Akt"). The present invention also relates to pharmaceutical compositions containing such compounds, and to methods of using such compounds for the treatment of malignant tumors.

Apoptosis (programmed cell death) plays an important role in embryonic development and pathogenesis of various diseases, such as degenerative diseases of the nervous system, cardiovascular diseases and malignant tumors. Recent work has led to the identification of various products of Pro - and protivopolozhnyh genes that are involved in the regulation or the implementation of programmed cell death. Expression protivopolozhnyh genes, such as Bcl2 or Bcl-xL, inhibits apoptotic cell death induced by various stimuli. On the other hand, expression proapoptotic genes, such as Bax or Bad, leads to programmed cell death (Adams et al. Science 281: 1322-1326 (1998)). The implementation of programmed cell death mediated by proteases, related caspase-1, including caspase-3, caspase-7, caspase-8 and caspase-9, etc. (Thornberry et al. Scince, 281: 1312-1316 (1998)).

The path of the phosphatidylinositol-3'-OH kinase (PI3K)/Akt apparently plays an important role in the regulation of cell viability/cell death (Kulik et al. Mol. Cell. Biol. 17: 1595-1606 (1997); Franke et al, Cell, 88: 435-437 (1997); Kauffmann-Zeh et al. Nature 385: 544-548 (1997) Hemmings, Science, 275: 628-630 (1997); Dudek et al., Science 275: 661-665 (1997)). Factors of viability, such as obtained from platelet growth factor (PDGF), nerve growth factor (NGF) and insulin-like growth factor-1 (IGF-I), increase cell viability in various conditions through the induction of PI3K activity (Kulik et al. 1997, Hemmings 1997). Activated PI3K leads to the production of phosphatidylinositol-(3,4,5)-triphosphate (Ptdlns(3,4,5)-P3), which, in turn, binds and stimulates the activation of serine/ser / thr kinase Akt, which contains a domain of homology with pleckstrin (PH) (Franke et al., Cell, 81: 727-736 (1995); Hemmings Science, 277: 534 (1997); Downward, Curr. Opin. Cell Biol. 10: 262-267 (1998), Alessi et al., EMBO J. 15: 6541-6551 (1996)). Specific PI3K inhibitors or dominant negative mutants of Akt suppresses increase the viability of the activity of these growth factors or cytokines. Previously it was found that inhibitors of PI3K (LY294002 or wortmannin) blocked the activation of Akt kinases, located in the cascade above. In addition, the introduction of constitutively active mutants of PI3K or Akt promotes cell viability under conditions in which normal cells are exposed to death due to apoptosis CL is current (Kulik et al. 1997, Dudek et al. 1997).

Identified three representatives of the subfamily Akt regulated secondary messengers serine/treoninove protein kinases, which are called Akt1/PKBα, Akt2/PKBβ and Akt3/PKBγ (hereinafter called "Akt1", "Akt2 and Akt3), respectively. The homologous isoforms, especially in the regions encoding the catalytic domains. Akt is activated by phosphorylation events occurring in response to a signal transmission PI3K. PI3K phosphorylates membrane inositolphosphorylceramide, forming a secondary messenger, phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,4-bisphosphate, which has been shown to be associated with the PH domain of Akt. The modern model of the activation of Akt requires the involvement of the enzyme in the membrane 3'-phosphorylated by phosphoinositide where the regulatory phosphorylation site of Akt kinases, located in the cascade above (B.A. Hemmings, Science 275: 628-630 (1997); BA. Hemmings, Science 276: 534 (1997); J. Downward, Science 279: 673-674 (1998)).

The Akt1 phosphorylation occurs in two regulatory sites, Thr308in the activation loop of the catalytic domain, and Ser473near the carboxyl end (D. R. Alessi et al. EMBO J. 15: 6541-6551 (1996) and R. Meier et al. J. Biol. Chem. 272: 30491-30497 (1997)). Equivalent regulatory phosphorylation sites are found in Akt2 and Akt3. Above the cascade kinase, which phosphorylates Akt at the website of the activation loop, was cloned and named as 3'-phosphoinositide-dependent protein kinase 1 (PDK1). PDK1 phosphorylates not only Akt, but also the kinase p70 ribosomal protein S6, p90RSK, serum and regulated by glucocorticoid kinase (SGK), and protein kinase C. above the kinase cascade, fosforiliruyusciye regulatory site of Akt near the carboxyl end, has not yet been identified, but in a recent message assumes the role associated with integrin kinase (ILK-I), serine/ser / thr protein kinase, or autophosphorylation.

Analysis of the levels of Akt in human tumors showed that Akt2 sverkhekspressiya a large number of malignant tumors of the ovary (J. Q. Cheng et al. Proc. Natl. Acad. Sci. USA 89: 9267-9271 (1992)) and pancreas (J. Q. Cheng et al. Proc. Natl. Acad. Sci. USA 93: 3636-3641 (1996)). Similarly discovered that Akt3 sverkhekspressiya in cell lines breast cancer and prostate (Nakatani et al. J. Biol. Chem. 274: 21528-21532 (1999)).

The tumor suppressor PTEN, phosphatase proteins and lipids, which removes specific 3'-phosphate (Ptdins(3,4,5)-P3, is a negative regulator of the pathway PI3K/Akt (Li et al. Science 275: 1943-1947 (1997), Stambolic et al. Cell 95: 29-39 (1998), Sun et al. Proc. Natl. Acad. Sci. U.S.A. 96: 6199-6204 (1999)). Mutations of PTEN germline responsible for malignant syndromes, such as Cowden's disease is (Liaw et al. Nature Genetics 16: 64-67 (1997)). PTEN disappears in a large percentage of human tumors, and in the lines of tumor cells without functional PTEN observed elevated levels of aktivirovani the th Akt (Li et al. above, Guldberg et al. Cancer Research 57: 3660-3663 (1997), Risinger et al. Cancer Research 57: 4736-4738 (1997)).

Such observations show that the path of the PI3K/Akt plays an important role in the regulation of survival of cells or apoptosis in the formation of tumors.

Inhibition of the activation and activity of Akt can be achieved by inhibition of PI3K such inhibitors as LY294002 and wortmannin. However, inhibition of PI3K may indiscriminately to affect not only all three isozyme Akt, but also on other containing PH-domain transmit signal molecules, which depend on PdtIns(3,4,5)-P3, such as the Tec family tyrosinekinase. In addition, it was found that Akt can be activated by growth signals, which are not dependent on PI3K.

Alternative Akt activity can be ingibirovany by blocking the activity above, in a cascade of kinase PDK1. It was not revealed specific inhibitors of PDK1. Again, inhibition of PDK1 could lead to inhibition of multiple kinases, the activity of which is dependent on PDK1, such as atypical isoforms of PKC, SGK, and S6 kinase (Williams et al. Curr. Biol. 10:439-448 (2000)).

The aim of the present invention is to provide new compounds which are inhibitors of Akt. Also the aim of the present invention to provide pharmaceutical compositions which contain the novel compounds which are inhibitors of Akt.

Also the purpose of this image is etenia is a method of treating a malignant tumor, which includes the introduction of such inhibitors of Akt activity.

The invention

The present invention relates to substituted compounds naphthiridine that inhibit the activity of Akt. In particular, the claimed compounds selectively inhibit one or more isoforms of Akt. The invention also relates to compositions containing such inhibiting compounds, and to methods of inhibiting the activity of Akt by introducing the compound to a patient in need of treatment of malignant tumors.

Detailed description of the invention

Compounds according to the present invention is applicable to inhibiting the activity of serine/ser / thr kinase Akt. In the first embodiment of the present invention, the inhibitors of Akt activity are represented by formula A:

in which:

E, F, G, H, I, J, K, L and M are independently selected from C or N, where each E, F, G, H, I, J, K, L and M optionally substituted R1;

a is 0 or 1; b is 0 or 1; m is 0, 1 or 2; p is independently 0, 1, 2, 3, 4 or 5;

the ring Z is selected from (C3-C8)cycloalkyl, aryl, heteroaryl and heterocyclyl;

R1selected from a carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, is alogena, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl and (C=O)aOb-heterocyclyl, with the specified alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted by one or more substituents selected from R6;

R2independently selected from a carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, SH, S(O)mNR7R8, S(O)m-(C1-C10)alkyl and (C=O)aOb-heterocyclyl, with the specified alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted by one or more substituents selected from R6;

R3independently selected from a carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8, CN, (CO) aOb(C3-C8)cycloalkyl, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl, (C1-C6)Alkylglucoside and (C=O)aOb-heterocyclyl, with the specified alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted by one or more substituents selected from R6;

R6means (C=O)aObC1-C10-alkyl, (C=O)aOb-aryl, C2-C10alkenyl, C2-C10-quinil, (C=O)aOb-heterocyclyl, CO2H, halogen, CN, OH, ObC1-C6-perfluoroalkyl, Oa(C=O)bNR7R8oxoprop, CHO, (N=O)R7R8, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl or (C=O)aObC3-C8-cycloalkyl, with the specified alkyl, aryl, alkenyl, quinil, heterocyclyl and cycloalkyl optionally substituted by one or more substituents selected from R6a;

R6aselected from (C=O)aOb(C1-C10)alkyl, Oa(C1-C3)perfluoroalkyl, (C0-C6)alkylen-S(O)mRaSH, carbonyl group, OH, halogen, CN, (C2-C10)alkenyl, (C2-C10)quinil, (C3-C6)cycloalkyl, (C0-C6)alkylaryl, (C0-C6)accelerationtime, (C0-C6)alkylene-N(R )2C(O)Ra, (C0-C6)alkylene-CO2RaC(O)H, and (C0-C6)alkylene-CO2H, with the specified alkyl, alkenyl, quinil, cycloalkyl, aryl and heterocyclyl optionally has up to three substituents selected from Rb, OH, (C1-C6)alkoxygroup, halogen, CO2H, CN, Oa(C=O)b(C1-C6)alkyl, carbonyl group and N(Rb)2;

R7and R8independently selected from H, (C=O)aOb(C1-C10)alkyl, (C=O)aOb(C3-C8)cycloalkyl, (C=O)aOb-aryl, (C=O)aOb-heterocyclyl, (C2-C10)alkenyl, (C2-C10)quinil, SH, SO2Raand (C=O)aNRb2while specified alkyl, cycloalkyl, aryl, heterocyclyl, alkenyl and quinil optionally substituted by one or more substituents selected from R6aor R7and R8together with the nitrogen atom to which they are bound, may form a monocyclic or bicyclic a heterocycle with 3-7 members in each cycle, and optionally containing in addition to the nitrogen atom one or two additional heteroatoms selected from N, O and S, with the specified monocyclic or bicyclic a heterocycle optionally substituted by one or more substituents selected from R6a;

Rameans (C1-C 6)alkyl, (C3-C6)cycloalkyl, aryl or heterocyclyl;

and Rbindependently mean H, (C1-C6)alkyl, aryl, heterocyclyl, (C3-C6)cycloalkyl, (C=O)aOb(C1-C6)alkyl or S(O)mRa;

or their pharmaceutically acceptable salt, or stereoisomer.

In the second embodiment of the present invention, the inhibitors of Akt activity are represented by formula B:

in which

selected from the

R1selected from H, carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl and (C=O)aOb-heterocyclyl, with the specified alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted by one or more substituents selected from R6;

and all other substituents and variables have the values defined in the first embodiment;

or their pharmaceutically acceptable salt, or with whom reasoner.

In the third embodiment of the present invention, the inhibitors of Akt activity are represented by formula C:

where q is 0, 1, 2, 3 or 4; r is 0, 1, 2, 3, 4, or 5; t is 2, 3, 4, 5 or 6;

Q is independently selected from a carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl and (C=O)aOb-heterocyclyl, with the specified alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted by one or more substituents selected from R6a;

R4and R5independently selected from H, (C1-C6)alkyl and (C1-C6)perfluoroalkyl, or R4and R5merged to form -(CH2)t-where one of the carbon atoms is optionally replaced by a residue selected from O, S(O)m, -N(Rb)C(O)- and-N(CORa)-;

and all other substituents and variables have the values defined in the second embodiment;

or their pharmaceutically acceptable salt, or stereoisomer.

In the fourth embodiment, the inhibitors according infusion is his invention represented by the formula D:

in which all other substituents and variables have the values defined in the third embodiment;

or their pharmaceutically acceptable salt, or stereoisomer.

In the fifth embodiment, the inhibitors according to the present invention represented by the formula E:

in which a is 0 or 1; b is 0 or 1; m is 0, 1 or 2;

R1selected from H, carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl and (C=O)aOb-heterocyclyl, with the specified alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted by one or more substituents selected from R6;

R3independently selected from H, carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C -C8)cycloalkyl, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl, (C1-C6)Alkylglucoside and (C=O)aOb-heterocyclyl, with the specified alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted by one or more substituents selected from R6;

R6means (C=O)aObC1-C10-alkyl, (C=O)aOb-aryl, C2-C10alkenyl, C2-C10-quinil, (C=O)aOb-heterocyclyl, CO2H, halogen, CN, OH, ObC1-C6-perfluoroalkyl, Oa(C=O)bNR7R8oxoprop, CHO, (N=O)R7R8, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl or (C=O)aObC3-C8-cycloalkyl, with the specified alkyl, aryl, alkenyl, quinil, heterocyclyl and cycloalkyl optionally substituted by one or more substituents selected from R6a;

R6aselected from (C=O)aOb(C1-C10)alkyl, Oa(C1-C3)perfluoroalkyl, (C0-C6)alkylen-S(O)mRaSH, carbonyl group, OH, halogen, CN, (C2-C10)alkenyl, (C2-C10)quinil, (C3-C6)cycloalkyl, (C0-C6)alkylaryl, (C0-C6)accelerationtime, (C0-C6)alkylene-N(Rb)2C(O)Ra , (C0-C6)alkylene-CO2RaC(O)H, and (C0-C6)alkylene-CO2H, with the specified alkyl, alkenyl, quinil, cycloalkyl, aryl, and heterocyclyl optionally has up to three substituents selected from Rb, OH, (C1-C6)alkoxygroup, halogen, CO2H, CN, Oa(C=O)b(C1-C6)alkyl, carbonyl group and N(Rb)2;

R7and R8independently selected from H, (C=O)aOb(C1-C10)alkyl, (C=O)aOb(C3-C8)cycloalkyl, (C=O)aOb-aryl, (C=O)aOb-heterocyclyl, (C2-C10)alkenyl, (C2-C10)quinil, SH, SO2Raand (C=O)aNRb2while specified alkyl, cycloalkyl, aryl, heterocyclyl, alkenyl and quinil optionally substituted by one or more substituents selected from R6aor R7and R8together with the nitrogen atom to which they are bound, may form a monocyclic or bicyclic a heterocycle with 3-7 members in each cycle, and optionally containing in addition to the nitrogen atom one or two additional heteroatoms selected from N, O and S, with the specified monocyclic or bicyclic a heterocycle optionally substituted by one or more substituents selected from R6a;

Rameans (C1-C6)alkyl, (C3 -C6)cycloalkyl, aryl or heterocyclyl;

and Rbindependently mean H, (C1-C6)alkyl, aryl, heterocyclyl, (C3-C6)cycloalkyl, (C=O)aOb(C1-C6)alkyl or S(O)mRa;

or their pharmaceutically acceptable salt, or stereoisomer.

In the sixth embodiment, the inhibitors according to the present invention represented by the formula F:

in which R4and R5independently mean H, and (C1-C6)alkyl, where the specified alkyl optionally has up to three substituents selected from OH and halogen; and R4and R5may be associated with the formation of (C3-C7)cycloalkyl; and

all other substituents and variables have the values defined in the fifth embodiment;

or their pharmaceutically acceptable salt, or stereoisomer.

In the seventh embodiment, the inhibitors according to the present invention represented by formula F,

in which:

R1selected from H, NH2, OH, and (C1-C6)alkyl;

R4and R5independently mean H, and (C1-C6)alkyl;

or their pharmaceutically acceptable salt, or stereoisomer.

In the eighth embodiment, the inhibitors according to the present invention represented by the formula G:

in which a is 0 or 1; b is 0 or 1; m is 0, 1 or 2;

<> Q is selected from heterocyclyl, which is optionally substituted by one or more substituents selected from R6a;

R1selected from H, carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl and (C=O)aOb-heterocyclyl, with the specified alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted by one or more substituents selected from R6;

R4and R5independently mean H, (C1-C6)alkyl, (C1-C6)alkenyl, (C1-C6)quinil where the specified alkyl optionally has up to three substituents selected from OH and halogen; and R4and R5taken together can form a (C3-C7)cycloalkyl, with the specified cycloalkyl optionally has up to three substituents selected from R6;

R6means (C=O)aObC1-C10-alkyl, (C=O)aOb-aryl, C2-C10alkenyl, C2-C10-quinil, (C=O)aOb-heterocyclyl, CO2H,halogen, CN, OH, ObC1-C6-perfluoroalkyl, Oa(C=O)bNR7R8oxoprop, CHO, (N=O)R7R8, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl or (C=O)aObC3-C8-cycloalkyl, with the specified alkyl, aryl, alkenyl, quinil, heterocyclyl and cycloalkyl optionally substituted by one or more substituents selected from R6a;

R6aselected from (C=O)aOb(C1-C10)alkyl, Oa(C1-C3)perfluoroalkyl, (C0-C6)alkylen-S(O)mRaSH, carbonyl group, OH, halogen, CN, (C2-C10)alkenyl, (C2-C10)quinil, (C3-C6)cycloalkyl, (C0-C6)alkylaryl, (C0-C6)accelerationtime, (C0-C6)alkylene-N(Rb)2C(O)Ra, (C0-C6)alkylene-CO2RaC(O)H, and (C0-C6)alkylene-CO2H, with the specified alkyl, alkenyl, quinil, cycloalkyl, aryl and heterocyclyl optionally have up to three substituents selected from Rb, OH, (C1-C6)alkoxygroup, halogen, CO2H, CN, Oa(C=O)b(C1-C6)alkyl, carbonyl group and N(Rb)2;

R7and R8independently selected from H, (C=O)aOb(C1-C10)alkyl, (C=O)aOb(C3-C8)cycloalkyl, (C=O)aO -aryl, (C=O)aOb-heterocyclyl, (C2-C10)alkenyl, (C2-C10)quinil, SH, SO2Raand (C=O)aNRb2while specified alkyl, cycloalkyl, aryl, heterocyclyl, alkenyl and quinil optionally substituted by one or more substituents selected from R6aor R7and R8taken together with the nitrogen atom to which they are bound, may form a monocyclic or bicyclic a heterocycle with 3-7 members in each cycle, and optionally containing in addition to the nitrogen atom one or two additional heteroatoms selected from N, O and S, with the specified monocyclic or bicyclic a heterocycle optionally substituted by one or more substituents selected from R6a;

Rameans (C1-C6)alkyl, (C3-C6)cycloalkyl, aryl or heterocyclyl; and

Rbindependently mean H, (C1-C6)alkyl, aryl, heterocyclyl, (C3-C6)cycloalkyl, (C=O)aOb(C1-C6)alkyl or S(O)mRa;

or their pharmaceutically acceptable salt, or stereoisomer.

In the ninth embodiment, the inhibitors according to the present invention represented by the formula H:

in which R1means heterocyclyl, with specified heterocyclyl optionally substituted with one Tr is two substituents, selected from (C1-C6)alkyl, OH, halogen and NH2;

R6aselected from the

or their pharmaceutically acceptable salt, or stereoisomer.

In the tenth embodiment, the inhibitors according to the present invention represented by the formula H:

in which R1selected from

and all other substituents and variables have the values defined in the ninth embodiment;

or their pharmaceutically acceptable salt, or stereoisomer.

In the eleventh embodiment, the inhibitors according to the present invention represented by the formula J:

in which a is 0 or 1; b is 0 or 1; m is 0, 1 or 2;

R1selected from CF3H, carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl and (C=O)aOb-heterocyclyl, with the specified alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted with one to six substituents selected from R6;

R3'and R3”ezavisimo selected from CF 3H, carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, halogen, OH, Ob(C1- C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl, (C1-C6)Alkylglucoside and (C=O)aOb-heterocyclyl, with the specified alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted with one to five substituents selected from R6; or R3'and R3”taken together with the nitrogen atom to which they are bound, may form a piperidine or pyrrolidine, which optionally can be substituted by one to five substituents selected from R6;

R4and R5independently mean H, (C1-C6)alkyl, (C1-C6)alkenyl, (C1-C6)quinil, with the specified alkyl optionally has up to three substituents selected from OH and halogen; and R4and R5taken together can form a (C3-C7)cycloalkyl, with the specified cycloalkyl optionally has up to three substituents selected from R6;

R6means CF3(C=O)aObC1-C10-Ala is l, (C=O)aOb-aryl, C2-C10alkenyl, C2-C10-quinil, (C=O)aOb-heterocyclyl, CO2H, halogen, CN, OH, ObC1-C6-perfluoroalkyl, Oa(C=O)bNR7R8oxoprop, CHO, (N=O)R7R8, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl or (C=O)aObC3-C8-cycloalkyl, with the specified alkyl, aryl, alkenyl, quinil, heterocyclyl and cycloalkyl optionally substituted with one to five substituents selected from R6a;

R6aselected from CF3(C=O)aOb(C1-C10)alkyl, Oa(C1-C3)perfluoroalkyl, (C0-C6)alkylen-S(O)mRaSH, carbonyl group, OH, halogen, CN, (C2-C10)alkenyl, (C2-C10)quinil, (C3-C6)cycloalkyl, (C0-C6)alkylaryl, (C0-C6)accelerationtime, (C0-C6)alkylene-N(Rb)2(C=O)aNRb2C(O)Ra, (C0-C6)alkylene-CO2RaC(O)H, and (C0-C6)alkylene-CO2H, with the specified alkyl, alkenyl, quinil, cycloalkyl, aryl and heterocyclyl optionally has up to three substituents selected from Rb, OH, (C1-C6)alkoxygroup, halogen, CO2H, CN, Oa(C=O)b(C1-C6)alkyl, carbonyl group and N(Rb)2 ;

R7and R8independently chosen from-CF3H, (C=O)aOb(C1-C10)alkyl, (C=O)aOb(C3-C8)cycloalkyl, (C=O)aOb-aryl, (C=O)aOb-heterocyclyl, (C2-C10)alkenyl, (C2-C10)quinil, SH, SO2Raand (C=O)aNRb2while specified alkyl, cycloalkyl, aryl, heterocyclyl, alkenyl and quinil optionally substituted with one to five substituents selected from R6a; or R7and R8taken together with the nitrogen atom to which they are bound, may form a monocyclic or bicyclic a heterocycle with 3-7 members in each cycle, and optionally containing in addition to the nitrogen atom one or two additional heteroatoms selected from N, O and S, with the specified monocyclic or bicyclic a heterocycle optionally substituted with one to six substituents selected from R6a;

Rameans (C1-C6)alkyl, NRb2, (C3-C6)cycloalkyl, aryl or heterocyclyl; and

Rbindependently mean H, (C1-C6)alkyl, NH2, aryl, heterocyclyl, (C3-C6)cycloalkyl, (C=O)aOb(C1-C6)alkyl or S(O)mRa;

or their pharmaceutically acceptable salt or stereoisomer.

Specific compounds according to the present image the structure include:

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (1-4);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-ol (1-5);

9-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (1-6);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-thiol (1-7);

3-methyl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-2);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-3);

3-(chloromethyl)-9-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-4);

3-[(4-methylpiperazin-1-yl)methyl]-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-5); and

2-({[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methyl}amino)ethanol (2-6);

or their pharmaceutically acceptable salts, or stereoisomers.

Examples of compounds according to the present invention include TFU-salts of the following compounds:

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-a]-1,6-naphthiridine-3-amine (1-4);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-ol (1-5);

9-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (1-6);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-thiol (1-7);

3-methyl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-2);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-3);

9-(chloromethyl)-9-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-4);

3-[(4-methylpiperazin-1-yl)methyl]-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-5);

2-({[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methyl}amino)ethanol (2-6);

3-(3-methyl-1H-1,2,4-triazole-5-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-9);

3 imidazo[2,1-b][1,3]thiazol-6-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-10);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-[1,2,4]triaz the lo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-11);

3 imidazo[1,2-a]pyridine-2-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-12);

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (13-3);

5-[({4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}amino)methyl]pyridine-2-ol (13-8);

N1N1,2,2-tetramethyl-N3-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propane-1,3-diamine (13-9);

N3-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-N1-(4-hydroxyphenyl)-beta-alaninemia (14-6);

1-[4-(9-phenyl-3-pyridin-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-13);

4-[3-(1-methyl-5-phenyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-41);

1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-1-benzothieno-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-42);

1-{4-[3-(1-isopropyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-43);

1-{4-[9-phenyl-3-(1,4,5,6-tetrahydrocyclopent[c]pyrazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16 to 44);

1-[4-(3-cyclopropyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-48);

1-{4-[9-phenyl-3-(trifluoromethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-49;

1-{4-[3-(5-methyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-50);

1-{4-[3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-51);

4-[3-(1H-indol-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-52);

1-{4-[3-(1-methyl-1H-imidazol-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-53);

1-{4-[3-(3-methyl-2H-lambda5-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-54);

4-[3-(6-chloroimidazo[1,2-a]pyridine-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-55);

1-{4-[3-(1H-benzimidazole-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-56);

4-[3-(5-cyclopropyl-4H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-57);

1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-1H-indazol-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-58);

4-[9-phenyl-3-(3-phenyl-1H-pyrazole-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-59);

1-(4-{9-phenyl-3-[3-(trifluoromethyl)-1H-pyrazole-5-yl][1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine (16-60);

1-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-61);

1-{4-[3-(1-benzyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-62);

1-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-on tilidin-8-yl)phenyl]methanamine (16-63);

4-[9-phenyl-3-(1-phenyl-1H-pyrazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-64);

1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-2-benzothieno-1-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-65);

1-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethane-1,2-diol (16-68);

4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}imidazolidin-2-it (16-69);

(2R)-2-amino-2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethanol (16-70);

(2R)-2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-2-(methylamino)ethanol (16-71);

1-[4-(3-ethyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (17-6);

1-[4-(9-phenyl-3-propyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (17-7);

1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropylamine (33-5);

1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}of cyclopropylamine (33-6);

1-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropylamine (33-7);

N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-4-yl-2-furamide (39-2);

(3-methyl-9-phenyl-8-(4-{1-[(pyridine-3-ylacetic)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-43);

3-methyl-9-phenyl-8-(4-{1-[(quinoline-3-ylcarbonyl)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-44);

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{1-[(pyridine-3-ylacetic)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-46);

1-[4-(9-ethyl-2-phenyl[1,2,4]triazolo[4',3':1,6]pyrido[2,3-b]pyrazin-3-yl)phenyl]cyclopropylamine (42-6); and

1-[4-(9-ethyl-3-phenyl[1,2,4]triazolo[4',3':1,6]pyrido[2,3-b]pyrazin-2-yl)phenyl]cyclopropylamine (42-7);

or stereoisomers.

Examples of compounds according to the present invention include salts of formic acid the following compounds:

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (1-4); and

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-ol (1-5);

or stereoisomers.

Specific compounds according to the present invention include:

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (1-4);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-ol (1-5);

9-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (1-6);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-thiol (1-7);

3-methyl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-16-naphthiridine (2-2);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-3);

3-(chloromethyl)-9-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-4);

3-[(4-methylpiperazin-1-yl)methyl]-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-5);

2-({[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methyl}amino)ethanol (2-6);

8-(4-aminomethylphenol)-9-phenyl-[1,2,4]triazolo[3,4-f][1,6]naphthiridine-3-ol (3-8);

1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (4-3);

4-(3-methyl-9-phenyl-[1,2,4]triazolo[3,4-f][1,6]naphthiridine-8-yl)benzylamine (5-3);

8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (6-2);

1-[4-(9-phenyl-[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (7-4); and

9-phenyl-8-{4-[4-(5-pyridin-2-yl-4H-[1,2,4]triazole-3-yl)piperidine-1-ylmethyl]phenyl}-[1,2,4]triazolo[3,4-f][1,6]naphthiridine (8-10)

or their pharmaceutically acceptable salts, or stereoisomers.

Examples of compounds according to the present invention include HCl salts of the following compounds:

8-(4-aminomethylphenol)-9-phenyl-[1,2,4]triazolo[3,4-f][1,6]naphthiridine-3-ol (3-8);

1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (4-3);

4-(3-methyl-9-phenyl-[1,2,4]triazolo[3,4-f][1,6]naphthiridine-8-yl)is ansilumen (5-3);

8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (6-2); and

1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (7-4);

3-(1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-5);

tert-butyl[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methylcarbamate (9-6);

[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol (9-7);

5-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]-2,4-dihydro-3H-1,2,4-triazole-3-one (9-8);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-(1H-1,2,4-triazole-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-13);

3-(1H-benzimidazole-6-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-14);

3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-15);

3 imidazo[1,2-a]pyrimidine-2-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-16);

5-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-espiridion-2-amine (9-17);

9-phenyl-3-pyrazolo[1,5-a]pyrimidine-3-yl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl)phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-18);

3-(5-methyl-1H-pyrazole-3-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-19);

3-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]pyridine-2-amine (9-20);

4-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]phenol (9-21);

3-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]phenol (9-22);

2-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]phenol (9-23);

1-{4-[3-(5-oxo-4,5-dihydro-1H-1,2,4-triazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}piperidine-4-carboxamide (9-24);

1-[4-(3-imidazo[1,2-a]pyridine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]piperidine-4-carboxamide (9-25);

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (13-3);

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (13-4);

N-[2-(4-methyl-1H-imidazol-2-yl)ethyl]-N-{4-[3-(1-methyl-1H-imide is evil-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}amine (13-5);

N1-(2-hydroxyphenyl)-N3-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}beta alaninemia (13-6);

1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}piperidine-4-carboxamide (13-7);

3-hydroxy-2,2-dimethyl-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-10);

2-fluoro-3-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-11);

2.2-debtor-3-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-12);

2,3-dihydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-13);

4-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]cyclohexanamine (13-14);

4-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]cyclohexanamine (13-15);

3-hydroxy-2,2-dimethyl-N-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propan-1-amine (13-16);

3-hydroxy-2,2-dimethyl-N-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-17);

3-hydroxy-2,2-dimethyl-N-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-18);

3-hydroxy-2,2-dimethyl-N-{4-[9-phenyl-3-(1H-1,2,3-triazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propane-1-a is in (13-19);

N-{4-[3-(ammoniacal)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-3-hydroxy-2,2-DIMETHYLPROPANE-1-amine (13-21);

N3-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-N1-(2-hydroxyphenyl)-beta-alaninemia (14-4);

(8-{4-[(cyclohexylamino)methyl]phenyl}-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl)methanol (14-5);

[9-phenyl-8-(4-{[4-(5-pyridin-3-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol (14-7);

l-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}piperidine-4-carboxamide (14-8);

1-{4-[3-(1-oxidability-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-4);

1-[4-(3,9-diphenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-5);

1-{4-[3-(4-forfinal)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (sheet 16-6);

4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}benzonitrile (16-7);

4-(9-phenyl-3-pyrimidine-4-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzylamine (16-8);

1-{4-[3-(1-oxidability-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-9);

5-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}pyridine-2-ol (16-10);

1-[4-(9-phenyl-3-pyridin-3-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-11);

4-(9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzylamine(16-12);

1-[4-(9-phenyl-3-pyrazin-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-14);

1-{4-[9-phenyl-3-(1H-1,2,4-triazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-15);

1-{4-[9-phenyl-3-(1,3-thiazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-16);

1-{4-[9-phenyl-3-(1H-pyrazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-17);

1-{4-[3-(3-methyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-18);

1-{4-[3-(3-methyl-1H-1,2,4-triazole-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-19);

1-{4-[3-(1-methyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-20);

1-{4-[9-phenyl-3-(1,2,5-thiadiazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-21);

1-{4-[9-phenyl-3-(1,2,3-thiadiazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-22);

1-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-3-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-23);

{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methanamine (16-24);

{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methanol (16-25);

1-{4-[9-phenyl-3-(2,2,2-triptorelin)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-26);

1-{4-[9-phenyl-3-(1H-tetrazol-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-27);

8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,-naphthiridine-3-carboxamide (16-28);

1-{4-[3-(1H-imidazol-1-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-29);

1-(4-{3-[(methylsulphonyl)methyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine (16-30);

{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}acetonitrile (16-31);

2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethanol (16-32);

N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)ndimethylacetamide (16-33);

1-[4-(3-imidazo[1,2-a]pyridine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16 to 36);

1-[4-(3-imidazo[2,1-b][1,3]thiazol-6-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-38);

1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-40);

1-(4-{9-phenyl-3-[(2R)-pyrrolidin-2-yl][1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine (16 to 44);

1-(4-{9-phenyl-3-[(2S)-pyrrolidin-2-yl][1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine (16-45);

4-[3-(1-amino-ethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-46);

1-{4-[3-(1H-imidazol-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-47);

1-{4-[9-phenyl-3-(5,6,7,8-tetrahydroimidazo[1,2-a]pyridine-2-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-66);

2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}propan-2-amine (16-67);

1-{4-[3-(5-utilization-3-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-72);

5-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-2,4-dihydro-3H-1,2,4-triazole-3-one (16-73);

6-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-4,5-dihydropyridine-3(2H)-she (16-74);

6-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}pyridazin-3(2H)-she (16-75);

N-(4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}phenyl)ndimethylacetamide (16-76);

1-{4-[3-(4-phenoxyphenyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-77);

1-{4-[3-(1H-benzimidazole-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-78);

(4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}phenyl)methanol (16-79);

4-[3-(4-cyclohexylphenol)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-80);

4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-1,3-dihydro-2H-imidazol-2-it (16-81);

1-{4-[3-(4-methyl-1H-imidazol-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-82);

4-[9-phenyl-3-(1-propyl-1H-imidazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-83);

1-{4-[3-(1-isopropyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-84);

1-{4-[3-(1-butyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-85);

1-[4-(3-imidazo[1,2-a]pyrimidine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine the (16-86);

1-(6-methoxypyridine-3-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]methanamine (17-4);

N-[(2-methoxypyridine-5-yl)methyl]-N-[4-(3-methyl-9-phenyl [1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amine (17-5);

9-phenyl-3-(1H-1,2,3-triazole-4-yl)-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (21-4);

1-{4-[9-phenyl-3-(3H-lambda43-thiazol-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (22-4);

1-{4-[9-phenyl-3-(1H-pyrazole-3-yl)-2H-lambda5-[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (22-5);

1-{4-[9-phenyl-3-(1,3-thiazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (22-6);

1-{4-[3-(azetidin-1-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (26-3);

1-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)piperidine-4-carboxamide (26-4);

1-{4-[3-(morpholine-4-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (26-5);

2-[({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)amino]ethanol (26-6);

1-(4-{3-[(4-methylpiperazin-1-yl)methyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine (26-7);

4-[9-phenyl-3-(piperazine-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (26-8);

N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)-N-methylamine (26-9);

N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]what triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)-N,N-dimethylamine (26-10);

3-methyl-9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (31-1);

1-{4-[9-phenyl-3-(5,6,7,8-tetrahydroimidazo[1,2-a][pyridine-2-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}of cyclopropylamine (33-8);

1-[4-(9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropylamine (33-9);

1-{4-[3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}of cyclopropylamine (33-10);

(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (34-5);

(1R)-1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (34-6);

(1R)-1-{4-[9-phenyl-3-(5-pyridin-2-yl-1H-pyrazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}of ethanamine (35-1);

(1R)-1-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}ethanamine (35-2);

(1R)-1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}of ethanamine (35-3);

(1R)-1-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (35-4);

(1R)-1-[4-(3-imidazo[2,1-b][1,3]thiazol-6-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (35-5);

(1R)-1-[4-(9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (35-6);

(1R)-1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-1-amine (36-1);

2-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-2-amine (37-4)

2-[4-(9-Fe is Il[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-2-amine (38-1);

3-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine (39-1);

N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-3-yl-2-furamide (39-3);

N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-3-yl-1H-pyrrole-3-carboxamide (39-4);

4-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)of the research (39-7);

2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxetanone (39-8);

4-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine (39-9);

2,4-dihydroxy-6-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyrimidine (39-10);

2-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine (39-11);

3-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine (39-12);

3-methyl-9-phenyl-8-[4-({[(pyridine-3-ylamino)carbonyl]amino}methyl)phenyl][1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-14);

3-methyl-9-phenyl-8-(4-{[(pyridine-3-ylcarbonyl)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-20);

3-methyl-9-phenyl-8-(4-{[(quinoline-3-ylcarbonyl)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-26);

8-(4-{[(1H-benzimidazole-1-ylacetic)amino]methyl}phenyl)-3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-29);

8-(4-{[(1H-benzimidazole-2-yl is cetil)amino]methyl}phenyl)-3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-30);

3-methyl-8-[4-({[(6-morpholine-4-espiridion-3-yl)carbonyl]amino}methyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-34);

3-methyl-9-phenyl-8-(4-{[(3-pyridin-3-ylpropyl)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-37);

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[(pyridine-3-ylacetic)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-38);

9-phenyl-3-pyrazolo[1,5-a]pyrimidine-3-yl-8-(4-{[(pyridine-3-ylacetic)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-39);

N-{(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}-2-pyridine-3-ylacetamide (39-47); and

N-((1R)-1-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}ethyl)-2-pyridin-3-ylacetamide (39-49);

or stereoisomers.

Additional specific compounds according to the present invention include:

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (1-4);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-ol (1-5);

9-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (1-6);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-thiol (1-7);

3-methyl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[34-f]-1,6-naphthiridine (2-2);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-3);

3-(chloromethyl)-9-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-4);

3-[(4-methylpiperazin-1-yl)methyl]-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-5);

2-({[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methyl}amino)ethanol (2-6);

8-(4-aminomethylphenol)-9-phenyl-[1,2,4]triazolo[3,4-f][1,6]naphthiridine-3-ol (3-8);

1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-16-naphthiridine-8-yl)phenyl]methanamine (4-3);

4-(3-methyl-9-phenyl-[1,2,4]triazolo[3,4-f][1,6]naphthiridine-8-yl)benzylamine (5-3);

8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (6-2);

1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (7-4);

9-phenyl-8-{4-[4-(5-pyridin-2-yl-4H-[1,2,4]triazole-3-yl)-piperidine-1-ylmethyl]phenyl}-[1,2,4]triazolo[3,4-f][1,6]naphthiridine (8-10);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-(1H-1,2,3-triazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-4);

3-(1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-5);

tert-butyl[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-on tilidin-3-yl]methylcarbamate (9-6);

[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol (9-7);

5-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]-2,4-dihydro-3H-1,2,4-triazole-3-one (9-8);

3-(3-methyl-1H-1,2,4-triazole-5-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-9);

3 imidazo[2,1-b][1,3]thiazol-6-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-10);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-11);

3 imidazo[1,2-a]pyridine-2-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-12);

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-(1H-1,2,4-triazole-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-13);

3-(1H-benzimidazole-6-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-14);

3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-15);

3 imidazo[1,2-a]pyrimidine-2-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-16-naphthiridine (9-16);

5-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]pyridine-2-amine (9-17);

9-phenyl-3-pyrazolo[1,5-a]pyrimidine-3-yl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-18);

3-(5-methyl-1H-pyrazole-3-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-19);

3-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]pyridine-2-amine (9-20);

4-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]phenol (9-21);

3-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]phenol (9-22);

2-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]phenol (9-23);

1-{4-[3-(5-oxo-4,5-dihydro-1H-1,2,4-triazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}piperidine-4-carboxamide (9-24);

1-[4-(3-imidazo[1,2-a]pyridine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]piperidine-4-carboxamide (9-25);

9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (10-4);

9-phenyl-8-(4-{[4-(5-pyrimidine-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-(1H-1,2,3-triazole-4-the l)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (11-4);

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyrimidine-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (12-1);

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (13-3);

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (13-4);

N-[2-(4-methyl-1H-imidazol-2-yl)ethyl]-N-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}amine (13-5);

N1-(2-hydroxyphenyl)-N3-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-beta-alaninate (13-6);

1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl} - piperidine-4-carboxamide (13-7);

5-[({4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}amino)methyl]pyridine-2-ol (13-8);

N1N1,2,2-tetramethyl-N3-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propane-1,3-diamine (13-9);

3-hydroxy-2,2-dimethyl-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-10);

2-fluoro-3-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-11);

2.2-debtor-3-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-12);

2,3-dihydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-13);

4-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]cyclohexanamine (13-14);

4-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]cyclohexanamine (13-15);

3-hydroxy-2,2-dimethyl-N-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propan-1-amine (13-16);

3-hydroxy-2,2-dimethyl-N-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-17);

3-hydroxy-2,2-dimethyl-N-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine (13-18);

3-hydroxy-2,2-dimethyl-N-{4-[9-phenyl-3-(1H-1,2,3-triazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propan-1-amine (13-19);

tert-butyl{[8-(4-{[(3-hydroxy-2,2-dimethylpropyl)amino]methyl}phenyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methyl}carbamate (13-20);

N-{4-[3-(ammoniated)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-3-hydroxy-2,2-DIMETHYLPROPANE-1-amine (13-21);

[9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol (14-3);

N3-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-N1-(2-hydroxyphenyl)-beta-alaninate (14-4);

(8-{4-[(cyclohexylamino)methyl]phenyl}-9-phenyl[1,2,4]triazolo[3,4-f]1,6-naphthiridine-3-yl)methanol (14-5);

N3-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-N1-(4-hydroxyphenyl)-beta-alaninate (14-6);

[9-phenyl-8-(4-{[4-(5-pyridin-3-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol (14-7);

1-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}piperidine-4-carboxamide (14-8);

{8-[4-(1-aminocyclopropane)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methanol (15-2);

1-[4-(9-phenyl-3-pyridin-4-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-3);

1-{4-[3-(1-oxidability-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-4);

1-[4-(3,9-diphenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-5);

1-{4-[3-(4-forfinal)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (sheet 16-6);

4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}benzonitrile (16-7);

4-(9-phenyl-3-pyrimidine-4-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzylamine (16-8);

1-{4-[3-(1-oxidability-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-9);

5-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}pyridine-2-ol (16-10);

1-[4-(9-phenyl-3-pyridin-3-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-11);

4-(9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzylamine (16-12);

1-[4-(9-phenyl-3-pyridin-2-yl[1,2,4]triazolo[3,4-f-1,6-naphthiridine-8-yl)phenyl]methanamine (16-13);

1-[4-(9-phenyl-3-pyrazin-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-14);

1-{4-[9-phenyl-3-(1H-1,2,4-triazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-15);

1-{4-[9-phenyl-3-(1,3-thiazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-16);

1-{4-[9-phenyl-3-(1H-pyrazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-17);

1-{4-[3-(3-methyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-18);

1-{4-[3-(3-methyl-1H-1,2,4-triazole-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-19);

1-{4-[3-(1-methyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-20);

1-{4-[9-phenyl-3-(1,2,5-thiadiazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-21);

1-{4-[9-phenyl-3-(1,2,3-thiadiazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-22);

1-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-3-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-23);

{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methanamine (16-24);

{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methanol (16-25);

1-{4-[9-phenyl-3-(2,2,2-triptorelin)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-26);

1-{4-[9-phenyl-3-(1H-tetrazol-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-27);

8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-to Roxane (16-28);

1-{4-[3-(1H-imidazol-1-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-29);

1-(4-{3-[(methylsulphonyl)methyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine (16-30);

{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}acetonitrile (16-31);

2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethanol (16-32);

N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)ndimethylacetamide (16-33);

4-[3-(2-methylimidazo[1,2-a]pyridine-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-34);

1-[4-(9-phenyl-3-pyrazolo[1,5-a]pyridine-3-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-35);

1-[4-(3-imidazo[1,2-a]pyridine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16 to 36);

1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-1,2-benzisoxazol-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-37);

1-[4-(3-imidazo[2,1-b][1,3]thiazol-6-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-38);

1-{4-[3-(1-methyl-1H-imidazol-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-39);

1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-40);

4-[3-(1-methyl-5-phenyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-41);

1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-1-benzothieno-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine(16-42);

1-{4-[3-(1-isopropyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-43);

1-{4-[9-phenyl-3-(1,4,5,6-tetrahydrocyclopent[c]pyrazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16 to 44);

1-(4-{9-phenyl-3-[(2S)-pyrrolidin-2-yl][1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine (16-45);

4-[3-(1-amino-ethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-46);

1-{4-[3-(1H-imidazol-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-47);

1-[4-(3-cyclopropyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-48);

1-{4-[9-phenyl-3-(trifluoromethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-49);

1-{4-[3-(5-methyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-50);

1-{4-[3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-51);

4-[3-(1H-indol-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-52);

1-{4-[3-(1-methyl-1H-imidazol-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-53);

1-{4-[3-(3-methyl-2H-lambda5-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-54);

4-[3-(6-chloroimidazo[1,2-a]pyridine-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-55);

1-{4-[3-(1H-benzimidazole-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-56);

4-[3-(5-cyclopropyl-4H-is irsol-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-57);

1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-1H-indazol-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-58);

4-[9-phenyl-3-(3-phenyl-1H-pyrazole-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-59);

1-(4-{9-phenyl-3-[3-(trifluoromethyl)-1H-pyrazole-5-yl][1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine (16-60);

1-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-61);

1-{4-[3-(1-benzyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-62);

1-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4}triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-63);

4-[9-phenyl-3-(1-phenyl-1H-pyrazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-64);

1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-2-benzothieno-1-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-65);

1-{4-[9-phenyl-3-(5,6,7,8-tetrahydroimidazo[1,2-a]pyridine-2-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-66);

2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}propan-2-amine (16-67);

1-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethane-1,2-diol (16-68);

4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}imidazolidin-2-he (16-69);

(2R)-2-amino-2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethanol (16-70);

(2R)-2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-2-(m is thylamino)ethanol (16-71);

1-{4-[3-(5-utilization-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-72);

5-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-2,4-dihydro-3H-1,2,4-triazole-3-one (16-73);

6-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-4,5-dihydropyridine-3(2H)-he (16-74);

6-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}pyridazin-3(2H)-he (16-75);

N-(4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}phenyl)ndimethylacetamide (16-76);

1-{4-[3-(4-phenoxyphenyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-77);

1-{4-[3-(1H-benzimidazole-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-78);

(4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}phenyl)methanol (16-79);

4-[3-(4-cyclohexylphenol)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-80);

4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-1,3-dihydro-2H-imidazol-2-he (16-81);

1-{4-[3-(4-methyl-1H-imidazol-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-82);

4-[9-phenyl-3-(1-propyl-1H-imidazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (16-83);

1-{4-[3-(1-isopropyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-84);

1-{4-[3-(1-butyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (16-85);

1-[4-(3-imide is zo[1,2-a]pyrimidine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-86);

5-({[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}methyl)pyridin-2-ol (17-3);

1-(6-methoxypyridine-3-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]methanamine (17-4);

N-[(2-methoxypyridine-5-yl)methyl]-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amine (17-5);

1-[4-(3-ethyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (17-6);

1-[4-(9-phenyl-3-propyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (17-7);

N-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (18-1);

4-({[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}methyl)phenol (19-1);

1-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanamine (20-1);

9-phenyl-3-(1H-1,2,3-triazole-4-yl)-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (21-4);

1-{4-[3-(1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (22-3);

1-{4-[9-phenyl-3-(3H-lambda43-thiazol-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (22-4);

1-{4-[9-phenyl-3-(1H-pyrazole-3-yl)-2H-lambda5-[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (22-5);

1-{4-[9-phenyl-3-(1,3-thiazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (22-6);

4-[9-phenyl-3-(pyrrolidin-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (26-2);

1-{4-[3-(Aset the DIN-1-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (26-3);

1-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)piperidine-4-carboxamide (26-4);

1-{4-[3-(morpholine-4-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (26-5);

2-[({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)amino]ethanol (26-6);

1-(4-{3-[(4-methylpiperazin-1-yl)methyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine (26-7);

4-[9-phenyl-3-(piperazine-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (26-8);

N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)-N-methylamine (26-9);

N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)-N,N-dimethylamine (26-10);

[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanol (28-1);

{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanol (28-2);

1-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanol (29-2);

9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (30-1);

3-methyl-9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (31-1);

9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-ol (32-1);

1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropane (33-5);

1-{4-[3-(1-meth is l-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}cyclopropane (33-6);

1-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropane (33-7);

1-{4-[9-phenyl-3-(5,6,7,8-tetrahydroimidazo[1,2-a]pyridine-2-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}cyclopropane (33-8);

1-[4-(9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropane (33-9);

1-{4-[3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}cyclopropane (33-10);

(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (34-5);

(1R)-1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (34-6);

(1R)-1-{4-[9-phenyl-3-(5-pyridin-2-yl-1H-pyrazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}ethanamine (35-1);

(1R)-1-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}ethanamine (35-2);

(1R)-1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}ethanamine (35-3);

(1R)-1-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (35-4);

(1R)-1-[4-(3-imidazo[2,1-b][1,3]thiazol-6-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (35-5);

(1R)-1-[4-(9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (35-6);

(1R)-1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-1-amine (36-1);

2-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-2-amine (37-4);

2-[4-(9-phenyl[1,2,4]t is Iesolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-2-amine (38-1);

3-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine (39-1);

N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-4-yl-2-furamide (39-2);

N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-3-yl-2-furamide (39-3);

N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-3-yl-1H-pyrrol-3-carboxamide (39-4);

2-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (39-5);

tert-butyl(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)carbamate (39-6);

4-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)morpholine (39-7);

2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxetanone (39-8);

4-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine (39-9);

2,4-dihydroxy-6-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyrimidine (39-10);

2-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine (39-11);

3-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine (39-12);

N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-pyrazin-2-ylacetamide (39-13);

3-methyl-9-phenyl-8-[4-({[(pyridine-3-ylamino)carbonyl]amino}methyl)phenyl][1,24]triazolo[3,4-f]-1,6-naphthiridine (39-14);

2-(2-hydroxyphenyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (39-15);

2-(3-hydroxyphenyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (39-16);

2-(4-hydroxyphenyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (39-17);

2-(3,4-dihydroxyphenyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (39-18);

N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-phenylacetamide (39-19);

3-methyl-9-phenyl-8-(4-{[(pyridine-3-ylcarbonyl)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-20);

2-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]benzamide (39-21);

2-(4-hydroxyphenyl)-2-methyl-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propanamide (39-22);

methyl-4-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-4-oxobutanoate (39-23);

2-hydroxy-N-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)benzamide (39-24);

N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-(5-phenyl-4H-1,2,4-triazole-3-yl)ndimethylacetamide (39-25);

3-methyl-9-phenyl-8-(4-{[(quinoline-3-ylcarbonyl)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-26);

N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-(4-oxoindole-3(4H)-yl)ndimethylacetamide (39-27);

N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthyridin the-8-yl)benzyl]-2-(2-oxo-1,3-benzoxazol-3(2H)-yl)ndimethylacetamide (39-28);

8-(4-{[(1H-benzimidazole-1-ylacetic)amino]methyl}phenyl)-3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-29);

8-(4-{[(1H-benzimidazole-2-ylacetic)amino]methyl}phenyl)-3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-30);

2-(4-methyl-1,2,5-oxadiazol-3-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (39-31);

2-(1H-indazol-1-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (39-32);

2-(5,6-dimethyl-4-oxathiane[2,3-d]pyrimidine-3(4H)-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (39-33);

3-methyl-8-[4-({[(6-morpholine-4-espiridion-3-yl)carbonyl]amino}methyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-34);

2-(6-chloropyridin-3-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (39-35);

3-cyano-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propanamide (39-36);

3-methyl-9-phenyl-8-(4-{[(3-pyridin-3-ylpropyl)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-37);

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[(pyridine-3-ylacetic)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-38);

9-phenyl-3-pyrazolo[1,5-a]pyrimidine-3-yl-8-(4-{[(pyridine-3-ylacetic)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-39);

N-(3-hydroxy-2,2-dimethylpropyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (39-40);

N-(3-hydroxy-2,2-dimethylpropyl)-N-{4-[3-(1-methyl-1H-imidazol-4-and the)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-2-(4-oxoindole-3(4H)-yl)ndimethylacetamide (39-41);

tert-butyl{2-[[4-(3-{[(tert-butoxycarbonyl)amino]methyl}-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl](3-hydroxy-2,2-dimethylpropyl)amino]-2-oxoethyl}carbamate (39-42);

3-methyl-9-phenyl-8-(4-{1-[(pyridine-3-ylacetic)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6 - naphthiridine (39-43);

3-methyl-9-phenyl-8-(4-{1-[(quinoline-3-ylcarbonyl)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-44);

N-{1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropyl}-2-(4-oxoindole-3(4H)-yl)ndimethylacetamide (39-45);

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{1-[(pyridine-3-ylacetic)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (39-46);

N-{(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}-2-pyridine-3-ylacetamide (39-47);

N-{(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}ndimethylacetamide (39-48);

N-((1R)-1-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}ethyl)-2-pyridin-3-ylacetamide (39-49);

N-{1-methyl-1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}ndimethylacetamide (39-50); and

N-{1-methyl-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}ndimethylacetamide (39-51);

or their pharmaceutically acceptable salts, or stereoisomers.

Compounds according to the present invention may have asymmetric centers, chiral axes, and chiral planes (as described in: E.L. Eliel and S.H. Wilen, Stereochemistry of Carbon Compounds, John Wiley amp; Sons, New York, 1994, pp.1119-1190), and occur as racemates, racemic mixtures and as individual diastereomers, with all possible isomers and mixtures thereof, including optical isomers and all stereoisomers are included in the present invention.

In addition, the compounds disclosed herein may exist as tautomers, and assumes that both tautomeric forms are included within the scope of the invention, even if depicted only one tautomeric structure. For example, in the scope of the present invention include the following compounds:

Tetrazole exist as a mixture of 1H/2H-tautomers. Tautomeric forms of the remainder of tetrazole also included in the scope of the present invention.

When any variable (for example, R2and so on) appears more than once in any component, its definition in each case is independent from the definition in any other case. Also, combinations of substituents and variables are permissible only if such combinations result in the formation of stable compounds. The line shown passing inside of cyclic systems from substituents indicate that the indicated bond may be formed with any substitutable atom in the cycle. If the ring system is a bicyclic, I mean that the bond formed is any suitable atom in any cycle bicyclic residue.

It is clear that specialist in this area can include one or more silicon atoms (Si) into compounds according to the present invention instead of the one or more carbon atoms with formation of compounds that are chemically stable and that can be easily synthesized by methods known in this field, from readily available starting materials. The atoms of carbon and silicon differ in their covalent radii, which results in differences in bond length and spatial location when comparing similar links C-element and Si element. These differences lead to subtle changes in the size and shape of the silicon-containing compounds compared to carbon compounds. The person skilled in the art it will be clear that the differences in size and shape can lead to a barely noticeable or significant changes in efficiency, solubility, lack not directed to the target activity, the property changes, styling, etc. (Diass, J. O. et al. Organometallics (2006) 5: 1188-1198; Showell, G.A. et al. Bioorganic and Medicinal Chemistry Letters (2006) 16: 2555-2558).

It is clear that the person skilled in the art can choose the substituents and the nature of the substitution of the compounds according to the present invention, to obtain compounds that are chemically stable and that can be easily synthesized by methods known is in this area, as well as in the ways described below, from readily available starting materials. If the Deputy is itself substituted by more than one group, it is clear that such a large group can be one and the same carbon atom or from different carbon atoms, provided that the result is a stable structure. The phrase "optionally substituted by one or more substituents" should be understood as equivalent to the phrase "optionally substituted with at least one Deputy, and in such cases the preferred option will have from zero to four substituents, more preferred option will have from zero to three substituents.

Used in this sense is understood that the term "alkyl" includes saturated aliphatic hydrocarbon group as branched and unbranched chain having the specified number of carbon atoms. For example, C1-C10as in the expression(C1-C10)alkyl" includes groups, having 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms, arranged in a linear or branched chain. For example, "(C1-C10)alkyl", in particular, includes methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, etc.

The term "cycloalkyl" means monocyclic nasy the military aliphatic hydrocarbon group, having the specified number of carbon atoms. For example, "cycloalkyl" includes cyclopropyl, methylcyclopropyl, 2,2-dimethylcyclobutyl, 2-ethylcyclopentane, cyclohexyl, etc.

"Alkoxygroup" means either cyclic or acyclic alkyl group with the specified number of carbon atoms linked by oxygen bridge. Therefore, the term "alkoxygroup" covers the definition of alkyl and cycloalkyl above.

Unless the number of carbon atoms, the term "alkenyl" refers to non-aromatic hydrocarbon radical with unbranched chain, branched chain or cyclic, containing from 2 to 10 carbon atoms and at least one carbon-carbon double bond. Preferably there is one carbon-carbon double bond, and may contain up to four non-aromatic carbon-carbon double bonds. Thus, (C2-C10)alkenyl" means alkanniny radical having from 2 to 10 carbon atoms. Alkeneamine groups include ethynyl, propenyl, butenyl, 2-methylbutanal and cyclohexenyl. Having an unbranched chain, branched chain or cyclic part alkenylphenol group may contain double bonds and may be substituted if specified, substituted Alchemilla group.

The term "quinil" refers to hydrocarbon radicals which have from unbranched chain, branched chain or cyclic, containing from 2 to 10 carbon atoms and at least one carbon-carbon triple bond. May contain up to three carbon-carbon triple bonds. Thus, (C2-C10)quinil" means alkynylaryl radical having from 2 to 10 carbon atoms. Alkyline group include ethinyl, PROPYNYL, butynyl, 3-methylbutanal etc. Having an unbranched chain, branched chain or cyclic part alkenylphenol group may contain a triple bond and may be substituted if specified, substituted Alchemilla group.

In some cases, the substituents can be defined with the range of number of carbon atoms, which includes zero, for example (C0-C6)alkylaryl. If we assume that the aryl is a phenyl, the definition will include phenyl as such, and-CH2Ph, -CH2CH2Ph, CH(CH3)CH2CH(CH3)Ph, etc.

Used in this sense imply that "aryl" shall mean any stable monocyclic or bicyclic carbon cycle, with up to 7 atoms in each cycle, at least one cycle is aromatic. Examples of such aryl groups include phenyl, naphthyl, tetrahydronaphthyl, indanyl and biphenyl. In cases where aryl Deputy is bi is ilicheskom and one cycle is non-aromatic, it is clear that binding occurs through the aromatic cycle.

The term heteroaryl used in this description means a stable monocyclic or bicyclic ring system, with up to 7 atoms in each cycle, at least one cycle is aromatic and contains from 1 to 4 heteroatoms selected from the group consisting of O, N and S. Heteroaryl groups within the scope of this definition include, without limitation: acridines, carbazolyl, cinnoline, honokalani, pyrazolyl, indolyl, benzotriazolyl, furanyl, thienyl, benzothiazyl, benzofuranyl, chinoline, ethenolysis, oxazolyl, isoxazolyl, indolyl, pyrazinyl, pyridazinyl, pyridinyl, pyrimidinyl, pyrrolyl, tetrahydroquinolin. As in the case of the heterocycle below also understand that heteroaryl" includes N-oxide derivative of any nitrogen-containing heteroaryl. In cases where heteroaryl Deputy is bicyclic, and one cycle is non-aromatic or contains no heteroatoms, it is clear that the binding is established through an aromatic cycle or by containing heteroatoms cycle, respectively. Such heteroaryl residues in the case of a substituent Q include, without limitation: 2-benzimidazolyl, 2-chinoline, 3-chinoline, 4-chinoline, 1-ethenolysis, 3-from chinoline and 4-ethenolysis.

The term "heterocycle" or "heterocyclyl" used in this description means 3-10-membered aromatic or nonaromatic a heterocycle containing from 1 to 4 heteroatoms selected from the group consisting of O, N and S, and includes bicyclic groups. Therefore, "heterocyclyl" includes the above heteroaryl and their dihydro and tetrahydro analogs. Additional examples of "heterocyclyl" include without limitation the following groups: benzoimidazolyl, benzoimidazolyl, benzofuranyl, benzofurazanyl, benzimidazolyl, benzotriazolyl, benzothiophene, benzoxazole, carbazolyl, carbolines, cinnoline, furanyl, imidazolyl, indolinyl, indolyl, indolizinyl, indazoles, isobenzofuranyl, isoindolyl, ethanolic, isothiazolin, isoxazolyl, naphthyridine, oxadiazole, oxazole, oxazoline, isoxazoline, oxetanyl, pyranyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridopyrimidines, pyridazinyl, pyridyl, pyrimidyl, pyrrolyl, hintline, hinely, honokalani, tetrahydropyranyl, tetrazolyl, tetrasulphides, thiadiazolyl, thiazolyl thienyl, triazolyl, azetidine, 1,4-dioxane, hexahydroazepin, piperazinil, piperidinyl, pyridine-2-IMT, pyrrolidinyl, morpholinyl, thiomorpholine, dihydrobenzofuranyl, dihydrobenzofuranyl, dihydrobenzofuranyl, dihydroisoxazole, dihydrofurane, dihydroimidazo is poured, dihydroindole, dihydroisoxazole, dihydroisoxazole, dihydroimidazole, dihydrooxazolo, dihydropyrazine, dihydropyrazolo, dihydropyridines, dihydropyrimidines, dihydropyrrole, dihydroquinoline, dihydrotetrazolo, dihydrothiazolo, dihydrothiazolo, dehydration, dihydrotriazine, dihydroisocodeine, methylenedioxybenzyl, tetrahydrofuranyl and tetrahydrothieno and their N-oxides. Linking heterocyclyl Deputy can occur through a carbon atom or through a heteroatom.

As will be clear to experts in this field, it is understood that "halogen" used in this sense includes chlorine (Cl), fluorine (F), bromine (Br) and iodine (I).

In an embodiment of formulas A, B, C, or D residue represented by the formula:

includes the following structures, which are only illustrative and not limiting:

In another embodiment of formula A, B, C, or D residue represented by the formula:

represents:

In one embodiment, ring Z is selected from phenyl and heterocyclyl. In another ring Z is selected from

In yet another embodiment, ring Z represents phenyl.

In one embodiment, p is independently 0, 1, 2, or 3.

The following ia ante p is independently equal to 0, 1 or 2.

In another embodiment, p is independently equal to 1.

In one embodiment, r is 0, 1, 2, or 3.

In the following embodiment, r is 0, 1 or 2.

In another embodiment, r is equal to 1.

In one embodiment, Q is selected from benzimidazolyl, benzimidazolinyl, benzofuranyl, benzofurazanyl, benzimidazolyl, benzotriazolyl, benzothiophene, benzoxazole, carbazolyl, carboline, cinnoline, furanyl, imidazolyl, indolinyl, indolyl, indolizinyl, indazole, isobenzofuranyl, isoindolyl, izochinolina, isothiazoline, isoxazole, naphthyridine, oxadiazole, oxazole, oxazoline, isoxazoline, oxetanyl, pyranyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridopyrimidines, pyridazinyl, pyridyl, pyrimidyl, pyrrolyl, heatline, chinoline, khinoksalinona, tetrahydropyranyl, tetrazolyl, tetrasulphide, thiadiazolyl, thiazolyl, teinila, triazolyl, azetidine, 1,4-dioxane, hexahydroazepin, piperazinil, piperidine, pyridine-2-onila, pyrrolidinyl, morpholinyl, thiomorpholine, dihydrobenzofuranyl, dihydrobenzofuranyl, dihydrobenzofuranyl, dihydroisoxazole, dihydrofurane, dihydroimidazole, dihydroindole, dihydroisoxazole, dihydroisoxazole, dihydroimidazole, dihydrooxazolo, dihydropyrazine, dihydropyrazolo, dihydropyridine, dihydropyrimidine, di is hydropyrolysis, dihydroquinoline, dihydrotetrazolo, dihydrothiazolo, dihydrothiazolo, dihydrothieno, dihydrotriazine, dihydroisocodeine, methylenedioxybenzyl, tetrahydrofuranyl and tetrahydrothieno and their N-oxides, optionally substituted with one to three substituents selected from R6a. Linking heterocyclyl Deputy may occur through a carbon atom or through a heteroatom.

In the following embodiment, Q is selected from 2-azapirone, benzimidazolyl, benzimidazolinyl, 2-diazepinone, imidazolyl, 2-imidazolidinone, indolyl, izochinolina, morpholinyl, piperidyl, piperazinil, pyridyl, pyrrolidinyl, 2-piperidine, 2-pyrimidinone, 2-pyrolidinone, chinoline, tetrazolyl, tetrahydrofuryl, tetrahydroisoquinoline and tanila, optionally substituted with one to three substituents selected from R6a. Linking heterocyclyl Deputy may occur through a carbon atom or through a heteroatom.

In yet another embodiment, when Q means heterocyclyl, Q is selected from

which optionally is substituted by one to three substituents selected from R6a.

In yet another embodiment, when Q means heterocyclyl, Q is selected from

which optionally is substituted by one Deputy, selected from R6a.

In one embodiment, R1selected from a carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, S(O)2NR7R8, SH, S(O)2-(C1-C10)alkyl and (C=O)aOb-heterocyclyl, where specified, the alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted R6a.

In another embodiment, R1selected from a carbonyl group (C=O)aOb(C1-C10)alkyl, CO2H, halogen, OH, CN, (C1-C6)alkoxygroup, S(O)2NR7R8, SH, S(O)2-(C1-C10)alkyl, O(C=O)(C1-C6)alkyl and N(Rb)2where the specified alkyl optionally substituted by R6a.

In another embodiment, R1selected from a carbonyl group, NH2, OH, SH, Oa(C1-C6)alkyl, where the specified alkyl optionally substituted by R6a.

In one embodiment, R1selected from H, carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb/sub> (C2-C10)quinil, CO2H, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, S(O)2NR7R8, SH, S(O)2-(C1-C10)alkyl and (C=O)aOb-heterocyclyl, where specified, the alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted R6a.

In another embodiment, R1selected from H, carbonyl group (C=O)aOb(C1-C10)alkyl, CO2H, halogen, OH, CN, (C1-C6)alkoxygroup, S(O)2NR7R8, SH, S(O)2-(C1-C10)alkyl, O(C=O)(C1-C6)alkyl and N(Rb)2where the specified alkyl optionally substituted by R6a.

In another embodiment, R1selected from H, carbonyl group, NH2, OH, SH, Oa(C1-C6)alkyl, where the specified alkyl optionally substituted by R6a.

In one embodiment, R2selected from a carbonyl group (C=O)aOb(C1-C10)alkyl, (C=O)aOb-aryl, (C=O)aOb(C2-C10)alkenyl, (C=O)aOb(C2-C10)quinil, CO2H, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, S(O)2NR7R8, S(O)2-(C1-C10)alkyl and (C=O)aOb-heteros who was tilila, where specified, the alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted Rb, OH, (C1-C6)alkoxygroup, halogen, CO2H, CN, O(C=O)(C1-C6)alkyl, exography and N(Rb)2.

In another embodiment, R2selected from a carbonyl group (C=O)aOb(C1-C10)alkyl, CO2H, halogen, OH, CN, (C1-C6)alkoxygroup, O(C=O)(C1-C6)alkyl, (C2-C10)alkenyl and N(Rb)2where the specified alkyl optionally substituted by Rb, OH, (C1-C6)alkoxygroup, halogen, CO2H, CN, O(C=O)(C1-C6)alkyl, exography and N(Rb)2.

In one embodiment, R3selected from H, carbonyl group, Ob(C1-C10)alkyl, Ob-aryl, Ob(C2-C10)alkenyl, Ob(C2-C10)quinil, halogen, OH, Ob(C1-C6)perfluoroalkyl, (C=O)aNR7R8CN, (C=O)aOb(C3-C8)cycloalkyl, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl, (C1-C6)Alkylglucoside and (C=O)aOb-heterocyclyl, where specified, the alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted by one or more substituents selected from R6.

In another embodiment, R3selected from (C1-C10)alkyl, Ari is a, (C2-C10)alkenyl, (C2-C10)quinil, halogen, NR7R8CN, (C3-C8)cycloalkyl, S(O)mNR7R8, SH, S(O)m-(C1-C10)alkyl, (C1-C6)Alkylglucoside and (C=O)aOb-heterocyclyl, where specified, the alkyl, aryl, alkenyl, quinil, cycloalkyl and heterocyclyl optionally substituted by one or more substituents selected from R6.

In another embodiment, R3selected from (C1-C10)alkyl, with the specified alkyl optionally substituted with one to three substituents selected from NH2, OH, carbonyl group and halogen.

In another embodiment, R4and R5mean H.

In one embodiment, when Q is replaced by R6aspecified R6ais heterocyclyl, optionally having up to three substituents selected from Rb, OH, (C1-C6)alkoxygroup, halogen, CO2H, CN, Oa(C=O)b(C1-C6)alkyl, carbonyl group and N(Rb)2.

In another embodiment, when Q is replaced by R6aspecified R6aselected from

optionally substituted by 1-3 substituents selected from the carbonyl group, OH, N(Rb)2, halogen and Oa(C1-C6)alkyl.

In one embodiment, Rbindependently selected from H and (C1-C6)alkyl.

In one variation of formula J R4/sup> and R5independently mean H and CH3or R4and R5may be associated with the formation of cyclopropyl.

In the scope of the present invention included the free form of compounds of the formula A and their pharmaceutically acceptable salts and stereoisomers. Some specific selected compounds described in this description as examples, are protonated salts of amine compounds. The term "free form" refers to amine compounds in mesolevel form. Included in the invention pharmaceutically acceptable salts include not only the individual salts are given as examples of specific compounds described in this publication, but also all the typical pharmaceutically acceptable salt free form of compounds of formula A. Free form described specific compound in the form of a salt may be isolated by methods known in this field. For example, the free form can be restored by treatment of the salt with a suitable dilute aqueous solution of a base, such as dilute aqueous NaOH solution, potassium carbonate, ammonia and sodium bicarbonate. Available forms, to some extent, may differ from their respective salt forms in certain physical properties, such as solubility in polar solvents, but otherwise the salts of the slot and grounds pharmaceutically equivalent to the corresponding free forms for the purposes of the invention.

Pharmaceutically acceptable salts of the proposed compounds can be synthesized from compounds according to the present invention, which contain the residue of a base or acid, conventional chemical methods. In General the salts of the basic compounds are given either ion exchange chromatography or by reaction of the free base with stoichiometric amounts or with an excess of the desired salt forming inorganic or organic acid in a suitable solvent or various combinations of solvents. Similarly salts of acidic compounds formed by reaction with a suitable inorganic or organic base.

Thus, pharmaceutically acceptable salts of the compounds according to the present invention include conventional non-toxic salts of the compounds according to the present invention, which is formed in the interaction of the compounds according to the invention in the form of a base with an inorganic or organic acid. For example, conventional non-toxic salts include salts derived from inorganic acids such as hydrochloric, Hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like, as well as salts derived from organic acids such as acetic, propionic, succinic, glycolic, stearic, Molon what I malic, tartaric, citric, ascorbic, Panova, maleic, hydroxymaleimide, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluensulfonate, methanesulfonate, ethicality, oxalic acid, setinova, triperoxonane (TFU), etc.

In the case where the connection according to the present invention is acidic, the term "pharmaceutically acceptable salt" refers to salts derived from pharmaceutically acceptable non-toxic bases, including inorganic bases and organic bases. Salts derived from inorganic bases include aluminum salts, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, trivalent manganese, divalent manganese, potassium, sodium, zinc and the like. Especially preferred are salts of ammonium, calcium, magnesium, potassium and sodium. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as resin-based arginine, betaine, caffeine, choline, N,N1-dibenziletilendiaminom, diethylamine, 2-Diethylaminoethanol, 2-dimethylaminoethanol, this is alumina, Ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, geranamine, Isopropylamine, lysine, methylglucamine, research, piperazine, piperidine, polyominoes resins, procaine, purines, theobromine, triethylamine, trimethylamine, Tripropylamine, tromethamine and the like

Obtain pharmaceutically acceptable salts described above, and other typical pharmaceutically acceptable salts is more fully described in Berg et al., "Pharmaceutical Salts", J. Pharm. Sci., 1977: 66: 1-19.

Also will indicate that the compounds according to the present invention can be an internal salt or zwitterion, as in physiological conditions deprotonirovannym acid residue in the connection, such as a carboxyl group may be anionic, and this electronic charge can then be internally balanced cationic charge protonated or alkylated basic residue, such as Quaternary nitrogen atom.

Applicability

Compounds according to the present invention are inhibitors of Akt activity and thus applicable for the treatment of malignant tumors, in particular malignant tumors associated with abnormal activity of Akt and located in the cascade below the cellular targets of Akt. Such malignancies include, without limitation ovarian cancer, pancreatic glands is, breast cancer and prostate cancer, and malignant tumors (including glioblastoma), in which mutated tumor suppressor PTEN (Cheng et al., Proc. Natl. Acad. Sci. (1992) 89: 9267-9271; Cheng et al., Proc. Natl. Acad. Sci. (1996) 93: 3636-3641; Bellacosa et al., Int. J. Cancer (1995) 64: 280-285; Nakatani et al., J. Biol. Chem. (1999) 274: 21528-21532; Graff, Expert. Opin. Ther. Targets (2002) 6(l): 103-113; and Yamada and Araki, J. Cell Science. (2001) 114: 2375-2382; Mischel and Cloughesy, Brain Pathol. (2003) 13(1): 52-61).

Compounds, compositions and methods proposed in the invention, applicable for the treatment of malignant tumors. Malignant tumors that can be treated by the compounds, compositions and methods according to the invention, include, without limitation:malignant tumors of the heart: sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma;lung: bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated both, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous the hamartoma, mesothelioma;gastrointestinal tract: esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancreas (duct adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors, vipoma), small bowel adenocarcinoma, lymphoma, carcinoid tumors, Kaposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large intestine (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma), colon, colon, rectum, rectum;urinary tract: kidney (adenocarcinoma, Wilm tumor [nephroblastoma], lymphoma, leukemia), bladder and urethra squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), prostate cancer (adenocarcinoma, sarcoma), testis (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, horiokartsinoma, sarcoma, interstitielle-cell carcinoma, fibroma, fibroadenoma, adenomatoid tumor, lipoma);liver:the hepatoma (hepatocellular carcinoma, cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, hemangioma;bones:osteogenic sarcoma (osteosarcoma, fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, abnormal Ewing sarcoma, malignant lymphoma (reticulation sarcoma, multiple myeloma, malignant giant cell tumors, chordomas, osteochondroma (osteo-cartilaginous exostosis), benign chondroma, chondroblastoma, chondromyxoid, osteology osteoma and brain tumors;nervous system:skull (osteoma, hemangioma, granuloma, can the WMD, deforming esteit), meninges (meningioma, meningioma, gliomas), brain (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma [pinealoma], glioblastoma, oligodendroglioma, sandamu, retinoblastoma, congenital tumors), neurofibroma spinal cord (meningioma, glioma, sarcoma);gynecological:uterine (endometrial carcinoma), cervical cancer (carcinoma of the cervix, precancerous cervical dysplasia), ovarian cancer (ovarian carcinoma [the serous cystadenocarcinoma, mulinuu cystadenocarcinoma, unclassified carcinoma], tumor granular-acalnych cells, tumor cells, Sertoli-cells, dysgerminoma, malignant teratoma), vulva (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (clear carcinoma, squamous cell carcinoma, mixed mesoderm tumor (the embryonic rhabdomyosarcoma), fallopian tubes (carcinoma);hematological: blood (myeloid leukemia [acute and chronic], acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, nahodkinskuju lymphoma [malignant lymphoma];leather: malignant melanoma, basal cell carcinoma,squamous cell carcinoma, Kaposi's sarcoma syndrome dysplastic nevus, lipoma, angioma, dermatofibroma, keloids, psoriasis; andthe adrenal glands: neuroblastoma. Thus, the term "cancerous cell", which appears in this description, includes a cell affected by any of the above conditions.

Malignant tumors that can be treated by the compounds, compositions and methods according to the invention, include, without limitation: breast cancer, prostate, colon, colorectal, lung, brain, testes, stomach, pancreas, skin, small intestine, large intestine, throat, head and neck, oral cavity, bone, liver, bladder, kidneys, thyroid gland and blood.

Malignant tumors that can be treated by the compounds, compositions and methods according to the invention include breast cancer, prostate, colon, ovarian, colorectal and lung.

Malignant tumors that can be treated by the compounds, compositions and methods according to the invention include breast cancer, colon (colorectal and lung.

Malignant tumors that can be treated by the compounds, compositions and methods according to the invention include lymphoma and leukemia.

Signal transmission Akt regulates many is estvo important stages of angiogenesis. Shiojima and Walsh, Circ. Res. (2002) 90: 1243-1250. The use of angiogenesis inhibitors for the treatment of malignant tumors is known from the literature, see, for example J. Rak et al. Cancer Research, 55: 4575-4580, 1995 and Dredge et al., Expert Opin. Biol. Ther. (2002) 2(8): 953-966. The role of angiogenesis in the development of malignant tumors is shown in the case of many types of malignant tumors and tissue: breast carcinoma (G. Gasparini and A.L. Harris, J. Clin. Oncol., 1995, 13: 765-782; M. Toi et al., Japan. J. Cancer Res., 1994, 85: 1045-1049); carcinoma of the bladder (A.J. Dickinson et al., Br. J. Urol, 1994, 74: 762-766); carcinoma of the colon (L.M. Ellis et al., Surgery, 1996, 120(5): 871-878) and tumors of the oral cavity (J.K. Williams et al., Am. J. Surg., 1994, 168: 373-380). Other malignant tumors include tumors at a later stage, leukemia, hairy cell, melanoma, head and neck cancer at a late stage, metastatic renal cell cancer, nahodkinskuju lymphoma, metastatic breast cancer, mammary adenocarcinoma, melanoma at a late stage cancer, pancreatic cancer, gastric, glioblastoma, lung cancer, ovarian cancer, non-small cell lung cancer, prostate cancer, small cell lung cancer, renal cell carcinoma, various solid tumors, multiple myeloma, metastatic prostate cancer, malignant glioma, kidney cancer, lymphoma, refractory metastatic disease, refractory multiple myeloma, cervical cancer, Kaposi's sarcoma, recidivism the General the anaplastic glioma and metastatic cancer of the colon (Dredge et al., Expert Opin. Biol. Ther. (2002) 2(8): 953-966). Thus, Akt inhibitors, disclosed in the present application is also applicable to the treatment of these associated with angiogenesis of malignant tumors.

Tumors that have undergone neovascularization are more likely to form metastases. Indeed, angiogenesis is essential for tumor growth and metastasis (S. P. Cunningham, et al., Can. Research, 61: 3206-3211 (2001)). Therefore, Akt inhibitors, disclosed in the present application is also applicable to prevent or reduce metastasis of tumor cells.

In addition, the scope of the invention is included a method of treatment or prophylaxis of diseases, which involve angiogenesis, which is the introduction to a mammal in need of such treatment, a therapeutically effective amount of compound according to the present invention. Associated with neovascularization diseases of the eye are examples of States in which the majority of end tissue damage can be explained by the abnormal growth of blood vessels in the eye (see WO 00/30651, publ. June 2, 2000). Unwanted germination can be run ischemic retinopathy, for example, diabetic retinopathy, retinopathy caused by premature birth, retinal vein occlusion, etc., or degenerative diseases such as x is rogulina neovascularization, observed in the case of age-related macular degeneration. Therefore, the inhibition of blood vessel growth by the introduction of the compounds according to the invention prevents the sprouting of blood vessels and helps to prevent or treat diseases involving angiogenesis, such as eye diseases, such vascularization of the retina, diabetic retinopathy, age-related macular degeneration, etc.

In addition, the scope of the invention is included a method of treatment or prophylaxis of non-cancerous diseases that involve angiogenesis, including, without limitation: eye diseases (such as vascularization of the retina, diabetic retinopathy and age-related macular degeneration, atherosclerosis, arthritis, psoriasis, obesity and Alzheimer's disease (Dredge et al., Expert Opin. Biol. Ther. (2002) 2(8): 953-966). In another embodiment, a method for the treatment or prevention of disease involving angiogenesis including a new method of treatment or prevention of eye diseases (such as vascularization of the retina, diabetic retinopathy and age-related macular degeneration, atherosclerosis, arthritis and psoriasis.

In addition, the scope of the invention is included a method of treating hyperproliferative disorders, such as restenosis, inflammation, autoimmune diseases and allergies/asthma.

In the scope of the present invention also is clucene the use of compounds according to the invention for covering the stent and therefore the use of these compounds covered by them stents for the treatment and/or prevention of restenosis (WO 03/032809).

In addition, the scope of the present invention included the use of compounds according to the invention for the treatment and/or prevention of osteoarthritis (WO 03/035048).

In addition, the scope of the invention is included a method of treating hyperinsulinism.

Compounds according to the invention is also applicable to obtain drugs, which is applicable to the treatment of the above diseases, in particular malignant tumors.

In one embodiment of the invention the proposed connection is a selective inhibitor, inhibiting the effectiveness of which depends on the PH-domain. In this embodiment, the compound exhibits a reduced inhibitory activity in vitro or absence of inhibitory activity in vitro against truncated proteins Akt, lacking the PH domain.

In the following embodiment, the compound according to the present invention is selected from the group consisting of a selective inhibitor of Akt1, selective inhibitor of Akt2 and selective inhibitor of Akt1 and Akt2.

In another embodiment, the compound according to the present invention is selected from the group consisting of a selective inhibitor of Akt1, selective inhibitor of Akt2, selective inhibitor of Akt3 and selective inhibitor of two of the three isoforms of Akt.

In another embodiment, the compound according to the present invention is election what nhibition all three isoforms of Akt, but not an inhibitor of one, two or all of such isoforms of Akt, which has been modified by deletion of the PH domain, hinge region, or both the PH domain and the hinge region.

The present invention also relates to a method for inhibiting the activity of Akt, which includes an introduction to the needy in the mammal pharmaceutically effective amount of compound according to the present invention.

Compounds according to the present invention can be introduced mammals, including humans, either alone or in combination with pharmaceutically acceptable carriers, excipients or diluents in a pharmaceutical composition according to standard pharmaceutical practice. The compounds can be administered orally or parenterally, including intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and local routes of administration.

Pharmaceutical compositions containing the active ingredient may be in a form suitable for oral administration, for example, in the form of tablets, pills, pellets, aqueous and oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Compositions intended for oral use can be obtained by any method known in this area for production is DSTV pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweeteners, corrigentov, dyes and preservatives, to get high-quality and pleasant taste pharmaceuticals. Tablets contain the active ingredient in a mixture with non-toxic pharmaceutically acceptable excipients which are suitable for manufacture of tablets. These excipients may be, for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and dezintegriruetsja tools, such as microcrystalline cellulose, sodium crosscarmellose, corn starch or alginic acid; binding agents, for example starch, gelatin, polyvinylpyrrolidone or the Arabian gum, and moving agents, for example magnesium stearate, stearic acid or talc. Tablets may be uncoated or may be coated by known methods, in order to mask the unpleasant taste of a drug or slow the breakdown and absorption in the gastrointestinal tract and thereby provide a continuous action over a longer period of time. For example, you can use water-soluble masking the taste of a substance, such as hydroxypropylmethylcellulose or hydroxypropylcellulose or amalaysia substance, such as ethylcellulose, acetate-butyrate cellulose.

Preparations for oral administration can also be offered in the form of hard gelatin capsules in which the active ingredient is mixed with an inert diluent, for example calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules in which the active ingredient is mixed with a water-soluble carrier such as polyethylene glycol or an oil medium, for example peanut oil, liquid paraffin or olive oil.

Aqueous suspensions contain the active substance in a mixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspendresume agents, such as sodium carboxymethyl cellulose, methylcellulose, hypromellose, sodium alginate, polyvinylpyrrolidone, tragacanth gum and Arabic gum; dispersing agents or moisturizers can be found in the nature of phosphated, for example lecithin, or condensation products of accelerated with fatty acids, for example polyoxyethylene, or condensation products of ethylene oxide with aliphatic alcohols with longer chains, such as heptadecafluorooctane, or condensation products of ethylene oxide with partial esters derived from fatty acids and exit, such as monooleate polyoxy is transorbital, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexatomic anhydrides, such as monooleate polyethylenimine. Aqueous suspensions can also contain one or more preservatives, for example ethyl-, or n-propyl-p-hydroxybenzoate, one or more dyes, one or more corrigentov and one or more sweeteners, such as sucrose, saccharin or aspartame.

Oil suspensions can be prepared by suspendirovanie active ingredient in a vegetable oil such as peanut oil, olive oil, sesame oil or coconut oil, or vegetable oil such as liquid paraffin. Oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Can be added sweeteners, such as sweeteners, above, and corrigentov to get a palatable oral preparation. In such compositions as preservatives may be added an antioxidant, such as bottled hydroxyanisol or alpha-tocopherol.

Dispersible powders and granules suitable for obtaining aqueous suspension by the addition of water, allow to obtain the active ingredient mixed with dispersing agent or a humectant, suspenders agent and one or more conservative is Tami. Examples of suitable dispersing agents or humectants and suspendida agents are agents that have already been specified above. There may be additional excipients, for example sweetening, corrigentov and dyes. In such compositions as preservatives may be added an antioxidant, such as ascorbic acid.

The pharmaceutical compositions according to the invention can also be in the form of an emulsion of oil in water. The oil phase may be a vegetable oil, such as olive oil or peanut oil, or mineral oil, for example liquid paraffin or mixtures thereof. Suitable emulsifying agents may be naturally occurring phosphatides, for example soy lecithin, and esters or partial esters derived from fatty acids and hexatomic anhydrides, such as monooleate sorbitan, and condensation products of these partial esters with ethylene oxide, such as monooleate of polyoxyethylenesorbitan. The emulsion may also contain sweeteners, corrigentov, preservatives and antioxidants.

Syrups and elixirs can be prepared with a sweetener, such as glycerin, propylene glycol, sorbitol or sucrose. Such preparations may also contain means for reducing irritation, preservatives, corrigentov and dyes and antioxidants.

Pharmaceutical is oppozitsii can be in the form of sterile injectable aqueous solutions. To an acceptable fillers and solvents that can be used include water, ringer's solution and isotonic sodium chloride solution.

The sterile injectable preparation may also be a sterile injecting the microemulsion "oil in water", in which the active ingredient is dissolved in the oil phase. For example, the active ingredient may be first dissolved in a mixture of soybean oil and lecithin. Then the oil solution is injected in a mixture of water and glycerine and process, forming a microemulsion.

Injectable solutions or microemulsions can be injected into the bloodstream of the patient by local bolus injection. Alternative pre-emption may be the introduction of the solution or microemulsion in a way that maintains a constant concentration in the circulating blood of the compounds according to the present invention. To maintain this constant concentration, you can use the device for continuous intravenous delivery. An example of such device is an intravenous pump Deltec CADD-PLUSTMmodel 5400.

The pharmaceutical compositions can be in the form of sterile injectable aqueous or oily suspension for intramuscular and subcutaneous injection. Such suspension may be prepared according to prior art using an approach is appropriate dispersing agents or humectants and suspendida agents, which were described above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a nontoxic acceptable for injecting diluent or solvent, for example in the form of a solution in 1,3-butanediol. In addition, as a solvent or suspension medium is usually used sterile non-volatile oil. For this purpose you can use soft fixed oils, including synthetic mono - or diglycerides. In addition, for the preparation of injection drug use fatty acids such as oleic acid.

The compounds of formula A can also be entered in the form of suppositories for rectal administration of medicinal means. Such compositions can be prepared by mixing the drug with a suitable not irritating excipient, which is solid at normal temperature but becomes liquid at rectal temperature and therefore will melt in the rectum, releasing the drug. Such substances include cocoa butter, glitserinovoye gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols with different molecular weight and esters of fatty acids and polyethylene glycol.

For local applications use creams, ointments, jellies, solutions or suspensions and d, containing the compound of formula A. (for the purposes of this application means for local use include means for washing or rinsing the mouth).

Compounds according to the present invention can be introduced in intranasal form via topical use of suitable intranasal vehicles and devices for the delivery or via transdermal routes, using the forms of transdermal skin patches well known to specialists in this field. In case of introduction in the form of a system for transdermal delivery of the dose, of course, be continuous, not periodic over dosing schedules. Compounds according to the present invention can also be delivered in the form of a suppository using such a framework, as cocoa butter, glitserinovoye gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols with different molecular masses and esters of fatty acids and polyethylene glycol.

In the case where the composition according to the present invention is administered to human, the daily dosage will normally be determined by the attending physician, the dosage generally will vary in accordance with age, weight and response of the particular patient, and the severity of the patient's symptoms.

Scheme dispensing with the use of compounds according to this is the overarching invention can be selected in accordance with many factors, including type, species, age, weight, sex and type of cancer being treated; the severity (i.e. stage) malignant tumor being treated; the route of administration; the functioning of the kidneys and liver of the patient; and the particular applied compound or its salt. Regular attending physician or veterinarian can easily determine and prescribe the effective amount of medicines needed to treat, for example, to prevent, inhibit (fully or partially) or to delay the progression of the disease.

For example, the compounds according to the present invention can be put in a total daily dose of up to 10,000 mg of the Compounds according to the present invention can be injected once a day (QD), or divided into several doses per day, for example twice a day (BID) and three times daily (TID). Compounds according to the present invention can be put in a total daily dose of up to 10,000 mg, such as 2000, 3000, 4000, 6000, 8000, or 10000 mg, which you can enter once a day or divided into several doses per day, as described above.

For example, the compounds according to the present invention can be put in a total daily dose of up to 1000 mg of the Compounds according to the present invention can be injected once a day (QD), or divided into several doses per day, for example twice a day (BID) and three times daily (TID). Connect the deposits according to the present invention can be put in a total daily dose of up to 1000 mg, for example, 200, 300, 400, 600, 800, or 1000 mg, which can be entered as a single dose per day or can be divided into several doses per day, as described above.

In addition, the introduction may be continuous, i.e. for every day or periodically. The terms "periodic" or "occasionally" used in this description means the termination and the beginning of either regular or irregular intervals. For example, the periodic introduction of compounds according to the present invention can provide an introduction from one to six days per week, or may mean the introduction of cycles (e.g., daily administration for two to eight consecutive weeks, then a rest period without introduction during the period of time up to one week), or may mean the introduction through the day.

In addition, the compounds according to the present invention can be entered according to the schemes described above, continuously for several weeks followed by a rest period. For example, the compounds according to the present invention can be entered under any of the schemes described above, from two to eight weeks, followed by a period of rest for one week, or twice a day in a dose of 100-500 mg for three to five days a week. In another specific embodiment, compounds according to the present invention can be entered three times in sotc is for two consecutive weeks followed by one week of rest.

Any one or more specific doses and dosing schemes compounds according to the present invention may also be applicable to any one or more therapeutic tools that must be used in combination therapy (hereafter referred to as "the second therapeutic agent").

In addition, the specific dose and dosing scheme specified second therapeutic agent can also vary, and the optimal dose, the dosage and route of administration will be determined on the basis of the second therapeutic agent.

Of course, the route of administration of the compounds according to the present invention does not depend on the route of administration of the second therapeutic agent. In one embodiment, the introduction of the compounds according to the present invention is oral administration. In another embodiment, introduction of the compounds according to the present invention is intravenous. Thus, according to the specified options for the connection according to the present invention is administered orally or intravenously, and the second therapeutic agent can be administered orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermal, sublingual, intramuscular, rectal, transbukkalno, intranasally, via liposomes, through the inhalation, vaginally, inside the eye, via local delivery through a catheter or stent, subcutaneously, into adipose tissue, inside joints, intrathecal or dosed in the form of slow release.

In addition, the connection according to the present invention and the second therapeutic agent can be entered the same way of introduction, that is injected, for example, orally, intravenously. However, the scope of the present invention also includes the introduction of the compounds according to the present invention one method of administration, for example oral, and the introduction of a second therapeutic agent other by introducing, for example intravenously or by any other method of administration described above.

The first treatment procedure, the introduction of the compounds according to the present invention, can take place prior to the second treatment procedure, i.e. before the introduction of the second therapeutic agent after treatment with the second therapeutic agent, simultaneously with the treatment with the second therapeutic agent or as a combination of the above schemes. For example, the total period of treatment can be defined in respect of compounds according to the present invention. The second therapeutic agent can be entered to ensure the connection according to the present invention or after treatment with the compound according to the present invention, in Addition, anticancer treatment can be carried out during the period of introduction of the compounds according to the present invention, but not necessarily during the entire period of treatment with the compound according to the present invention.

Compounds according to the present invention is also applicable in combination with therapeutic, chemotherapeutic and anti-tumor agents. Combination described in this publication compounds with therapeutic, chemotherapeutic and anti-tumor funds are included in the scope of the invention. Examples of such tools can be found in Cancer Principles and Practice of Oncology by V.T. Devita and S. Hellman (editors), 6thedition (February 15, 2001), Lippincott Williams and Wilkins Publishers. The person skilled in the art it will be clear which combinations of tools may be applicable based on the specific properties of drugs and specific malignant tumors. These include the following: modulators of estrogen receptors, modulators of the androgen receptor, the receptor modulators retinoids, a cytotoxic/cytostatic tools, antiproliferative funds inhibitors prenyl-protein transferase inhibitors HMG-CoA-reductase inhibitors and other angiogenesis inhibitors, HIV protease inhibitors, reverse transcriptase inhibitors, inhibitors of cell proliferation and signal transmission viability, bisphosphonates, inhibitors of ar is matasy, therapeutic agents based on mark, inhibitors of γ-secretase funds, which have a negative impact on receptor tyrosine kinase (RTK), and tools that interfere with the checkpoint of the cell cycle. Compounds according to the present invention is particularly applicable when the joint introduction with radiation therapy.

The term "modulators of estrogen receptor" refers to compounds that interfere with or inhibit the binding of estrogen to the receptor, regardless of mechanism. Examples of modulators of estrogen receptors include, without limitation tamoxifen, raloxifene, idoxifene, LY353381, LY117081, toremifene, fulvestrant, 4-[7-(2,2-dimethyl-1-oxopropoxy-4-methyl-2-[4-[2-(1-piperidinyl)ethoxy]phenyl]-2H-1-benzopyran-3-yl]phenyl-2,2-dimethylpropanoate, 4,4'-dihydroxybenzophenone-2,4-dinitrophenylhydrazone and SH646.

The term "receptor modulators, androgen" refers to compounds that interfere with or inhibit the binding with the receptor, regardless of mechanism. Examples of modulators of androgen receptors include finasteride and other inhibitors of 5α-reductase, nilutamide, flutamide, bikalutamid, liarozole and acetate abiraterone.

The term "receptor modulators retinoid" refers to compounds that interfere with or inhibit the binding of retinoids to the receptor, regardless of mechanism. Examples of such modulators recipe is the moat of retinoids include bexarotene, tretinoin, 13-CIS-retinoic acid, 9-CIS-retinoic acid, α-deformational, ILX23-7553, TRANS-N-(4'-hydroxyphenyl)retinamide and N-4-carboxyaniline.

The term "cytotoxic/cytostatic funds" refers to compounds which cause cell death or inhibit cell proliferation primarily by the fact that directly interfere with the functioning of cells, or inhibit or interfere with the mitosis of cells, including alkylating agents, tumor necrosis, intercalatory, hypoxia-activated compounds, inhibitors of microtubules/agents, stabilizing microtubules, inhibitors of mitotic kinesins, inhibitors of histone deacetylase inhibitors of kinases involved in the completion of mitosis, inhibitors of kinases involved in the pathway of signal transduction of growth factors and cytokines, antimetabolites, biological response modifiers, hormonal/antihormonal therapeutic agents, hematopoietic growth factors, therapeutic agents directed to the target monoclonal antibodies, inhibitors of topoisomerases, the proteosome inhibitors, inhibitors of ubiquitinate and inhibitors of aurora kinase.

Examples of cytotoxic/cytostatic means include without limitation serene, cachectin, ifosfamide, tasonermin, lonidamine, carboplatin, altretamin, predni the Ustin, dibromodulcitol, ranimustine, fotemustine, nedaplatin, oxaliplatin, temozolomide, heptaplatin, estramustin, toilet of improsulfan, trofosfamide, nimustine, dibromide chloride, punitive, lobaplatin, satraplatin, propiomazine, cisplatin, irofulven, Taxifolin, CIS-amindian(2-methylpyridine)platinum, benzylguanine, glufosfamide, GPX100, (TRANS, TRANS, TRANS)-bis-mu-(hexane-1,6-diamine)-mu-[diaminopurine (II)]bis[diamine(chloro)platinum (II)]tetrachloride, dianisidines trioxide arsenic, 1-(11-dodecylamino-10-hydroxyphenyl)was 3.7-dimethylxanthine, zorubicin, idarubitsin, daunorubicin, bisantrene, mitoxantrone, pirarubicin, pinfed, valrubicin, amrubicin, antineoplaston, 3'-desamino-3'-morpholino-13 deoxo-10-hydroxylaminopurine, annamycin, galarubicin, alienated, MEN10755, 4-dimethoxy-3-desamino-3-aziridinyl-4-methylsulfonylbenzoyl (see WO 00/50032), inhibitors of Raf kinase (such as Bay43-9006) and mTOR inhibitors (such as CCI-779 Wyeth).

An example of a hypoxia-activated connection is tirapazamine. Examples of the proteosome inhibitors include, without limitation lactacystin and MLN-341 (Velcade).

Examples of inhibitors of microtubule/stabilizing microtubule agents include paclitaxel, sulfate vindesine, 3',4'-didehydro-4'-deoxy-8'-nonventilatory, docetaxol, rhizoxin, dolastatin, isetionate of mesobolin, auristatin, cemadotin, RPR109881, BMS 18476, vinflunine, cryptophycin, sulfonamide 2,3,4,5,6-pendaftar-N-(3-fluoro-4-methoxyphenyl)benzene, anhydrovinblastine, N,N-dimethyl-L-poured-L-poured-N-methyl-L-poured-L-prolyl-L-Proline-tert-butylamide, TDX258, epothilone (see, for example, U.S. patent No. 6284781 and 6288237) and BMS188797. In one embodiment, epothilone not included in the group of inhibitors of microtubule/stabilizing microtubules agents.

Some examples of inhibitors of topoisomerases are topotecan, gcaptain, irinotecan, rubitecan, 6-ethoxypropanol-3',4'-O-Exo-benzylidene-chartrain, 9-methoxy-N,N-dimethyl-5 - nitropyrazole[3,4,5-kl]acridine-2-(6H)propanamine, 1-amino-9-ethyl-5-fluoro-2,3-dihydro-9-hydroxy-4-methyl-1H,12H-benzo[de]pyrano[3',4':b,7]-indolizino[1,2b]quinoline-10,13(9H,15H)Dion, lurtotecan, 7-[2-(N-isopropylamino)ethyl]-(20S)camptothecin, BNP1350, BNPI1100, BN80915, BN80942, etoposide phosphate, teniposide, sobuzoxane, 2'-dimethylamino-2'-desocialised, GL331, N-[2-(dimethylamino)ethyl]-9-hydroxy-5,6-dimethyl-6H-pyrido[4,3-b]carbazole-1-carboxamide, Bulacan, (5a,5aB,8aa,9b)-9-[2-[N-[2-(dimethylamino)ethyl]-N-methylamino]ethyl]-5-[4-hydroaxe-3,5-acid]-5,5a,6,8,8a,9-hexahydrofuro(3',4':6,7)oil(2,3-d)-1,3-dioxol-6-he, 2,3-(methylenedioxy)-5-methyl-7-hydroxy-8-methoxybenzo[c]phenanthridine, 6,9-bis[(2-amino-ethyl)amino]benzo[g]isoquinoline-5,10-dione, 5-(3-aminopropylene)-7,10-dihydroxy-2-(2-hydroxyethylaminomethyl)-6H-pyrazolo[4,5,1-de]acridine-6-he N-[1-[2(diethylamino)ethylamino]-7-methoxy-9-oxo-H-thioxanthen-4-ylmethyl]formamide, N-(2-(dimethylamino)ethyl)acridine-4-carboxamide, 6-[[2-(dimethylamino)ethyl]amino]-3-hydroxy-7H-indeno[2,1-c]quinoline-7-he demesne.

Examples of inhibitors of mitotic kinesins, in particular the mitotic kinesin KSP person described in the publications WO 03/039460, WO 03/050064, WO 03/050122, WO 03/049527, WO 03/049679, WO 03/049678, WO 04/039774, WO 03/079973, WO 03/099211, WO 03/105855, WO 03/106417, WO 04/037171, WO 04/058148, WO 04/058700, WO 04/126699, WO 05/018638, WO 05/019206, WO 05/019205, WO 05/018547, WO 05/017190, US 2005/0176776. In one embodiment, inhibitors of mitotic kinesins include, but not limited to inhibitors of KSP, inhibitors of MKLP1, inhibitors of CENP-E, inhibitors of MCAK and inhibitors of Rab6-KIFL.

Examples of inhibitors of histone deacetylase" include, without limitation SAHA, TSA, examplein, PXD101, MG98 and scriptaid. Additional link to other inhibitors of histone deacetylase can be found in the manuscript Miller, T.A. et al. J. Med. Chem. 46(24): 5097-5116 (2003).

"Inhibitors of kinases involved in the completion of mitosis" include, without limitation inhibitors of aurora kinase, inhibitors of Polo-like kinases (PLK; in particular, inhibitors of PLK-1), inhibitors of bub-1 and inhibitors of bub-R1. Examples of the aurora kinase inhibitor is VX-680.

"Antiproliferative funds" include antisense oligonucleotides RNA and DNA, such as G3139, ODN698, RVASKRAS, GEM231, and MX3001, and antimetabolites, such as enocitabine, carmofur, tegafur, pentostatin, doxifluridine, trimetrexate, fludarabine, capecitabine, Galitsin, ocfosfate udarabine, hydrate fasteasy-sodium, raltitrexed, raltitrexed, Amateur, tianfuan, decitabine, nolatrexed, pemetrexed, nelarabine, 2'-deoxy-2'-matricectomy, 2'-permatile-2'-deoxycytidine, N-[5-(2,3-dihydrobenzofuran)sulfonyl]-N'-(3,4-dichlorophenyl)urea, N6-[4-deoxy-4-[N2-[2(E),4(E)-tetradecanoyl]glycylamino]-L-glycero-B-L-managedproperty]adenine, aplidin, ecteinascidin, troxacitabine, 4-[2-amino-4-oxo-4,6,7,8-tetrahydro-3H-pyrimidine[5,4-b][1,4]thiazin-6-yl-(S)-ethyl]-2,5-toenail-L-glutamic acid, aminopterin, 5-fluorouracil, alanosine, an ester of 11-acetyl-8-(carbamoyloxymethyl)-4-formyl-6-methoxy-14-oxa-1,11-desaturacia(7.4.1.0.0)-tetradeca-2,4,6-triene-9-luxusni acid, swainsonine, lometrexol, dexrazoxane, methionines, 2'-cyano-2'-deoxy-N4-Palmitoyl-1-B-D-arabinofuranosylcytosine, thiosemicarbazone 3-aminopyridine-2-carboxaldehyde and trastuzumab.

Examples are directed to the target monoclonal antibody therapeutic agents include therapeutic agents, which contain cytotoxic agents or radioisotopes associated with a monoclonal antibody specific to the malignant cell, or it is specific to the target cell. Examples include Bexxar.

The term "inhibitors of HMG-CoA reductase inhibitor" refers to inhibitors of 3-hydroxy-3-methylglutaryl-CoA-reductase. Examples of inhibitors of HMG-CoA-reducta is s, which can be used include, without limitation lovastatin (MEVACOR®; see U.S. patent No. 4231938, 4294926 and 4319039), simvastatin (ZOCOR®; see U.S. patent No. 4444784, 4820850 and 4916239), pravastatin (PRAVACHOL®; see U.S. patent No. 4346227, 4537859, 4410629, 5030447 and 5180589), fluvastatin (LESCOL®; see U.S. patent№№5354772, 4911165, 4929437, 5189164, 5118853, 5290946 and 5356896), atorvastatin (LIPITOR®; see U.S. patent No. 5273995, 4681893, 5489691 and 5342952) and tseriwastatina (also known as mevastatin and BAYCHOL®; see U.S. patent No. 5177080). Structural formulas of these and additional inhibitors of HMG-CoA-reductase, which can be used in the methods according to the invention, described on page 87 in M. Yalpani, "Cholesterol Lowering Drugs", Chemistry and Industry, pp.85-89 (5 February 1996) and U.S. patent No. 4782084 and 4885314. The term inhibitor of HMG-CoA reductase inhibitor used in this sense includes all pharmaceutically acceptable forms of the lactone and open-acid (i.e. the form in which the lactone cycle opened with the formation of the free acid), and also forms salts and complex ester compounds which have inhibitory activity against HMG-CoA-reductase, and therefore the use of such forms in the form of salts, esters, open-acid and lactone included in the scope of the present invention.

The term "inhibitor prenyl-protein transferase" refers to a compound which inhibits any one or any combination of the enzymes prenyl-Pro is Ein-transferring enzyme, including farnesyl-protein-transferase (FPT), geranylgeranyl-protein-transferase type I (GGPT-I) and geranylgeranyl-protein-transferase type II (GGPT II, also called GGPT Rab).

Examples of inhibitors prenyl-protein-transferring enzyme can be found in the following publications and patents: WO 96/30343, WO 97/18813, WO 97/21701, WO 97/23478, WO 97/38665, WO 98/28980, WO 98/29119, WO 95/32987, U.S. patent No. 5420245, U.S. patent No. 5523430, U.S. patent No. 5532359, U.S. patent No. 5510510, U.S. patent No. 5589485, U.S. patent No. 5602098, the publication of the European patent 0618221, the publication of the European patent 0675112, the publication of the European patent 0604181, the publication of the European patent 0696593, WO 94/19357, WO 95/08542, WO 95/11917, WO 95/12612 WO 95/12572, WO 95/10514, U.S. patent No. 5661152, WO 95/10515, WO 95/10516, WO 95/24612, WO 95/34535, WO 95/25086, WO 96/05529, WO 96/06138, WO 96/06193, WO 96/16443, WO 96/21701, WO 96/21456, WO 96/22278, WO 96/24611, WO 96/24612, WO 96/05168, WO 96/05169, WO 96/00736, U.S. patent No. 5571792, WO 96/17861, WO 96/33159, WO 96/34850, WO 96/34851, WO 96/30017, WO 96/30018, WO 96/30362, WO 96/30363, WO 96/31111, WO 96/31477, WO 96/31478, WO 96/31501, WO 97/00252, WO 97/03047, WO 97/03050, WO 97/04785, WO 97/02920, WO 97/17070, WO 97/23478, WO 97/26246, WO 97/30053, WO 97/44350, WO 98/02436 and U.S. patent No. 5532359. As an example, describe the roles of inhibitor prenyl-protein transferase in angiogenesis, see European J. Of Cancer, Vol.35, No. 9, pp.1394-1401 (1999).

The term "angiogenesis inhibitors" refers to compounds that inhibit the formation of new blood vessels, regardless of mechanism. Examples of angiogenesis inhibitors include, but are not limited to what I inhibitors tyrosinekinase, such as inhibitors tyrosinekinase receptors FIt-I (VEGFR1) and FIk-1/KDR (VEGFR2), inhibitors of epidermal derived from fibroblasts or derived from platelet growth factors, inhibitors of MMP (matrix metalloprotease), blockers of integrins, interferon-α, interleukin-12, polysulphate of pentosan, cyclo-oxygenase inhibitors, including nonsteroidal anti-inflammatory drugs (NSAIDs), like aspirin and ibuprofen as well as selective inhibitors of cyclooxygenase-2, similar to celecoxib and rofecoksib (PNAS, Vol.89, p.7384 (1992); JNCI, Vol.69, p.475 (1982); Arch. Opthalmol., Vol.108, p.573 (1990); Anat. Rec, Vol.238, p.68 (1994); FEBS Letters, Vol.372, p.83 (1995); Clin. Orthop. Vol.313, p.76 (1995); J. Mol. Endocrinol, Vol.16, p.107 (1996); Jpn. J. Pharmacol., Vol.75, p.105 (1997); Cancer Res., Vol.57, p.1625 (1997); Cell, Vol.93, p.705 (1998); Intl. J. Mol. Med., Vol.2, p.715 (1998); J. Biol. Chem., Vol.274, p.9116 (1999)), steroidal anti-inflammatory drugs (such as corticosteroids, mineralocorticoids, dexamethasone, prednisone, prednisolone, methylpred, betamethasone), carboxamidates, combretastatin A-4, squalamine, 6-O-chloroacetoacetanilide, thalidomide, angiostatin, troponin-1, antagonists of angiotensin II (see Fernandez et al., J. Lab. Clin. Med. 105: 141-145 (1985)), and antibodies to VEGF (see Nature Biotechnology, Vol.17, pp.963-968 (October 1999); Kim et al., Nature, 362, 841-844 (1993); WO 00/44777 and WO 00/61186).

Other therapeutic agents that modulate or inhibit angiogenesis, and can also be used in combination with sedimentologica the present invention, include tools that modulate or inhibit the coagulation system and fibrinolysis (see review in Clin. Chem. La. Med. 38: 679-692 (2000)). Examples of such tools that modulate or inhibit the pathway of coagulation and fibrinolysis, include, without limitation heparin (see Thromb. Haemost. 80: 10-23 (1998)), low molecular weight heparins and inhibitors of carboxypeptidase U (also known as inhibitors of activated active thrombin inhibitor of fibrinolysis [TAFIa]) (see Thrombosis Res. 101: 329-354 (2001)). The TAFIa inhibitors are described in the applications for the grant of a U.S. patent registration No. 60/310927 (filed August 8, 2001) and 60/349925 (filed January 18, 2002).

The term "tools that interfere with the checkpoint of the cell cycle" refers to compounds that inhibit protein kinases that transmit signals checkpoint of the cell cycle, thereby sensibiliser malignant cell to the action of DNA-damaging agents. These tools include inhibitors of kinases ATR, ATM, CHKI1 and CHK12 and inhibitors of cdk kinases and cdc, and specific examples of such agents are 7-hydroxystaurosporine, flavopiridol, CYC202 (cyclacel) and BMS-387032.

The term "funds, which have a negative impact on receptor tyrosine kinase (RTK)" refers to compounds that inhibit RTK and, therefore, inhibit the mechanisms involved in the carcinogenesis and progression of tumors. Such sredstava inhibitors of c-Kit, Eph, PDGF, Flt3 and c-Met. Additional tools include the RTK inhibitors, which are described in the Bume-Jensen and Hunter, Nature, 411: 355-365, 2001.

The term "inhibitors of transmission path signals proliferation and viability of cells" refers to compounds which inhibit the signal transduction cascades below the receptors on the cell surface. These tools include inhibitors of serine/treoninove kinases (including but not limited to inhibitors of Akt such as are described in WO 02/083064, WO 02/083139, WO 02/083140, US 2004-0116432, WO 02/083138, US 2004-0102360, WO 03/086404, WO 03/086279, WO 03/086394, WO 03/084473, WO 03/086403, WO 2004/041162, WO 2004/096131, WO 2004/096129, WO 2004/096135, WO 2004/096130, WO 2005/100356, WO 2005/100344, US 2005/029941, US 2005/44294, US 2005/43361, 60/734188, 60/652737, 60/670469), inhibitors of Raf kinase (for example BAY-43-9006)inhibitors of MEK (for example CI-1040 and PD-098059), inhibitors of mTOR (for example Wyeth CCI-779) and inhibitors of PI3K (for example LY294002).

As described above, the combination with NSAIDs relate to the use of NSAIDs, which are strong any abscopal COX-2 agents. For purposes of this description NSAIDs is strong if it has the IC50in relation to inhibition of COX-2, component 1 μm or less when measured in the analyses based on the cells or microsomes.

The invention also encompasses combination with NSAIDs that are selective inhibitors of COX-2. For purposes of this description NSAIDs that are selective inhibitors of COX-2, is defined as the NSAIDs that are about the present specificity in relation to inhibition of COX-2 compared to COX-1 of at least 100 higher when measured against IC 50for COX-2 to the IC50for COX-1 evaluated in the analyses based on the cells or microsomes. Such compounds include without limitation compounds described in U.S. patent 5474995, U.S. patent 5861419, U.S. patent 6001843, U.S. patent 6020343, U.S. patent 5409944, U.S. patent 5436265, U.S. patent 5536752, U.S. patent 5550142, U.S. patent 5604260, U.S. patent 5698584, U.S. patent 5710140, WO 94/15932, U.S. patent 5344991, U.S. patent 5134142, U.S. patent 5380738, U.S. patent 5393790, U.S. patent 5466823, U.S. patent 5633272 and U.S. patent 5932598, which are all included in this description by reference.

Inhibitors of COX-2 that are particularly applicable in this method of treatment are: 3-phenyl-4-(4-(methylsulphonyl)phenyl)-2-(5H)-furanone; and 5-chloro-3-(4-methylsulphonyl)phenyl-2-(2-methyl-5-pyridinyl)pyridine; or their pharmaceutically acceptable salts.

Compounds that have been described as specific inhibitors of COX-2 and therefore applicable in the present invention include without limitation the following connections: parecoxib, BEXTRA® and CELEBREX® or their pharmaceutically acceptable salts.

Other examples of angiogenesis inhibitors include, without limitation, endostatin, Ukraine, ranpirnase, IM862, 5-methoxy-4-[2-methyl-3-(3-methyl-2-butenyl)oxiranyl]-1-oxaspiro[2,5]Oct-6-yl(chloroacetyl)carbamate, azetidinone, 5-amino-1-[[3,5-dichloro-4-(4-chlorobenzoyl)phenyl]methyl]-1H-1,2,3-triazole-4-carboxamide, CM101, squalamine, combretastatin, RPI4610, NX3838, phosphate sulfated mandamentos, 7,7-(carbonyl-bis[imino-N-methyl-4,2-pyrroloquinoline[N-methyl-4,2-pyrrole]carbylamine]bis-(1,3-naphthalenedisulfonate) and 3-[(2,4-dimethylpyrrole-5-yl)methylene]-2-indolinone (SU5416).

As indicated above, the term "antagonists of integrins" refers to compounds which selectively antagonizing, inhibit or counteract binding of a physiological ligand with αvβ3-integrin, to compounds which selectively antagonizing, inhibit or counteract binding of a physiological ligand with αvβ5-integrin, to compounds which antagonizing, inhibit or counteract binding of a physiological ligand with αvβ3-integrin and αvβ5-integrin, and to compounds that antagonizing, inhibit or counteract the activity of the particular integrin(s)expressed on endothelial cells of capillaries. The term also refers to antagonists integrins αvβ6αvβ8α1β1α2β1α5β1α6β1and α6β4. The term also refers to antagonists of any combination of integrins αvβ3αvβ5αvβ6αvβ8α1β1α2β1α5β1, the 6β1and α6β4.

Some specific examples of tyrosine kinase inhibitors include N-(triptoreline)-5-methylisoxazol-4-carboxamide, 3-[(2,4-dimethylpyrrole-5-yl)methylidene)indolin-2-he, 17-(allylamino)-17-demethoxygeldanamycin, 4-(3-chloro-4-forgenerating)-7-methoxy-6-[3-(4-morpholinyl)propoxy]hinzelin, N-(3-ethynylphenyl)-6,7-bis(2-methoxyethoxy)-4-hinazolinam, BIBX1382, 2,3,9,10,11,12-hexahydro-10-(hydroxymethyl)-10-hydroxy-9-methyl-9,12-epoxy-1H-vindaloo[1,2,3-fg:3',2',1'-kl]pyrrolo[3,4-i][1,6]benzodiazepin-1-he SH268, genistein, STI571, CEP2563, sulfonate 4-(3-chlorpheniramine)-5,6-dimethyl-7H-pyrrolo[2,3-d]pyrimidinone, 4-(3-bromo-4-hydroxyphenyl)amino-6,7-dimethoxyquinazoline, 4-(4'-hydroxyphenyl)amino-6,7 - dimethoxyquinazoline, SU6668, STI571A, N-4-chlorophenyl-4-(4-pyridylmethyl)-1-phthalazinone and EMD121974.

Combination with other compounds, different from anticancer compounds, are also applicable in the methods according to the present invention. For example, the combination of the claimed compounds with agonists of PPAR-γ (i.e. PPAR-gamma) and agonists of PPAR-δ (i.e. PPAR-Delta) applicable for the treatment of certain malignant diseases. PPAR-γ and PPAR-δ are nuclear-activated proliferation peroxisome receptor γ and δ. The expression of PPAR-γ on endothelial cells and their involvement in angiogenesis described in the literature (see J. Cardiovasc. Pharmacol. 1998; 31: 909-913; J. Biol. Chem. 1999; 274: 9116-9121; Invest. Ophthalmol. Vis. Sci. 200; 41: 2309-2317). Recently it was shown that agonists of PPAR-γ inhibit the angiogenic response to VEGF in vitro; troglitazone and rosiglitazona maleate inhibit the development of neovascularization of the retina in mice (Arch. Ophthamol. 2001; 119: 709-717). Examples of agonists of PPAR-γ agonists of PPAR-γ/α include, without limitation preparations of thiazolidinediones (such as DRF2725, CS-011, troglitazone, rosiglitazone and pioglitazone), fenofibrate, gemfibrozil, clofibrate, GW2570, SB219994, AR-H039242, JTT-501, MCC-555, GW2331, GW409544, NN2344, KRP297, NP0110, DRF4158, NN622, GI262570, PNU182716, DRF552926, 2-[(5,7-dipropyl-3-trifluoromethyl-1,2-benzisoxazol-6-yl)oxy]-2-methylpropionate acid (discussed in USSN 09/782856), and 2(R)-7-(3-(2-chloro-4-(4-pertenece)phenoxy)propoxy)-2-ethylpropane-2-carboxylic acid (discussed in USSN 60/235708 and 60/244697).

Another embodiment of the present invention is the use of the claimed compounds in combination with gene therapy for the treatment of malignant tumors. Review genetic methods of treatment of malignant tumors, see Hall et al. (Am. J. Hum. Genet. 61: 785-789, 1997) and Kufe et al (Cancer Medicine, 5thEd., pp.876-889, BC Decker, Hamilton 2000). Gene therapy can be used for delivery of any overwhelming tumor gene. Examples of such genes include, without limitation p53, which can be delivered through mediated virus gene transfer (see, for example, U.S. patent No. 6069134), the antagonist of the uPA/uPAR ("Adenovirus-Mediated Delivery of a uPA/uPAR Antagonist Suppresses Angiogenesis-Dependent Tumr Growth and Dissemination in Mice," Gene Therapy, August 1998; 5(8): 1105-13), and interferon gamma (J. Immunol. 2000; 164: 217-222).

Compounds according to the present invention can also be introduced in combination with an inhibitor of innate policecourtneu resistance (MDR), in particular MDR associated with high levels of protein expression vectors. Such MDR inhibitors include inhibitors of p-glikoproteid (P-gp), such as LY335979, XR9576, OC144-093, R101922, VX853 and PSC833 (valspodar).

The connection according to the present invention can be used in conjunction with antiemetic means to treat nausea or emesis, including acute, delayed, late and expected vomiting that may be caused by the use of the compounds according to the present invention alone or together with radiation therapy. To prevent or treat vomiting connection according to the present invention can be used in conjunction with other antiemetic means, especially with receptor antagonists neirokinina-1, 5HT3 receptor antagonists, such as ondansetron, granisetron, tropisetron and zatosetron, agonists of GABAB receptor, such as baclofen, a corticosteroid such as decadron (dexamethasone), kenalog, aristocort, nasalide, prepared, benecare or other, such as described in U.S. patents№№2789118, 2990401, 3048581, 3126375, 3929768, 3996359, 3928326 and 3749712, antidopaminergics means, such as phenothiazines (e.g.p is chlorphenesin, fluphenazine, thioridazine and mesoridazine), metoclopramide or dronabinol. In another embodiment, joint therapy antiemetic agent selected from receptor antagonist neirokinina-1, a 5HT3 receptor antagonist and corticosteroid, it is proposed to treat or prevent vomiting, which may be a result of the introduction of the compounds according to the present invention.

Antagonists of the receptor neirokinina-1 used together with the compounds according to the present invention are fully described, for example, in U.S. patents№№5162339, 5232929, 5242930, 5373003, 5387595, 5459270, 5494926, 5496833, 5637699, 5719147; publications of the European patent no EP 0360390, 0394989, 0428434, 0429366, 0430771, 0436334, 0443132, 0482539, 0498069, 0499313, 0512901, 0512902, 0514273, 0514274, 0514275, 0514276, 0515681, 0517589, 0520555, 0522808, 0528495, 0532456, 0533280, 0536817, 0545478, 0558156, 0577394, 0585913, 0590152, 0599538, 0610793, 0634402, 0686629, 0693489, 0694535, 0699655, 0699674, 0707006, 0708101, 0709375, 0709376, 0714891, 0723959, 0733632 and 0776893; international publication patent No. WO 90/05525, 90/05729, 91/09844, 91/18899, 92/01688, 92/06079, 92/12151, 92/15585, 92/17449, 92/20661, 92/20676, 92/21677, 92/22569, 93/00330, 93/00331, 93/01159, 93/01165, 93/01169, 93/01170, 93/06099, 93/09116, 93/10073, 93/14084, 93/14113, 93/18023, 93/19064, 93/21155, 93/21181, 93/23380, 93/24465, 94/00440, 94/01402, 94/02461, 94/02595, 94/03429, 94/03445, 94/04494, 94/04496, 94/05625, 94/07843, 94/08997, 94/10165, 94/10167, 94/10168, 94/10170, 94/11368, 94/13639, 94/13663, 94/14767, 94/15903, 94/19320, 94/19323, 94/20500, 94/26735, 94/26740, 94/29309, 95/02595, 95/04040, 95/04042, 95/06645, 95/07886, 95/07908, 95/08549, 95/11880, 95/14017, 95/15311, 95/16679, 95/17382, 95/18124, 95/18129, 95/19344, 95/20575, 95/21819, 95/22525, 95/23798, 95/26338, 95/28418, 95/30674, 95/30687, 95/33744, 96/0181, 96/05193, 96/05203, 96/06094, 96/07649, 96/10562, 96/16939, 96/18643, 96/20197, 96/21661, 96/29304, 96/29317, 96/29326, 96/29328, 96/31214, 96/32385, 96/37489, 97/01553, 97/01554, 97/03066, 97/08144, 97/14671, 97/17362, 97/18206, 97/19084, 97/19942 and 97/21702; and in British publications patents№№2266529, 2268931, 269170, 2269590, 2271774, 2292144, 2293168, 2293169 and 2302689. The compounds are fully described in the above patents and publications, which are incorporated in this description by reference.

In one embodiment, the receptor antagonist neirokinina-1 used together with the compounds according to the present invention, is selected from 2-(R)-(1-(R)-(3,5-bis(trifluoromethyl)phenyl)ethoxy)-3-(S)-(4-forfinal)-4-(3-(5-oxo-1H,4H-1,2,4-triazolo)methyl)of the research or its pharmaceutically acceptable salt described in U.S. patent No. 5719147.

The connection according to the present invention can also be entered with the agent, applicable for the treatment of anemia. This agent for the treatment of anaemia, for example, activator receptor erythropoiesis long-term actions (such as epoetin Alfa).

The connection according to the present invention can also be entered with the agent, applicable to the treatment of neutropenia. This agent for the treatment of neutropenia is, for example, hematopoietic growth factor, which regulates the production and function of neutrophils, such as colony-stimulating factor in human granulocytes (G-CSF). Examples of G-CSF include filgrastim.

The connection agreement is but the present invention can also be entered with drug enhance the immunological response, such as levamisole, isoprinosine and zadaxin.

The connection according to the present invention may also be applicable for the treatment or prevention of a malignant tumor in combination with P450 inhibitors, including xenobiotics, quinidine, tyramine, ketoconazole, testosterone, quinine, metyrapone, caffeine, phenelzine, doxorubicin, troleandomycin, cyclobenzaprin, erythromycin, cocaine, furafylline, cimetidine, dextromethorphan, ritonavir, indinavir, APV, diltiazem, terfenadine, verapamil, cortisol, Itraconazole, mibefradil, nefazodone and nelfinavir.

The connection according to the present invention may also be applicable for the treatment or prevention of a malignant tumor in combination with inhibitors of Pgp and/or BCRP, including cyclosporin A, PSC833, GF120918, cremophor EL, fumitremorgin C, Kol32, Kol34, iressa, of imatinib mesilate, EKI-785, C11033, novobiocin, diethylstilbestrol, tamoxifen, respecin, VX-710, tryprostatin A, flavonoids, ritonavir, saquinavir, nelfinavir, omeprazole, quinidine, verapamil, terfenadine, ketoconazole, nifedipine, FK506, amiodarone, XR9576, indinavir, APV, cortisol, testosterone, LY335979, OC144-093, erythromycin, vincristine, digoxin and talinolol.

The connection according to the present invention may also be applicable for the treatment or prevention of malignant tumors, including Sloka the natural enemy tumor of bone in combination with bisphosphonates (assuming that they include bestiality, diphosphonates, bisphosphonic acids and diphosphonic acids). Examples of bisphosphonates include, without limitation etidronate (didronel), pamidronate (aredia), alendronate (fosamax), risedronate (actonel), zoledronate (zometa), ibandronate (boniva), encadrant or comadronas, clodronate, EB-1053, minodronate, meridional, Piedmont and tiludronate, including any and all of their pharmaceutically acceptable salts, derivatives, hydrates and mixtures.

The connection according to the present invention may also be applicable for the treatment or prevention of malignant mammary gland tumors in combination with an aromatase inhibitor. Examples of aromatase inhibitors include, without limitation, anastrozole, letrozole, and exemestane.

The connection according to the present invention may also be applicable for the treatment or prevention of a malignant tumor in combination with therapies based on mark.

Compounds according to the present invention can also enters in combination with inhibitors of γ-secretase and/or inhibitors of signal transmission NOTCH. Such inhibitors include compounds described in WO 01/90084, WO 02/30912, WO 01/70677, WO 03/013506, WO 02/36555, WO 03/093252, WO 03/093264, WO 03/093251, WO 03/093253, WO 2004/039800, WO 2004/039370, WO 2005/030731, WO 2005/014553, USSN 10/957251, WO 2004/089911, WO 02/081435, WO 02/081433, WO 03/018543, WO 2004/031137, O 2004/031139, WO 2004/031138, WO 2004/101538, WO 2004/101539 and WO 02/47671 (including LY-450139).

Inhibitors of Akt, which are described in the following publications: WO 02/083064, WO 02/083139, WO 02/083140, US 2004-0116432, WO 02/083138, US 2004-0102360, WO 03/086404, WO 03/086279, WO 03/086394, WO 03/084473, WO 03/086403, WO 2004/041162, WO 2004/096131, WO 2004/096129, WO 2004/096135, WO 2004/096130, WO 2005/100356, WO 2005/100344, US 2005/029941, US 2005/44294, US 2005/43361, 60/734188, 60/652737, 60/670469 and including compounds according to the present invention are also applicable in combination with salts of potassium, salts of magnesium, beta-blockers (such as atenolol) antagonists of the endothelin-a (ETa) to maintain cardiovascular homeostasis.

Inhibitors of Akt, which are described in the following publications: WO 02/083064, WO 02/083139, WO 02/083140, US 2004-0116432, WO 02/083138, US 2004-0102360, WO 03/086404, WO 03/086279, WO 03/086394, WO 03/084473, WO 03/086403, WO 2004/041162, WO 2004/096131, WO 2004/096129, WO 2004/096135, WO 2004/096130, WO 2005/100356, WO 2005/100344, US 2005/029941, US 2005/44294, US 2005/43361, 60/734188, 60/652737, 60/670469 and including compounds according to the present invention are also applicable in combination with insulin, stimulants of insulin secretion, agonists of PPAR-gamma, Metformin, agonists of the somatostatin receptor, such as octreotide, DPP4 inhibitors, sulfonylureas and alpha-glucosidase inhibitors, with the goal of maintaining glucose homeostasis.

The connection according to the present invention may also be applicable for the treatment or prevention of a malignant tumor in combination with PARP inhibitors.

The connection agreement is but the present invention may also be applicable for the treatment of malignant tumors in combination with the following therapeutic means: abarelix (deposited Plenaxis®); aldeslakin (Prokine®); aldeslakin (Proleukin®); alemtuzumab (Campath®); alitretinoin (Panretin®); allopurinol (Zyloprim®); altretamin (Hexalen®); amifostine (Ethyol®); anastrozole (Arimidex®); arsenic trioxide (Trisenox®); asparaginase (Elspar®); azacytidine (Vidaza®); bevacizumab (Avastin®); bexarotene capsules (Targretin®); gel bexarotene (Targretin®); bleomycin (Blenoxane®); bortezomib (Velcade®); intravenous drug busulfan (Busulfex®); oral busulfan (Myleran®); calusterone (Methosarb®); capecitabine (Xeloda®); carboplatin (Paraplatin®); carmustin (BCNU®, BiCNU®); carmustine (Gliadel®); the implantable carmustin with polifeprosan 20 (Gliadel Wafer®); celecoxib (Celebrex®), cetuximab (Erbitux®), chlorambucil (Leukeran®), cisplatin (Platinol®); cladribine (Leustatin®, 2-CdA®); Clofarabine (Clolar®); cyclophosphamide (Cytoxan®, Neosar®), cyclophosphamide (Cytoxan injection®), cyclophosphamide (Cytoxan® tablets); cytarabine (Cytosar-U®), liposomal cytarabine (DepoCyt®), dacarbazine (DTIC-Dome®); dactinomycin, actinomycin D (Cosmegen®); darbepoietin Alfa (Aranesp®), daunorubicin liposomal (DanuoXome®); daunorubicin, daunomycin (Daunorubicin®); daunorubicin, daunomycin (Cerubidine®); denileukin diftitox (Ontak®); dexrazoxane (Zinecard®); docetaxel (Taxotere®); doxorubicin (Adriamicin PFS®), doxorubicin (Adriamycin®, Rubex®), doxorubicin (Adriamycin PFS® injection); doxorubicin liposomal (Doxil); propionate dromostanolone (dromostanolone®); propionate dromostanolone (masterone® for injection; solution Elliott B (Elliott''s B solution is); epirubicin (Ellence®); epoetin Alfa (epogen®); erlotinib (Tarceva®); estramustine (Emcyt®); etoposide phosphate (Etopophos®), etoposide, VP-16 (Vepesid®), exemestane (Aromasin®); filgrastim (Neupogen®); floxuridine (intra-arterial) (FUDR®), fludarabine (Fludara®), fluorouracil, 5-FU (Adrucil®), fulvestrant (Faslodex®); gefitinib (Iressa®); gemcitabine (Gemzar®); gemtuzumab ozogamicin (Mylotarg®); goserelin acetate (Zoladex® implantable)); goserelin acetate (Zoladex®); histrelin acetate (Histrelin® implantable); hydroxyurea (Hydrea®); ibritumomab xuxian (Zevalin®); idarubitsin (Idamicin®), ifosfamide (IFEX®); of imatinib mesilate (Gleevec®), interferon alpha 2a (Roferon A®), interferon Alfa-2b (Intron A®); irinotecan (Camptosar®), lenalidomide (Revlimid®); letrozole (Femara®), leucovorin (Wellcovorin®, Leucovorin®); acetate leuprolide (Eligard®), levamisole (Ergamisol®); lomustin, CCNU (CeeBU®); mechlorethamine, nitrogen mustard (Mustargen®); the acetate megestrol (Megace®); melphalan, L-PAM (Alkeran®); mercaptopurine, 6-MP (Purinethol®); mesna (Mesnex®); mesna (Mesnex tabs®); methotrexate (Levitra®); metoksalen (Uvadex®), mitomycin C (Mutamicin®); mitotane (Lysodren®); mitoxantrone (Novantrone®); phenpropionate nandrolone (Durabolin-50®); nelarabine (Arranon®); nofetumomab (Verluma®); oprelvekin (Neumega®); oxaliplatin (Eloxatin®), paclitaxel (Paxene®), paclitaxel (Taxol®); associated with protein particles of paclitaxel (Abraxane®); palifermin (Kepivance®), pamidronate (Aredia®); pegademase (Adagen® (pegademase bullish)); pegaspargase (Oncaspar®); pegfilgrastim (Neulasta®); disodium-pemetrexed (Alimta®); pentostatin (Nipent®); pipobroman (Vercyte®); plicamycin, mithramycin (Mithracin®); sodium porfimer (Photofrin®), procarbazine (Matulane®); chinacan (Atabrine®); rasburicase (Elitek®), rituximab (Rituxan®); sargramostim (Leukine®); sargramostim (Prokine®); sorafenib (Nexavar®); streptozocin (Zanosar®); sunitinib maleate (Sutent®); talc (Sclerosol®); tamoxifen (Nolvadex®); temozolomide (Temodar®); teniposide, VM-26 (Vumon®); testolactone (Teslac®); tioguanin, 6-TG (Thioguanine®); thiotepa (Thioplex®), topotecan (Hycamtin®); toremifene (Fareston®); tositumomab (Bexxar®); tositumomab/I-131 tositumomab (Bexxar®), trastuzumab (Herceptin®); tretinoin, ATRA (Vesanoid®); uramustine (Uracil Mustard® capsules); valrubicin (Valstar®); vinblastine (Velban®), vincristine (Oncovin®); vinorelbine (Navelbine®); zoledronate (Zometa®).

Thus, the scope of the present invention included the use of the claimed compounds in combination with a second compound selected from the modulator of estrogen receptor, a modulator of androgen receptor, a modulator of the receptor retinoid, a cytotoxic/cytostatic tools, antiproliferative funds inhibitor prenyl-protein transferase, an inhibitor of HMG-CoA reductase inhibitor, an inhibitor of HIV protease, reverse transcriptase inhibitors, inhibitors of angiogenesis, agonists of PPAR-γ agonists of PPAR-δ, an inhibitor of innate policecourtneu resistance, anti-emetics, tools, applicable for the treatment of anemia, tools, apply the CSOs for the treatment of neutropenia, drugs that enhance the immune response, an inhibitor of cell proliferation and signal transmission viability, bisphosphonates, aromatase inhibitor, a therapeutic agent based on mark, inhibitors of γ-secretase, funds that adversely affect the receptor tyrosine kinase (RTK), an agent that interferes with the checkpoint of the cell cycle, and any of therapeutic agents listed above.

The term "introduction" and its variants (e.g., "introduction" connection) with respect to the connection according to the invention means introducing the compound or prodrug of the compound into the system of an animal in need of treatment. In the case where the connection according to the invention or a prodrug represented in combination with one or more other active agents (e.g., a cytotoxic agent, and so on), it should be understood that the term "introduction" and its variants include concurrent and sequential introduction of the compound or its prodrug, and other tools.

Used in this sense is understood that the term "composition" includes a product containing specified ingredients in the specified amounts, as well as any product that directly or indirectly results from a combination of specific Ingram is diantou in the specified amounts.

The term "therapeutically effective amount" used herein means that amount of active compound or pharmaceutical agent that causes a biological or medical response in a tissue, system, animal or person sought by a researcher, veterinarian, doctor or other Clinician.

The term "treatment of malignant tumors" refers to administration to a mammal suffering from malignant diseases, and refers to the effect that improves the condition of malignant disease by inducing the death of malignant cells, as well as to the effect, the result of which is the inhibition of growth and/or metastasis of malignant tumors.

In one embodiment, the angiogenesis inhibitor to be used as the second compound selected from a tyrosine kinase inhibitor, an inhibitor of epidermal growth factor inhibitor derived from fibroblast growth factor, an inhibitor derived from platelet growth factor, an inhibitor of MMP (matrix metalloprotease), an integrin blocker, interferon-α, interleukin-12, polysulfate of pentosan, an inhibitor of cyclooxygenase, carboxamidates, combretastatin A-4, squalamine, 6-O-(chloracetophenone)fumakilla, thalidomide, angiostatin, troponin-1, or antibodies to VEGF. In about the nom embodiment, the modulator of the estrogen receptor is tamoxifen or raloxifene.

Also in the scope of the claims included a method of treating a malignant tumor, which includes the introduction of a therapeutically effective amount of compound according to the present invention in combination with radiation therapy and/or in combination with a second compound selected from the modulator of estrogen receptor, a modulator of androgen receptor, a modulator of the receptor retinoid, a cytotoxic/cytostatic tools, antiproliferative funds inhibitor prenyl-protein transferase, an inhibitor of HMG-CoA reductase inhibitor, an inhibitor of HIV protease, reverse transcriptase inhibitors, inhibitors of angiogenesis, agonists of PPAR-γ agonists of PPAR-δ, an inhibitor of innate policecourtneu resistance, antiemetic tools, tools, applicable for the treatment of anemia, tools, applicable to the treatment of neutropenia, drugs that enhance the immune response, an inhibitor of cell proliferation and signal transmission viability, bisphosphonates, aromatase inhibitor, a therapeutic agent based on mark, inhibitors of γ-secretase, funds that adversely affect the receptor tyrosine kinase (RTK), an agent that interferes with the checkpoint of the cell cycle, and any of therapeutic agents listed above.

Another embodiment of izopet the tion is a method of treating a malignant tumor, which includes the introduction of a therapeutically effective amount of compound according to the present invention in combination with paclitaxel or trastuzumab.

The invention also covers a method of treatment or prevention of a malignant tumor, which includes the introduction of a therapeutically effective amount of compound according to the present invention in combination with a COX-2 inhibitor.

The present invention also relates to pharmaceutical compositions suitable for treatment or prevention of a malignant tumor, which contains a therapeutically effective amount of a compound according to the present invention and a second compound selected from the modulator of estrogen receptor, a modulator of androgen receptor, a modulator of the receptor retinoid, a cytotoxic/cytostatic tools, antiproliferative funds inhibitor prenyl-protein transferase, an inhibitor of HMG-CoA reductase inhibitor, an inhibitor of HIV protease, reverse transcriptase inhibitors, inhibitors of angiogenesis, agonist of PPAR-γ agonist of PPAR-δ, an inhibitor of cell proliferation and signal transmission viability, bisphosphonates, aromatase inhibitor, therapeutic means on the basis of mark, inhibitors of γ-secretase, funds that adversely affect the receptor tyrosine kinase (RTK), means the, which prevents the checkpoint of the cell cycle, and any of therapeutic agents listed above.

All of these patents, publications and co pending applications for patent are included in this description by reference.

The following abbreviations used in the description of chemical reactions and in the examples are: AEBSF (p-aminoethylethanolamine); BSA (bovine serum albumin); BuLi (n-utility); CDCl3(chloroform-d); CuI (copper iodide); CuSO4(copper sulfate); DCE (dichloroethane); DHM (dichloromethane); DEAD (diethylazodicarboxylate); DMF (N,N-dimethylformamide); DMSO (dimethyl sulfoxide); DTT (dithiothreitol); EDTA (ethylenediaminetetraacetic acid); EGTA (etilenvinilatsetata acid); EtOAc (ethyl acetate); EtOH (ethanol); HOAc (acetic acid); HPLC (high performance liquid chromatography; MS-BP (mass spectrum high resolution); LC-MS (liquid chromatography-mass spectrometry); LHMDS (lithium bis(trimethylsilyl)amide); MS-HP (the mass spectrum of the low-resolution); MeOH (methanol); MP-B(CN)H3(macroporous cyanoborohydride); NaHCO3(sodium bicarbonate); Na2SO4(sodium sulfate); Na(OAc)3BH (triacetoxyborohydride sodium); NH4OAc (ammonium acetate); NBS (N-bromosuccinimide); NMR (nuclear magnetic resonance); PBS (phosphate-saline buffer); PCR (polymerase chain reaction); Pd(dppf) ([1,1'-bis(definito the Fino)ferrocene]palladium); Pd(Ph3)4(palladium(0)tetranitroaniline); POCl3(phosphorus oxychloride); PS - DIEA (diisopropylethylamine polystyrene (PS); PS-PPh3(politicalcriterion); TBAF (tetrabutylammonium fluoride); THF (tetrahydrofuran); TFU (triperoxonane acid); TMSCH2N2(trimethylsilyldiazomethane) and Ac (acetyl); BOC (tert-butoxycarbonyl); Bu (butyl); Calc. (calculated); DIEA (diisopropylethylamine); DMAP (4-dimethylaminopyridine); EDC (N-ethyl-N'-(3-dimethylaminopropyl)carbodiimide); EQ. (equivalents); Et (ethyl); HOBT (hydroxybenzotriazole); PA (isopropanol); LC/MS (liquid chromatography-mass spectrometry); Me (methyl); MeCN (acetonitrile); NMP (N-methylpyrrolidinone); Pr (propyl); Pyr (pyridine); feast upon. (saturated) and tasilova (pair-toluensulfonate acid).

Compounds according to the present invention can be obtained by using the reactions shown in the following diagrams reactions, in addition to other standard methods known in the literature or given as examples in the section "Experimental methods". Therefore, the following illustrative scheme of the reaction is not limited to these compounds or any particular substituents used for purposes of illustration. The numbering of the substituents shown in the schemes of reactions, not necessarily correlate with the numbering used in the formula izaberete the Oia, and often, for clarity, shows only one Deputy, associated with the connection, when many Pets substituents as defined in formula A, above.

The initial synthesis of compounds according to the invention shown in the schemes of reactions I-IX. The end of the reaction, which can be used to create compounds according to the present invention, shown in the schemes of reactions X-XIV.

Brief description of schemes reactions

The following diagrams reactions, the schemes of reactions I-IX, provides useful details get bicyclic residues of the compounds according to the invention.

The necessary intermediate products in some cases are commercially available or can be obtained according to the literature methods. As shown in reaction scheme I, an appropriately substituted phenylacetamide may be subjected to interaction with iodide of copper with the formation of the corresponding acetylide copper I-1 (see, for example, Sonogashira, K.; Toda, Y.; Hagihara, N. Tetrahedron Lett. 1975, 4467). Then the intermediate product I-1 can interact with an appropriately substituted electrophilic component, giving asymmetrically substituted I-2. Interaction with NBS, followed by hydrolysis gives I-3 (see, for example, Yusybov, M.S.; Filimonov, V.D.; Synthesis 1991, 2, 131). Many substituted and unsubstituted arrow and heterocyclyl also mouthbut obtained commercially.

In reaction scheme II illustrates the formation of compounds on the basis of appropriately substituted II-1. Specified intermediate product may be subjected to interaction with an appropriately substituted amine with obtaining an intermediate product II-2, which may be subjected to interaction with the appropriate aryl - or heteroelement with a mixture of regioisomers of the compounds according to the invention, which generally can be divided chromatography.

In reaction scheme III illustrates the synthesis of another bicyclic heterocyclyl.

In reaction scheme IV illustrates the formation of compounds on the basis of appropriately substituted 4-amino-3-nitrobenzonitrile IV-I. Specified intermediate product can then be subjected to driven by microwave radiation cycloaddition reaction [3+2] obtaining tetrazole IV-II. Alkylation acid tetrazol the electrophile, such as methyliodide, gives a mixture of 2-methyl(IV-III)/1-methyl(IV-IV)-alkyl tetrazoles who share chromatography on a column. Ra-Ni-hydrogenation IV-III gives the diamine IV-V. Further synthesis is carried out as described for the above schemes reactions.

The reaction scheme V illustrates the synthesis of compounds. Cyclocondensation Friedlander appropriately substituted aryl - or heteroarylboronic with cuts in Estulin follows substituted ketone gives intermediates of the formula V-1. The transformation of a functional group of carboxylic acid functional group of the aldehyde gives the intermediate product V-2 and is carried out by methods well known to the person skilled in the art. Reductive alkylation of suitably substituted amine provides compounds of formula V-3.

The reaction scheme VI illustrates an alternative synthesis of intermediate product V-2.

The reaction scheme VII illustrates the synthesis of compounds, starting from the ketone VII-1, which is obtained according to the method described in the literature (Renault, O.; Dallemagne, P.; and Rault, S. Org. Prep. Proced. Int., 1999, 31, 324). The condensation of (VII-1 dimethylacetal N,N-dimethylformamide gives ketoenamine VII-2, which cyclized with 2 cyanoacetamide, giving pyridone VII-3. Processing VII-3 phosphorus oxychloride gives chloropyridin VII-4. Bromination radical with subsequent substitution of the appropriately substituted amines gives the amines VII-5. The subsequent interaction of chloronicotinamide VII-5 with different binucleophiles gives cyklinowanie structure VII-6.

The reaction scheme VIII illustrates the formation of compounds 1,6-naphthiridine-6(5H)-she. The synthesis starts from commercially available carboxylic acid (VIII-I), which in turn amide Weinrebe (VIII-2). The interaction of the amide with abillities reagent formed by exchange reactions lithium-halogen of arilbred with n-butyllithium, gives Eton (VIII-3). Condensation specified substituted ketone with 4-aminonicotinamide in the presence of a base, for example sodium hydroxide or sodium methoxide gives 1,6-naphthiridine (VIII-4). The substituent R on the phenyl may be a functional group, such as (silyl)protected hydroxymethyl, masked aldehyde (i.e. acetal) or carboxylic acid. The resulting substance can be converted into the desired aldehyde VIII-4. In the case where the group R represents a hydroxymethyl, an oxidation reagent, such as activated manganese dioxide gives the aldehyde VIII-4. In the case when R is an acetal, mild acid hydrolysis gives the aldehyde. Recovery groups are carboxylic acid by reduction of the mixed anhydride with borohydride gives the aldehyde VIII-4. The resulting aldehyde can then be subjected to reductive aminating a number of different amines, such as 4-substituted piperidine, and borohydride to obtain 1,6-naphthiridine-5(H)-ones (VIII-5). Treatment of (VIII-5) pyridinium hydrochloride at 150°C gives the final product (VIII-6).

The reaction scheme IX illustrates an alternative way of introduction heterocycles in the C3-position. It begins with commercially available dichlorobenzophenone, which can be subjected to reaction in combination with arylboronic acid in the presence of palladium catalyst is a (Suzuki reaction). Then repeat the specified reaction with another heterocyclic Bronevoy acid gives the final product under the same reaction conditions.

The scheme of reactions I

The reaction scheme II

The reaction scheme III

The reaction scheme IV

The reaction scheme V

The reaction scheme VI

The reaction scheme VII

The reaction scheme VIII

The reaction scheme IX

A brief description of finite state diagrams reactions

The following diagrams reactions, the schemes of reactions X-XIV, provides useful details of receiving tricyclic residues of the compounds according to the present invention.

The required intermediate products in some cases are commercially available or can be obtained according to the literature methods. Treatment of appropriately substituted intermediate aryl or heteroaryl X-1 using POCl3gives intermediates of formula X-2. Pre the treatment of functional groups chloride functional group of the hydrazide yields an intermediate product X-3 and is implemented by the methods well-known specialist in this field. Cyclization with the corresponding diimidazole predecessor gives the compounds of formula X-4.

The reaction scheme XI illustrates an alternative synthesis of compounds of formula X-4.

The reaction scheme XII illustrates the synthesis of compounds of formula XII-2. The condensation of the X-3 with the appropriate trimethoxyaniline gives chloromethylstyrene intermediate XII-1, which is the result of nucleophilic substitution gives structure XII-2.

The reaction scheme XIII illustrates the connection of triazolopyridine. The synthesis begins with the well-known from the literature and patents of naphthyridine (XIII-I), which in turn chloride naphthiridine (XIII-2) after treatment POCl3in terms of boiling under reflux. The interaction of the latter compound with neat hydrazine boiling under reflux gives hydrazide (XIII-3), which serves as a key intermediate for the synthesis of compounds triazolopyridine. The conversion of the hydrazide (XIII-4) required in connection triazolopyridine in these conditions completes the planned synthesis. The substituent R on the rest of the triazole can be a functional group such as amino group, oxoprop or Tolna group.

The reaction scheme XIV illustrates an alternative method of introducing the rest of Tria the Ola in the left part of the molecule. It begins with the previously synthesized intermediate hydrazide (XIII-3)which can be processed by trimethoxybenzoate, getting the desired final product, compound diazonaphthalene (XIV-I). The substituent R on the rest of the triazole can be a functional group, such as a proton, a simple alkyl group, a group of chlormethyl or functionalized alkyl group.

The reaction scheme XV illustrates the synthesis of compounds of the formula XV-I, using three different methods reductive amination for the introduction of a primary amine in a certain position in benzyl. The methods are also applicable to other aldehydes, such as compounds of formula XVII-I.

The reaction scheme XVI illustrates the synthesis of compounds of formula XVI-2 by using a variation of the conditions for the cyclocondensation shown in the reaction scheme VIII. The use of aprotic solvent and base allows you to get chlornaphazine structure XVI-2.

The reaction scheme XVII illustrates the synthesis of compounds of formula XVII-4. In this case, the Deputy methyl injected in the position of the benzyl through the sulfonamide XVII-2. Other substituents can be introduced using ORGANOMETALLIC reagents such as Grignard reagents. Tert-butylsulfonyl can be split by acid, such as HCl, getting Amin.

The scheme of the reaction is s XVIII illustrates the synthesis of compounds of formula XVIII-2 as an option for the synthesis of triazole, described in reaction scheme XI. In this case, the hydrazine XVIII-I associated with carboxylic acid and intermediate acylhydrazone cyclist to condensed triazole under conditions of acid catalysis.

The reaction scheme XIX illustrates the synthesis of compounds of formula XIX-2, in which cyclopropylamine synthesized from nitrile XIX-1.

The reaction scheme XX illustrates the synthesis of compounds of formula XX-2 of the amines of the formula XX-1 at standard conditions of reductive amination.

The reaction scheme X

The reaction scheme XI

The reaction scheme XII

The reaction scheme XIII

The reaction scheme XIV

The reaction scheme XV

The reaction scheme XVI

The reaction scheme XVII

The reaction scheme XVIII

The reaction scheme XIX

The reaction scheme XX

EXAMPLES

The examples and diagrams are intended to further assist in understanding the invention. Have in mind that the specific substance and the conditions are additional illustrations of the invention and do not limit the appropriate scope of the invention.

SCHEME 1

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,thriasio[3,4-f]-1,6-naphthiridine-3-amine (1-4)

5-chloro-3-phenyl-2-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (1-2)

In a bottle RB volume of 25 ml with magnetic stir bar was loaded 3-phenyl-2-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine-5(6H)-he (0,86 g, 1.6 mmol), and then anhydrous POCl3(8 ml). The mixture was heated to 120°C and stirred while boiling under reflux for 4 hours. After the reaction mixture was cooled to room temperature, the reaction mixture was carefully added to the mixture of cold saturated aqueous solution of NaHCO3(20 ml) and EtOAc (20 ml). During the process of clearing the pH of the aqueous layer was maintained around pH 8-9. Then the aqueous solution was twice extracted with EtOAc (15 ml) and the residue washed with MeOH (20 ml). The organic phases were combined and concentrated in vacuum, obtaining 5-chloro-3-phenyl-2-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (1-2) (900 mg). The crude substance is directly used in the next stage without additional purification.

5-hydrazino-3-phenyl-2-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl)phenyl)-1,6-naphthiridine (1-3)

In the bottle RB volume of 25 ml with magnetic stir bar was loaded 5-chloro-3-phenyl-2-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (1-2) (900 mg, 1.6 mmol), and then anhydrous NH2NH2(8 ml). The suspension was heated to 110°C and stirred while boiling under reflux for 5 hours. After the reaction mixture was cooled to room temperature, the reaction mixture was concentrated in vacuum, obtaining a yellowish powder (900 mg). The crude product was used in the next stage without additional purification.

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (1-4)

To 5-hydrazino-3-phenyl-2-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (1-3) (70 mg, 0,126 mmol) in DMF (1.5 ml) was added known from the literature 1,1-di-1H-imidazol-1-ylmethanone (102 mg, 0,633 mmol). The reaction mixture was stirred at 85°C for 4 hours, concentrated in vacuo and subjected to chromatography, obtaining the required 9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl}[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (1-4) (46 mg) as a salt triperoxonane acid.1H NMR (500 MHz, CDCl3): δ 8,76 (s, 1H), total of 8.74 (d, J=4.3 Hz, 1H), 8,29-of 8.27 (m, 2H), 8,19 (m, 1H), to 7.67 (m, 1H), 7,54-7,53 (m, 2H), of 7.48-7,46 (m, 2H), 7,47 (d, J=7.7 Hz, 1H), 7,34-7,26 (m, 5H), 4,43 (s, 2H), 3,65 (userd, J=10,9 Hz, 2H), 3.46 in (users, 1H), 3.27 to 3,19 (m, 2H), 2,50-to 2.42 (m, 2H), 2,10-to 2.06 (m, 2H).

The following compounds listed in table 1, was obtained in a manner similar to the method shown in scheme 1, and the AK are shown in the diagrams reactions.

Table 1
Connection.StructureNameMS-BP m/z (M+H)
1-59-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-ol579,3
1-69-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine577,3
1-79-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-thiol595,2

SCHEME 2

3-methyl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-2)

To 5-hydrazino-3-phenyl-2-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (2-1) (55 mg, 0,101 mmol) in DMF (1.0 ml) was added t is emailarticle (0.63 ml, 5,04 mmol). The reaction mixture was stirred at 100°C for 3 hours and then concentrated in vacuo and subjected to chromatography, obtaining the desired 3-methyl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (2-2) (28 mg) as a salt triperoxonane acid.1H NMR (500 MHz, CDCl3): δ 8,87 (s, 1H), 8,65 (d, J=6,4 Hz, 1H), with 8.33 (d, J=7.5 Hz, 1H), 8,11 (d, J=7.8 Hz, 1H), 7,92 (t, J=7.8 Hz, 1H), 7,49-7,41 (m, 3H), of 7.36-7,30 (m, 8H), 3,61 (s, 2H), 3,02-3,00 (m, 2H), 3.00 and-2,84 (m, 1H), 2,25-of 2.21 (m, 2H), 2,10-to 1.83 (m, 4H), of 1.97 (s, 3H).

The following compounds listed in table 2, was obtained in a manner similar to the method described in scheme 2, and as shown in the schemes of reactions:

Table 2
Connection.StructureNameMS-BP m/z (M+H)
2-39-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine563,3
2-43-(chloromethyl)-9-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,24]triazolo[3,4-f]-1,6-naphthiridine 610,2
2-53-[(4-methylpiperazin-1-yl)methyl]-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine675,4

2-62-({[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methyl}amino)ethanol636,3

SCHEME 3

8-(4-Aminomethylphenol)-9-phenyl-[1,2,4]triazolo[3,4-f][1,6]naphthiridine-3-ol (3-8)

STAGE A: Tert-butyl(2-chloro-3-formylpyridine-4-yl)carbamate (3-1)

A solution of 4-amino-2-chloropyridine (1.28 g, 10 mmol) and di-tert-BUTYLCARBAMATE (2,21 g, 10.1 mmol) in THF (20 ml) was cooled to 0°C and slowly added a 1M solution of bis(trimethylsilyl)amide lithium in THF (20 ml, 20 mmol), keeping the temperature below 0°C. the Reaction mixture was allowed to warm to room temperature for one hour and then was suppressed by the addition of 1,5h. an aqueous solution of ammonium chloride (15 ml). After stirring for several hours the reaction is ionic mixture was extracted with ethyl acetate, was washed with saturated salt solution, the organic layer was dried (Na2SO4), filtered and evaporated. The residue is triturated in diethyl ether, obtaining purified tert-butyl(2-chloropyridin-4-yl)carbamate. The residual solution was subjected to chromatography on silica gel, elwira mixture 25-45% ethyl acetate/hexane, receiving an additional amount of product.

A solution of tert-butyl(2-chloropyridin-4-yl)carbamate (1,14 g, 5 mmol) in anhydrous THF (20 ml) was cooled to -70°C in an inert atmosphere and was slowly added a 1.7 M tert-utility/pentane (8 ml, 13.5 mmol). The reaction mixture was stirred for two hours and then was added anhydrous DMF (1.2 ml, of 15.5 mmol). The reaction mixture gave the opportunity to slowly warm to room temperature for three hours. The reaction mixture was extinguished 3h. HCl (12 ml) and diluted with diethyl ether. The ether layer was washed in an aqueous solution of NaHCO3, dried over Na2SO4), filtered and evaporated. The residue is triturated in cold diethyl ether, obtaining purified tert-butyl(2-chloro-3-formylpyridine-4-yl)carbamate. The residual solution was subjected to chromatography on silica gel, elwira mixture 15-20% ethyl acetate/hexane, receiving an additional amount of product.1H NMR (500 MHz, CDCl3): δ 11,0 (1H, users), 10,52 (1H, s) scored 8.38 (1H, d, J=6 Hz), 8,31 (1H, d, J=6 Hz), and 1.54 (9H, s); m/e (m+1): 257,2.

STAGE B: 1-[4-(1,3-Dioxolane-2-yl)who enyl]-2-phenylethanone (3-2)

To a solution of 4-cyanobenzaldehyde (20,0 g, 152,5 mmol) and ethylene glycol (25,5 ml, the rate of 457.5 mmol) in toluene (250 ml) was added para-toluensulfonate acid (300 mg). The flask was equipped with a trap Dean-stark and the mixture is boiled under reflux. After 5 hours the mixture was concentrated. The residue was collected in ethyl acetate and washed with saturated solution of NaHCO3, water (2×) and saturated salt solution. The organic layer was dried (MgSO4), filtered and concentrated, obtaining 4-(1,3-dioxolane-2-yl)benzonitrile in the form of a clear oil, which was aterials in vacuum:1H NMR (500 MHz, CDCl3): δ to 7.67 (2H, d, J=8,06 Hz), to 7.59 (2H, d, J=8,30 Hz), to 5.85 (1H, s), 4,13-of 4.05 (4H, m).

To a solution of 4-(1,3-dioxolane-2-yl)benzonitrile (5.0 g, 28,54 mmol) in anhydrous THF (100 ml) slowly at 0°C was added chloride benzylamine (36 ml, 20% of the mass. solution in THF, 43 mmol). After one hour the mixture was heated to room temperature. After 4 hours the mixture was cooled to 0°C and extinguished a saturated solution of NH4Cl. The mixture was heated to room temperature and was extracted with ethyl acetate (3×). The combined organic layers were dried (MgSO4), filtered and concentrated. Flash chromatography on a column (10% ethyl acetate/hexane) gave 1-[4-(1,3-dioxolane-2-yl)phenyl]-2-phenylethanol in the form of a pale yellow solid:1H NMR (500 MHz, CDCl3): δ 8,02 (2H, d, J=8,30 Hz), EUR 7.57 (2H, d, J=8,30 Hz), 7,38-of 7.24 (5H, m), 5,86(1H, C)the 4.29 (2H, s), 4,28-4.09 to (4H, m).

STAGE C: 5-Chloro-2-(4-[1,3]dioxolane-2-ylphenyl)-3-phenyl[1,6]naphthiridine (3-3)

To a solution of tert-butyl(2-chloro-3-formylpyridine-4-yl)carbamate (3-1, 30.5 g, 118,9 mmol) and 1-[4-(1,3-dioxolane-2-yl)phenyl]-2-phenylethanone (3-2, 29,0 g, 108,1 mmol) in anhydrous THF (300 ml) at room temperature was added LHMDS (1M in THF, 248 ml) in the stream. The reaction mixture was stirred at room temperature overnight and then boiled under reflux for 24 hours. The mixture was cooled and concentrated to obtain a syrup and processed NaHCO3(saturated solution, 50 ml) and water (300 ml) with the formation of solid, which was collected by filtration. The solid was dried, washed with ether and then azeotrope dried with toluene, receiving specified in the header connection. MS-NR m/z (M+1) calculated: 389,1; found 389,1.

STAGE D: [2-(4-[1,3]Dioxolane-2-ylphenyl)-3-phenyl[1,6]naphthiridine-5-yl]hydrazine (3-4)

A suspension of 5-chloro-2-(4-[1,3]dioxolane-2-ylphenyl)-3-phenyl[1,6]naphthiridine (3-3, 5,2 g, a 13.4 mmol) and anhydrous hydrazine (5 ml) in anhydrous 1,4-dioxane (15 ml) was heated at 100°C in a microwave reactor for 5 minutes, the Reaction mixture was cooled, concentrated and azeotrope dried with toluene, getting mentioned in the title compound in the form of solids. MS-NR m/z (M+1) calculated: 385,2; found 385,3.

STAGE E: 8-(4-[1,3]Dioxolane-2-ylphenyl)-9-Fe is Il[1,2,4]triazolo[3,4-f][1,6]naphthiridine-3-ol (3-5)

To a solution of [2-(4-[1,3]dioxolane-2-ylphenyl)-3-phenyl[1,6]naphthiridine-5-yl]hydrazine (3-4, 5.3g, to 13.8 mmol) in CH2Cl2(anhydrous, 40 ml) at 0°C was added triethylamine (9.7 ml, for 68.9 mmol), then quickly added phosgene in toluene (2M, 7,6 ml). After stirring for 10 min at room temperature the mixture was concentrated and added water (30 ml). The solid is collected and azeotrope dried with toluene, getting mentioned in the title compound, which was used for the next stage without additional purification. MS-NR m/z (M+1) calculated: 411,1; found 411,2.

STAGE F: 4-(3-Hydroxy-9-phenyl[1,2,4]triazolo[3,4-f][1,6]naphthiridine-8-yl)benzaldehyde (3-6)

A suspension of 8-(4-[1,3]dioxolane-2-ylphenyl)-9-phenyl[1,2,4]triazolo[3,4-f][1,6]naphthiridine-3-ol (3-5, 2.7 g, 6.6 mmol) in dioxane (20 ml) and 2n. HCl (20 ml) was stirred at room temperature for 20 minutes the Mixture was concentrated to remove most of the dioxane at 25°C. the Residue was poured into ice-cold water, getting a brown solid, which was collected by filtration and azeotrope dried with toluene, receiving specified in the header connection. MS-NR m/z (M+1) calculated: 367,1; found 367,1.

STAGE G: 8-(4-Aminomethyl-phenyl)-9-phenyl[1,2,4]triazolo[3,4-f][1,6]naphthiridine-3-ol (3-8)

A suspension of 4-(3-hydroxy-9-phenyl[1,2,4]triazolo[3,4-f][1,6]naphthiridine-8-yl)benzaldehyde (3-6, 2.4 g, 6.6 mmol) and 2-amino-2,4-dimethylpentane is islote (3-7, to 1.9 g of 13.1 mmol) in DMF (25 ml) was heated at 150°C for 20 minutes the Reaction mixture was cooled, diluted with dioxane (50 ml) and 2n. HCl (50 ml) and was heated at 100°C for 30 minutes the Mixture was cooled and purified by reversed-phase HPLC (0-60% acetonitrile/water)to give after evaporation of the solvent specified in the title compound as a yellow solid. MS-BP m/z (M+1) calculated: 368,1506; found 368,1504.1H NMR (CD3OD): δ 8,72 (s, 1H), 7,98 (d, 1H), 7,52 (d, 2H), 7,46 (d, 2H), 7.24 to 7,38 (m, 5H), 7,12 (d, 1H), 4,14 (s, 2H).

SCHEME 4

1-[4-(9-Phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (4-3)

STAGE A: 8-[4-(1,3-Dioxolane-2-yl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (4-1)

To a solution of [2-(4-[1,3]dioxolane-2-ylphenyl)-3-phenyl[1,6]naphthiridine-5-yl]hydrazine (3-4, 1.6 g, 4.2 mmol) and monohydrate toluensulfonate acid (79 mg, 0.4 mmol) in a mixture of 3:1 toluene:MeOH (16 ml) was added triethylorthoformate (of 0.58 ml, 12.5 mmol). The mixture was heated to 100°C in a microwave reactor for 1 hour. Then the reaction mixture was concentrated in vacuum. The solid is collected and azeotrope dried with toluene, getting mentioned in the title compound, which was used for the next stage without additional purification. MS-NR m/z (M+1) calculated: 395,1 found 395,2.

STAGE B: 4-(9-Phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-yl)benzaldehyde (4-2)

A suspension of 8-[4-(1,3-dioxolane-2-yl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (4-1, to 0.80 g, 2.0 mmol) in dioxane (10 ml) and 3n. HCl (10 ml) was stirred at room temperature for 15 minutes the Mixture was concentrated at 25°C to remove most of the dioxane. The residue was poured into ice-cold water, getting a brown solid, which was collected by filtration and azeotrope dried with toluene (x2), receiving specified in the header connection. MS-NR m/z (M+1) calculated: 351,1; found 351,2.

STAGE C: 1-[4-(9-Phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (4-3)

A suspension of 4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzaldehyde (4-2, to 0.80 g, 2.3 mmol) and 2-amino-2,4-dimethylpentane acid (3-7, 0,340 g, 2.3 mmol) in DMF (10 ml) was heated at 150°C for 30 minutes the Reaction mixture was cooled and the solvent was removed in vacuum. The crude residue was dissolved in 3n. HCl (8 ml) and heated at 100°C for 30 minutes the Mixture was cooled and purified by reversed-phase HPLC (5-65% acetonitrile/water over 15 min)to give after evaporation of the solvents mentioned in the title compound as a yellow solid.1H NMR (CD3OD): δ a 9.60 (s, 1H), 8,98 (s, 1H), 8,73 (d, 1H), of 7.75 (d, 1H), 7,60 (d, 2H), 7,46 (d, 2H), 7,39 was 7.36 (m, 5H), is 4.15 (s, 2H).

SCHEME 5

4-(3-Methyl-9-phenyl-[1,2,4]triazolo[3,4-f][1,6]naphthiridine-8-yl)benzylamine (5-3)

STAGE : 8-[4-(1,3-Dioxolane-2-yl)phenyl]-3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (5-1)

To a solution of [2-(4-[1,3]dioxolane-2-ylphenyl)-3-phenyl[1,6]naphthiridine-5-yl]hydrazine (3-4, 0.35 g, of 0.91 mmol) and monohydrate toluensulfonate acid (17 mg, 0.09 mmol) in a mixture of 3:1 toluene:MeOH (4 ml) was added triethylorthoformate (of) 0.157 ml of 1.23 mmol). The mixture was heated to 100°C in a microwave reactor for 75 minutes and Then the reaction mixture was concentrated in vacuum. The solid is collected and azeotrope dried with toluene, getting mentioned in the title compound, which was used for the next stage without additional purification. MS-NR m/z (M+1) calculated: 409,2 found 409,2.

STAGE B: 4-(3-Methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzaldehyde (5-2)

A suspension of 8-[4-(1,3-dioxolane-2-yl)phenyl]-3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (5-1, a 0.30 g, 0.73 mmol) in dioxane (5 ml) and 3n. HCl (5 ml) was stirred at room temperature for 15 minutes the Mixture was concentrated at 25°C to remove most of the dioxane. The residue was poured into ice-cold water, getting a brown solid, which was collected by filtration and azeotrope dried with toluene (x2), receiving specified in the header connection. MS-NR m/z (M+1) calculated: 365,1; found 365,2.

STAGE C: 4-(3-Methyl-9-phenyl[1,2,4]triazolo[3,4-f][1,6]naphthiridine-8-yl)benzylamine (5-3)

A suspension of 4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzaldehyde (13, 0.25 g, 0.69 mmol) and 2-amino-2,4-dimethylpentan the howling acid (3-7, 0,101 g, 0.69 mmol) in DMF (3 ml) was heated at 150°C for 30 minutes the Reaction mixture was cooled and the solvent was removed in vacuum. The crude residue was dissolved in 3n. HCl (2.5 ml) and heated at 100°C for 30 minutes the Mixture was cooled and purified by reversed-phase HPLC (5-65% acetonitrile/water over 15 min)to give after evaporation of the solvents mentioned in the title compound as a yellow solid. MS-BP m/z (M+1) calculated: 366,1713 found 366,1715.

Figure 5 (ALTERNATIVE SYNTHESIS)

4-(3-Methyl-9-phenyl[1,2,4]triazolo[3,4-f][1,6]naphthiridine-8-yl)benzylamine (5-3)

STAGE A: 4-(5-Chloro-3-phenyl[1,6]naphthiridine-2-yl)benzaldehyde (A)

To a solution of 3-3 (5.0 g, 12.9 mmol) in 1,4-dioxane (30 ml) at 0°C was added to 8.5 ml of 3h. HCl (25,7 mmol). The mixture was allowed to warm to room temperature and was stirred for 1.3 hours. The reaction mixture was extinguished NaHCO3(saturated solution) until pH 7-8. The mixture was extracted with EtOAc (X3). The combined organic layers were washed with saturated salt solution, dried over MgSO4and concentrated, obtaining a yellow solid as the desired product A. LC/MS found: M+1=345,1.

STAGE B: Tert-butyl ether [4-(5-chloro-3-phenyl[1,6]naphthiridine-2-yl)benzyl]carbamino acid (C)

To A solution (2.8 g, 8.1 mmol) and B (1.1 g, 8.9 mmol)in 15 ml of anhydrous MeCN was added triethylsilane (8.5 g, 73 mmol), then triperoxonane acid (3.7 g, 32.5 mmol). The mixture was stirred at room temperature for 3 hours. Then the mixture was poured into aqueous sodium bicarbonate solution (30 ml) and was extracted with EtOAc (X3). The combined organic layers were washed with saturated salt solution and dried over MgSO4. After removal of solvent the residue was purified flash chromatography on a column of receiving the desired product C. LC/MS found: M+1=446,1.

STAGE C: Tert-butyl ether [4-(5-hydrazino-3-phenyl[1,6]naphthiridine-2-yl)benzyl]carbamino acid (D)

To a solution of C (3.7 g, 8.3 mmol) in 22 ml of 1,4-dioxane was added dropwise hydrazine (6,1 g, 189,1 mmol). The mixture was heated at 100°C in a microwave reactor for 5 minutes After removal of the solvent the residue was collected in EtOAc and washed with saturated solution of NaHCO3. The organic layer was washed with saturated salt solution, dried over MgSO4and concentrated, obtaining the desired product D, which was used in the next stage without additional purification. LC/MS found: M+1=442,2.

STAGE D: Tert-butyl ether [4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f][1,6]naphthiridine-8-yl)benzyl]carbamino acid (E)

To a solution of D (3.8 g, 8.6 mmol) and monohydrate para-toluensulfonate acid (0.08 g, 0.4 mmol) in 20 ml of a mixture of toluene/methanol (3:1) was added triethylorthoformate (1.4 g, 11.6 mmol). The solution was heated in mi is Romanova reactor at 100°C for 35 minutes The reaction mixture was extinguished solid NaHCO3(0.5 g). The organic layer was concentrated and purified flash chromatography on a column (100% EtOAc To 10% MeOH/90% EtOAc in over 35 min)to give the desired product E. LC/MS found: M+1=466,2.

STAGE E: 4-(3-Methyl-9-phenyl[1,2,4]triazolo[3,4-f][1,6]naphthiridine-8-yl)benzylamine (5-3)

To a solution of E (4.1 g, 8,7 mmol) in 80 ml of CH2Cl2was added dropwise 40 ml of TFU. The mixture was stirred at room temperature for 15 minutes the Solvent was removed. The residue was treated with NaHCO3(saturated solution) until pH 9. The mixture was extracted with EtOAc (X6). The combined organic layers were concentrated and dried over MgSO4. After removal of solvent required 5-6 product as a yellow solid. LC/MS found: M+1=366,1.1H NMR (300 MHz, CD3OD): δ of 8.95 (s, 1H), 8,66 (d, 1H), 7,82 (d, 1H), 7,60 (d, 2H), 7,45 (d, 2H), 7,42-7,34 (m, 5H), is 4.15 (s, 2H), 3.00 and (s, 3H).

SCHEME 6

8-[4-(Aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (6-2)

STAGE A: 8-[4-(1,3-Dioxolane-2-yl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (6-1)

To anhydrous EtOH (1 ml) was added brazian (0.104 g ml, 0.52 mmol, 5 M in MeCN), then sodium carbonate (96 mg, of 0.91 mmol). Was added [2-(4-[1,3]Dioxolane-2-ylphenyl)-3-phenyl[1,6]naphthiridine-5-yl]hydrazine (3-4, 100 mg, 0.26 mmol) and the mixture was stirred for 3 hours. The reaction mixture is concentrated in vacuo and the resulting solid was used without further purification. MS-NR m/z (M+1) calculated: 410,2; found 410,1.

STAGE B: 8-[4-(Aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (6-2)

Specified in the title compound was obtained from 8-[4-(1,3-dioxolane-2-yl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine (6-1)using the methods described in scheme 5 (5-1 to 5-3). MS-NR m/z (M+1) calculated: 367,2; found 367,1.

SCHEME 7

1-[4-(9-Phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (7-4)

STAGE A: 2-Methyl-N-{(1E)-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methylidene}propane-2-sulfinamide (7-2)

Racemic 2-methyl-2-propanesulfinamide (7-1, 647 mg, 5.3 mmol), copper sulfate (1.70 g, 7,30 mmol) and aldehyde 4-2 (511 mg, 1,45 mmol) was stirred in methylene chloride (10 ml) for 5 days at 50°C. After cooling to room temperature the mixture was filtered through celite, concentrated to a minimum volume and purified by automated chromatography on silica gel (0-10% MeOH in CH2Cl2within 30 min), getting mentioned in the title compound as a brown foam. MS-NR m/z (M+1) calculated: 454,2; found 454,2.

STAGE B: 2-Methyl-N-{1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenylethylamine-2-sulfinamide (7-3)

Bromide solution Metalmania (13,5 ml of 1.4 M solution in a mixture of 3:1 toluene/THF, 19 mmol) was added to a stirred solution of 2-methyl-N-{(1E)-[4-(phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methylidene}propane-2-sulfinamide (7-2, 298 mg, 0.66 mmol) in methylene chloride (5 ml) at -78°C and the solution was heated to room temperature. After 18 h, the reaction mixture was extinguished with a saturated solution of ammonium chloride and was extracted with ethyl acetate, washed with saturated salt solution, dried over magnesium sulfate, filtered and concentrated, obtaining the foam is amber, which was purified by chromatography on silica gel (0-10% MeOH/CH2Cl2within 30 min), getting mentioned in the title compound as a yellow foam. MS-NR m/z (M+1) calculated: 470,2; found 470,3.

STAGE C: 1-[4-(9-Phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (7-4)

To a stirred solution of 2-methyl-N-{1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}propane-2-sulfinamide (7-3, 180 mg, 0.38 mmol) in methanol (6 ml) was added concentrated HCl (1.5 ml). After 1 hour was added water and the mixture was washed with methylene chloride. The water part was podslushivaet a saturated solution of sodium carbonate and was extracted with methylene chloride. To the organic layer was added 2n. HCl (5 ml) and the mixture was concentrated to a minimum volume. The crude product was purified using reverse-phase preparative HPLC, getting mentioned in the title compound as a pale yellow solid. MS-NR m/z (M+1) calculated: 366,2 found 366,3.

SCHEME 8

9-Phenyl-8-{4-[4-(5-pyridin-2-yl-4H-[1,2,4]triazole-3-yl)piperidine-1-ylmethyl]phenyl}-[1,2,4]triazolo[3,4-f][1,6]naphthiridine (8-10)

Tert-butyl(2-chloro-3-formylpyridine-4-yl)carbamate (8-1)

A solution of 4-amino-2-chloropyridine (1.28 g, 10 mmol) and di-tert-BUTYLCARBAMATE (2,21 g, 10.1 mmol) in THF (20 ml) was cooled to 0°C and slowly added a 1M solution of bis(trimethylsilyl)amide lithium in THF (20 ml, 20 mmol), keeping the temperature below 0°C. the Reaction mixture was allowed to warm to room temperature for one hour and then was suppressed by the addition of 1,5h. an aqueous solution of ammonium chloride (15 ml). The mixture was extracted with ethyl acetate, washed with saturated salt solution and the organic layer was dried (Na2SO4), filtered and evaporated. The residue is triturated in diethyl ether, obtaining purified tert-butyl(2-chloropyridin-4-yl)carbamate. The residual solution was subjected to chromatography on silica gel, elwira mixture 25-45% ethyl acetate/hexane, receiving an additional amount of product.

A solution of tert-butyl(2-chloropyridin-4-yl)carbamate (1,14 g, 5 mmol) in anhydrous THF (20 ml) was cooled to -70°C in an inert atmosphere and slowly added 1.7 M tert-utility/pentane (8 ml, 13.5 mmol). The reaction mixture was stirred for two hours and then was added anhydrous DMF (1.2 ml, of 15.5 mmol). The reaction mixture gave the opportunity to slowly warm to room t is mperature for three hours. The reaction mixture was extinguished 3h. HCl (12 ml) and diluted with diethyl ether. The ether layer was washed in an aqueous solution of NaHCO3, dried over Na2SO4), filtered and evaporated. The residue is triturated in cold diethyl ether, obtaining purified tert-butyl(2-chloro-3-formylpyridine-4-yl)carbamate. The residual solution was subjected to chromatography on silica gel, elwira mixture 15-20% ethyl acetate/hexane, receiving an additional amount of product.1H NMR (500 MHz, CDCl3): δ 11,0 (1H, users), 10,52 (1H, s), scored 8.38 (1H, d, J=6 Hz), 8,31 (1H, d, J=6 Hz), and 1.54 (9H, s); m/e (m+1): 257,2.

1-[4-(1,3-Dioxolane-2-yl)phenyl]-2-phenylethanone (8-2)

To a solution of 4-cyanobenzaldehyde (20,0 g, 152,5 mmol) and ethylene glycol (25,5 ml, the rate of 457.5 mmol) in toluene (250 ml) was added para-toluensulfonate acid (300 mg). The flask was equipped with a trap Dean-stark and the mixture is boiled under reflux. After 5 h the mixture was concentrated. The residue was collected in ethyl acetate and washed with saturated solution of NaHCO3, water (2x) and saturated salt solution. The organic layer was dried (MgSO4), filtered and concentrated, obtaining 4-(1,3-dioxolane-2-yl)benzonitrile in the form of a clear oil, which was aterials in vacuum:1H NMR (500 MHz, CDCl3): δ to 7.67 (2H, d, J=8,06 Hz), to 7.59 (2H, d, J=8,30 Hz), to 5.85 (1H, s), 4,13-of 4.05 (4H, m).

To a solution of 4-(1,3-dioxolane-2-yl)benzonitrile (5.0 g, 28,54 mmol) in anhydrous THF (100 ml) slowly n and 0°C was added chloride benzylamine (36 ml, 20% of the mass. solution in THF, 43 mmol). After one hour the mixture was heated to room temperature. After four hours the mixture was cooled to 0°C and extinguished a saturated solution of NH4Cl. The mixture was heated to room temperature and was extracted with ethyl acetate (3x). The combined organic layers were dried (MgSO4), filtered and concentrated. Flash chromatography on a column (10% ethyl acetate/hexane) gave 1-[4-(1,3-dioxolane-2-yl)phenyl]-2-phenylethanol in the form of a pale yellow solid:1H NMR (500 MHz, CDCl3): δ 8,02 (2H, d, J=8,30 Hz), EUR 7.57 (2H, d, J=8,30 Hz), 7,38-of 7.24 (5H, m), 5,86 (1H, s), the 4.29 (2H, s), 4,28-4.09 to (4H, m).

2-[4-(1,3-Dioxolane-2-yl)phenyl]-5-methoxy-3-phenyl-1,6-naphthiridine (8-3)

To incomplete solution of 1-[4-(1,3-dioxolane-2-yl)phenyl]-2-phenylethanone (997 mg, 3.72 mmol) and tert-butyl(2-chloro-3-formylpyridine-4-yl)carbamate (924 mg, 3.6 mmol) in anhydrous methanol (14 ml) was added a mixture of 25% of the mass. the sodium methoxide/methanol (2.5 ml, of 11.4 mmol). The reaction mixture was heated at 65°C for four hours. The cooled reaction mixture was concentrated to remove methanol and the residue was distributed between water and ethyl acetate. The organic layer was dried (Na2SO4), filtered and evaporated. The residue is triturated in cold ether, obtaining the purified 2-[4-(1,3-dioxolane-2-yl)phenyl]-5-methoxy-3-phenyl-1,6-naphthiridine. The residual solution was purified by chromatography on silica gel, and elwira is the use of a mixture of 20-40% ethyl acetate/hexane gave an additional amount of product. 1H NMR (500 MHz, CDCl3): δ 8,54 (1H, s)8,23 (1H, d, J=5,9 Hz), 7,55 (1H, d, J=5,9 Hz), of 7.48 (2H, d, J=8 Hz), 7,40 (2H, d, J=8 Hz), 7,29-7,30 (3H, m), 7,22-of 7.25 (2H, m), 4,16 (3H, s), as 4.02-411 (4H, 2m), m/e (m+1): 385,1.

4-(5-Methoxy-3-phenyl-1,6-naphthiridine-2-yl)benzaldehyde (8-4)

To a solution of 2-[4-(1,3-dioxolane-2-yl)phenyl]-5-methoxy-3-phenyl-1,6-naphthiridine (760 mg, to 1.98 mmol) in THF (8 ml) was added 1N. HCl (6 ml) and the solution was stirred for three hours. Ethyl acetate was added and the mixture was podslushivaet aqueous solution of Na2CO3. The organic layer was dried (Na2SO4), filtered and the solvent evaporated. The residue is triturated in diethyl ether, obtaining a pure product. The residual solution was purified by chromatography on a column of silica gel, and elution with a mixture of 10-30% ethyl acetate/hexane gave an additional amount of product.1H NMR (500 MHz, CDCl3): δ 10,10 (1H, s), at 8.60 (1H, s), compared to 8.26 (1H, d, J=6 Hz), 7,81 (2H, d, J=8,3 Hz), a 7.62 (2H, d, J=8,3 Hz), 7,56 (1H, d, J=6,1 Hz), 7,30-to 7.32 (3H, m), 7,21-of 7.23 (2H, m), 4,17 (3H, s), m/e (m+1): 341,1.

The dihydrochloride of 2-(3-piperidine-4-yl-1H-1,2,4-triazole-5-yl)pyridine (8-5)

Carbonyldiimidazole (3.57 g, 22 mmol) was added to a solution of 1-(tert-butoxycarbonyl)piperidine-4-carboxylic acid (4.59 g, 20 mmol) in methylene chloride (50 ml) and was stirred for two hours until the gas evolution stops. Then to the reaction mixture was added hydrazine (0.8 ml, 26 mmol) and the reaction mixture was stirred at room themes is the temperature value within two hours. The reaction mixture was diluted with more methylene chloride and washed with saturated aqueous NaHCO3. The organic layer was dried over anhydrous Na2SO4was filtered and the solvent evaporated, receiving a viscous residue. Rubbing in diethyl ether gave tert-butyl 4-(hydrazinophenyl)piperidine-1-carboxylate in the form of not-quite-white solid.1H NMR (500 MHz, CDCl3): δ 6,77 (1H, users), is 4.15 (2H, users), 3,90 (2H, users), a 2.75 (2H, users), 2,22 (1H, m), of 1.78 (2H, userd, J=11,9 Hz)of 1.66 (2H, userc, J=and 12.2 Hz, J=27.5 Hz), of 1.47 (9H, s).

The resulting substance (2,43 g, 10 mmol) was dissolved in anhydrous 2-ethoxyethanol (20 ml) and to the solution was added 2-cyanopyridine (1,14 g, 11 mmol). After adding a mixture of 25% of the mass. the sodium methoxide/methanol (1.1 ml, ~5 mmol) the mixture was heated to 130°C for 16 hours. The cooled reaction mixture was neutralized with acetic acid and was distributed between ethyl acetate and aqueous solution of NaHCO3. The organic layer was dried over Na2SO4salt was removed by filtration and the solvent evaporated in vacuum. The resulting residue is triturated in diethyl ether, obtaining tert-butyl-4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-carboxylate as a white solid.1H NMR (500 MHz, CDCl3): δ to 8.70 (1H, d, J=3,9 Hz), 8,19 (1H, d, J=7.9 Hz), 7,87 (1H, dt, J=1.7 Hz, J=8 Hz), 7,40 (1H, m), 4,20 (2H, users), 3,03 (1H, m), 2,95 (2H, users), 2,09 2H, userd, J=12 Hz), to 1.86 (2H, userc, J=4, 2 Hz), for 1.49 (9H, s); m/e (m+1): 330,2.

The resulting substance (2,68 g, 8,14 mmol) suspended in a mixture of 4n. HCl/dioxane. The reaction mixture in a closed vessel was stirred at room temperature for 16 hours and then diluted with diethyl ether. The solid was isolated by filtration and hygroscopic solid was treated with acetonitrile. The obtained solid was isolated by filtration and was partially dissolved in hot methanol. After cooling and adding to the solution a quantity of ethyl ester of 2-(3-piperidine-4-yl-1H-1,2,4-triazole-5-yl)pyridine was slowly precipitate in the form of dihydrochloride salt.1H NMR (500 MHz, DMSO-d6): δ 9,10 (1H, users), of 8.92 (1H, users), 8,73 (1H, d, J=4.9 Hz), 8,10-to 8.20 (2H, m), of 7.64 (1H, t, J=5.7 Hz), to 3.33 (2H, userd, J=a 12.7 Hz), and 3.16 (1H, m), 3,05 (2H, userc, J=11,9 Hz, J=21,8 Hz)to 2.18 (2H, userd, J=11.5 Hz), 1,99 (2H, userc, J=to 11.0 Hz, J=22,2 Hz): m/e (m+1): 230,3.

5-Methoxy-3-phenyl-2-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]were-1,6-naphthiridine (8-6)

To a solution of dihydrochloride of 2-(3-piperidine-4-yl-1H-1,2,4-triazole-5-yl)pyridine (542 mg, of 1.80 mmol) and 4-(5-methoxy-3-phenyl-1,6-naphthiridine-2-yl)benzaldehyde (560 mg, of 1.65 mmol) in anhydrous DMF (6 ml) was added triethylamine (of 0.83 ml, 6 mmol). After stirring for 10 minutes was added acetic acid (of 1.03 ml, 18 mmol) and the mixture was stirred at room temperature in ECENA night. Then one portion was added triacetoxyborohydride sodium (367 mg, at 1.73 mmol) and was stirred for six hours. After validation using LC/MS was determined that the reaction was not completed, added additional portions of triacetoxyborohydride sodium (2×90 mg) over the next several hours, during which time the reaction was complete. The mixture was diluted with ethyl acetate and was added an aqueous solution of Na2CO3. The organic layer was separated and washed twice with water, dried (Na2SO4) and the solvent evaporated. The residue was treated with acetonitrile and after cooling, the solid product was isolated by filtration. The obtained solid is suspended in hot ethyl acetate and slowly added methanol until complete dissolution. Then the solvents evaporated to small volume and allowed to cool, it was crystallized pure product. The residual solution was purified by chromatography on a column of silica gel, and elution with a mixture of 1-7% methanol/ethyl acetate gave an additional amount of product.1H NMR (500 MHz, CDCl3): δ 8,66 (1H, d, J=4,7 Hz), 8,54 (1H, s)8,23 (1H, d, J=6 Hz), 8,16 (1H, d, J=7.8 Hz), 7,83 (1H, dt, J=1.7 Hz, J=7.8 Hz), 7,56 (1H, d, J=6 Hz), 7,40 (2H, d, J=8 Hz), was 7.36 (1H, DD), 7,28-7,30 (3H, m), 7.23 percent-of 7.25 (2H, m), 4,16 (3H, s), of 3.54 (2H, s), 2,96 (2H, userd, J=11.5 Hz), 2,85 (1H, t, J=3,7 Hz), 2.06 to 2,17 (4H, m), 1,92 is 2.01 (2H, m), m/e (m+1): 554,3, 277,9 [(m+2)/2].

3-Phenyl-2-(4-{[4-(5-feast of the DIN-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine-5(6H)-he (8-7)

A mixture of 5-methoxy-3-phenyl-2-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (725 mg, 1,31 mmol) and pyridine hydrochloride (6.9 g, ~60 mmol) was heated at 150°C for ten minutes. The cooled residue was dissolved in minimum amount of water and neutralized aqueous solution of NaHCO3. Precipitinogen solid substance was collected by filtration and was purified by chromatography on a column of silica gel, elwira mixture 1-14% methanol/ethyl acetate (saturated NH4OH). The isolated product was treated with a mixture of methanol/acetonitrile, getting a pure product.1H NMR (500 MHz, DMSO-d6): δ 11,58 (1H, d, J=4,8 Hz), 8,68 (1H, users), 8,39 (1H, s), 8,03 (1H, d, J=7,3 Hz), 7,50 (2H, t, J=6.5 Hz), 7,31-7,33 (5H, m), 7.24 to to 7.25 (4H, m), 6,79 (2H, d, J=7,3 Hz), 3,50 (2H, s)2,84 (2H, userd, J=10.5 Hz), of 2.72 (1H, m), of 2.08 (2H, ushort, J=11 Hz), 1,95 (2H, userd, J=11,6 Hz), or 1.77 (2H, m). m/e (m+1): 540,3, 270,9 [(m+2)/2].

5-Chloro-3-phenyl-2-{4-[4-(5-pyridin-2-yl-4H-[1,2,4]triazole-3-yl)piperidine-1-ylmethyl]phenyl}[1,6]naphthiridine (8-8)

The mixture 8-7 (5.5 g, 10.2 mmol) and POCl3(50.0 g, to 326.1 mmol) and DMF (0.3 g, 4.1 mmol) was boiled under reflux at 130°C for 3 hours. The reaction mixture was cooled and concentrated to remove POCl3. Added 40 ml of toluene and concentrated, obtaining a solid substance. The solid substance was added 50 ml of H2O and 40 ml of NaHCO3(saturated) and 20 ml of 1N. NaOH to pH 9. The mixture was stirred to precipit is its solid, which was collected by filtration in the form of the desired product 8-8. The product was washed with water and CH3CN and dried in vacuum.

LC/MS: M+1=559,09.

(3-Phenyl-2-{4-[4-(5-pyridin-2-yl-4H-[1,2,4]triazole-3-yl)piperidine-1-ylmethyl]phenyl}[1,6]naphthiridine-5-yl)hydrazine (8-9)

Suspension 8-8 (4.3 g, 7.7 mmol) in 30 ml of 1,4-dioxane and hydrazine (7,4 g, 231,1 mmol) was heated in a microwave reactor at 100°C for 5 minutes the Mixture was cooled and concentrated to remove the solvents. Added toluene 40 ml (X3) and removed under vacuum to remove residual hydrazine. The desired product 8-9 received in the form of solids.

LC/MS: M+1=554,4.

9-Phenyl-8-{4-[4-(5-pyridin-2-yl-4H-[1,2,4]triazole-3-yl)piperidine-1-ylmethyl]phenyl}[1,2,4]triazolo[3,4-f][1,6]naphthiridine (8-10)

To a solution of 8-9 (4.5 g, 8.1 mmol) in 20 ml of methanol and 60 ml of toluene was added trimethoxyflavone (3.5 g, 32.5 mmol) and toluensulfonate acid (0.1 g, 0.8 mmol). The mixture was boiled under reflux for 10 hours. After removal of solvent the residue was purified flash chromatography on a column (100% CHCl3up to 50% CHCl3and 50% methanol)to give the desired product 8-10.

MS-BP: M+1 (calculated) = 564,2619; found = 564,2589.

1H NMR (500 MHz, CD3OD): δ a 9.35 (1H, s), 8,96 (1H, s), 8,72 (1H, d), 8,59 (1H, d), 8,28-8,10 (2H, m), 7.68 per-of 7.48 (6H, m), 7,40-7,30 (5H, m), and 4.40 (2H, s), 3,68-3,20 (5H, m), 2,50 is 2.10 (4H, m).

SCHEME 9

9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-(1H-1,2,3-triazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-4)

4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)benzaldehyde (9-1)

To a stirred solution of 3-3 (16 g, 41,1 mmol) in anhydrous 1,4-dioxane (75 ml) at 0°C was added 3n. HCl (27 ml). Then the reaction mixture was allowed to reach room temperature and was stirred for about 3 hours. After completion of the reaction extinguished a saturated solution of NaHCO3to pH>7. The product was extracted with ethyl acetate (3×150 ml). The combined organic layers were washed with saturated salt solution, dried over Na2SO4and MgSO4, filtered and concentrated in vacuum, obtaining 4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)benzaldehyde 9-1 in the form of a yellow-brown solid. LC/MS (M+1) calculated: 345,8; found: 345,0.

5-chloro-3-phenyl-2-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (9-2)

To a stirred solution of 9-1 (4.9 g, of 14.2 mmol) and 8-5 (4,2 g, 15.6 mmol) in NMP (50 ml) was added triethylamine (6 ml, of 42.6 mmol)and then acetic acid (1.6 ml, 28.4 mmol). After stirring at ambient temperature over night portions was added triacetoxyborohydride sodium (3.6 g, 17 mmol). After completion, the reaction mixture was diluted what dilatatum and washed with saturated solution of NaHCO 3then water, then a saturated solution of salt. The organic layer was dried over Na2SO4and MgSO4, filtered and concentrated in vacuum. The crude residue was purified using flash chromatography on silica (gradient: 0% to 10% MeOH in CHCl3within 25 min), receiving 9-2 in the form of an orange solid. LC/MS (M+1) calculated: 559,1; found: 559,2.

5-hydrazino-3-phenyl-2-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (9-3)

To mix the solution 9-2 (5 g, 8.9 mmol) in anhydrous 1,4-dioxane (20 ml) was added hydrazine (5,9 ml, 188,1 mmol). The solution was heated to 100°C in a microwave reactor for 5 minutes. The solvent was removed in vacuum and three times conducted azeotropic drying with toluene. The crude solid was ground in a saturated solution of NaHCO3within 20 minutes. The suspension was filtered and washed with large amounts of water. The solid is three times azeotrope dried with toluene, getting 9-3 in the form of a yellow-brown solid. LC/MS (M+1) calculated: 554,6; found: 554,2.

9-phenyl-8-(4-{[4-(5-pyridin-2-yl~4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-(1H-1,2,3-triazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (9-4)

To mix the solution 9-3 (2.0 g, 3.6 mmol), HOBT (0.5 g, 3.9 mmol) and 1H-1,2,3-triazole-4-carboxylic acid (0.4 g, 3.9 mmol) in anhydrous DMF (20 ml) was added DIEA (1.2 ml,7.2 mmol), then EDC (0,76 g, 3.9 mmol). The solution was stirred at ambient temperature overnight. Then the solution was treated with 2 ml of acetic acid and was heated up to 80°C for 3 hours. After cooling to room temperature the solution was filtered through a syringe filter and purified by reversed-phase HPLC on C18 column, receiving 9-4 in the form of solids. MS (M+1), calculated: 631,2789; found: 631,2778.

Table 3 shows compounds obtained using the methods according to scheme 9, with replacement 8-9 appropriate amine and replacing 1H-1,2,3-triazole-4-carboxylic acid of the corresponding carboxylic acid. Connection 9-5 - 9-8 and 9-13 - 9-25 was isolated as HCl-salt. Connection 9-9 - 9-12 allocated in the form of TFU-salts.

Table 3
Connection.StructureNameMS-BP m/z (M+H)
9-53-(1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine630,2831
9-6the pet-butyl[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methylcarbamate 693,3394
9-7[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol594,2703
9-85-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]-2,4-dihydro-3H-1,2,4-triazole-3-one647,2729
9-93-(3-methyl-1H-1,2,4-triazole-5-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine645,2948

9-103 imidazo[2,1-b][1,3]thiazol-6-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine686,2547
9-119-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,triazol-3-yl)piperidine-1-yl]methyl}phenyl)-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine 682,2902
9-123 imidazo[1,2-a]pyridine-2-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridineMS-NR (M+1)=680,3
9-139-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-(1H-1,2,4-triazole-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine631,2792
9-143-(1H-benzimidazole-6-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine680,2988
9-153-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl}methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine658,3145
9-163 imidazo[1,2-a]pyrimidine-2-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine--yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine 681,2949
9-175-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]pyridine-2-amine656,2988
9-189-phenyl-3-pyrazolo[1,5-a]pyrimidine-3-yl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine681,2951
9-193-(5-methyl-1H-pyrazole-3-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine644,2998
9-203-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]pyridine-2-amine656,298
9-214-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,-naphthiridine-3-yl]phenol 656,288
9-223-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]phenol656,288
9-232-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]phenol656,2894
9-241-{4-[3-(5-oxo-4,5-dihydro-1H-1,2,4-triazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}piperidine-4-carboxamide546,2344
9-251-[4-(3-imidazo[1,2-a]pyridine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]piperidine-4-carboxamide579,2598

SCHEME 10

9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (10-4)

2-(3-piperidine-4-yl-1H-1,2,4-Tr the azole-5-yl)pyrazin (10-1)

To a solution of 1-(tert-butoxycarbonyl)piperidine-4-carboxylic acid (120 g, 520 mmol) in DHM (250 ml) portions was added carbonyldiimidazole (96 g, 590 mmol) at room temperature. After 30 minutes the reaction mixture was added to a freshly prepared solution of hydrazine (27 g, 840 mmol) in DHM (100 ml). After 30 minutes the reaction mixture was washed with saturated sodium carbonate solution, saturated salt solution, dried over sodium sulfate, filtered and concentrated. The resulting solid is suspended in ether and filtered, obtaining tert-butyl-4-(hydrazinophenyl)piperidine-1-carboxylate as a white solid.1H NMR (400 MHz, DMSO-d6): δ of 9.00 (s, 1H), 4,15-4,10 (s, 2H), 3.95 to 3,90 (m, 2H), 2,80-2,60 (m, 2H), 2,25-of 2.20 (m, 1H), 1,62-of 1.55 (m, 2H), 1,40 (s, 9H).

The solution pyrazinecarboxamide (2.0 g, 19 mmol) in methanol (20 ml) was treated with sodium methoxide in methanol (25 wt. -%, 1.3 ml, 5.7 mmol) at room temperature. After 30 minutes the solution was added tert-butyl 4-(hydrazinophenyl)piperidine-1-carboxylate (4.6 g, 19 mmol) in methanol (20 ml) and the reaction mixture is boiled under reflux for 19 hours. The reaction mixture was concentrated, dissolved in ethoxyethanol (50 ml) and boiled under reflux for 22 hours. The reaction mixture was cooled to room temperature, extinguished acetic acid (0,38 ml, 6.6 mmol) is concentrated. The residue is suspended in ether and filtered, obtaining tert-butyl-4-(5-pyrazin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-carboxylate in the form of solids. MS-BP(M+N+): found = 331,1876, computed = 331,1877.1H NMR (400 MHz, CD3OD): δ 9,29 (d, J=1.6 Hz, 1H), 8,70 (DD, J=2,4, and 1.6 Hz, 1H), 8,64 (d, J=2.4 Hz, 2H), 4,19-to 4.15 (m, 2H), 3,15-to 3.09 (m, 1H), 2,97 (m, 2H), 2,07-2,03 (m, 2H), 1,84 is 1.75 (m, 2H), to 1.48 (s, 9H).

A solution of tert-butyl 4-(5-pyrazin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-carboxylate (6.0 g, 18 mmol) in triperoxonane acid (25 ml) was stirred at room temperature. After 1 hour the reaction mixture was concentrated. The resulting solid is suspended in ethyl acetate and methanol and filtered, obtaining 10-1 in the form of TFU-salt. The salt was dissolved in a mixture of 1:1 acetonitrile:water, was applied to a SCX ion-exchange resin, washed with acetonitrile and suirable 10% NH3in ethanol, receiving 10-1 in the form of a solid substance.1H NMR (400 MHz, CDCl3): δ 9.28 are-9,26 (m, 1H), 8,70-8,68 (m, 1H), 8,60-8,58 (m, 1H), 3,35-up 3.22 (m, 2H), 3.15 and was 3.05 (m, 1H), 2,90-to 2.85 (m, 2H), 2,15-of 2.08 (m, 2H), 1,95-1,90 (m, 2H).

5-chloro-3-phenyl-2-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (10-2)

To a stirred solution of 9-1 (1 g, 2.9 mmol) and 10-1 (1,09 g, 3.2 mmol) in NMP (10 ml) was added triethylamine (0.8 ml, 5.8 mmol)and then acetic acid (0.3 ml, 5.8 mmol). After stirring at ambient temperature over night portions were added to triacetoxyborohydride sodium (0.6 g, 2.9 mmol). After completion, the reaction mixture was diluted with ethyl acetate and washed with saturated solution of NaHCO3then water, then a saturated solution of salt. The organic layer was dried Na2SO4and MgSO4, filtered and concentrated in vacuum. The crude residue was purified using flash chromatography on silica (gradient: 0% to 10% MeOH in CHCl3within 25 min), receiving 10-2 in the form of solids. LC/MS (M+1) calculated: 560,1; found: 560,2.

5-hydrazino-3-phenyl-2-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (10-3)

To a stirred solution of 10-2 (0.5 g, 0.9 mmol) in anhydrous 1,4-dioxane (5 ml) was added hydrazine (of 0.56 ml, 17.8 mmol). The solution was heated to 100°C in a microwave reactor for 20 minutes. The solvent was removed in vacuum and three times azeotrope dried with toluene. The crude solid was ground in a saturated solution of NaHCO3within 20 minutes. The suspension was filtered and washed with plenty of water. The solid is three times azeotrope dried with toluene, getting 10-3 in the form of a brown solid. LC/MS (M+1) calculated: 555,6; found: 555,2.

9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (10-4)

To a stirred solution of 10-3 (0.5 g, 0.9 mmol) in 16 ml of a mixture of 3:1 toluene:methanol was added Tr is meteorophobia (0.3 g, 2.7 mmol) and the monohydrate para-toluensulfonate acid (0,017 g, 0.09 mmol). The reaction mixture was heated to 100°C in a microwave reactor for 1 hour. After cooling to room temperature the solvent was removed under reduced pressure. The product was purified by reversed-phase HPLC on C18 column, receiving 10-4 in the form of solids. Mass (M+1) calculated: 565,2571; found: 565,2523.

SCHEME 11

9-phenyl-8-(4-{[4-(5-pyrimidine-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-(1H-1,2,3-triazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (11-4)

2-(3-piperidine-4-yl-1H-1,2,4-triazole-5-yl)pyrimidine (11-1)

A mixture of tert-butyl 4-(hydrazinophenyl)piperidine-1-carboxylate (10.1 g, 41.5 mmol) and 2-cyanopyrimidine (4,36 g, 41.5 mmol) in 1-butanol (20 ml) was boiled under reflux for 48 hours. The mixture was concentrated, suspended in ether and filtered, obtaining tert-butyl-4-(5-pyrimidine-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-carboxylate in the form of solids. MS (M+H+): found 331,2;1H NMR (400 MHz, CD3OD): δ of 8.92 (d, J=4.0 Hz, 2H), 7,52 (t, J=4.0 Hz, 1H), 4,18-to 4.15 (m, 2H), 3,14-is 3.08 (m, 1H), 2,98 (users, 2H), 2,07 is 2.01 (m, 2H), 1.85 to 1.77 in (m, 2H), to 1.48 (s, 9H).

To a solution of tert-butyl 4-(5-pyrimidine-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-carboxylate (13,6 g, 41,1 mmol) in methanol (30 ml) and DHM (15 ml) was added to NASA the military solution of anhydrous HCl in ethyl acetate (60 ml). After 2 hours the reaction mixture was concentrated. The resulting solid is suspended in ethyl acetate and methanol and filtered, obtaining 11-1 as HCl-salt. The salt was dissolved in a mixture of 1:1 acetonitrile:water, was applied to a SCX ion-exchange resin, washed with acetonitrile and suirable 10% NH3in ethanol, receiving 11-1 in the form of solids. MS (M+H+): 231,2.

5-chloro-3-phenyl-2-(4-{[4-(5-pyrimidine-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (11-2)

To a stirred solution of 9-1 (0.25 g, 0.73 mmol) and 11-1 (0,23 g, 0.87 mmol) in NMP (5 ml) was added triethylamine (0.3 ml, 2.2 mmol)and then acetic acid (0,082 ml, 1.5 mmol). After stirring at ambient temperature overnight was added triacetoxyborohydride sodium (0.18 g, 0.87 mmol). After completion of the reaction, the reaction mixture was diluted with ethyl acetate and washed with saturated solution of NaHCO3then water, then a saturated solution of salt. The organic layer was dried over Na2SO4and MgSO4, filtered and concentrated in vacuum, obtaining 11-2. LC/MS calculated: 559,1; found: 559,3.

5-hydrazino-3-phenyl-2-(4-{[4-(5-pyrimidine-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (11-3)

To mix the solution 11-2 (0.4 g, 0.7 mmol) in anhydrous 1,4-dioxane (3 ml) was added hydrazine (0.45 ml, 14.5 mmol). The solution was heated to 100°C in micro. novom the reactor for 5 minutes. The solvent was removed in vacuum and three times azeotrope dried with toluene, getting 11-3. LC/MS (M+1) calculated: 555,6; found: 555,4.

9-phenyl-8-(4-{[4-(5-pyrimidine-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-(1H-1,2,3-triazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (11-4)

To mix the solution 11-3 (0.2 g, 0.36 mmol), HOBT (0.05 g, 0.4 mmol) and 1H-1,2,3-triazole-4-carboxylic acid (0.05 g, 0.4 mmol) in anhydrous DMF (2 ml) was added DIEA (of 0.18 ml, 1.1 mmol) followed by addition of EDC (0.08 g, 0.4 mmol). The solution was heated in a microwave reactor for 30 minutes at 80°C. Then the solution was treated with 0.5 ml acetic acid and heated to 80°C in a microwave reactor for 10 minutes After cooling to room temperature, the solution was passed through a syringe filter and purified by reversed-phase HPLC on C18 column, receiving 11-4 in the form of solids. Mass (M+1) calculated: 632,2742; found: 632,274.

SCHEME 12

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyrimidine-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl]phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (12-1)

To mix the solution 11-3 (0,23 g, 0.4 mmol), HOBT (0.06 g, 0.45 mmol) and 1-methyl-1H-imidazole-4-carboxylic acid (0.06 g, 0.45 mmol) in anhydrous DMF (2 ml) was added DIEA (of 0.13 ml, 0.8 mmol)and then EDC (0.09 g, 0.5 mmol). The solution was heated in a microwave reactor for 15 minutes at 80°C. Before the solution was treated with 0.2 ml of acetic acid and was heated up to 80°C in a microwave reactor for 20 minutes. After cooling to room temperature, the solution was passed through a syringe filter and purified by reversed-phase HPLC on C18 column, receiving 12-1 in the form of solids. Mass (M+1) calculated: 632,2742; found: 632,274.

SCHEME 13

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (13-3)

8-[4-(1,3-dioxolane-2-yl)phenyl]-3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (13-1)

To a stirred solution of 3-4 (5 g, 13 mmol), HOBT (1.9 grams, and 14.3 mmol)and 1-methyl-1H-imidazole-4-carboxylic acid (2 g, 15.6 mmol) in anhydrous DMF (100 ml) was added EDC (2.7 g, of 14.3 mmol). The solution was stirred over night at ambient temperature. Then the solution was treated with 24 ml of acetic acid and was heated up to 80°C in an oil bath for 5 hours. After cooling to room temperature was added an equal volume of water, the resulting suspension was filtered and washed with plenty of water. Collected solid is three times azeotrope dried with toluene, receiving 13-1 in the form of a yellow-brown solid. Mass (M+1) calculated: 475,1877; found: 475,1871.

4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzaldehyde (13-2)

Peremeshivaemogo solution 13-1 (2 g, 4.2 mmol) in THF (32 ml) was added 1N. HCl (32 ml). As stirring the reaction mixture at room temperature for 1 hour to form a slurry. Then the reaction was suppressed 100 ml of a saturated solution of NaHCO3. The suspension was filtered and washed with water. Collected solid is three times azeotrope dried toluene, getting 13-2 in the form of a yellow-brown solid. Mass (M+1) calculated: 431,1615; found: 431,1616.

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,thriasio[3,4-f]-1,6-naphthiridine (13-3)

To mix the solution 13-2 (0.5 g, 1.2 mmol) and 8-5 (0.34 g, 1.3 mmol) in NMP (10 ml) was added triethylamine (0.33 ml, 2.3 mmol)and then acetic acid (0,13 ml, 2.3 mmol). After stirring overnight at room temperature portions was added triacetoxyborohydride sodium (0.3 g, 1.3 mmol). After stirring for 6 hours the solution was filtered through a syringe filter and purified by reversed-phase HPLC on C18 column, receiving 13-3 in the form of solids. Mass (M+1) calculated: 644,2993; found: 644,2988.

Table 4 contains compounds obtained using methods described in scheme 13, with replacement 8-5 appropriate amine. Connection 13-4 - 13-7, 13-10 - 13-19 13-21 and was isolated as HCl-salt. Connection 13-8 and 13-9 allocated in the form of TFU-salts.

Table 4
Connection.StructureNameMS-BP m/z (M+H)
13-43-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine645,2946
13-5N-[2-(4-methyl-1H-imidazol-2-yl)ethyl]-N-(4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}amine540,2609
13-6N1-(2-hydroxyphenyl)-N3-(4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}beta alanine595,2564
13-71-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}piperidine-4-carboxamide543,2611
13-8 5-[({4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}amino)methyl]pyridine-2-ol539,2302
13-9N1N1,2,2-tetramethyl-N3-(4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propane-1,3-diamine545,3125
13-103-hydroxy-2,2-dimethyl-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amineCalculated: 452,2659 Found: 452,2655
13-112-fluoro-3-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amineCalculated: 442,2038 Found: 442,2021
13-122.2-debtor-3-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amineCalculated: 460,1944 Found: 460,1926
13-13 2,3-dihydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amineCalculated: 440,2081 Found: 440,2076
13-144-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]cyclohexanamineCalculated: 464,2445 Found: 464,2448
13-154-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]cyclohexanamineCalculated: 464,2445 Found: 464,2438
13-163-hydroxy-2,2-dimethyl-N-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propan-1-amineCalculated: 518,2663 Found: 518,2663
13-173-hydroxy-2,2-dimethyl-N-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amineCalculated: 556,2568 Found: 556,2570
13-18 3-hydroxy-2,2-dimethyl-N-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amineCalculated: 555,2616 Found: 555,2575
13-193-hydroxy-2,2-dimethyl-N-{4-[9-phenyl-3-(1H-1,2,3-triazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propan-1-amineCalculated: 505,2459 Found: 505,2453
13-20tert-butyl{[8-(4-{[(3-hydroxy-2,2-dimethylpropyl)amino]methyl}phenyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methyl}carbamateCalculated: 567,3018 Found: 567,3015
13-21N-{4-[3-(ammoniated)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-3-hydroxy-2,2-DIMETHYLPROPANE-1-amineCalculated: 467,2554 Found: 467,2553

Connection 13-4

3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-

yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (13-4)

To mix the solution 13-2 (1.5 g, 3.5 mmol) and 10-1 (1.4 g, 4.0 mmol) in NMP (30 ml) was added treati the amine (1 ml, 7 mmol)and then acetic acid (0.4 ml, 7 mmol). After stirring overnight at room temperature portions was added triacetoxyborohydride sodium (0.9 g, 4.2 mmol). After stirring for 6 hours was added a saturated solution of NaHCO3up to a pH above 7. The resulting suspension was filtered and washed with water. The solid is three times azeotrope dried toluene and purified using normal phase flash chromatography (gradient: from 100% CHCl3to 10% MeOH in CHCl3within 40 min), receiving 13-4 in the form of a white solid. Mass (M+1) calculated: 645,2946; found: 645,2946.

SCHEME 14

[9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol (14-3)

{8-[4-(1,3-dioxolane-2-yl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol (14-1)

To a stirred solution of 3-4 (5 g, 13 mmol), HOBT (1.9 grams, and 14.3 mmol) and glycolic acid (1.2 g, 15.6 mmol) in anhydrous DMF (100 ml) was added EDC (2.7 g, of 14.3 mmol). The solution was stirred over night at ambient temperature. Then the solution was treated with 5 ml of glacial acetic acid and was heated up to 80°C in oil bath for 2 hours. After cooling to room temperature the reaction mixture razbam the Yali with ethyl acetate and washed with NaHCO 3(aqueous solution), water and saturated salt solution. The organic layer was dried over MgSO4, filtered and concentrated in vacuum, obtaining 14-1 in the form of a red solid. LC/MS (M+1) calculated: 425,5; found: 425,6.

4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzaldehyde (14-2).

To a suspension 14-1 (2.1 g, 4.9 mmol) in THF (50 ml) was added 1N. HCl (50 ml). After stirring at room temperature for 30 minutes, the reaction mixture was diluted with ethyl acetate and washed twice with water, then with saturated salt solution. The organic layer was dried over MgSO4and Na2SO4, filtered and concentrated in vacuum, obtaining 14-2 in the form of a red solid. Mass (M+1) calculated: 381,1346; found: 381,1346.

[9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol (14-3)

To mix the solution 14-2 (0.05 g, 0.1 mol) and 10-1 (0.05 g, 0.15 mmol) in NMP (1 ml) was added triethylamine (0.04 ml, 0.26 mmol)and then acetic acid (0.01 ml, 0.26 mmol). After stirring over night at room temperature was added triacetoxyborohydride sodium (0.03 g, 0.2 mmol). After stirring for 6 hours the solution was filtered through a syringe filter and purified by reversed-phase HPLC on C18 column, receiving 14-3 in the form of solids. Mass (M+1) calculated: 55,2677; found: 595,2679.

Table 5 shows the connection obtained using methods described in scheme 14, with replacement 10-1 corresponding amine. Connection 14-4, 14-5, 14-7 and 14-8 were isolated as HCl-salt. Connection 14-6 allocated in the form of TFU-salt.

Table 5
Connection.StructureNameMS-BP m/z (M+H)
14-4N3-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-N1-(2-hydroxyphenyl)beta alanine545,2293
14-5(8-{4-[(cyclohexylamino)methyl]phenyl}-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl)methanol464,2435
14-6N3-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-N1-(4-hydroxyphenyl)beta alanine545,2296

14-7[9-phenyl-8-(4-{[4-(5-pyridin-3-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanolMS-NR (M+1)= 594,2
14-81-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}piperidine-4-carboxamide493,2344

SCHEME 15

{8-[4-(1-aminocyclopropane)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methanol (15-2)

4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzonitrile (15-1)

To a stirred suspension 14-2 (0.4 g, 1.1 mmol) in anhydrous THF (15 ml) was added 3 ml of concentrated NH4OH. Then the solution was treated with iodine (0.4 g, 1.1 mmol) followed by stirring at room temperature over night. The reaction was suppressed with saturated solution of sodium thiosulfate (20 ml) and the product three times were extracted with ethyl acetate. The combined organic layers were washed with saturated salt solution, dried over Na2SO4, filtered and concentrated in vacuum, obtaining 15-1 in the form of a yellow-brown solid. Mass (M+1) calculated: 378,135; nage is about: 378,1345.

{8-[4-(1-aminocyclopropane)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methanol (15-2)

Bromide of etermine in diethyl ether (0.4 ml, 1.2 mmol, 3 M) was added at

-70°C to a solution 15-1 (0.1 g, 0.3 mmol) and isopropoxide titanium (IV) (0.17 g, 0.6 mmol) in anhydrous THF (7 ml). After 10 min the cooling bath was removed and the reaction mixture was heated to room temperature. After stirring for 1 hour was added an additional amount of bromide of etermine in diethyl ether (of 0.18 ml, 0.5 mmol, 3 M), the reaction mixture was cooled to 0°C in an ice bath and treated with efratom of boron TRIFLUORIDE (0.18 g, 1.2 mmol). The reaction mixture was stirred at 0°C for 30 minutes, then was heated to room temperature within 1 hour. The reaction was suppressed 1H. HCl, followed by stirring for 3 hours. The solution was podslushivaet 1 M NaOH, and was extracted with chloroform, dried over Na2SO4, filtered and concentrated in vacuum. The crude residue was collected in methanol and purified using reverse-phase HPLC on C18 column, receiving 15-2 in the form of solids. LC/MS (M+1) calculated: 408,4; found: 408,0.

SCHEME 16

1-[4-(9-phenyl-3-pyridin-4-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-3)

Tert-butyl 4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)benzylcarbamoyl (16-1)

mix a solution of 9-1 (7 g, a 20.2 mmol) and tert-BUTYLCARBAMATE (2.6 g, of 22.3 mmol) in anhydrous acetonitrile (35 ml) was added triethylsilane with 29.1 ml, 182 mmol), then triperoxonane acid (6 ml, 81 mmol). After stirring for 3 hours the solution was poured into an aqueous solution of NaHCO3and three times were extracted with ethyl acetate. The combined organic layers were washed with water, then with saturated salt solution. Then the organic layer was dried over Na2SO4, was filtered and was concentrated in vacuo and purified using flash chromatography on silica. LC/MS (M+1) calculated: 446,9; found: 446,1.

Tert-butyl 4-(5-hydrazino-3-phenyl-1,6-naphthiridine-2-yl)benzylcarbamoyl (16-2)

To mix the solution 16-1 (6.8 g, of 15.2 mmol) in anhydrous 1,4-dioxane (20 ml) was added hydrazine (10,8 ml, 343 mmol). The solution was heated to 100°C in a microwave reactor for 5 minutes. The solvent was removed in vacuo, the crude residue was collected in ethyl acetate and washed with aqueous solution of NaHCO3then a saturated solution of salt. The organic layer was dried over MgSO4, filtered and concentrated in vacuum, obtaining 16-2 in the form of an orange solid. LC/MS (M+1) calculated: 442,5; found: 442,2.

1-[4-(9-phenyl-3-pyridin-4-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (16-3)

To mix the solution 16-2 (0.08 g, 0.2 mmol), HOBT (0.03 g, 0.2 mmol) and isonicotinic acid is you (0.02 g, 0.2 mmol) in anhydrous DMF (1 ml) was added DIEA (of 0.08 ml, 0.5 mmol)and then EDC (0.04 g, 0.2 mmol). The solution was heated in a microwave reactor at 80°C for 12 minutes Then the solution was treated with 0.5 ml acetic acid and heated in a microwave reactor at 80°C for 30 minutes. After cooling to room temperature, volatiles evaporated in vacuo, the solution was filtered through a syringe filter and purified by reversed-phase HPLC on C18 column, receiving 16-3 in the form of solids. Mass (M+1) calculated: 429,1822; found: 429,1811.

Table 6 shows the connection obtained using methods described in scheme 16, with the replacement of isonicotinic acid corresponding carboxylic acid:

16-11
Table 6
Connection.StructureNameMS-BP m/z (M+H)
16-41-{4-[3-(1-oxidability-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt445,1772
16-51-[4-[3,9-diphenyl[1,2,]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; allocated in the form of HCl salt428,1865
Sheet 16-61-{4-[3-(4-forfinal)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt446,177
16-74-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}benzonitrile; isolated as HCl salt453,182
16-84-(9-phenyl-3-pyrimidine-4-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzylamine; isolated as HCl salt430,1774
16-91-{4-[3-(1-oxidability-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt445,174
16-105-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}pyridine-2-ol; isolated as HCl salt445,1771
1-[4-(9-phenyl-3-pyridin-3-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine; isolated as HCl salt429,1846
16-124-(9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzylamine; isolated as HCl salt430,177
16-131-[4-(9-phenyl-3-pyridin-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine; isolated as a salt TFUMS-NR (M+1)=42 9,1
16-141-[4-(9-phenyl-3-pyrazin-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine; isolated as HCl salt430,1775
16-151-{4-[9-phenyl-3-(1H-1,2,4-triazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt419,1727
16-16 1-{4-[9-phenyl-3-(1,3-thiazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt470,1824
16-171-{4-[9-phenyl-3-(1H-pyrazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt418,1764
16-181-{4-[3-(3-methyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt432,193
16-191-{4-[3-(3-methyl-1H-1,2,4-triazole-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine allocated in the form of HCl salt433,182
16-201-{4-[3-(1-methyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt432,193
16-211-{4-[9-phenyl-3-(1,2,5-thiadiazole-3-yl)[1,2,4]Tria is olo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; allocated in the form of HCl salt436,1341
16-221-{4-[9-phenyl-3-(1,2,3-thiadiazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt436,1333
16-231-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-3-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine; isolated as HCl salt469,1882
16-24{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methanamine; isolated as HCl salt381,1817
16-25{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methanol; isolated as HCl salt382,1657
16-261-{4-[9-phenyl-3-(2,2,2-triptorelin)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt16-271-{4-[9-phenyl-3-(1H-tetrazol-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt434,1831
16-28{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-carboxamide; isolated as HCl saltMS-NR (M+1)=39 5,2
16-291-{4-[3-(1H-imidazol-1-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt432,1931
16-301-(4-{3-[(methylsulphonyl)methyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine; isolated as HCl salt444,1488
16-31{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}acetonitrile; isolated as HCl salt391,166
2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethanol; isolated as HCl salt396,1819
16-33N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)ndimethylacetamide; isolated as HCl salt423,1925
16-344-[3-(2-methylimidazo[1,2-a]pyridine-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamineMS-NR (M+1)=48
2,2
16-351-[4-(9-phenyl-3-pyrazolo[1,5-a]pyridine-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamineMS-NR (M+1)=46
8,1
16 to 361-[4-(3-imidazo[1,2-a]pyridine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine; isolated as the free base and HCl salt468,1923
16-37 1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-1,2-benzisoxazol-3-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamineMS-NR (M+1)=45
6,2
[M-NH2]
16-381-[4-(3-imidazo[2,1-b][1,3]thiazol-6-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine; isolated as the free base and HCl salt474,1474
16-391-{4-[3-(1-methyl-1H-imidazol-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamineMS-NR (M+1)=41
5,1
[M-NH2]
16-401-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as the free base and HCl saltMS-NR (M+1)=43
2,1
16-411-[3-(1-methyl-5-phenyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine; isolated as a salt TFU508,2232
16-42 1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-1-benzothieno-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine allocated in the form of a salt TFU488,189
16-431-{4-[3-(1-isopropyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine allocated in the form of a salt TFU460,2245
16 to 441-{4-[9-phenyl-3-(1,4,5,6-tetrahydrocyclopent[c]pyrazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as a salt TFU458,2067
16-451-(4-{9-phenyl-3-[(2S)-pyrrolidin-2-yl][1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine; isolated as HCl salt421,2137
16-464-[3-(1-amino-ethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine); isolated as HCl salt395,1962
16-47 1-{4-[3-(1H-imidazol-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt418,1774
16-481-[4-(3-cyclopropyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine; isolated as a salt TFU392,1866
16-491-{4-[9-phenyl-3-(trifluoromethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as a salt TFU420,1423
16-501-{4-[3-(5-methyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as a salt TFU432,1924
16-511-{4-[3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as a salt TFU446,2077
16-524-[3-(1H-indol-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine; selected as a salt TFU467,1968
16-531-{4-[3-(1-methyl-1H-imidazol-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as a salt TFU432,1921
16-541-{4-[3-(3-methyl-2H-lambda5-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine allocated in the form of a salt TFUMS-NR (M+1)=43
2,1
16-554-[3-(6-chloroimidazo[1,2-a]pyridine-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine; isolated as a salt TFUMS-NR (M+1)=50
2,1
16-561-{4-[3-(1H-benzimidazole-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as a salt TFU468,1921
16-574-[3-(5-cyclopropyl-4H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-of naphthas is ridin-8-yl]benzylamine; selected as a salt TFU458,2087
16-581-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-1H-indazol-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as a salt TFU472,2244
16-594-[9-phenyl-3-(3-phenyl-1H-pyrazole-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine; isolated as a salt TFU494,2085
16-601-(4-{9-phenyl-3-[3-(trifluoromethyl)-1H-pyrazole-5-yl][1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine; isolated as a salt TFU486,1643
16-611-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine; isolated as a salt TFU469,1881
16-621-{4-[3-(1-benzyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine allocated in the form of a salt TFU 508,2235
16-631-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine; isolated as a salt TFU470,1834
16-644-[9-phenyl-3-(1-phenyl-1H-pyrazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine; isolated as a salt TFU494,2085
16-651-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-2-benzothieno-1-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as a salt TFU488,1901
16-661-{4-[9-phenyl-3-(5,6,7,8-tetrahydroimidazo[1,2-a]pyridine-2-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt472,2231
16-672-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}propan-2-amine; isolated as a salt Cl 409,2126
16-681-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethane-1,2-diol; isolated as a salt TFU412,1761
16-694-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}imidazolidin-2-he; isolated as a salt TFU436,1873
16-70(2R)-2-amino-2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethanol; isolated as a salt TFU411,1921
16-71(2R)-2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-2-(methylamino)ethanol; isolated as a salt TFU425,2077
16-721-{4-[3-(5-utilization-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt447,193
16-735-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-2,4-dihydro-3H-1,2,4-triazole-3-one; isolated as HCl saltMS-NR (M+1)=43 5,2
16-746-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-4,5-dihydropyridine-3(2H)-he; isolated as HCl saltMS-NR (M+1)=43 1,2
[M-NH2]
16-756-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}pyridazin-3(2H)-he; isolated as HCl saltMS-NR (M+1)=42 9,1
[M-NH2]
16-76N-(4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}phenyl)ndimethylacetamide; isolated as HCl salt485,2074
16-771-{4-[3-(4-phenoxyphenyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt 520,2136
16-781-{4-[3-(1H-benzimidazole-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt468,1927
16-79(4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}phenyl)methanol; isolated as HCl salt458,1963
16-804-[3-(4-cyclohexylphenol)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine; isolated as HCl salt510,2634
16-814-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-1,3-dihydro-2H-imidazol-2-he; isolated as HCl salt434,1719
16-821-{4-[3-(4-methyl-1H-imidazol-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt432,1921
16-834-[9-phenyl-3-(1-propyl-1H-imidazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine; isolated as HCl salt460,2231
16-841-{4-[3-(1-isopropyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt460,2231
16-851-{4-[3-(1-butyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine; isolated as HCl salt474,2387
16-861-[4-(3-imidazo[1,2-a]pyrimidine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine; isolated as HCl salt469,1867

SCHEME 17

5-({[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}methyl)pyridin-2-ol (17-3)

Tert-butyl 4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzylcarbamoyl (17-1)

To mix the solution 16-2 (5 g, 11.3 mmol) in 20 ml of a mixture of 3: toluene:methanol was added triethylorthoformate (1.8 g, of 15.3 mmol) and monohydrate para-toluensulfonate acid (0.1 g, 0.6 mmol). The reaction mixture was heated to 100°C in a microwave reactor for 35 minutes. After cooling to room temperature the solvent was removed under reduced pressure. The residue was purified using normal phase flash chromatography, receiving 17-1 in the form of solids. LC/MS (M+1) calculated: 466,6; found: 466,2.

1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (5-3)

HCl was barbotirovany through methanol (75 ml) for 5 minutes To the resulting solution was added 17-1 (7.5 g, 16 mmol) and the solution was stirred at room temperature for 6 hours. After removal of the solvent in vacuum, the resulting solid was ground for 30 minutes in a solution of 10:1 ethyl acetate and methanol, respectively. The suspension was filtered and dried, obtaining 5-3 in the form of HCl salt. Mass (M+1) calculated: 366,1713; found: 366,1694.

6-Hydroxynicotinate (17-2)

Mix a solution of 6-methoxy-3-pyridinecarboxamide (0.45 g, 3.3 mmol) in 3h. HCl (10 ml) was heated to 100°C for 30 minutes. After cooling, the formed needle crystals. The crystals were collected by filtration, getting 17-2.1H NMR (CD3OD): δ for 9.64 (c, 1H), δ 8.17-a is 8.16 (m, 1H), δ of 7.96-7,94 (m, 1H), δ to 6.58 (d, 1H).

5-({[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}methyl)Piri is in-2-ol (17-3)

To mix the solution 5-3 (0.1 g, 0.3 mmol) and triethylamine (of 0.08 ml, 0.5 mmol) in NMR (1 ml) was added 17-2 (0.03 g, 0.3 mmol) and acetic acid (0,03 ml, 0.5 mmol), then triacetoxyborohydride sodium (0.12 g, 0.5 mmol). After stirring over night at room temperature the reaction mixture was filtered through a syringe filter and purified by reversed-phase HPLC on C18 column, receiving 17-3 in the form of HCl salt. Mass (M+1) calculated: 473,2085; found: 473,2092.

Table 7 summarizes the compounds obtained using the methods described in scheme 17, with replacement 17-2 corresponding aldehyde. Connection 17-4 and 17-5 were isolated as HCl salts. Connection 17-6 and 17-7 allocated in the form of salts TFU.

Table 7
Connection.StructureNameMS-BP m/z (M+H)
17-41-(6-methoxypyridine-3-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]methanamine487,2237
17-5N-[(2-methoxypyridine-5-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazole,4-f]-1,6-naphthiridine-8)benzyl]amine MS-NR (M+1)=488,1
17-61-[4-(3-ethyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamineMS-NR (M+1)=380,2
17-71-[4-(9-phenyl-3-propyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine394,2023

SCHEME 18

N-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide (18-1)

To a solution of 4-3 (0.02 g, 0.06 mmol) and triethylamine (0,02 ml, 0.2 mmol) in absolute ethanol (0.5 ml) was added acetic anhydride (0,02 ml, 0.2 mmol). The reaction was terminated after 10 minutes and the product was directly purified by reversed-phase HPLC on C18 column, receiving 18-1 in the form of solids. LC/MS (M+1) calculated: 394,5; found: 394,2.

SCHEME 19

4-({[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}methyl)phenol (19-1)

To a stirred solution of 4-2 (0.05 g, 0.14 mmol) and 4-(aminomethyl)phenol (0.04 g, 0.35 mmol) in DMF (0.5 ml) was added acetic acid (0.04 ml, 0.7 mmol). After stirring for 2 hours at room temperature was added triacetoxyborohydride sodium (0.06 g, 0.3 for the mol). After stirring over night the reaction mixture was filtered through a syringe filter and purified by reversed-phase HPLC on C18 column, receiving 19-1 in the form of solids. LC/MS (M+1) calculated: 458,5; found: 458,3.

SCHEME 20

1-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)[piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanamine (20-1)

The solution 9-6 (0.03 g, 0.04 mmol) in 30% of TFU in dichloromethane (1 ml, 30% vol.) was stirred at room temperature for 30 minutes. The solvent was removed in vacuum and the crude residue was collected in methanol and was purified by reversed-phase HPLC on C18 column, receiving 20-1 in the form of solids. Mass (M+1) calculated: 593,2884; found: 593,2867.

SCHEME 21

9-phenyl-3-(1H-1,2,3-triazole-4-yl)-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (21-4)

4-(1H-1,2,4-triazole-3-yl)piperidine (21-1)

To a solution of benzyl-4-cyanopiperidine-1-carboxylate (20 g, 82 mmol) in methanol (150 ml) was added a solution of sodium methoxide in methanol (25 wt. -%, 5.6 ml, 25 mmol) at room temperature. After 30 minutes, was added a solution of formic acid hydrazide (4.9 g, 82 mmol) in methanol (20 ml) and the reaction mixture is boiled under reflux in the course is the development of 24 hours, at this time, was added sodium methoxide in methanol (25 wt. -%, 5.6 ml, 25 mmol) and formic hydrazide acid (4.9 g, 82 mmol). After 72 hours the reaction mixture was cooled to room temperature, extinguished acetic acid (3.0 ml, 49 mmol) and concentrated. The resulting residue was dissolved in ethyl acetate, washed with water, saturated sodium bicarbonate solution, saturated salt solution, dried over sodium sulfate, filtered and concentrated. The residue was purified by chromatography on a column elwira 1-35% IPA/DHM. The appropriate fractions were combined and the solvent was removed in vacuum, obtaining benzyl-4-(1H-1,2,4-triazole-3-yl)piperidine-1-carboxylate in the form of solids. MS (M+H+): 287,2;1H NMR (400 MHz, CDCl3): δ 11,13 (s, 1H), of 8.06 (s, 1H), was 7.36-7,31 (m, 5H), of 5.15 (s, 2H), 4,24 (users, 2H), 3,06 are 2.98 (m, 3H), 2,07-2,04 (m, 2H), 1,84-of 1.78 (m, 2H).

To a solution of benzyl 4-(1H-1,2,4-triazole-3-yl)piperidine-1-carboxylate (of 7.3 g, 25 mmol) in ethanol (100 ml) was added 10% palladium on coal (500 mg), the reaction vessel was purged with hydrogen and stirred in an atmosphere of hydrogen for 3 hours. The reaction mixture was filtered and concentrated, obtaining 21-1 in the form of solids. MS (M+H+): 153,2;1H NMR (400 MHz, DMSO-d6): δ to 7.99 (s, 1H), 2,98-to 2.94 (m, 2H), 2,82-to 2.74 (m, 1H), 2.57 m-2,50 (m, 2H), 1,82-of 1.78 (m, 2H), 1.60-to 1,50 (m, 2H).

5-chloro-3-phenyl-2-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (21-2

To a stirred solution of 9-1 (0.25 g, 0.73 mmol) and 21-1 (0,13 g, 0.87 mmol) in NMP (5 ml) was added triethylamine (0.3 ml, 2.2 mmol)and then acetic acid (0,082 ml, 1.5 mmol). After stirring at ambient temperature overnight was added triacetoxyborohydride sodium (0.18 g, 0.87 mmol). After completion of the reaction, the reaction mixture was diluted with ethyl acetate and washed with saturated solution of NaHCO3then water, then a saturated solution of salt. The organic layer was dried over Na2SO4and MgSO4, filtered and concentrated in vacuum, obtaining 21-2. LC/MS (M+1) calculated: 482,0; found: RUB 482.2.

5-hydrazino-3-phenyl-2-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-1,6-naphthiridine (21-3)

To mix the solution 21-2 (0.4 g, 0.8 mmol) in anhydrous 1,4-dioxane (3 ml) was added hydrazine (0.45 ml, 14.5 mmol). The solution was heated to 100°C in a microwave reactor for 5 minutes. The solvent was removed in vacuum and the residue three times azeotrope dried with toluene, getting 21-3. LC/MS (M+1) calculated: 477,6; found: 477,3.

9-phenyl-3-(1H-1,2,3-triazole-4-yl)-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,thriasio[3,4-f]-1,6-naphthiridine (21-4)

To mix the solution 21-3 (0.2 g, 0.36 mmol), HOBT (0.05 g, 0.4 mmol) and 1H-1,2,3-triazole-4-carboxylic acid (0.05 g, 0.4 mmol) in anhydrous DMF (2 ml) was added DIEA (of 0.18 ml, 1.1 mmol)and then EDC (0.08 g, 0.4 mmol). The solution is Aravali in a microwave reactor for 12 minutes at 80°C. Then the solution was treated with 0.5 ml acetic acid and heated to 80°C in a microwave reactor for 10 minutes. After cooling to room temperature, the solution was passed through a syringe filter and purified by reversed-phase HPLC on C18 column, receiving 21-4 in the form of HCl salt. Mass (M+1) calculated: found: LC/MS (M+1) calculated: 554,6; found: 554,3.

SCHEME 22

1-{4-[3-(1H-Imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (22-3)

8-[4-(1,3-Dioxolane-2-yl)phenyl]-3-(1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine (22-1)

To a solution of 3-4 (0.2 g, 0.5 mmol), 1H-imidazole-4-carboxylic acid (0.06 g, 0.5 mmol), HOBT (0.06 g, 0.5 mmol) and DIEA (0.2 ml, 1.4 mmol) in DMF (2 ml) was added EDC (0.1 g, 0.6 mmol). The solution was stirred at room temperature for 45 min and then was heated at 80°C in a microwave reactor for 15 minutes the Solvent was removed in vacuum. The residue was collected in DMF (0.5 ml) and was treated with ice-cold AcOH (2.0 ml). The reaction mixture was heated at 80°C for 45 minutes Then the reaction extinguished with water (10 ml) and was extracted with EtOAc (3×20 ml). The combined organic layers were concentrated in vacuo, getting 22-1 in the form of a brown residue. MS calculated M+H: 461,5; found 461,2.

4-[3-(1H-Imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzaldehyde (22-2)

To a solution of 22-1 (0.8 g, 1.7 m is ol) in 1,4-dioxane (3 ml) was added dropwise 3h. HCl (1.1 ml, 3.4 mmol). After stirring for 10 min the solution was treated with hydroxylamine hydrochloride (0.5 g, 6,9 mmol) in water (0.5 ml). The mixture was stirred for 1 hour and then extinguished NaHCO3(rich) until pH 8. After removal of solvent the residue was collected in water, filtered and azeotrope dried with toluene, getting 22-2 in the form of solids. MS calculated M+H: 432,5; found 432,2.

1-{4-[3-(1H-Imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine (22-3)

The solution 22-2 (0.06 g, 0.1 mmol) and Zn (0.02 g, 0.3 mmol) in anhydrous ice AcOH was stirred at room temperature for 30 minutes To the solution was added 4 equivalents of Zn (0.04 g, 0.6 mmol). The reaction mixture was stirred for 1 hour. After filtration and removal of solvent the residue was collected in MeOH and treated with ammonium hydroxide. After removal of solvent the residue was purified by reversed-phase HPLC, getting 22-3 in the form of solids. MS calculated M+H: 418,5; found: 401,1 (M-NH2).

Table 8 shows the connections obtained using methods described in scheme 22, with the replacement of the imidazole-4-carboxylic acid, the corresponding acid. Compounds in table 8 were isolated as HCl salts.

Table 8
Connection. StructureNameMS-BP m/z (M+H)
22-41-{4-[9-phenyl-3-(3H-lambda43-imadol-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine437,1543
22-51-{4-[9-phenyl-3-(1H-pyrazole-3-yl)-2H-lambda5-[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine418,1776
22-61-{4-[9-phenyl-3-(1,3-thiazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine435,1385

SCHEME 23

5,6,7,8-Tetrahydroimidazo[1,2-a]pyridine-2-carboxylic acid (23-2)

To a solution 23-1 (0.1 g, 0.7 mmol) in EtOH (15 ml) in a dry flask were added Pt2O (0.1 g, 0.4 mmol). The reaction mixture was placed in an atmosphere of nitrogen and then under vacuum conditions. These operations were repeated 3 times, then the reaction mixture was placed in an atmosphere of hydrogen. After 3 hours the reaction mixture was filtered through celite. After removal of the solvent was obtained the desired product 23-2 received in the form of not just b the logo of the powder. MS calculated M+H: of 167.2; found: 167,1.

SCHEME 24

4-Methyl-1H-imidazole-5-carboxylic acid (24-2)

To a solution 24-1 (0.5 g, 2.4 mmol) in EtOH (2 ml) was added 3n. LiOH (2.2 ml, 6.5 mmol). The reaction mixture was heated at 80°C for 1 hour. The temperature was reduced to 40°C and the mixture was stirred over night. Then the mixture was heated at 80°C for 5.5 hours. The reaction mixture was neutralized n. HCl and concentrated in vacuum. The azeotrope residue was dried with toluene, obtaining the desired product 24-2 in the form of solids. MS: calculated M+H: 127,1; found 127,1.

SCHEME 25

Methyl-1-propyl-1H-imidazole-4-carboxylate (25-2)

To a solution 25-1 (0.5 g, 4.0 mmol) in anhydrous THF (15 ml) in a dry flask portions was added NaH (0.1 g, 4.8 mmol). After the allocation of vials was added jumprope (0.8 ml, 8.0 mmol) and stirred at room temperature overnight. To the reaction mixture was added an additional 0.5 EQ. NaH together with 3 EQ. jumproping. After stirring for 50 hours added another 0.5 EQ. NaH together with 2 EQ. jumproping. The reaction mixture was stirred for 20 hours, then extinguished ethanol (5 ml). Removal of solvent gave the desired product 25-2 in the form of solids. MS: calculated M+H: 169,2; found: 155, 1mm (M-CH2).

1-Propyl-1H-imidazole-4-carbon whom I acid (25-3)

To a solution of 25-2 (0.6 g, 3.6 mmol) in anhydrous MeOH (2 ml) was added 3n. LiOH (2.6 ml, 7.9 mmol). The reaction mixture was heated at 80°C for 1 hour. The temperature was lowered and the mixture was stirred at 40°C during the night. Then the reaction mixture was neutralized n. HCl and then concentrated in vacuum. The azeotrope residue was dried with toluene, obtaining the desired product 25-3 in the form of solids. MS: calculated M+H: 155, 2mm; found: 155, 1mm.

Table 9 shows the connection obtained using methods described in scheme 25, replacing the corresponding alkylhalogenide.

Table 9
Connection.StructureNameMS-BP m/z (M+H)
25-41-isopropyl-1H-imidazole-4-carboxylic acid155, 1mm
25-51-butyl-1H-imidazole-4-carboxylic acid155, 1mm

SCHEME 26

4-[9-Phenyl-3-(pyrrolidin-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (262)

Tert-butyl 4-[3-(chloromethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylcarbamoyl (26-1)

To a suspension 16-2 (1.2 g, 2.7 mmol) in CH2Cl2(10 ml) was added DMAP (0.03 g, 0.03 mmol) and pyridine (0.4 ml, 5.4 mmol), then Chloroacetic anhydride (0.5 g, 3.0 mmol). The reaction mixture was stirred at room temperature for 2 hours, then further added Chloroacetic anhydride (0.2 g, 0.9 mmol). After stirring for 10 min the solvent was removed in vacuum. The residue was distributed between saturated aqueous solution of NaHCO3and EtOAc (3×30 ml). The combined organic layers were washed with water, saturated salt solution and dried (Na2SO4/MgSO4). Removal of solvent gave the desired product 26-1 in the form of a red powder. MS: calculated: 500,2; found; 500,1.

4-[9-Phenyl-3-(pyrrolidin-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine (26-2)

To a solution 26-1 (0.05 g, 0.1 mmol) in DMSO (1 ml) was added pyrrolidine. The solution was heated at 150°C for 30 minutes, the Reaction mixture was purified using reverse-phase HPLC. The residue was dissolved in MeOH (0.5 ml) and was treated with 1H. HCl (0.4 ml). The reaction mixture was stirred at 35°C for 1 day. Removal of solvent gave the desired product 26-2 in the form of solids. MS: calculated: 535,7; 435,5.

Table 10 shows the connection obtained by applying the method shown in scheme 26, replacement pyrrolidin the corresponding amine. The compounds listed in table 10, were isolated as HCl salts.

Table 10
Connection.StructureNameMS-BP m/z (M+H)
26-31-{4-[3-(azetidin-1-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine421,2124
26-41-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)piperidine-4-carboxamide492,249
26-51-{4-[3-(morpholine-4-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine451,2228
26-62-[({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)amino]ethanol425,2071
26-71-(4-{3-[(4-methylpiperazin-1-yl)methyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanes464,2543
26-84-[9-phenyl-3-(piperazine-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine450,2386
26-9N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)-N-methylamine;395,1969
26-10N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)-N,N-dimethylamine409,2125

SCHEME 28

[4-(3-Methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanol (28-1)

To a solution of 4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzaldehyde (5-2, MX 0.317 g, 0,870 mmol) in methanol (5 ml) was added sodium borohydride (0,033 g, 0,870 mmol) at 0°C. After 10 minutes the reaction mixture was poured into ethyl acetate and the organic layer was washed with a saturated solution of bicarbona the sodium, water, then with saturated salt solution, dried over sodium sulfate, filtered and concentrated to dryness under reduced pressure. Purification by reversed-phase chromatography (Waters Sunfire MSC18, 1% acetonitrile/0.1% of triperoxonane acid/water → 95% acetonitrile/0.1% of triperoxonane acid/water) gave listed in the connection header in the form of solids. MS-BP (M+H+): calculated = 367,1554; found = 367,1547.

{4-[3-(1-Methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanol (28-2)

Specified in the title compound was obtained from 13-2 according to the method indicated in scheme 28; MS-BP (M-H+): calculated = 433,1772; found = 433,1761.

SCHEME 29

1-[4-(9-Phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanol (29-2)

1-[4-(5-Chloro-3-phenyl-1,6-naphthiridine-2-yl)phenyl]ethanol (29-1)

To a solution of 4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)benzaldehyde (9-1, 0,500 g 1,450 mmol) in anhydrous methylene chloride (10 ml) was added bromide Metalmania (2,072 ml, 2.9 mmol, 1.4 M solution in a mixture of toluene/tetrahydrofuran (75:25)) at 0°C. After 15 minutes the reaction mixture was poured into ethyl acetate and the organic layer was washed with saturated sodium bicarbonate solution, water, then saturated salt solution, dried over self the volume of sodium was filtered and concentrated to dryness under reduced pressure, obtaining specified in the header connection. MS (M+H+): calculated = 361,85; found = 361,1.

1-[4-(9-Phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanol (29-2)

Specified in the title compound was obtained according to the methods given in figure 9; MS-BP (M+H+): calculated = 485,1833; found = 485,1812.

The following compounds listed in table 11 were obtained according to the method indicated in figure 13 of piperidine 21-1 and the indicated aldehyde.

Table 11
Connection.StructureNameMS-BP m/z (M+H)
30-1 (4-2)9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridineCalculated: 487,2371 Found: 484,2371
31-1 (5-2)3-methyl-9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine; isolated as HCl saltCalc is but: 501,2510 Found: 501,2531
32-1 (3-6)9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-olCalculated: 503,2303 Found: 503,2327

SCHEME 33

Triptorelin 1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropylamine (33-5)

4-(2-Benzyl-1,3-dioxolane-2-yl)benzonitrile (33-1)

A solution of 1-(4-bromophenyl)-2-phenylethanone (5.0 g, 18 mmol), ethylene glycol (3.0 ml, 54 mmol) and para-toluensulfonate acid (0.04 g, 0.2 mmol) in toluene (30 ml) was boiled under reflux with trap Dean-stark for 15 hours. The reaction mixture was cooled to room temperature, diluted with ethyl acetate, washed with saturated sodium bicarbonate solution, saturated salt solution, dried over sodium sulfate, filtered and concentrated, obtaining the crude 2-benzyl-2-(4-bromophenyl)-1,3-dioxolane in the form of a white solid. To the crude substance was added cyanide zinc (2.3 g, 20 mmol), tetrakis(triphenylphosphine)palladium (3,3 g, 2.8 mmol), DMF (20 ml) and dioxane (20 ml), the resulting suspension was purged with nitrogen for 15 minutes, then was heated at 100°C in them is giving 15 hours. The reaction mixture was cooled to room temperature, poured into ether and filtered. The organic filtrate was washed with water, saturated bicarbonate solution, saturated salt solution, dried over sodium sulfate, filtered and concentrated. Purification by chromatography on silica gel (1% ethyl acetate/hexane → 50% ethyl acetate/hexane) gave specified in the title compound as a white solid. MS (M+H+): calculated = 265,31; found = 266,1.

Tert-butyl{1-[4-(phenylacetyl)phenyl]cyclopropyl}carbamate (33-2)

To a solution of 4-(2-benzyl-1,3-dioxolane-2-yl)benzonitrile (33-1, 1.5 g, 5.6 mmol) in ether (25 ml) was added isopropoxide titanium (1.8 ml, 6.2 mmol), then the bromide of etermine (4,2 ml, 12 mmol, 3 M in ether) at -78°C. After 10 minutes the reaction mixture was heated to room temperature within 60 minutes. The reaction mixture was cooled to 0°C and added complex epirate of boron TRIFLUORIDE (1.4 ml, 11 mmol). After 30 minutes at 0°C the reaction mixture was heated to room temperature for 1 hour, after this time the reaction was suppressed and was acidified using 1 M HCl. The suspension was stirred for another 3 hours at room temperature, then the mixture was podslushivaet 1 M NaOH and was extracted with chloroform. The combined organic layers were dried over sodium sulfate, filtered and concentrated. To the crude substance immediately add recipients who do acetonitrile (15 ml) and di-tert-BUTYLCARBAMATE (1.2 g, 5,6 mmol) at room temperature. After 12 hours the reaction mixture was concentrated to dryness and purified by chromatography on silica gel (1% ethyl acetate/hexane → 60% ethyl acetate/hexane)to give specified in the title compound as a white solid. MS (M+H+): calculated = 351,44; found = 352,1.

Tert-butyl{1-[4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)phenyl]cyclopropyl)carbamate (33-3)

The solution 33-2 (0.64 g, 2.5 mmol), 3-1 (0.88 g, 2.5 mmol) and potassium carbonate (2.1 g, 15 mmol) in DMF (14 ml) was heated to 120°C for 4.5 hours. The reaction mixture was cooled to room temperature, diluted with ethyl acetate, washed with water, saturated salt solution, dried over sodium sulfate, filtered and concentrated. Purification by chromatography on silica gel (1% ethyl acetate/hexane → 70% ethyl acetate/hexane) gave specified in the title compound in the form of foam. MS (M+H+): calculated = 471,98; found = 472,1.

Tert-butyl{1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropyl}carbamate (33-4)

Specified in the title compound was obtained from 33-3 according to the method indicated in scheme 27; MS (M+H+): calculated = 491,58; found = 492,1.

Triptorelin 1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropylamine (33-5)

Specified in the title compound was obtained according to the method indicated in scheme 27; MS-BP (M+H +): calculated = 392,1870; found = 392,1893.

The following compounds listed in table 12 were obtained according to the method indicated in scheme 33. Connection 33-8 - 33-10 was isolated as HCl salts. Connection 33-6 was isolated as a salt TFU.

Table 12
Connection.StructureNameMS-BP m/z (M+H)
33-61-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}cyclopropaneCalculated: 458,2088 Found: 458,2114
33-71-[4-(9~phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropaneCalculated: 496,1993 Found: 496,1987
33-81-{4-[9-phenyl-3-(5,6,7,8-tetrahydroimidazo[1,2-a]pyridine-2-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}cyclopropane498,238
33-9 1-[4-(9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropane456,1915
33-101-{4-[3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}cyclopropane472,2227

SCHEME 34

Chloride (1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-naphthiridine-8-yl)phenyl]ethanamine (34-5)

N-{(1E)-[4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)phenyl]methylene}-2-methylpropan-2-sulfinamide (34-1)

A solution of 4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)benzaldehyde (9-1, 4,24 g, 12.3 mmol), S-(-)-2-methylpropan-2-sulfinamide fees (3.43 ml, 28.3 mmol) and copper sulfate (4,49 g, 28.1 mmol) in methylene chloride (20 ml) was boiled under reflux in a nitrogen atmosphere. After 18 hours the reaction mixture was washed with saturated sodium bicarbonate solution, saturated salt solution, dried over magnesium sulfate, filtered and concentrated. Purification by chromatography on silica gel (0% ethyl acetate/hexane → 45% ethyl acetate/hexane) gave specified in the title compound as an orange foam. MS (M+H+): calculated = 447,99; found = USD 448,2.

N-{1R)-1-[4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)phenyl]ethyl}-2-methylpropan-2-sulfinamide (34-2)

To a solution of N-{(1E)-[4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)phenyl]methylene}-2-methylpropan-2-sulfinamide (34-1, a 4.53 g, 10.1 mmol) in methylene chloride (100 ml) was added bromide Metalmania (30 ml, 42.0 mmol, 1.4 M in a mixture of 75:25 toluene:THF) at -10°C. After 30 minutes the reaction was suppressed by addition of a saturated solution of ammonium chloride keeping the temperature below 0°C) and were extracted with methylene chloride. The combined organic layers were washed with water, saturated salt solution, dried over magnesium sulfate, filtered and concentrated, obtaining mentioned in the title compound as a pale yellow solid. MS (M+H+): calculated = 464,03; found = 464,2.

Tert-butyl({(1R)-1-[4-(5-hydrazino-3-phenyl-1,6-naphthiridine-2-yl)phenyl]ethyl}amino)sulfonyl (34-3)

To a solution of N-{(1R)-1-[4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)phenyl]ethyl}-2-methylpropan-2-sulfinamide (34-2, 0,707 g of 1.52 mmol) and anhydrous hydrazine (15 ml) was heated at 115°C for 1 hour. The reaction mixture was poured into ethyl acetate and the organic layer was washed with saturated sodium bicarbonate solution, then water, then with saturated salt solution, dried over magnesium sulfate, filtered and concentrated to dryness under reduced pressure to give crude adduct of hydrazine in the form of an orange solid. MS (M+H+): calculated = 459,62; found = 460,4.

Tert-butyl({(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triaz the lo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl)amino)sulfonyl (34-4)

To the crude tert-butyl({(1R)-1-[4-(5-hydrazino-3-phenyl-1,6-naphthiridine-2-yl)phenyl]ethyl}amino)sulfanilate (34-3, 1.06 g, 2,31 mmol), p-toluensulfonate acid (63 mg, 0.36 mmol) and triethylorthoformate (1.0 ml, 7.7 mmol) was added anhydrous toluene (10 ml) and heated to 110°C for 48 hours. The volume of the reaction mixture was reduced under reduced pressure and was purified by chromatography on silica gel (0-10% methanol/methylene chloride)to give an orange foam. MS (M+H+): calculated = 483,64; found = 484,2.

Chloride (1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (34-5)

Tert-butyl({(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}amino)sulfonyl (34-4) was treated with 4n. HCl in dioxane at room temperature for 15 minutes. The volume of the reaction mixture was reduced under reduced pressure and was purified by reversed-phase chromatography (Waters Sunfire MCC18, 1% acetonitrile/0.1% of triperoxonane acid/water → 95% acetonitrile/0.1% of triperoxonane acid/water) and was converted into HCl salt (adding a saturated solution of HCl in ethyl acetate (concentration ~4N)), getting mentioned in the title compound in the form of solids. MS (M+H+): calculated = 379,47; found = 380,2.

(1R)-1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine (34-6)

Specified in the title compound was obtained according to the SNO ways, indicated on the diagram 34; MS (M+H+): calculated = 365,43; found = 366,2. Connection 34-6 was isolated as HCl salt.

SCHEME 35

The dihydrochloride of (1R)-1-{4-[9-Phenyl-3-(5-pyridin-2-yl-1H-pyrazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]fenilalanina (35-1)

To tert-butyl({(1R)-1-[4-(5-hydrazino-3-phenyl-1,6-naphthiridine-2-yl)phenyl]ethyl}amino)sulfanilate (34-3, 0.20 g, 0.43 mmol), EDC (0.11 g, or 0.57 mmol), anhydrous HOBT (0.06 g, 0,39 mmol), DIPEA (0.17 ml, 0.96 mmol) and 5-pyridin-2-yl-1H-pyrazole-3-carboxylic acid (0.08 g, 0.43 mmol) added anhydrous DMF (2 ml) and stirred at room temperature overnight. To the reaction mixture was added HCl/ether (1 ml, 2n.) and was stirred for 20 min at room temperature, then was heated in a microwave reactor at 100°C for 30 minutes the Solvent was removed in vacuo and was purified by reversed-phase chromatography (Waters Sunfire MCC18, 1% acetonitrile/0.1% of triperoxonane acid/water → 95% acetonitrile/0.1% of triperoxonane acid/water) and was converted into HCl salt (adding a saturated solution of HCl in ethyl acetate (concentration ~ 4N), receiving specified in the title compound in the form of solids. MS (M+H+): calculated = 508,58; found = 509,1.

The following compounds listed in table 13 were obtained according to the method indicated in scheme 35. The compounds listed in table 13, was isolated in the form of salts Cl.

Table 13
Connection.StructureNameMS-BP m/z (M+H)
35-2(1R)-1-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}ethanamineFound: 396,0
35-3(1R)-1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}ethanamineFound: 445,9
35-4(1R)-1-[4-[9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamineFound: Ozenmunaygas given KZT 484.1 ecological
35-5(1R)-1-[4-(3-imidazo[2,1-b][1,3]thiazolo-6-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamineFound: 488,0
35-6 (1R)-1-[4-[9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamineFound: 444,1

(1R)-1-[4-(9-Phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-1-amine (36-1)

Specified in the title compound was obtained according to the methods given in figure 34. MS (M+H+): calculated = 379,47; found = 380,2. Connection 36-1 was isolated as HCl salt.

SCHEME 37

2-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-2-amine (37-4)

N-{1-methyl-1-[4-(phenylacetyl)phenyl]ethyl]ndimethylacetamide (37-1)

A solution of N-(1-methyl-1-phenylethyl)ndimethylacetamide (21,3 g, 121 mmol), phenylacetylene (19.5 g, 126 mmol) and trichloride aluminum (19 g, 142 mmol) in methylene chloride (140 ml) was stirred overnight at room temperature in a nitrogen atmosphere. The reaction mixture was poured into ice and stirred until the ice melting, then the layers were separated and the organic layer was washed with saturated sodium bicarbonate solution, saturated salt solution, dried over magnesium sulfate, filtered and concentrated. Purification by chromatography on silica gel gave specified in the header connection. MS (M+H+): calculated = 295,38; found = 296,1.

N-{1-[4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)phenyl]-1-methylethyl}ndimethylacetamide (37-2)

Specified in the title compound was obtained from 37-1 according to the method indicated in figure 3; MS (M+H+): calculated = 415,91; found = 416,1.

Tert-butyl{1-[4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)phenyl]-1-methylethyl}carbamate (37-3)

To a solution of N-{1-[4-(5-chloro-3-phenyl-1,6-naphthiridine-2-yl)phenyl]-1-methylethyl}ndimethylacetamide (37-2, to 4.73 g of 11.4 mmol) in anhydrous THF (120 ml) was added diphenylsilane (10.5 ml, 56,9 mmol) and isopropoxide titanium (16.6 ml, 56,9 mmol) at 40°C for 1 hour. The reaction mixture was removed from the bath and was suppressed by the addition of saturated solution of bicarbonate. Added methylene chloride and filtered through a pillow celite and magnesium sulfate. To the solution was added di-tert-BUTYLCARBAMATE (is 3.08 g, 14.1 mmol), and then evaporated on a rotary evaporator to a minimum amount. Added anhydrous methylene chloride (140 ml), di-tert-BUTYLCARBAMATE (4.1 g, 18,8 mmol) and TEA (4.0 ml, 28.7 mmol) and was stirred over night at room temperature. The reaction mixture was washed with sodium bicarbonate, saturated salt solution, dried over magnesium sulfate, filtered and concentrated. Purification by chromatography on silica gel (0-40% EtOAc/hexane over 30 min) gave specified in the title compound as a white foam. MS (M+H+): calculated = 473,99; found = 474,1.

Hydrochloride of 2-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-2-amine (37-4)

Listed is in the title compound was obtained from 37-3 according to the methods given in figure 5; MS (M+H+): calculated = 393,48; found = 394,1.

2-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-2-amine (38-1)

Specified in the title compound was obtained according to the methods indicated on the diagram 37; MS (M+H+): calculated = 421,51; found = 422,3. Connection 38-1 was isolated as HCl salt.

SCHEME 39

Chloride 3-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridinium (39-1)

The hydrochloride of 1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine (5-3, 20 mg, 0,050 mmol), EDC (12 mg, 0,065 mmol), HOBT (10 mg, 0,0650 mmol), DIPEA (0,033 ml, 0,199 mmol) and the hydrochloride pyridine-3-luxusni acid (11 mg, 0,0650 mmol) was added 0.6 ml of anhydrous dimethylformamide. Then the reaction mixture was heated with microwave radiation at 100°C for 5 minutes. Purification of the crude reaction mixture by reversed-phase chromatography (Waters Sunfire MCC18, 1% acetonitrile/0.1% of triperoxonane acid/water → 95% acetonitrile/0.1% of triperoxonane acid/water) and conversion into HCl salt (adding a saturated solution of HCl in ethyl acetate (concentration ~ 4N) gave specified in the title compound as a yellow solid. MS-BP (M+H+): calculated = 243,1079; found = 243,1083.

The following compounds listed in table 14 were obtained from the defined amine (see the column "Connection" in parentheses) according to the method indicated in scheme 39.

/tr>
Table 14
Connection.StructureNameMS-BP m/z (M+H)
39-2 (5-3)N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-4-yl-2-furamide; isolated as a salt TFUCalculated: 537,2034 Found: 537,2027
39-3 (5-3)N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-3-yl-2-furamide; isolated as HCl saltCalculated: 537,2034 Found: 537,2023
39-4 (5-3)N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-3-yl-1H-pyrrol-3-carboxamide; isolated as HCl saltCalculated: 536,2194 Found: 536,2218
39-5 (5-3)2-hydroxy-N-[4(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide Calculated: 424,1768 Found: 424,1767
39-6 (5-3)tert-butyl(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)carbamateCalculated: 523,2452 Found: 523,2444
39-7 (5-3)4-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)morpholine; isolated as HCl saltCalculated: 494,2347 Found: 493,2358
39-8 (5-3)2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxetanone; isolated as HCl saltCalculated: 423,1928 Found: 423,1942
39-9 (5-3)4-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine; isolated as HCl saltCalculated: 485,2085 Found: 485,2120
39-10 (5-3)2,4-dihydro what si-6-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyrimidine; allocated in the form of HCl saltCalculated: 518,1935 Found: 518,1960
39-11 (5-3)2-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine; isolated as HCl saltCalculated: 485,2085 Found: 485,2118
39-12 (5-3)Chloride 3-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridiniumCalculated: 243,1079 Found: 243,1083
39-13 (5-3)N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-pyrazin-2-ylacetamideCalculated: 486,2037 Found: 486,2044
39-14 (5-3)3-methyl-9-phenyl-8-[4-({[pyridin-3-ylamino)carbonyl]amino}methyl)phenyl][1,2,4]triazolo[3,4-f]-1,6-naphthiridine allocated in the form of HCl saltCalculated: 486,2037 Found: 486,2056
39-15 (5-3) Calculated: 500,2081 Found: 500,2087
39-16 (5-3)2-(3-hydroxyphenyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamideCalculated: 500,2081 Found: 500,2086
39-17 (5-3)2-(4-hydroxyphenyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamideCalculated: 500,2081 Found: 500,2085
39-18 (5-3)2-(3,4-dihydroxyphenyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamideCalculated: 576,2030 Found: 576,2025
39-19 (5-3)N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-phenylacetamideCalculated: 484,2132 Found: 4844,2161
39-20 (5-3)3-methyl-9-phenyl-8-(4-{[(pyridine-3-ylcarbonyl)amino]methyl}phenyl)[1,2,4]
triazolo[3,4-f]-1,6-naphthiridine; the separation of the config in the form of HCl salt
Calculated: 471,1928 Found: 471,1928
39-21 (5-3)2-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]benzamideCalculated: 486,1925 Found: 486,1919
39-22 (5-3)2-(4-hydroxyphenyl)-2-methyl-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propanamideCalculated: 528,2394 Found: 528,2386
39-23 (5-3)Methyl-4-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-4-oxobutanoateCalculated: 480,2030 Found: 480,2030
39-24 (5-3)2-hydroxy-N-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)benzamideCalculated: 543,2139 Found: 543,2127
39-25 (5-3)N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-(5-phenyl-4H-1,2,4-Tria is ol-3-yl)ndimethylacetamide Calculated: 551,2303 Found: 551,2292
39-26 (5-3)3-methyl-9-phenyl-8-(4-{[(quinoline-3-ylcarbonyl)amino]methyl}phenyl)[1,2,4]
triazolo[3,4-f]-1,6-naphthiridine; isolated as HCl salt
Calculated: 521,2085 Found: 521,2061
39-27 (5-3)N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-(4-oxoindole-3(4H)-yl)ndimethylacetamideCalculated: 552,2143 Found: 552,2126
39-28 (5-3)N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-(2-oxo-1,3-benzoxazol-3(2H)-yl)ndimethylacetamideCalculated: 541,1983 Found: 541,1965
39-29 (503)8-(4-{[(1H-benzimidazole-1-ylacetic)amino]methyl}phenyl)-3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine allocated in the form of HCl saltCalculated: 524,2194 Found: 524,2199
39-30 (5-3)8-(4-{[(1H-Ben is imidazol-2-ylacetic)amino]methyl}phenyl)-3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine, allocated in the form of HCl saltCalculated: 524,2194 Found: 524,2185
39-31 (5-3)2-(4-methyl-1,2,5-oxadiazol-3-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamideCalculated: 440,1986 Found: 490,1976
39-32 (5-3)2-(1H-indazol-1-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamideCalculated: 524,2194 Found: 524,2171
39-33 (5-3)2-(5,6-dimethyl-4-oxathiane[2,3-d]pyrimidine-3(4H)-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamideCalculated: 586,2020 Found: 586,1993
39-34 (5-3)3-methyl-8-[4-({[(6-morpholine-4-espiridion-3-yl)carbonyl]amino}methyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine; isolated as HCl saltCalculated: 556,2456 Found: 556,2441
39-35 (5-3) 2-(6-chloropyridin-3-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamideCalculated: 519,1695 Found: 519,1673
39-36 (5-3)3-cyano-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propanamideCalculated: 447,1928 Found: 447,1921
39-37 (5-3)3-methyl-9-phenyl-8-(4-{[(3-pyridin-3-ylpropyl)amino]methyl}phenyl)[1,2,4]
triazolo[3,4-f]-1,6-naphthiridine allocated in the form of HCl salt
Calculated: 499,2241 Found: 499,2244
39-38 (16 to 44)3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[(pyridine-3-ylacetic)amino]methyl}phenyl)[1,2,4]tri-azolo[3,4-f]-1,6-naphthiridine; isolated as HCl saltCalculated: 551,2303 Found: 551,2326
39-39 (16-22)9-phenyl-3-pyrazolo[1,5-a]pyrimidine-3-yl-8-(4-{[(pyridine-3-ylacetic)amino]methyl}phenyl)[1,2,4]tri-azolo[3,4-f]-1,6-naphthiridine; isolated as HCl saltCalculated: 588,2255 Found: 588,2276
39-40 (13-10)N-(3-hydroxy-2,2-dimethylpropyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamideCalculated: 494,2551 Found: 494,2557
39-41 (13-16)N-(3-hydroxy-2,2-dimethylpropyl)-N-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-2-(4-oxoindole-3(4H)-yl)ndimethylacetamideMS-NR (M+1)=
Found: 704,3
39-42 (13-20)tert-Butyl{2-[[4-(3-{[(tert-butoxycarbonyl)amino]methyl}-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl](3-hydroxy-2,2-dimethylpropyl)amino]-2-oxoethyl}carbamateCalculated: 724,3817 Found: 724,3822
39-43 (33-5)3-methyl-9-phenyl-8-(4-{1-[(pyridine-3-ylacetic)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine; isolated as a salt TFUCalculated: 511,2241 Found: 511,2264
39-44 (33-5) 3-methyl-9-phenyl-8-(4-{1-[(quinoline-3-ylcarbonyl)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine; isolated as a salt TFUCalculated: 547,2241
Found: 547,2225
39-45 (33-5)N-{1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropyl}-2-(4-oxoindole-3(4H)-yl)ndimethylacetamideCalculated: 578,2299 Found: 578,2276
39-46 (33-6)3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{1-[(pyridine-3-ylacetic)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine; isolated as a salt TFUCalculated: 577,2459
Found: 577,2488
39-47 (34-5)N-{(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}-2-pyridine-3-ylacetamide; isolated as HCl saltMS-NR (M+1) = found: 498,4
39-48 (34-5)N-{(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}ndimethylacetamideMS-NR (M+1) = found: 422,2
39-49 (34-5)N-((1R)-1-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}ethyl)-2-pyridin-3-ylacetamide; isolated as HCl saltMS-NR (M+1) = found: 514,8
39-50 (38)N-{1-methyl-1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}ndimethylacetamideMS-NR (M+1) = found: 422,3
39-51 (37-4)N-{1-methyl-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}ndimethylacetamideMS-NR (M+1) = found: 435,8

2-[{4-[3-(Ammoniated)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}(3-hydroxy-2,2-dimethylpropyl)amino]-2-oxetanone (39-52)

Specified in the title compound was obtained according to the methods specified in scheme 27, 39-42; MS (M+H+): calculated: 524,2769; found: 524,2777. Connection 39-52 was isolated as HCl salt.

EXAMPLE 1

Cloning of the Akt isoforms of human and ΔPH-Akt1

Vector pS2neo (deposited in the ATCC on 3 April 2001 number ATCC PTA-3253) was prepared as follows. The pRmHA3 vector (obtained is, as described in Nucl. Acid Res. 16: 1043-1061 (1988)) cut BglII and allocated fragment length 2734 BP Vector pUChsneo (obtained as described in EMBO J. 4: 167-171 (1985)) also cut BglII and allocated bandwidth corresponding 4029 BP Two resulting fragment is ligated together with the formation of the vector, named pS2neo-1. The indicated plasmid contains polylinker between promoter metallothionein and customers attach poly-A-lots of alcohol dehydrogenase. The plasmid also has resistance gene neo regulated by the heat shock promoter. Vector pS2neo-1 cut Psp5II and BsiWI. Synthesized and then annealed two complementary oligonucleotide (CTGCGGCCGC (SEQ ID NO:1) and GTACGCGGCCGCAG (SEQ ID NO:2)). Cut pS2neo-1 and subjected to annealing the oligonucleotides were ligated together with the formation of the second vector, pS2neo. This transformation was added to the NotI site to provide linearized before transfection of S2 cells.

Gene Akt1 man amplified in PCR (Clontech) cDNA spleen person (Clontech)using the 5'-primer: 5'CGCGAATTCAGATCTACCATGAGCGACGTGGCTATTGTG 3' (SEQ ID NO:3) and 3'primer: 5'CGCTCTAGAGGATCCTCAGGCCGTGCTGCTGGC3' (SEQ ID NO:4). the 5'primer included sites EcoRI and BglII. the 3'primer included sites XbaI and BamHI for cloning. The resulting PCR product was subcloned into pGEM3Z (Promega) as EcoRI/XbaI fragment. For expression/purification was added to the label "middle-T" to the 5'-end full-Akt1 gene, using primer for PCR: 5GTACGATGCTGAACGATATCTTCG 3' (SEQ ID NO:5). The resulting PCR product contained the 5'-Kpn1 site and 3'-BamHI site, which used to sublimirovanny fragment in the frame containing bitenova label expressing the vector in insect cells, pS2neo.

For the expression of variant Akt1 with deletionism pleckstrin-homology domain (PH) (Δand 4-129, which includes the deletion of a portion of the hinge region Akt1) was carried out by PCR-based deletion mutagenesis using a full-size Akt1 gene in the vector pS2neo as a matrix. PCR was carried out in two stages, using internal overlapping primers (5'GAATACATGCCGATGGAAAGCGACGGGGCTGAAGAGATGGAGGTG 3' (SEQ ID NO:6) and 5'CCCCTCCATCTCTTCAGCCCCGTCGCTTTCCATCGGCATGTATTC 3' (SEQ ID NO:7)), which encompassed the deletion and 5'- and 3'-flanking primers that covered the site kpni restriction sites and the label "middle-T" at the 5'-end. The final PCR product was digested and kpni restriction sites SmaI and ligated into the vector pS2neo cut Cloned/SmaI and contains a full-sized Akt1, effectively replacing the 5'-end of the clone deletionism option.

Akt3 gene human amplified, carrying out PCR cDNA brain of the adult human brain (Clontech), using aminobenzoic oligonucleotide primer: 5' GAATTCAGATCTACCATGAGCGATGTTACCATTGTG 3' (SEQ ID NO:8); and oligonucleotide primer at the carboxyl end: 5' TCTAGATCTTATTCTCGTCCACTTGCAGAG 3' (SEQ ID NO:9). These primers included a 5'-EcoRI/BglII site and a 3'XbaI/BglII site for cloning. The resulting PCR product Cloner the Wali sites EcoRI and XbaI pGEM4Z (Promega). For expression/purification was added to the label "middle-T" to the 5'-end of the full-length clone of Akt3 using PCR primer: 5' GGTACCATGGAATACATGCCGATGGAAAGCGATGTTACCATTGTGAAG 3' (SEQ ID NO:10). The resulting PCR product contained the 5'-kpni restriction sites website, which gave the possibility of cloning in frame with containing bitenova label expressing the vector in insect cells, pS2neo.

Akt2 gene human amplified in PCR with cDNA of human thymus (Clontech), using aminobenzoic oligonucleotide primer: 5' AAGCTTAGATCTACCATGAATGAGGTGTCTGTC 3' (SEQ ID NO:11); and oligonucleotide primer at the carboxyl end: 5' GAATTCGGATCCTCACTCGCGGATGCTGGC 3' (SEQ ID NO:12). These primers included a 5'-HindIII/BglII site and a 3'EcoRI/BamHI site for cloning. The resulting PCR product was subcloned into the HindIII/EcoRI sites of pGem3Z (Promega). For expression/purification was added to the label "middle-T" to the 5'-end full-size Akt2 using PCR primer: 5' GGTACCATGGAATACATGCCGATGGAAAATGAGGTGTCTGTCATCAAAG 3' (SEQ ID NO:13). The resulting PCR product was subcloned into the vector pS2neo, as described above.

EXAMPLE 2

Expression of Akt isoforms of human and ΔPH-Akt1

DNA containing the cloned genes Akt1, Akt2, Akt3, andΔPH-Akt1 in expressing vector pS2neo, was purified and used for transfection of cells of Drosophila S2 (ATCC) method using calcium phosphate. Selected pools of resistant to the antibiotic cells (G418, 500 μg/ml). Cells were propagated up to a volume of 1.0 l (~7,0 the 10 6/ml), was added Biotin and CuSO4to a final concentration of 50 μm and 50 mm, respectively. Cells were grown for 72 hours at 27°C and collected by centrifugation. The cell paste was frozen at -70°C and stored until use.

EXAMPLE 3

Purification of the Akt isoforms of human and ΔPH-Akt1

Cell mass of one liter of S2 cells, described in example 2, was literally by sonication with 50 ml of 1% CHAPS in buffer A: 50 mm Tris pH of 7.4, 1 mm EDTA, 1 mm EGTA, 0.2 mm AEBSF, 10 μg/ml of benzamidine, 5 μg/ml leupeptin, Aprotinin and pepstatin, 10% glycerol and 1 mm DTT). The soluble fraction was purified on a column of protein G-separate Fast flow (Pharmacia)loaded with 9 mg/ml monoclonal antibody against middle-T and suirable 75 μm peptide EYMPME (SEQ ID NO:14) in A buffer containing 25% glycerol. Fractions containing the Akt/PKB, were combined and evaluated the purity of a protein using SDS-page. Purified protein was assessed quantitatively using a Protocol according to Bradford. Purified protein was rapidly frozen in liquid nitrogen and stored at -70°C.

Akt and Akt with the deletions pleckstrin-homologous domain, purified from S2 cells required activation. Akt and Akt with the deletions pleckstrin-homologous domain activated (Alessi et al. Current Biology 7: 261-269) in the reaction mixture, containing 10 nm PDK1 (Upstate Biotechnology, Inc.), liposomes (10 μm phosphatidylinositol-3,4,5-triphosphate - Metreya, Inc., 100 μm phosphatidyl is in and 100 μm phosphatidylserine - Avanti Polar lipids, Inc.) and a buffer for activation (50 mm Tris pH of 7.4, 1.0 mm DTT, 0.1 mm EGTA, 1,0 µm microcystin-LR, 0.1 mm ATP, 10 mm MgCl2, 333 μg/ml BSA and 0.1 mm EDTA). The reaction mixture was incubated at 22°C for 4 hours. Aliquots were quickly frozen in liquid nitrogen.

EXAMPLE 4

Analyses kinase Akt

Activated Akt isoforms and constructs with deletions of pleckstrin-homologous domain were analyzed using received from GSK biotinylated peptide substrate. The degree of phosphorylation of the peptide was determined homogeneous fluorescence with a time resolution (HTRF), using the associated with the chelate lanthanide (Lance) monoclonal antibody specific against phosphopeptide, in combination with the associated with the streptavidin-fluorophore by allophycocyanin (SA-APC), which will contact the Biotin residue on the peptide. In the case when Lance and APC are close to each other (i.e. are associated with one and the same molecule phosphopeptide), is non-radioactive energy transfer from the Lance to the APC with the subsequent emission of light from APC at 665 nm.

Materials needed for analysis:

A. Activated Akt inhibitory or design with deletionism pleckstrin-homologous domain.

B. Peptide substrate Akt: GSK3α (S21), peptide No. 3928 Biotin-GGRARTSSFAEPG (SEQ ID NO:15), Macromolecular Resources.

C. Labeled Lance monoclonal antibody against phospho-GSK3α (Cell Signaing Technology, clone No. 27).

D. SA-APC (Prozyme No. in catalogue PJ25S, batch No. 896067).

E. Tablets for micrometrology with a U-shaped bottom Microfluor®B (Dynex Technologies, № directory 7205).

F. the Analyzer in HTRF microplate Discovery®, Packard Instrument Company.

G. 100 X a mixture of protease inhibitors (PIC): 1 mg/ml of benzamidine, 0.5 mg/ml pepstatin, 0.5 mg/ml leupeptin, 0.5 mg/ml Aprotinin.

H. 10X buffer for analysis: 500 mm HEPES, pH 7.5, 1% PEG, mm EDTA, 1 mm EGTA, 1% BSA, 20 mm β-glycerophosphate.

I. Buffer for damping: 50 mm HEPES pH 7.3, 16,6 mm EDTA, 0.1% BSA, 0.1% Triton X-100, to 0.17 nm Lance-labeled monoclonal antibody clone No. 27, 0,0067 mg/ml SA-APC.

J. working solution of ATP/MgCl2: 1X buffer for analysis, 1 mm DTT, 1X PIC, 125 mm KCl, 5% glycerol, 25 mm MgCl2, 375 μm ATP.

K. working solution with enzyme: 1X buffer for analysis, 1 mm DTT, 1X PIC, 5% glycerol, active Akt. The final concentration of enzyme was chosen so that the analysis took place in the linear range of response.

L. working solution with peptide: 1X buffer for analysis, 1 mm DTT, 1X PIC, 5% glycerol, 2 μm biotinylated peptide GSK3 No. 3928.

The reaction mixture was made by adding 16 μl of the working solution of ATP/MgCl2in appropriate wells of 96-hole tablet for micrometrology. Added inhibitor or filler (1,0 ml), then 10 μl of the working solution with the peptide. The reaction was started by addition of 13 μl of the working solution with the enzyme and mixing. The reaction gave the opportunity of a CR is to Tecate for 50 min and then stopped by adding 60 μl of buffer to absorb HTRF. After stopping the reaction the reaction mixture is incubated at room temperature for at least 30 min and then was detected on device Discovery.

The method of analysis on streptavidin coated tablets Flash Plate:

Stage 1

1 μl of a solution of test compound in 100% DMSO was added to 20 ál of 2X substrate solution (20 μm peptide GSK3, 300 μm ATP, 20 mm MgCl2, 20 mccoury/ml [γ33P]ATP, 1X buffer for analysis, 5% glycerol, 1 mm DTT, 1X PIC, 0,1% BSA and 100 mm KCl). The phosphorylation reaction was initiated by addition of 19 ál of 2X solution of the enzyme (6,4 nm active Akt/PKB, 1X buffer for analysis, 5% glycerol, 1 mm DTT, 1X PIC and 0.1% BSA). Then the reaction mixture was incubated at room temperature for 45 minutes.

Stage 2

The reaction was stopped by the addition of 170 μl of 125 mm EDTA. 200 μl of the reaction mixture after stopping the reaction was transferred into a tablet coated with streptavidin Flashplate® PLUS (NEN Life Sciences, № directory SMP103). The tablet were incubated for ≥10 minutes at room temperature on the shaker for tablets. The contents of each well aspirated and the wells 2 times washed with 200 μl of TBS per well. Then the wells were washed 3 times for 5 minutes with 200 μl of TBS per well, during the incubation tablets at room temperature on a shaking platform at the stage of washing.

The tablets covered with a film and carried out the expense of using MF is tcheka Packard TopCount with the appropriate settings for the account of [ 33P] tablets Flashplates.

The method of analysis on streptavidin coated filter tablets:

Stage 1

Carried out the enzymatic reaction described above for stage 1 analysis on streptavidin coated tablets Flash Plate.

Stage 2

The reaction was stopped by adding 20 μl of 7.5 M guanidine hydrochloride. 50 ál of the reaction mixture after stopping the reaction was transferred to a streptavidin coated filter tablet (tablet to capture Biotin SAM2TM, Promega, No. in catalogue V7542) and incubated on the filter for 1-2 minutes before applying vacuum.

The tablet then washed using a vacuum manifold as follows: 1) 4×200 μl/well of 2M NaCl; 2) 6×200 μl/well of 2M NaCl with 1% H3PO4; 3) 2×200 μl/well of distilled H2O; and 4) 2×100 μl/well of 95% ethanol. Then the membranes were given the opportunity to fully air dry before adding the scintillator.

The bottom of the tablet tightly closed white lining film, was added to 30 ál/well of Microscint 20 (Packard Instruments, no directory 6013621). On top of the tablet was closed by a transparent sealing film and then carried out the expense in the tablet, using the counter Packard TopCount with appropriate parameters for [33P] and liquid scintillator.

The method of analysis on the tablet with phosphocellulose filter

Stage 1

fermentative reaction was carried out, as described for stage 1 of the analysis, on streptavidin coated tablets Flash Plate (above), using KKGGRARTSSFAEPG (SEQ ID NO:16) as the substrate instead of the Biotin-GGRARTSSFAEPG.

Stage 2

The reaction was stopped by adding 20 μl of 0.75% H3PO4. 50 ál of the reaction mixture after stopping the reaction was transferred to a filter tablet (UNIFILTERTMstrong cation-exchanger Whatman P81, white polystyrene 96-well plates, Polyfiltronics, No. in catalogue 7700-3312) and incubated on the filter for 1-2 minutes before applying vacuum.

The tablet then washed using a vacuum manifold as follows: 1) 9×200 μl/well of 0.75% H3PO4; and 2) 2×200 μl/well of distilled H2O. the bottom of the tablet tightly closed white lining film, then add 30 ál/well of Microscint 20. On top of the tablet was closed by a transparent sealing film and then carried out the expense in the tablet, using the counter Packard TopCount with appropriate parameters for [33P] and liquid scintillator.

Analysis of PKA:

For each individual analysis PKA used the following components:

A. 5X buffer for analysis of PKA (200 mm Tris pH 7.5, 100 mm MgCl2, 5 mm β-mercaptoethanol, 0.5 mm EDTA).

B. 50 μm mother liquor Kemptide (Sigma)diluted in water.

C.33P-ATP prepared by diluting to 1.0 ál33P-ATP [10 mcurie/ml] 200 μl of 50 μm uterine Rast is ora its ATP.

D. 10 ál of 70 nm stock solution of the catalytic subunit of PKA (UBI, No. in catalogue 14-114)diluted in 0.5 mg/ml BSA.

E. working solution PKA/Kemptide: equal volumes of 5X buffer for analysis of PKA, solution Kemptide and the catalytic subunit of PKA.

The reaction mixture was prepared in 96-well tablet analysis with deep holes. Inhibitor or filler (10 ml) was added to 10 μl of a solution33P-ATP. The reaction was initiated by adding 30 μl of the working solution PKA/Kemptide in each well. The reaction mixture was stirred and incubated at room temperature for 20 minutes the Reaction was stopped by adding 50 μl of 100 mm EDTA and 100 mm sodium pyrophosphate and mixing.

The product of the enzymatic reaction (phosphorylated Kemptide) were collected in 96-well filtration tablets with filters from phosphocellulose p81 (Millipore). To prepare the tablet through each well of the filter tablet p81 filter 75 mm phosphoric acid. The wells were emptied through the filter, summing up the vacuum to the bottom of the tablet. To each well was added phosphoric acid (75 mm, 170 μl). Aliquot 30 ál of each reaction mixture after stopping the reaction PKA was added into the appropriate wells of the filter tablet containing phosphoric acid. The peptide was collected on the filter after the supply of vacuum and the filters washed 5 times with 75 mm phosphoric acid. After the last industry the key filter was allowed to air dry. To each well was added to scintillation fluid (30 ml) and made the account filters on the counter TopCount (Packard).

Analysis of PKC:

For each analysis PKC used the following components:

A. 10X buffer for coactively PKC: 2.5 mm EGTA, 4 mm CaCl2.

B. 5X buffer to activate PKC: 1.6 mg/ml phosphatidylserine, 0.16 mg/ml diacylglycerol, 100 mm Tris pH 7.5, 50 mm MgCl2, 5 mm β-mercaptoethanol.

C.33P-ATP prepared by diluting to 1.0 ál33P-ATP [10 mcurie/ml] 100 μl of 100 μm stock solution its ATP.

D. Basic myelin protein (350 μg/ml, UBI)diluted with water.

E. PKC (50 ng/ml, UBI No. in catalogue 14-115)diluted in 0.5 mg/ml BSA.

F. working solution PKC/basic myelin protein, prepared by mixing 5 volumes of each buffer to coactively PKC and the basic protein of myelin with 10 volumes each of buffer to activate PKC and PKC.

The reaction mixture for analysis were prepared in 96-well tablet analysis with deep holes. Inhibitor or filler (10 ml) was added to a 5.0 ál33P-ATP. Reactions were initiated by addition of working solution PKC/basic myelin protein and mixing. The reaction mixture was incubated at 30°C for 20 minutes the Reaction was stopped by adding 50 μl of 100 mm EDTA and 100 mm sodium pyrophosphate and mixing. Phosphorylated myelin basic protein were collected in the PVDF membranes in a 9-hole filtering tablets and quantitatively assessed by scintillation counting.

Compounds according to the present invention, described in the schemes and the tables were tested in the above assays and found that they have the IC50≤50 μm against one or more of Akt1, Akt2 and Akt3.

EXAMPLE 5

Cell-based assays to determine inhibition of Akt/PKB

Cells (e.g., LnCaP or line PTEN tumor cells(-/-)activated Akt/PKB) were sown in a Cup with a diameter of 100 mm When the cells were merged into a monolayer of approximately 70-80%, the culture medium was replaced with 5 ml of fresh medium and the solution was added to test the connection. Controls included untreated cells, cells treated filler, and cells treated with either LY294002 (Sigma), or wortmannin (Sigma) at a concentration of 20 ám and 200 nm, respectively. Cells were incubated for 2, 4 or 6 hours and the medium was removed, cells were washed in PBS, collected and transferred to a centrifuge tube. Cells were besieged and again washed with PBS. Finally, the precipitated cells resuspendable in lyse buffer (20 mm Tris pH 8, 140 mm NaCl, 2 mm EDTA, 1% Triton, 1 mm Na-pyrophosphate, 10 mm β-glycerophosphate, 10 mm NaF, 0.5 mm NaVO4, 1 μm microcystin and 1x a mixture of protease inhibitors), placed on ice for 15 minutes and gently shook to lyse the cells. The lysate was centrifuged in a tabletop ultracentrifuge Beckman at 100000×g at 4°C for 20 min Protein in nodosa the ke quantitatively evaluated, using the standard Protocol of Bradford (BioRad) and kept at -70°C until use.

Proteins were immunoprecipitated (IP) from cleared lysates as follows. To determine Akt1/PKBI lysates were mixed with Santa Cruz sc-7126 (D-17) in NETN (100 mm NaCl, 20 mm Tris pH 8.0, 1 mm EDTA, 0,5% NP-40) was added to protein A/G-agarose (Santa Cruz sc-2003). To determine Akt2/PKBβ lysates were mixed in NETN with anti-Akt2-agarose (Upstate Biotechnology No. 16-174), and to determine Akt3/PKBK lysates were mixed in NETN with anti-Akt3-agarose (Upstate Biotechnology No. 16-175). IP incubated over night at 4°C, washed and separated in SDS-page.

Western blots were used to analyze total Akt, pThr308-Akt1, pSer473-Akt1 and related sites of phosphorylation on Akt2 and Akt3 and below in the cascade targets Akt, using specific antibodies (Cell Signaling Technology): an antibody against total Akt (No. in catalogue 9272), antibody against phosphoserine-473-Akt (No. in catalogue 9271) and antibody against posttraining-308-Akt (No. in catalogue 9275). After incubation with the corresponding first antibody diluted in PBS + 0.5% of nonfat dry milk (NFDM), at 4°C during the night the blots were washed, incubated with horseradish peroxidase (HRP) as the second antibody in PBS + 0.5% of NFDM for 1 hour at room temperature. Proteins were detected using ECL reagents (Amersham/Pharmacia Biotech RPN2134).

EXAMPLE 6

Stimulated by heregulin activation of Akt

Cells MCF7 (line CL is current breast cancer man which is PTEN+/+) were sown on 1×106cells in a Cup with a diameter of 100 mm When the cells were merged into the monolayer at 70-80%, the culture medium was replaced with 5 ml serum-free medium and incubated overnight. The next morning, was added compound and the cells were incubated for 1-2 hours, then added heregulin (to induce Akt activation) for 30 minutes and cells were analyzed as described above.

EXAMPLE 7

Inhibition of tumor growth

The efficiency of in vivo inhibitor of the growth of malignant cells can be confirmed by using several protocols known in this field.

Line human tumor cells, in which there is dysregulation of the P13K pathway (e.g., LnCaP, PC3, C33a, OVCAR-3, MDA-MB-468, A2780 or the like), were injected with subcutaneously into the left flank of the nude female mice 6-10 weeks of age (also used male mice [10-14 weeks of age] for xenografts of prostate tumor [LnCaP and PC3]) (Harlan) at 0 day. Mice were randomly divided into groups of processing filler compound or combination treatment. Daily subcutaneous administration was started on day 1 and continued throughout the experiment. Alternative test inhibitory compound can be entered using the pump for continuous infusion. Compound, combination of compounds or filler injected is in a total volume of 0.2 ml Tumors were excised and weighed, when all the treated filler of animals observed lesion diameter 0.5-1.0 cm, usually 4-5,5 weeks after injection of cells. Expected average weight of the tumors in each group processing for each cell line.

EXAMPLE 8

Analysis spots in tablets Multiplex

This method refers to the immunoassay of the sandwich type, used for the detection of multiple phosphorylated proteins in the same well of 96-well plate. Lysates of cells were incubated in 96-well tablets, on which different capture antibodies were placed in the form of spatially separated spots in the same hole. Added specific phosphorylation polyclonal antibody rabbit and the complex was detected using antibodies against rabbit immunoglobulin labeled with electrochemiluminescent label.

96-well tablets LNCaP +/- connections:

Centrifuged in a centrifuge Beckman J6 at 1200 rpm for 10 min, the medium aspirated. Added 50 μl/well: TBS (Pierce No. 28376-20 mm Tris pH 7.5, 150 mm NaCl + 1% Triton X-100 + protease inhibitors and phosphatase. Closed film was placed in a freezer at -70°C until complete freezing. Blocked tablets Multiplex (Meso Scale Discovery, Gaithersburg, MD) 3% blocker A in 1X Tris-buffer for washing, 150 μl/well. Closed with lighting the mix for sealing tablets, incubated on the Micromix shaker at room temperature for 2 hours (minimum). Washed 1X RCM 51 (TTBS). Was unfrozen tablets with cell lysate on ice, was added 40 μl of lysate/well in a blocked tablets. Closed using a device for sealing tablets, incubated on the Micromix shaker at 4°C O/N. Washed 1X RCM 51. Diluted second antibody in 1% blocker A in 1X Tris-buffer for washing: anti-phospho-AKT (T3O8), anti-phospho-tuberin (T1462), separately or in combination. Was added at 25 μl/hole, closed the tablet using the device for sealing tablets, incubated on the Micromix shaker at room temperature for 3 hours. Washed 1X RCM 51. Diluted EN-GAR in 1% blocker A in 1X Tris-buffer for washing. Was added at 25 μl/hole, closed with devices for sealing tablets, incubated on the Micromix shaker at room temperature for 1 hour. Washed 1X RCM 51. Diluted 4X buffer to register T to 1X with water, was added to 200 µl of the diluted buffer for Desk/well.

Registered in the device Sector Imager 6000.

Inhibitors of proteases and phosphatases:

Microcystin-LR, Calbiochem No. 475815 to a final concentration of 1 μm (mother solution = 500 µm)

Calbiochem No. 524624, 100 X set I

Calbiochem No. 524625, 100 X set II

Calbiochem No. 539134, 100 X set III

Anti-phospho-AKT (T308):

Cell Signaling Technologies No. 9275

Anti-fosfateren (T 1462):

Covance, affinity purified (rabbits MS 2731/2732)

EN-GAR = butanilicaine antibodies goat against rabbit immunoglobulin

10X Tris-buffer flush blocker and A 4X buffer T for washing

10X RCM 51 (10X TTBS, RCM 51)

1X = 20 mm Tris pH 7.5, 140 mm NaCl, 0.1% tween-20

EXAMPLE 9

Cell-based analysis (in-vivo)

This method relates to cell-based (in vivo) to analyze the activity of serine/ser / thr kinase Akt. Activated endogenous Akt is able to fosforilirovanii specific peptide substrate of Akt (GSK3β), which biotinylated. The registration exercise homogeneous fluorescence with a time resolution (HTRF), using the associated with Cryptocom europium [Eu(K)] antibody specific to phosphopeptide, and associated with the streptavidin fluorophore XL665, which will be contacted with Biotin residue on the peptide. When [Eu(K)] and XL665 are next to each other (i.e. are associated with one and the same molecule phosphopeptide) is non-radioactive energy transfer from Eu(K) to XL665 with the subsequent emission of light from XL665 at 665 nm.

The analysis can be used to identify inhibitors of all three isoenzymes Akt (Akt1, Akt2 and Akt3) from many different species, each of them are antibodies.

MATERIALS AND REAGENTS

A. 96-well plates to micrometrology cultures of cells PLoS is their bottom, Corning Costar No. in catalogue 3598.

B. 96-well plates, coated with protein A Reacti-Bind, Pierce, No. in catalogue 15130.

C. 96-well plates, coated with protein G Reacti-Bind, Pierce, No. in catalogue 15131.

D. Micromix Shaker 5.

E. Tablets for micrometrology with a U-shaped bottom Microfluor® B, Dynex Technologies, № directory 7205.

F. a Device for washing 96-well plates, Bio-Tek Instruments, No. in catalogue EL 404.

G. Analyzer in HTRF microplate Discovery®, Packard Instrument Company.

BUFFER SOLUTIONS

A. Buffer for lysis of the cells in the analysis of IP kinase: 1X TBS; 0.2% tween-20; 1X mixture of protease inhibitors III (the original solution is 100X, Calbiochem, 539134); 1X mixture of phosphatase inhibitors I (the original solution is 100X, Calbiochem, 524624); and 1X a mixture of phosphatase inhibitors II (the original solution is 100X, Calbiochem, 524625).

B. 10X buffer for analysis: 500 mm Hepes pH 7.5; 1% PEG; 1 mm EDTA; 1 mm EGTA; and 20 mm β-glycerol.

C. Buffer for analysis of IP kinase: 1X buffer for analysis; 50 mm KCl; 150 μm ATP; 10 mm MgCl2; 5% glycerol; 1 mm DTT; 1 tablet a mixture of protease inhibitors in 50 ml of buffer for analysis; and 0.1% BSA.

D. GSK3β substrate Solution: buffer for analysis of IP kinase and 500 nm biotinylated peptide GSK3β.

E. Buffer Lance: 50 mm Hepes pH 7.5, 0.1% BSA and 0.1% Triton X-100.

F. Buffer to stop Lance: buffer Lance and 33.3 mm EDTA.

G. Buffer for registration Lance: buffer Lance, of 13.3 μg/ml SA-APC and 0,665 nm EuK-Antibodies against phospho(Ser-21)GSK3β.

Multistage analysis of immunodeficiency is precipitatio kinase Akt

1 day

A. stage seeding C33a cells: Sown 60000 C33a cells/well in 96-well plate for micrometrology.

B. Cells were incubated over night at 37°C.

2 day

D. stage of adding compounds: Compounds were added in fresh medium (alpha-MEM/10% FBS, room temperature) in the above 96-well plate, and incubated for 5 hours in the incubator for tissue culture.

E. stage lysis of cells: Wednesday aspirated and added to 100 μl of buffer for lysis of cells for analysis of IP kinase.

F. 96-well plate for micrometrology was frozen at -70°C (note: this stage can be carried out for at least 1 hour or over night).

3 day

G. stage using a 96-hole tablet coated with protein A/G: I added the appropriate concentration of α-Akt-antibody (Akt1, Akt2 or Akt3) in 100 μl PBS in the following wells:

α-Akt1 (20 ng/well/100 ál)B2""""B10/rows B-G/tablet Akt1
α-Akt2 (50 ng/well/100 ál)B2""""B10/rows B-G/tablet Akt2
IgG rabbit (150 ng/well/100 ál)B11-G11 on each tablet (Akt1 and Akt2)

H. Incubated in the cold room (+4°C) for 4 hours at Microix 5 (form 20; position 2) (note: the position depends on what device Micromix 5 is used).

I. Aspirated solution of α-Akt antibodies and to each well was added 100 μl of PBS.

J. stage thus Akt: 100 µl PBS with stage (I) add 5 ál of thawed lysate of cells in the case of tablets for Akt1 and 10 ál of thawed lysate of cells in the case of tablets for Akt2. Note: lysate of cells was thawed on ice. Thawed lysate was mixed by pipetting up and down 10 times before putting it into tablets with antibodies. Tablets with cell lysate was kept on ice. After transfer of the lysate of cells in tablets with antibodies tablets with lysates of cells was re-frozen at -70°C.

K. Incubated in the cold room (+4°C) overnight on a shaker for Micromix 5 (form 20, position 3).

4 day

L. stage washing tablet thus: 96-hole tablets were washed 1 time in TTBS (RCM 51, 1 time = 2 cycles)using a device for washing 96-well plates. The wells were filled with TTBS and incubated for 10 minutes. 96-well tablets were washed 2 times with TTBS. (Note: fill the device for flushing the tablets before use: 1) check the capacity of the buffer, making sure that they were completed, and 2) empty waste containers.

M. stage hand washing tablets: Added 180 μl of buffer for analysis of IP kinase.

N. Start the enzymatic reaction Akt: Added adosados. Added 60 μl of substrate solution GSK3β.

O. Incubated for 2.5 hours on the Micromix shaker 5 at room temperature. Note: the incubation Time should be set so that the ratio of column 10 to column 11 was not >10.

P. Combined 30 ál of buffer for registration Lance with 30 μl of a buffer to stop Lance (60 μl/well) and added to 96-well black tablet with a U-shaped bottom Microfluor.

Q. Stopped the enzymatic reaction Akt: bore 40 μl of the mixture for the enzymatic reaction of Akt coated with protein A/G 96-well plate with the stage (O) in 96-well black tablet with a U-shaped bottom Microfluor with stage (P).

U. Incubated at room temperature for 1-2 hours on the shaker Micromix 5 (form 20, position 3), then registered on the analyzer, microplate Discovery using the program for Akt.

Buffer for lysis of cells for analysis of IP kinase

100 μl per well.

8 ml (1 tablet)45 ml (6 tablets)
1X TBS7744 álNA
Tween-20 20 álNA
1X a mixture of protease inhibitors III80 álNA
1X a mixture of phosphatase inhibitors I450 ál
1X a mixture of phosphatase inhibitors II80 ál450 ál
Microcystin LR (500X)
80 ál90 µl

Buffer for analysis of IP kinase

100 μl per well.

8 ml (1 tablet)50 ml (3 tablet)
10X buffer for analysis800 ál5 ml
1 M KCl2.5 ml
250 mm ATP4,8 ál30 ál
1M MgCl280 ál500 ál
Glycerin400 ál2.5 ml
1M DTT8 ál50 µl
A mixture of protease inhibitors1 tablet/50 ml1
10% BSA80 ál500 ál
Distilled H2About6227,2 ál38,9 ml

The substrate solution GSK3β

60 μl per well.

5 ml (1 tablet)7 ml
5 ml-
1 mm peptide GSK3β2,5 álthe 3.5 ál

Buffer to stop Lance

30 μl per well.

3 ml (1 tablet)5 ml5 ml
1X buffer Lance2800,2 ál
EDTA 0.5 M199,8 ál

The buffer register Lance

30 μl per well.

3 ml (1 tablet)5 ml
SA-APC (1 mg/ml in distilled deionized H2Oh)40 ál66,7 ál
EuK Antibody phospho (Ser 21)GSK3β (680 nm), diluted 1/1133 buffer Lance2,7 ál a 4.5 ál

1. The compound of formula E

in which the dotted line represents an optional double bond;
R1selected from N, carbonyl group, SH, NH2(C=O)NH2With3-C6cycloalkyl, phenyl, optionally substituted HE, CN, halogen, C3-C6cycloalkyl, phenoxy, hydroxys1-C6the alkyl or the group NR7R8where R7means hydrogen, a R8means (C=O)1-C6alkyl;
With1-C6alkyl, optionally substituted 1-2 times by halogen, C1-C6the perfluoroalkyl, S(O)2C1-C6the alkyl, HE, CN, a group NR7R8where R7means hydrogen or C1-C6alkyl, a R8means H, C1-C6alkyl, hydroxys1-C6alkyl, (C=O)C1-C6alkyl, (C=O)OS1-C6alkyl, 4-6-membered heterocyclyl selected from the group consisting of azetidine, pyrrolidine, morpholine, piperidine, replaced by aminocarbonyl, and piperazinil, optionally substituted C1-C6the alkyl, 5-membered heteroaryl selected from the group consisting of tetrazolyl or imidazolyl;
5-membered heteroaryl containing 1-2 nitrogen atom and one oxygen atom or sulfur as heteroatoms, and heteroaryl with one atomo the nitrogen and one oxygen atom substituted With the 1-C6by alkyl;
5-membered heteroaryl containing 2-3 nitrogen atom as heteroatom, optionally substituted C1-C6the alkyl, C3-C6cycloalkyl, phenyl, benzyl, pyridinyl, triptorelin or geography, or 5-membered heteroaryl containing 1-2 nitrogen atom as heteroatoms, condensed with a benzene ring;
6-membered heteroaryl containing 1-2 nitrogen atom as heteroatoms selected from the group consisting of pyridinyl, optionally substituted amino or hydroxy group, oxydiphenylene, pyrimidinyl, pyrazinyl, pyridazinone or dihydropyridine;
condensed heterocyclic system consisting of two 5 - or 5-6-membered rings and containing 2-4 nitrogen atom and sulfur atom as heteroatoms selected from the group consisting of imidazopyrimidines, pyrazolopyrimidine, triazolopyrimidine, pyrazolopyrimidine, imidazopyridine, optionally substituted C1-C6by alkyl or halogen;
5-membered heteroaryl containing two nitrogen atom, one sulfur atom or one nitrogen atom and one oxygen atom, condensed with gidrirovanny benzene ring;
R3selected from C3-C6cycloalkyl, substituted NH2or group with other8where R8means (C=O)1-C6alkyl, where the alkyl replace the EN-pyridinyl, hyalinella or oxothiazolidine,1-C6alkyl, substituted NH2HE group NR7R8where R7means hydrogen, a R8means3-C6cycloalkyl, optionally substituted hydroxy, C1-C6the alkyl substituted by halogen, hydroxy, dis1-C6alkylamino, phenyl, substituted hydroxy, pyridinyl, substituted by hydroxy or C1-C6alkoxy, imidazolyl, substituted C1-C6the alkyl group (C=O)NR7R8where R7means hydrogen, a R8means phenyl, substituted hydroxy group (C=O)1-C6alkyl, where alkyl optionally substituted NH2HE, CN, phenyl, substituted hydroxy, pyridinyl, optionally substituted with halogen, 1H-indazolinone, oxadiazolyl, morpholinyl, pyrazinium, pyrimidinium, substituted hydroxy, triazolyl, substituted phenyl, oxothiazolidine, benzoxazolium, benzimidazolium, group (C=O)OS1-C6the alkyl group other8where R8means (C=O)OS1-C6alkyl or (C=O)phenyl, substituted hydroxy, or
R7mean group (C=O)C1-C6alkyl, optionally substituted NH2, oxothiazolidine, a group with other8where R8means (C=O)OS1-C6alkyl, or
R7and R8together with the nitrogen atom, which is neither associated, form a 6-membered cycle, the substituted group (C=O)NH2or 5-membered heteroaryl containing 2-3 nitrogen atom as heteroatoms, which is optionally substituted pyridinyl;
or its pharmaceutically acceptable salt.

2. The compound of formula J

in which the dotted line represents an optional double bond; R1selected from N, carbonyl group, SH, NH2(C=O)NH2With3-C6cycloalkyl, phenyl, optionally substituted HE, CN, halogen, C3-C6cycloalkyl, phenoxy, hydroxys1-C6the alkyl or the group NR7R8where R7means hydrogen, a R8means (C=O)1-C6alkyl;
With1-C6alkyl, optionally substituted 1-2 times by halogen, C1-C6the perfluoroalkyl, S(O)2C1-C6the alkyl, HE, CN, group where R7means hydrogen or C1-C6alkyl, a R8means H, C1-C6alkyl, hydroxys1-C6alkyl, (C=O)C1-C6alkyl, (C=O)OS1-C6alkyl, 4-6-membered heterocyclyl selected from the group consisting of azetidine, pyrrolidine, morpholine, piperidine, replaced by aminocarbonyl, and piperazinil, optionally substituted C1-C6the alkyl, 5-membered heteroaryl selected from the group consisting of tetrazolyl is or imidazolyl;
5-membered heteroaryl containing 1-2 nitrogen atom and one oxygen atom or sulfur as heteroatoms, and heteroaryl with one nitrogen atom and one oxygen atom substituted With the1-C6by alkyl;
5-membered heteroaryl containing 2-3 nitrogen atom as heteroatom, optionally substituted C1-C6the alkyl, C3-C6cycloalkyl, phenyl, benzyl, pyridinyl, triptorelin or geography, or 5-membered heteroaryl containing 1-2 nitrogen atom as heteroatoms, condensed with a benzene ring;
6-membered heteroaryl containing 1-2 nitrogen atom as heteroatoms selected from the group consisting of pyridinyl, optionally substituted amino or hydroxy group, oxydiphenylene, pyrimidinyl, pyrazinyl, pyridazinone or dihydropyridine;
condensed heterocyclic system consisting of two 5 - or 5-6-membered rings and containing 2-4 nitrogen atom and sulfur atom as heteroatoms selected from the group consisting of imidazopyrimidines, pyrazolopyrimidine, triazolopyrimidine, pyrazolopyrimidine, imidazopyridine, optionally substituted C1-C6by alkyl or halogen;
5-membered heteroaryl containing two nitrogen atom, one sulfur atom or one nitrogen atom and one oxygen atom, condensed with hereroland the m benzene ring;
R3'and R3"independently selected from H, (C=O)1-C6the alkyl, optionally substituted 6-membered heterocyclyl containing a nitrogen atom and oxygen, 5-6-membered heteroaryl containing 1-3 nitrogen atom and optionally an oxygen atom and substituted With1-C6by alkyl, halogen, hydroxy, phenyl, substituted hydroxy group NR7R8where R7means hydrogen, a R8means (C=O)OS1-C6alkyl, (C=O)phenyl, substituted hydroxy; C1-C6the alkyl, optionally substituted hydroxy, halogen, the group (C=O)NR7R8where R7means hydrogen, a R8means phenyl, substituted hydroxy; di(C1-C6the alkyl)amino; With3-C6cycloalkyl, optionally substituted by hydroxy; and (C1-C6alkyl)phenyl, optionally substituted by hydroxy; (C=O)heteroaryl where heteroaryl means 5-6-membered ring containing a nitrogen atom or an oxygen atom and optionally substituted pyridinyl, morpholinyl, condensed heterocyclic system consisting of two 5-6-membered ring containing 1-2 nitrogen atom or an oxygen atom, or sulfur selected from the group consisting of chinoline, oxothiazolidine, benzoxazolyl, substituted oxo, benzimidazolyl, indazole, thieno[2,3-d]pyrimidinyl, substituted by oxo; and (C1-C6)liljaroslilja, containing one or two nitrogen atom, optionally substituted C1-C6by alkyl, hydroxy, C1-C6alkoxy; or
R3'and R3"taken together with the nitrogen atom to which they are bound, may form a piperidine or pyrrolidine, which may not necessarily be substituted 5-membered heteroaryl containing 2-3 nitrogen atom as heteroatom, optionally substituted (C=O)NH2, pyridinyl, triazolyl, optionally substituted pyrazinium;
R4and R5independently mean H, C1-C6alkyl; or R4and R5taken together can form a (C3-C7)cycloalkyl;
or its pharmaceutically acceptable salt.

3. Compound which is selected from:
9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine;
9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-ol;
9-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine;
9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-thiol;
3-methyl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)shall piperidin-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-(chloromethyl)-9-phenyl-8-(4-{[4-(4-pyridin-2-yl-1H-imidazol-1-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-[(4-methylpiperazin-1-yl)methyl]-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
2-({[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-1H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methyl}amino)ethanol;
8-(4-aminomethylphenol)-9-phenyl-[1,2,4]triazolo[3,4-f][1,6]naphthiridine-3-ol;
1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
4-(3-methyl-9-phenyl-[1,2,4]triazolo[3,4-f][1,6]naphthiridine-8-yl)benzylamine;
8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-amine;
1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine;
9-phenyl-8-{4-[4-(5-pyridin-2-yl-4H-[1,2,4]triazole-3-yl)-piperidine-1-ylmethyl]phenyl}-[1,2,4]triazolo[3,4-f][1,6]naphthiridine;
9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-(1H-1,2,3-triazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-(1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
tert-butyl[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methylcarbamate;
[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol; 5-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]-2,4-dihydro-3H-1,2,4-triazole-3-one;
3-(3-methyl-1H-1,2,4-triazole-5-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3 imidazo[2,1-b][1,3]thiazol-6-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3 imidazo[1,2-a]pyridine-2-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)-3-(1H-1,2,4-triazole-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-(1H-benzimidazole-6-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3 imidazo[1,2-a]pyrimidine-2-yl-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
5-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]pyridine-2-amine;
9-phenyl-3-irazola[1,5-a]pyrimidine-3-yl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-(5-methyl-1H-pyrazole-3-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]pyridine-2-amine;
4-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]phenol;
3-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]phenol;
2-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]phenol;
1-{4-[3-(5-oxo-4,5-dihydro-1H-1,2,4-triazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}piperidine-4-carboxamide;
1-[4-(3-imidazo[1,2-a]pyridine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]piperidine-4-carboxamide;
9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
9-phenyl-8-(4-{[4-(5-pyrimidine-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl)phenyl)-3-(1H-1,2,3-triazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyrimidine-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine; 3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
N-[2-(4-methyl-1H-imidazol-2-yl)ethyl]-N-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}amine;
N1-(2-hydroxyphenyl)-N3-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-beta-alaninemia;
1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}piperidine-4-carboxamide;
5-[({4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}amino)methyl]pyridine-2-ol;
N1N1,2,2-tetramethyl-N3-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propane-1,3-diamine;
3-hydroxy-2,2-dimethyl-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine;
2-fluoro-3-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine;
2.2-debtor-3-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine;
3-dihydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine;
4-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]cyclohexanamine;
4-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]cyclohexanamine;
3-hydroxy-2,2-dimethyl-N-{4-[3-(1-methyl-1H and idazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propan-1-amine;
3-hydroxy-2,2-dimethyl-N-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine;
3-hydroxy-2,2-dimethyl-N-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propane-1-amine;
3-hydroxy-2,2-dimethyl-N-{4-[9-phenyl-3-(1H-1,2,3-triazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}propan-1-amine;
tert-butyl{[8-(4-{[(3-hydroxy-2,2-dimethylpropyl)amino]methyl}phenyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methyl}carbamate;
N-{4-[3-(ammoniated)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-3-hydroxy-2,2-DIMETHYLPROPANE-1-amine;
[9-phenyl-8-(4-{[4-(5-pyrazin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol;
N3-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-N1-(2-hydroxyphenyl)-beta-alaninemia;
(8-{4-[(cyclohexylamino)methyl]phenyl}-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl)methanol;
N3-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-N1-(4-hydroxyphenyl)-beta-alaninemia;
[9-phenyl-8-(4-{[4-(5-pyridin-3-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanol;
1-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}piperidine-4-carboxamide;
{8-[4-(1-aminocyclopropane)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthyridin-yl}methanol;
1-[4-(9-phenyl-3-pyridin-4-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
1-{4-[3-(1-oxidability-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-[4-(3,9-diphenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
1-{4-[3-(4-forfinal)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}benzonitrile;
4-(9-phenyl-3-pyrimidine-4-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzylamine;
1-{4-[3-(1-oxidability-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
5-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}pyridine-2-ol;
1-[4-(9-phenyl-3-pyridin-3-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
4-(9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzylamine;
1-[4-(9-phenyl-3-pyridin-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
1-[4-(9-phenyl-3-pyrazin-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
1-{4-[9-phenyl-3-(1H-1,2,4-triazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[9-phenyl-3-(1,3-thiazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[9-phenyl-3-(1H-pyrazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[3-(3-methyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[3-(3-methyl-1H-1,2,4-triazole-5-yl)-9-enyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[3-(1-methyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[9-phenyl-3-(1,2,5-thiadiazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[9-phenyl-3-(1,2,3-thiadiazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-3-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methanamine;
{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methanol;
1-{4-[9-phenyl-3-(2,2,2-triptorelin)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[9-phenyl-3-(1H-tetrazol-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-carboxamide;
1-{4-[3-(1H-imidazol-1-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-(4-{3-[(methylsulphonyl)methyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine;
{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}acetonitrile;
2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethanol;
N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)ndimethylacetamide;
4-[3-(2-methylimidazo[1,2-a]pyridine-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine;
1-[4-(9-phenyl-3-pyrazolo[1,5-a]pyridine-3-yl[1,2,4]triazole is[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
1-[4-(3-imidazo[1,2-a]pyridine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-1,2-benzisoxazol-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-[4-(3-imidazo[2,1-b][1,3]thiazol-6-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
1-{4-[3-(1-methyl-1H-imidazol-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
4-[3-(1-methyl-5-phenyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine;
1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-1-benzothieno-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[3-(1-isopropyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[9-phenyl-3-(1,4,5,6-tetrahydrocyclopent[C]pyrazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-(4-{9-phenyl-3-[(2S)-pyrrolidin-2-yl][1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine;
4-[3-(1-amino-ethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine;
1-{4-[3-(1H-imidazol-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-[4-(3-cyclopropyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
1-{4-[9-phenyl-3-(trifluoromethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[3-(5-methyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-NAF is iridin-8-yl]phenyl}methanamine;
1-{4-[3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
4-[3-(1H-indol-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine;
1-{4-[3-(1-methyl-1H-imidazol-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[3-(3-methyl-2H-lambda5-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
4-[3-(6-chloroimidazo[1,2-a]pyridine-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine;
1-{4-[3-(1H-benzimidazole-2-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
4-[3-(5-cyclopropyl-4H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine;
1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-1H-indazol-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
4-[9-phenyl-3-(3-phenyl-1H-pyrazole-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine;
1-(4-{9-phenyl-3-[3-(trifluoromethyl)-1H-pyrazole-5-yl][1,2,4]triazolo[3,4-f]1,6-naphthiridine-8-yl}phenyl)methanamine;
1-[4-(9-phenyl-3-pyrazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
1-{4-[3-(1-benzyl-1H-pyrazole-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
4-[9-phenyl-3-(1-phenyl-1H-pyrazole-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine;
1-{4-[9-phenyl-3-(4,5,6,7-tetrahydro-2-benzothieno-1-yl)[1,24]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[9-phenyl-3-(5,6,7,8-tetrahydroimidazo[1,2-a]pyridine-2-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}propan-2-amine;
1-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethane-1,2-diol;
4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}imidazolidin-2-it;
(2R)-2-amino-2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}ethanol;
(2R)-2-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-2-(methylamino)ethanol);
1-{4-[3-(5-utilization-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
5-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-2,4-dihydro-3H-1,2,4-triazole-3-one;
6-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-4,5-dihydropyridine-3(2H)-she;
6-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}pyridazin-3(2H)-she;
N-(4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}phenyl)ndimethylacetamide;
1-{4-[3-(4-phenoxyphenyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[3-(1H-benzimidazole-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
(4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}phenyl)methanol;
4-[3-(4-cyclohexylphenol)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine is;
4-{8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}-1,3-dihydro-2H-imidazol-2-it;
1-{4-[3-(4-methyl-1H-imidazol-5-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
4-[9-phenyl-3-(1-propyl-1H-imidazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine;
1-{4-[3-(1-isopropyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[3-(1-butyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-[4-(3-imidazo[1,2-a]pyrimidine-2-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
5-({[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}methyl)pyridin-2-ol;
1-(6-methoxypyridine-3-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]methanamine;
N-[(2-methoxypyridine-5-yl)methyl]-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amine;
1-[4-(3-ethyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
1-[4-(9-phenyl-3-propyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanamine;
N-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide;
4-({[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}methyl)phenol;
1-[9-phenyl-8-(4-{[4-(5-pyridin-2-yl-4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl]methanamine;
9-phenyl-3-(1H-1,2,3-triazole-4-yl)-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
1-{4-[3-(1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[9-phenyl-3-(3H-lambda43-thiazol-5-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[9-phenyl-3-(1H-pyrazole-3-yl)-2H-lambda5-[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-{4-[9-phenyl-3-(1,3-thiazol-4-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
4-[9-phenyl-3-(pyrrolidin-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine;
1-{4-[3-(azetidin-1-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
1-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)piperidine-4-carboxamide;
1-{4-[3-(morpholine-4-ylmethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanamine;
2-[({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)amino]ethanol;
1-(4-{3-[(4-methylpiperazin-1-yl)methyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl}phenyl)methanamine;
4-[9-phenyl-3-(piperazine-1-ylmethyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzylamine;
N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)-N-methylamine;
N-({8-[4-(aminomethyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-yl}methyl)-N,N-dimethylamine;
[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]methanol;
{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}methanol;
1-[-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanol;
9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-methyl-9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl)piperidine-1-yl]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-3-ol;
1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropylamine;
1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}of cyclopropylamine;
1-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropylamine;
1-{4-[9-phenyl-3-(5,6,7,8-tetrahydroimidazo[1,2-a]pyridine-2-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}of cyclopropylamine;
1-[4-(9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropylamine;
1-{4-[3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}of cyclopropylamine;
(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine;
(1R)-1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine;
(1R)-1-{4-[9-phenyl-3-(5-pyridin-2-yl-1H-pyrazole-3-yl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}of ethanamine;
(1R)-1-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}of ethanamine;
(1R)-1-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}of ethanamine;
(1R)-1-[4-(9-phenyl-3-[1,2,4]triazolo[1,5-a]feast midin-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine;
(1R)-1-[4-(3-imidazo[2,1-b][1,3]thiazol-6-yl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine;
(1R)-1-[4-(9-phenyl-3-pyrimidine-2-yl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethanamine;
(1R)-1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-1-amine;
2-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-2-amine;
2-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]propan-2-amine;
3-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine;
N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-4-yl-2-furamide;
N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-3-yl-2-furamide;
N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-5-pyridin-3-yl-1H-pyrrole-3-carboxamide;
2-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide;
tert-butyl(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)carbamate;
4-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)of the research;
2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxetanone;
4-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine;
2,4-dihydroxy-6-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyrimidine;
2-(2-{[-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine;
3-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)pyridine;
N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-pyrazin-2-ylacetamide;
3-methyl-9-phenyl-8-[4-({[(pyridine-3-ylamino)carbonyl]amino}methyl)phenyl][1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
2-(2-hydroxyphenyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide;
2-(3-hydroxyphenyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide;
2-(4-hydroxyphenyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide;
2-(3,4-dihydroxyphenyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide;
N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-phenylacetamide;
3-methyl-9-phenyl-8-(4-{[(pyridine-3-ylcarbonyl)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
2-hydroxy-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]benzamide;
2-(4-hydroxyphenyl)-2-methyl-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propanamide;
methyl-4-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-4-oxobutanoate;
2-hydroxy-N-(2-{[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]amino}-2-oxoethyl)benzamide;
N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-(5-phenyl-4H-1,2,4-triazole-3-yl)ndimethylacetamide;
3-methyl-9-phenyl-8-(4-{[(chinali the-3-ylcarbonyl)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]-2-(4-oxoindole-3(4H)-yl)ndimethylacetamide;
N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]2-(2-oxo-1,3-benzoxazol-3(2H)-yl)ndimethylacetamide;
8-(4-{[(1H-benzimidazole-1-ylacetic)amino]methyl}phenyl)-3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
8-(4-{[(1H-benzimidazole-2-ylacetic)amino]methyl}phenyl)-3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
2-(4-methyl-1,2,5-oxadiazol-3-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide;
2-(1H-indazol-1-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide;
2-(5,6-dimethyl-4-oxathiane[2,3-d]pyrimidine-3(4H)-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide;
3-methyl-8-[4-({[(6-morpholine-4-espiridion-3-yl)carbonyl]amino}methyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
2-(6-chloropyridin-3-yl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide;
3-cyano-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]propanamide;
3-methyl-9-phenyl-8-(4-{[(3-pyridin-3-ylpropyl)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{[(pyridine-3-ylacetic)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
9-phenyl-3-pyrazolo[1,5-a]pyrimidine-3-yl-8-(4-{[(pyridine-3-ylacetic)amino]methyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
N-(3-hydroxy-2,2-d is methylpropyl)-N-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl]ndimethylacetamide;
N-(3-hydroxy-2,2-dimethylpropyl)-N-{4-[3-(1-methyl-1H-imidazol-4-yl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]benzyl}-2-(4-oxoindole-3(4H)-yl)ndimethylacetamide;
tert-butyl{2-[[4-(3-{[(tert-butoxycarbonyl)amino]methyl}-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)benzyl](3-hydroxy-2,2-dimethylpropyl)amino]-2-oxoethyl}carbamate;
3-methyl-9-phenyl-8-(4-{1-[(pyridine-3-ylacetic)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
3-methyl-9-phenyl-8-(4-{1-[(quinoline-3-ylcarbonyl)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
N-{1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]cyclopropyl}-2-(4-oxoindole-3(4H)-yl)ndimethylacetamide;
3-(1-methyl-1H-imidazol-4-yl)-9-phenyl-8-(4-{1-[(pyridine-3-ylacetic)amino]cyclopropyl}phenyl)[1,2,4]triazolo[3,4-f]-1,6-naphthiridine;
N-{(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}-2-pyridine-3-ylacetamide;
N-{(1R)-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}ndimethylacetamide;
N-((1R)-1-{4-[3-(hydroxymethyl)-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl]phenyl}ethyl)-2-pyridin-3-ylacetamide;
N-{1-methyl-1-[4-(9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}ndimethylacetamide; and
N-{1-methyl-1-[4-(3-methyl-9-phenyl[1,2,4]triazolo[3,4-f]-1,6-naphthiridine-8-yl)phenyl]ethyl}ndimethylacetamide;
or its pharmaceutically acceptable salt or stereoisomer.

4. Pharmaceutical composition having inhibitory action of activity is eminovoy/ser / thr kinase Akt, containing a pharmaceutical carrier, and dispersed therein a therapeutically effective amount of a compound according to claim 3.

5. The use of compounds according to claim 3 to obtain drugs that are applicable for the treatment or prevention of a malignant tumor in a mammal in need of such treatment.



 

Same patents:

FIELD: medicine.

SUBSTANCE: in formula (I) , the ring A represents 6-members aryl or 5-6-members heteroaryl containing 1-2 heteroatoms selected from nitrogen and sulphur; Q means C3-8 cycloalkyl, 5-6-members heterocycle containing 1 heteroatom selected from oxygen, nitrogen or sulphur, C1-6 alkyl or C2-6 alkenyl; the ring T represents 5, 6, 9 or 10-members heteroaryl or 9-members heterocycle optionally additionally substituted by 1-3 heteroatoms independently selected from nitrogen or sulphur. The values of other substitutes are specified in the patent claim. Also, the invention refers to methods for preparing oxime derivatives of general formula (I), to pharmaceutical compositions containing the compound of the invention as an active ingredient and to applications of the compounds of the invention in preparing a drug.

EFFECT: compounds of the invention exhibit properties of a glucokinase activator.

33 cl, 1499 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to compounds of formula

wherein Q together with carbon and nitrogen atoms whereto attached forms a 5-6-members monocyclic heteroaromatic ring; or Q together with carbon and nitrogen atoms whereto attached forms a 9-10-members bicyclic heterocycle; R1 and R2 independently mean hydrogen, halogen, alkyl, alkyl substituted by one or more halogen, alkoxygroup, alkoxygroup substituted by alkoxygroup, alkylthiogroup, sulphonyl, free or etherified carboxygroup, carbamoyl, sulohamoyl, morpholinyl or pyridinyl; or R2 is absent; R3 means (C3-C6)cycloalkyl; R4 means hydrogen, halogen, lower alkyl or lowest alkyl substituted by one or more halogen; R5 means (C3-C6cycloalkyl, (C6-C10) aryl, (C3-C10)heterocyclyl or (C1-C6)alkyl optionally substituted by (C1-C6)alkoxygroup, (C3-C7)cycloalkyl, (C6-C10)aryl or (C3-C10)heterocyclyl; R6 means free or etherified carboxygroup; and n is an integer equal to 1-6; or to its enanthiomer, or a mixture of its enanthiomers, or its pharmaceutically acceptable salt. Besides, the invention refers to a method of glucokinase activation in mammals, to a method of treating pathological conditions associated with glucokinase activation in mammals and impaired glucose tolerance, as well as to a pharmaceutical composition based on these compounds and to application of said compositions for preparing a drug.

EFFECT: there are produced and described new compounds which are activators and can be used as therapeutic agents for treating the glucokinase mediated pathological conditions.

31 cl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to a derivative of 5-substituted 7-amino-[1,3]thiazolo[4,5-d]pyrimidine of formula

and its optical isomers and pharmaceutically acceptable salts where R1 represents CH3 or CH3CH2; R2 represents H, 2-F, 2-Cl, 3-F, 3-OCN3, 3-CN, 3-CF3, 3-CONH2 or 3-SO2CH3; R3 represents H or CH3; R4 represents H or CH3; and R5 represents H; or when R4 represents CH3, R5 represents H or F. Also, the invention refers to methods for producing the compounds of formula (I) and to pharmaceutical compositions exhibiting CX3CR1 receptor antagonist properties containing the compounds of formula (I).

EFFECT: production of 5-substituted 7-amino-[1,3]thiazolo[4,5-d]pyrimidine as selective CX3CR1 receptor antagonists.

15 cl, 2 tbl, 18 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to compounds (la) of formula applied as tyrosine kinase c-Met inhibitors. , where: LA is selected from ,

or ; RA is selected from:

or each RA2 and RA6 represents hydrogen; RA3 represents RAr; or RA3, RA4 and carbon atoms whereto attached form 6-members aryl, optionally substituted, in the amount up to 4 by independent groups RAr, or a 5-6-members heterocyclyl or heteroaryl ring containing at least one O, N or S atom; R represents -OH; RA5 represents hydrogen or RAr; LB represents a covalent bond or -N(R*)-; RB represents halogen, NH2 or C1-8aliphatic group, optionally substituted by R; a 6-10-members aryl ring; a 3-7-members carbocyclyl ring, a 5-10-members heteroaryl ring containing 1-4 heteroatoms independently selected from nitrogen, oxygen and sulphur atoms, where each said aryl or heteroaryl ring is optionally substituted, in the amount up to five by independent groups RAr; R represents halogen, -R°, -SR°, Ph, optionally substituted R° or -C(O)OR°; each RAr is independently selected from halogen, -R°, -OR°, -SR°, Ph, optionally substituted in the amount up to five by independent groups -R°, -CN, -N(R°)2 or -C(O)OR°; or two adjacent groups RAr taken together, represent 1,2-methylenedixy or 1,2-ethylenedixy; each R* represents hydrogen; and each R° represents independently hydrogen, an optionally substituted C1-6aliphatic radical or an unsubstituted 5-6-members heteroaryl or heterocyclic ring containing 1-3 heteroatoms independently selected from nitrogen, oxygen and sulphur atoms.

EFFECT: invention refers to pharmaceutically acceptable compositions containing the compounds under the invention, and methods of application of the compositions in treatment of various proliferative disorders.

10 cl, 4 tbl, 548 ex, 9 dwg

FIELD: chemistry.

SUBSTANCE: invention relates to azole derivatives of formula I , where: A denotes S, O; W denotes -(C=O)-; X are identical or different and denote =C(-R)- or =N-; Y denotes -O- or -NR1-; R denotes hydrogen, halogen, (C1-C6)-alkyl, nitro; R1 denotes hydrogen; R2 denotes (C5-C16)-alkyl, (C1-C4)alkyl-phenyl, where phenyl can be optionally mono- or poly-substituted with (C1-C6)-alkyl; R3 denotes hydrogen; or R2 and R3 together with the nitrogen atom bearing them can form a monocyclic saturated 6-member ring system, where separate members of this ring system can be substituted with 1 group selected from the following: -CHR5-, -NR5-; R5 denotes (C1-C6)-alkyl, trifluoromethyl; and physiologically acceptable salts thereof. The invention also pertains to methods of producing said compounds and a medicinal agent based on said compounds.

EFFECT: novel compounds and a medicinal agent based on said compounds are obtained, which can be used as hormone-sensitive lipase (HSL) or endothelial lipase (EL) inhibitors.

12 cl, 11 ex

FIELD: chemistry.

SUBSTANCE: invention relates to novel sulphonamidethiazole pyrimidine derivatives of formula (I)

, which are glucokinase activators or to their enantiomers, mixture of enantiomers or pharmaceutically acceptable salts. The invention also relates to a pharmaceutical composition based on the novel compounds, use of the compounds to prepare a medicinal agent and to a method of activating glucokinase. In formula (I) R1 denotes (C1-C10)alkoxy, R2 denotes (C3-C6)cycloalkyl, R3 denotes hydrogen, and values of substitutes R4 and R5 are given in the formula of invention.

EFFECT: more effective use of the compounds.

33 cl, 166 ex

FIELD: chemistry.

SUBSTANCE: invention relates to a compound of formula [I-D1] or pharmaceutically acceptable salt thereof,

,

where each symbol is defined in the claim. The invention also relates to pharmaceutical compositions containing said compound and having HCV polymerase inhibiting activity.

EFFECT: disclosed compound exhibits anti-HCV activity, based on HCV polymerase inhibiting activity and is useful as an agent for preventing and treating hepatitis C.

32 cl, 497 tbl, 1129 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to derivatives of 5,7-disubstituted [1,3]thiazolo[4,5-d]pyrimidine-2(3H)-one of formula (I) where R1 represents CH3 or CH3CH2; R2 represents H, 3-CN, 2-CF3, 2-F, 3-F, 3-CF3, 3-CONH2 or SO2CH3; R3 represents H; R4 represents H or CH3; and R5 represents H; or, when R4 represents CH3, R5 represents H or F; and to its pharmaceutically acceptable salts. Also, the invention refers to a pharmaceutical composition exhibiting properties of CX3CR1 receptor antagonist containing compound (I) of formula or its pharmaceutically acceptable salt mixed with a pharmaceutically acceptable diluent or carrier.

EFFECT: enabled administration of the derivatives of 5,7-disubstituted [1,3]thiazolo[4,5-d]pyrimidine-2(3H)-one as selective CX3CR1 receptor antagonists.

13 cl, 1 tbl, 20 ex

FIELD: chemistry.

SUBSTANCE: invention relates to 3-cyclohexylaminomethylthiazole[3,2-a]benzimidazole dihydrochloride of formula I: , having immunotropic and anti-aggregation activity.

EFFECT: novel compounds have useful biological properties.

2 cl, 8 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to novel compounds which possess inhibiting properties with respect to PI3-kinase of general formula (1), where R1 is selected from group, including -NHRC, -NHC(O)Rc, -NHC(O)ORc, -NHC(O)NRcRc and -NHC(O)SRc, R2 stands for residue, optionally substituted with one or two substituents R4, selected from group, including C1-C6alkyl, C3-C8cycloalkyl, 5-6-member heterocycloalkyl with one heteroatom, selected from nitrogen and sulphur, phenyl, benzyl and 5-6-member heteroaryl, including 1-2 nitrogen atoms, R3 stands for optionally substituted with one or several substituents Re and/or Rf residue, selected from group, including phenyl and 5-6-member heteroaryl with 1-3 heteroatoms, selected from nitrogen and oxygen, R4 represents residue, selected from group, including Ra, Rb, and substituted with one or several identical or different substituents Rc and/or Rb , Ra in each case is independently selected from group, including C1-C6alkyl, phenyl, 4-7-member heterocycloalkyl with 1-2 heteroatoms, selected from nitrogen and oxygen, and 9-member heteroaryl with one atom of nitrogen as heteroatom, Rb in each case is independently selected from group, including =O, -ORc, -NRCRC, halogen, -CF3, -CN, -S(O)Rc, -C(O)Rc, -C(O)ORc, -C(O)NRcRc, -C(O)N(Rg)NRcRc, -N(Rg)C(O)Rc, -N(Rg)S(O)2Rc, -N(Rg)S(O)2NRcRc, -N(Rg)C(O)ORc and -N(Rg)C(O)NRcRc, RC in each case independently represents hydrogen or optionally substituted with one or two identical or different substituents R and/or Re residue, selected from group, including C1-C6alkyl, C3-C8cycloalkyl, C6-C9aryl, 4-7-member heterocycloalkyl with 1-2 heteroatoms, selected from nitrogen and oxygen, and 5-6-member heteroaryl with 1-2 heteroatoms, selected from nitrogen, oxygen and sulphur, Rd in each case independently represents hydrogen or optionally substituted with one or two identical or different substituents Re and/or Rf residue, selected from group, including C1-C6alkyl, C3-C8cycloalkyl, phenyl, 4-7-member heterocycloalkyl with 1-2 heteroatoms, selected from nitrogen and oxygen, and 5-10-member heteroaryl with one atom of nitrogen, Re in each case is independently selected from group, including =O, -ORf, -SRf, -NRfRf, -CN, -S(O)2Rf, -C(O)Rf, -C(O)ORf, -C(O)NRfRf and -OC(O)Rf, Rf in each case independently represents hydrogen or optionally substituted with one or two identical or different substituents Rg residue, selected from group, including C1-C6alkyl, C3-C8cycloalkyl, phenyl, 4-7-member heterocycloalkyl with 1-2 heteroatoms, selected from nitrogen and oxygen and 5-6-member heteroaryl with one heteroatom, selected from nitrogen and sulphur, Rg in each case independently represents hydrogen, C1-C6alkyl, C3-C8cycloalkyl and 4-7-member heterocycloalkyl with one nitrogen as heteroatom, as well as to their pharmaceutically harmless acid-additive salts. Invention also relates to compounds, used as intermediate products of synthesis of formula (I) compounds, pharmaceutical composition and application of compounds for preparation of medication, possessing properties of PI3-kinase inhibitor.

EFFECT: elaborated are novel compounds, which possess properties of PI3-kinase inhibitor.

11 cl, 9 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to compounds (la) of formula applied as tyrosine kinase c-Met inhibitors. , where: LA is selected from ,

or ; RA is selected from:

or each RA2 and RA6 represents hydrogen; RA3 represents RAr; or RA3, RA4 and carbon atoms whereto attached form 6-members aryl, optionally substituted, in the amount up to 4 by independent groups RAr, or a 5-6-members heterocyclyl or heteroaryl ring containing at least one O, N or S atom; R represents -OH; RA5 represents hydrogen or RAr; LB represents a covalent bond or -N(R*)-; RB represents halogen, NH2 or C1-8aliphatic group, optionally substituted by R; a 6-10-members aryl ring; a 3-7-members carbocyclyl ring, a 5-10-members heteroaryl ring containing 1-4 heteroatoms independently selected from nitrogen, oxygen and sulphur atoms, where each said aryl or heteroaryl ring is optionally substituted, in the amount up to five by independent groups RAr; R represents halogen, -R°, -SR°, Ph, optionally substituted R° or -C(O)OR°; each RAr is independently selected from halogen, -R°, -OR°, -SR°, Ph, optionally substituted in the amount up to five by independent groups -R°, -CN, -N(R°)2 or -C(O)OR°; or two adjacent groups RAr taken together, represent 1,2-methylenedixy or 1,2-ethylenedixy; each R* represents hydrogen; and each R° represents independently hydrogen, an optionally substituted C1-6aliphatic radical or an unsubstituted 5-6-members heteroaryl or heterocyclic ring containing 1-3 heteroatoms independently selected from nitrogen, oxygen and sulphur atoms.

EFFECT: invention refers to pharmaceutically acceptable compositions containing the compounds under the invention, and methods of application of the compositions in treatment of various proliferative disorders.

10 cl, 4 tbl, 548 ex, 9 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: there is described new macrocyclic compound of general formula 1-c:

and its pharmaceutically acceptable acid or base addition salts or its stereoisomers (the radical values are presented in the patent claim).

EFFECT: producing the compounds which are hepatitis type C virus inhibitors and can find application in medicine.

9 cl, 1 tbl, 95 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to condensed heterocyclic derivative, represented by formula (I): where ring A represents 5-member monocyclic heteroaryl, containing 1 or 2 heteroatoms, selected from N or S; RA represents lower alkyl group, optionally substituted with hydroxyl group, COW1, COOW1 or CONW2W3, in which W1-W3 independently represent a hydrogen atom or lower alkyl group; m represents integer 0 or 2; ring B represents benzene ring or thiophene ring; RB represents halogen atom, cyano group, lower alkyl group or OW4, in which W4 represents a hydrogen atom or lower alkyl group; n represents integer 0-2; E1 represents an oxygen atom; E2 represents an oxygen atom; U represents a single bond or lower alkelene group; X represents group, represented by Y, -CO-Y, -SO2-Y, -S-L-Y, -O-L-Y, -CO-L-Y, -SO-L-Y, -SO2-L-Y, -S-Z or -O-Z, in which L represents a lower alkylene group optionally substituted with halogen or hydroxy group; Y represents group, represented by Z or -NW7W8, where W7 and W8 independently represent a hydrogen atom, lower alkyl group or Z on condition that W7 and W8 are not simultaneously hydrogen atoms, or W7 and W8 can bind together with adjacent nitrogen atom with formation of cyclic amino group; Z represents cycloalkyl group, optionally condensed with phenyl and optionally substituted with phenyl group, optionally substituted with halogen or alkoxy group; 6-8-member heterocycoalkyl group, which has 1 heteroatom, selected from nitrogen atom or oxygen atom, optionally condensed with phenyl and optionally substituted with phenyl; phenyl group optionally substituted with a substituent, selected from group, consisting of a halogen atom, cyano group, alkyl group, optionally substituted with halogen atom, hydroxy group or alkoxy group, alkoxy group, optionally substituted with halogen atom, hydroxy group, alkoxy group, alkoxy-carbonyl-oxy group or acyloxy group, alkylthio group, carboxy group and alkoxy-carbonyl group; pyridyl; or its pharmaceutically acceptable salt. Invention also relates to pharmaceutical composition possessing antagonistic activity with respect to gonatotropin-releasing hormone, based on the claimed compound.

EFFECT: obtained are novel compounds and based on them pharmaceutical composition, which can be applied in medicine for prevention or treatment of a disease depending on sex hormones, which is selected from group, consisting of benign prostatic hypertrophy, hysteromyoma, endometriosis, premature puberty, prostate cancer, ovarian cancer and breast cancer.

29 cl, 112 tbl, 428 ex

FIELD: chemistry.

SUBSTANCE: invention relates to a novel crystalline form of a compound of formula (I), which has P2T antagonist properties and can be used to prevent arterial thrombotic complications in patients suffering from coronary artery disease, cerebrovascular and peripheral vascular diseases. The crystalline form of compound (I) is essentially a pure polymorph II, which is essentially in anhydrous form and which is characterised by X-ray powder diffraction pattern, having characteristic base peaks of high intensity at 5.5°(±0.1°), 13.5°(+0.1°), 18.3°(±0.1°), 22.7°(±0.1°) and 24.3°(±0.1°) 2θ, and has characteristic peaks at 5.5°(±0.1°), 6.8°(±0.1°), 10.6°(±0.1o), 13.5°(±0.1°), 14.9°(±0.1°), 18.3°(±0.1°), 19.2°(±0.1°), 22.7°(+0.1°), 24.3°(±0.1°) and 27.1°(±0.1°) 2θ. The differential scanning calorimetry curve of the said crystalline polymorph has melting onset point in the range of 136-139°C.

EFFECT: invention also relates to a method of producing the disclosed polymorph, according to which a compound of formula (I) is crystallised from chloroform.

9 cl, 6 dwg, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to compound of formula 2: and to its pharmaceutically acceptable salts and their mixtures, where values of R, M, Q, Z, W, D radicals are described in i.1 of the invention formula. Invention also relates to pharmaceutical compositions, which possess inhibiting activity with respect to Btk, based on formula 2 compounds.

EFFECT: obtained are novel compounds and based on them pharmaceutical compositions which can be applied in medicine for treatment of patients with diseases associated with inhibiting Btk activity and/or B-cell activity.

55 cl, 19 ex

FIELD: chemistry.

SUBSTANCE: in formula I' , R denotes -(C=Q)R2a, CN or Y; Y denotes phenyl, or ; Q denotes O; R2a denotes phenyl, OR5 or N(R5)2; R1 denotes H; Z denotes a bond; R3 and R4 denotes H, halogen, C1-6alkoxy, N(R5)2 or Um-V, where m equals 0 or 1; V denotes H, phenyl, 5-6-member heteroaryl containing up to two nitrogen atoms, 5-6-member heterocyclyl containing up to two heteroatoms selected from N or O, or C1-6aliphatic group; U denotes a C1-6alkylidene chain, where up to two methylene links of the chain may be substituted with -CO2-, -C(O)-, -C(O)NH-, -C(O)NR5; R5 denotes H, C0-6alkykphenyl or C1-6aliphatic group, or two R5 groups, taken together with an atom to which they are bonded are optionally bonded to form a 5-7-member heterocyclic ring containing 1-2 heteroatoms selected from N, O or S; JY is selected from N(R9)2, SR9, OR9, halogen, CN, COOR9, -X-OH, phenyl, -X-phenyl, 5-6-member heteroaryl containing up to two nitrogen atoms, -X-(5-6-member heteroaryl containing up to two nitrogen atoms) or X; X denotes a C1-12aliphatic group; R9 denotes H, C1-6aliphatic group, phenyl, C3-6cycloaliphatic group, 4-6-member heterocyclyl containing up to 2 nitrogen atoms. Invention also relates to a pharmaceutical composition and a method of inhibiting Tec or c-Met kinase activity.

EFFECT: high inhibiting activity towards Tec or c-Met kinase.

16 cl, 11 tbl, 20 ex

FIELD: chemistry.

SUBSTANCE: invention relates to compounds of formula (I) or pharmaceutically acceptable salts, solvates or tautomers thereof, where substitute M is selected from groups D1 and D2, having structural formulae given below, and R1, E, A and X are as described in the formula of invention. Disclosed also are pharmaceutical compositions which contain these compounds, methods for synthesis of these compounds, intermediate compounds and synthesis methods thereof, as well as use of compounds of formula (I) in preventing or treating diseases mediated by CDK kinases, GSK-3 kinases or Aurora kinases.

EFFECT: high effectiveness of the compounds.

40 cl, 8 dwg, 18 tbl, 84 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: described are new compounds of general formula (I): het-X-AB (I) where het is pentamerous N-heteroaryl, additionally containing one O, S or N atom as a heteroatom with heteroaryl with additional O atom being condensed with a benzene ring, or hexamerous N-heteroaryl; X means S; and where N-atom of N- heteroaryl residue and an X group are separated by one carbon atom; AB means 1,2,3-triazolo[4,5-d] pyrimidine-7-yl radical of general formula (II): where R3 is C1-8alkyl, phenyl, benzyl optionally substituted; R5-H, C1-8alkyl or phenyl.

EFFECT: production of new compounds for preparing a pharmaceutical composition either effective for treating cardiovascular, cancer, autoimmune diseases, stroke, neurodegenerative diseases, cystic fibrosis, or used in antithrombotic therapy.

9 cl, 11 ex, 3 tbl

FIELD: chemistry.

SUBSTANCE: invention relates to novel 5,7-diamino-substituted pyrazolo[1,5-a]pyrimidines selected from specific compounds, e.g. those given below, which have cyclin-dependent kinase inhibiting properties, such as CDK2. The compounds can be used to treat diseases and conditions associated with CDK, such as proliferative diseases, leukaemia.

.

EFFECT: more effective use of the compounds.

12 cl, 87 tbl, 1057 ex

FIELD: chemistry.

SUBSTANCE: invention describes novel benzotriazole UV ray absorbers of general formula (I): (values of radicals are given in the description), having an absorption spectrum which is shifted towards the long-wave region with considerable optical density to 410-420 nm, as well as a UV radiation stable composition which contains novel UV ray absorbers, and use of the novel compounds as UV radiation stabilisers when applying coating on automobiles.

EFFECT: improved composition.

9 cl, 6 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: there are described new compounds of general formula

where Xa represents 2 to 4 condensed cycloalkyl, aryl, heterocyclic rings containing 1 to 2 heteroatoms, chosen of N and O, and heteroaryl rings containing 1 to 4 heteroatoms, chosen of N, O or S where said rings can be additionally substituted. (Radical values R1-R4, R1, Y and n are specified in the patent claim), specific representatives of said compounds and a pharmaceutical composition containing them.

EFFECT: new compounds are effective in stimulation of endogenous development or release of growth hormone and can be used in treating obesity, osteoporosis and for increasing muscle bulk and muscle strength.

17 cl, 339 ex, 10 tbl

Up!