Novel application of recombinant adenovirus p53 to treat cancer patients

FIELD: chemistry; biochemistry.

SUBSTANCE: invention concerns biotechnology and health care. Recombinant adenovirus p53 is capable of lowering side effects of the type caused by anti-tumour chemotherapy and radio-therapy. In cancer patients, recombinant adenovirus p53 can restore operation of organs, including blood analysis, liver functioning, kidney functioning etc in order to improve the quality of life of patients, for example improvement of appetite, mental status and the like.

EFFECT: invention can be used in medicine.

19 cl, 7 dwg, 4 tbl, 5 ex

 

The scope of the present invention

The present invention relates to methods of improving the quality of life of subjects suffering from cancer, as well as reducing the side effects induced by anticancer therapy, such as chemotherapy, radiotherapy and other therapies, the impact of which is subjected to the specified entities.

Background of the present invention

Cancer is the leading cause of death in animals and humans. Standard types of modern cancer treatment include surgery, radiotherapy and chemotherapy. Despite advances in cancer treatment each method of treatment has serious side effects. For example, surgery is distorted by the patient or disrupts the normal functioning of the body. Chemotherapy or radiotherapy may cause the patient's symptoms, weakening it, such as nausea, diarrhea, hypersensitivity to light, hair loss, etc. Side effects of these cytotoxic compounds often limit the frequency and dosage, in which they can be applied.

In biochemical and physiological analyses indicators of these side effects can be leukocytes, hemoglobin, aspartate aminotransferase, alanine aminotransferase. The results of these analyses show that biochemical and physiological parameters of patients, alocasia chemotherapy and radiotherapy, reach the lower border of the same parameters for control patients not receiving anti-tumour therapy. Often cancer patients suffer from side effects of chemotherapy or radiation therapy. In some cases, the pain and suffering of the patient caused by these side effects even more than the actual cancer.

Currently, there were many attempts to reduce the serious side effects of cancer treatment.

U.S. patent No. 6,479,500 reveals the structure and effectiveness of chemical agents, which may reduce side effects induced by anticancer agent.

U.S. patent No. 5,017,371 describes the use of interferon to reduce the toxic side effects associated with radiation therapy or chemotherapy.

In U.S. patent No. 6,462,017 describes ways to reduce the severity of side effects in cancer patients by the use of chemotherapy α-thymosin. Thus, it is obvious that there is a great need to develop new and effective ways of reducing the side effects of cancer treatment in order to improve the quality of life of cancer patients and helping them to take the full course of chemotherapy or radiation therapy.

Summary of the present invention

According to present the invention, the method of administration of an effective amount of recombinant adenovirus p53 in combination with conventional anticancer treatment can effectively reduce the side effects of cancer treatment (type chemotherapy and radiotherapy) in patients receiving it. The weakening of the side effects should improve the quality of life of such patients. The results of the biological, physiological and biochemical tests can prove this improvement.

According to the present invention by way of introduction only recombinant adenovirus p53 is able to improve the quality of life of cancer patients. Indicators of this improvement, cancer patients can be identified to improve appetite and sleep, more energy, reduce pain and needed weight gain.

Brief description of drawings

For further description of the characteristics, advantages, purposes and other aspects of the present invention the details above its summary will be illustrated by the accompanying drawings, included in the present invention. However, it should be understood that these drawings are only illustrative and are not intended to limit the scope of the present invention.

Figure 1 schematically represents the process of constructing recombinant adenovirus p53 according to the present invention.

Figure 2 is a flowsheet of protocols obtain recombinant adenovirus p53.

Figure 3 gives the results of electrophoresis on agarose gel of PCR product amplification genetic forms of p53. As matrix ispolzovaniem p53, and as primers - 5'CCACGACGGTGACACGCTTC and 5'CAAGCAAGGGTTCAAAGAC that illustrates the stability of recombinant adenovirus p53. A DNA fragment containing 1400 base pairs was obtained from PCR amplification of p53 gene. Lane 1: standard molecular weight markers DNA; lanes 2, 3 and 4: the results of PCR amplification of cDNA of p53.

Figure 4 represents the results of Western blotting of recombinant adenovirus p53 extracted 36 hours before subjected to lysis of the cells that survived the transfection of the recombinant adenovirus p53. Cells that undergo transfection, were cancer cells larynx man ner-2, and nemelka cancer cells H1299. Lane 1: standard molecular weight markers protein; lanes 2 and 3: negative control cells ner-2 and H1299, respectively, which were not subjected to transfection with recombinant adenovirus p53 (Ad-p53); lanes 4 and 5: cell ner-2 and H1299, respectively, which were subjected to transfection with recombinant adenovirus p53 (Ad-p53).

Figure 5 is a curve showing the effect of cytolysis recombinant adenovirus p53 in cells ner-2. Cells ner-2 were cultured on 6-cellular plates until they reach the density component of the cell 1×106. For transfection of these cells at different time points (24, 48, 72 and 96 h) was administered Ad-p53; the multiplicity of infection was 100. Akrasian the e cells was Trifanova blue and then calculated the percentage of blue (dead) cells.

6 shows the scheme of clinical observations of the effects of recombinant adenovirus p53 antitumor treatment and ways to assess this impact.

Detailed description of the present invention

In clinical trials of patients with tumors of various types (type scale-like head and neck cancer, nemelka cancer cells, lung cancer, thyroid cancer, ovarian cancer, etc.) was administered recombinant adenovirus p53. Regardless of its ability to suppress cancer, it was found that the recombinant adenovirus p53 is also able to reduce the side effects caused by conventional chemotherapy and radiation therapy, as well as to improve the quality of life of cancer patients. Next we describe the structure of recombinant adenovirus p53 and its clinical application. The selected recombinant adenovirus p53 is a commercially available product under the brand name of Gendicine (Gendicine).

1. p53 and p53 mutations in cancer

At present recognize p53 gene is a suppressor of cancer (Montenarh, M., 1992). Increased expression was detected in many cells transformed by chemical carcinogenesis, UV-irradiation, as well as certain viruses, including SV40. Gene p53 is a private target mutational inactivation of various forms of human cancer, and by now there are reports about it as the gene most frequently mutated in cancer cells (Mercer, 1992). Mutation of p53 occurs in more than 50% nemelka cell lung cancer (Hollestein et al., 1991).

Gene p53 encodes a phosphorylated protein of 293 amino acid residues that can bind large T-antigen and protein EW. Expression of p53 protein detected in healthy tissues and cells, but it is lower than in transformed cells or in cancer cells. Interestingly, p53 nematanthus type plays an important role in the regulation of growth and cell division. On certain lines of cancer cells overexpression of p53 nematanthus type demonstrated the effect of preventing their proliferation. Thus, p53 can act as a negative regulator of cell growth (Weinberg,1991) and can directly inhibit the uncontrolled growth of cells or suppress it indirectly by activating target genes located below the selected area. Thus, the absence of nematanthus p53 or its inactivation may contribute to the continuous transformation. However, some studies have shown that the presence of mutant p53 may be necessary for the full expression of the transforming possibilities of a gene.

Nematanthus p53 is defined as a very important growth regulator in many types of cells because of the role of genetic and biochemical characteristics. For normal p53 mutations with changes in meaning, and they are important for the transforming ability of the oncogene. A single genetic change driven by point mutation, can create carcinogenic p53. However, unlike other oncogenes, point mutations of p53 occur in at least 30 codons, and they represent a dominant mutation that can make shift cell phenotype without integration in the homozygous mutation. In addition, it was found that many of these dominant negative alleles are tolerant to the body and transferred to the germ line cells. Discovered various mutant alleles of p53 functional changes from minimally dysfunctional to the dominant (Weinberg,1991).

Casey colleagues reported that transfection of DNA that encodes nematanthus type p53, in two cell lines breast cancer restored growth inhibition in these cells (Casey et al., 1991). A similar effect was demonstrated by transfection nematanthus type p53 in cell lines of cancer of the larynx person (Takahashi, et al., 1992). Nematanthus type p53 was dominant over the mutant gene, and transfection in cells with mutant p53 have to specifically inhibit cell proliferation. In cells with endogenous p53 was observed normal expression affected by transfection nematanthus type p53, and had no effect on the growth of such cells. Thus, according to this izopet is of such constructs can without side effects to be used by healthy cells.

Therefore, a cancer associated with p53 mutation, can be treated using nematanthus type p53 in order to reduce the number of malignant cells. However, the above studies are far from achieving this goal, at least due to the fact that transfection of DNA cannot be used for introducing DNA into cancer cells of the patient in vivo.

2. Method of gene therapy

To date, there have been several experimental approaches to gene therapy. However, as it turned out, each of them had certain disadvantages (Milligan, 1993). When the above-mentioned basic way transfection the DNA fragment containing the gene of interest was introduced into the cell a non-biological way, such as by penetration through the cell membrane physically or chemically. Therefore, this approach is limited to the treatment of such cells, like lymphocytes, which may be temporarily separated from the body and able to be tolerant to the cytotoxicity caused by this treatment. Liposomes or proteins, merged with certain lipids and infofilename peptides, can be used for transfection, however, the effectiveness of integration of the gene remains very low, constituting about one integration 1000-100000 cells, and expression of unwavering transfection of genes is often limited days (in the fast-growing cells) or n is DELAMI (in cells not growing fast). It is obvious that the transfection of DNA is not a method suitable for the treatment of cancer.

The second approach uses the natural ability of viruses within the cell and make it the target gene together with some of its own genetic material. Retrovirus, due to their ability to integrate their genes into the DNA genome of the host, transferring a large number of alien genetic material, infects a large range of species and cells and uses packaging cell lines for their production and packaging; it is treated as a vector of expected delivery of the gene. However, the practical application of retrovirus difficult three problems. First, retroviral infectivity depends on the availability of viral receptors on the surface of target cells. Secondly, retroviruses integrate seamlessly only autoreproduction cells. And, in conclusion, to concentrate and purify retroviruses difficult.

3. Construction of adenovirus for gene therapy

The human adenovirus is a virus with the double helix of DNA, the size of its genome are approximately 36 KB (Tooza,1981). Adenoviruses were used extensively and satisfactorily described as a model to study the expression of eukaryotic gene; this makes them an attractive candidate for RA is the development of gene transfer systems. This group of viruses are easy to grow and easy to manipulate, they have a wide range of hosts in vivo and in vitro. In lytic infected cells adenoviruses are able to turn off the synthesis of "host" protein, while directing the cellular mechanism for the synthesis of large quantities of viral protein by replicating and copious quantities of the virus.

Region E1 adenoviral genome contains genes EA and EB that encode proteins capable of transcription regulation of viral genome, as well as several genes of the cells of the host. Area E2 contains genes EA and EB and coded her protein products (type DNA-binding protein, DNA polymerase and terminal protein as primers for replication, replication competent virus. The gene products EZ contain immune release of adenoviruses and prevent the attack cells of the host cytotoxic T-cells and, as a consequence, destruction; therefore, play an important role in the survival of the virus and its spread. In the end, the functions of the various E proteins associated with DNA replication, late gene expression and disabling certain functions of the cells of the host. Products of late gene expression include most of the virion capsid proteins which are expression only after replication of adenovirus substantially completed and Primerose MLP. MLP demonstrates high efficiency in initiating transcription at the late phase of adenovirus infection (Stratford-Perricaudet and Perricaudet, 199la).

As for CIS-activation required only a small part of the viral genome (Tooza, 1981), the vectors derived from adenovirus, can offer insertion space for the replacement of large DNA fragments produced in 293 cells. Line 293 kidney cells of a human embryo, held Ad5-transformation (Graham et al., 1977) capable of TRANS-activating elements for replication and packaging of adenoviral vectors. Therefore, the characteristics of adenovirus make it a good candidate for gene therapy of tumors in vivo (Grunhaus and Horwitx, 1992).

Particular advantages of an adenovirus delivery of foreign proteins to the cell are that: (i) it has the ability to substitute relatively large areas of viral DNA alien DNA; (ii) structure of recombinant adenovirus stable; (iii) it is safe for injection of adenovirus to humans; (iv) there is no information about the interaction of adenoviral infection with cancer or malignancies; (v) possible production of adenovirus with high titers; (vi) the adenovirus has a high infectivity.

An adenoviral vector has a higher level of exogenous exp is ASCII compared with the retrovirus vector, and replication of the adenovirus does not depend on the replication of the gene of the host. Since the transformed genes region E1 adenovirus can be easily destroyed and have no impact on the efficient expression of exogenous genes, suggest that the carcinogenic risk of adenovirus vector void (Grunhaus and Horwitx, 1992).

Usually the transmission system gene of adenovirus is a recombinant adenovirus was constructed by genetic engineering and the driven state of the replication-competent state by deletion of the region E1 of its genome, still retaining its competence in relation to infections. When in the genome of adenovirus has been further deletions, it may be an expression of a relatively large exogenous genes. For example, the adenovirus with a deletion in the region E1, and in the field EZ is capable of carrying up to 10KB of exogenous DNA, and can be grown to high titers in 293 cells (Stratford-Perricaudet and Perricaudet. 199la). It was also reported surprisingly stable expression of exogenous genes after adenoviral infection.

Mediated by adenovirus gene transfer has recently been evaluated as a means of mediating gene transfer in eukaryotic cells and in laboratory animals. For example, it was found that treatment of mice suffering from deficit infintessimally (OTS) (disease, pre is maintained by a rare recessive genetic disorder), the adenovirus vector can be used for delivery of a normal gene of the enzyme OTS. Unfortunately, OTS has reached the target in only 4 cases out of 17 (Stratford-Perricaudet and Perricaudet. 199la). Therefore, most laboratory animals this defect was corrected only partially and did not lead to any physiological or phenotypic changes. These results obviously slightly stimulated by the use of adenovirus vectors in the treatment of tumors.

Studies on the use of adenovirus for gene conversion controller tsistnoy fibrosis transmembrane conductance (CFTR) epithelium of the lungs of rats for the treatment tsistnoy fibrosis were only partially successful, but to assess biological activity of the gene transferred into the epithelium of animals, it was not possible (Rosenfeld et al., 1992). These studies again showed that the expression of CFTR protein in cells of the Airways of the lungs has not given any physiological effect.

These results do not show that the adenovirus is able to send sufficient endogenous expression in infected cells in order to achieve a physiological effect; and so the researchers do not intend to use the system of adenovirus in cancer therapy. In addition, prior to the present invention there was a General opinion that p53 may not be included in the packaging cells, the COI is lsemaj upon receipt of recombinant adenovirus, because it is toxic to these cells. As held earlier expression of E1 protein of an adenovirus binds to the p53 protein, it was assumed that there must be a technical reason why the adenovirus vector and p53 gene are not able to connect.

4. The construction of Ad-p53 and tumor suppression

The present invention provides a new and more effective suppressor of tumors, as well as a vector for gene therapy of tumors. This recombinant virus takes advantage of adenoviral vectors, such as high titer, wide range of targets, efficient transduction and necklacesthe in target cells. In particular, the present invention provides independent cell-helper adenovirus defective replication, which provides the expression of nematanthus type p53 (Ad5SV-p53), the process is under control of the rous sarcoma virus (Rous Sarcoma Virus) promoter.

The regulatory functions of the expression vectors often get viruses, if you want the expression of exogenous genes in mammalian cells. For example, the standard promoters obtained from polyoma, adenovirus 2 and monkey virus (SV-40). You can also use smaller or larger fragments of the virus SV-40, provided that they contain a sequence of approximately 250 nucleotide bases from the HindIII site to the NRA is the t site BgII, located in the original replication. These 250 nucleotide bases can be stored or, if necessary, destroyed. In addition, it is also possible and often desirable, to utilize promoter or control sequences normally associated with the chosen gene target, provided such control sequences are compatible with the system host cell.

Initial replication can be provided from an exogenous source, derived from SV40 or other sources (for example, polyoma, adenovirus, herpetic stomatitis virus VSV virus, bovine papillomas BPV), or obtained through chromosomal replication mechanism of the host cell. If the vector integrates into the chromosome of the host cell, this is often significant.

Figure 1 shows the recombinant adenovirus p53. In this regard, developed an improved construction Protocol and identification of such a recombinant adenovirus. After identifying the structure of recombinant adenovirus p53 was confirmed by PCR. After selection and confirmation of its structure adenovirus p53 was used to infect cancer cells Near larynx and nemelka cancer cells H1299 lung that have "broken" homologous gene p53. The results of West blotting showed that exogenous p53 protein is exposed to a high step is no expression.

These studies show that recombinant adenovirus p53 has tumor suppressor properties, which are manifested in the restoration of the tumor cells the function of p53. These results may support the use of the virion Ad5RSV-p53 as a therapeutic agent for cancer therapy.

As a new transmission system gene recombinant adenovirus has a large number of potential applications in gene therapy, as well as in vaccine development. Therefore, the propagation of recombinant adenovirus is an important tool in molecular biology. Modern methods of propagation of recombinant adenovirus include transfection of 293 cells, mediated by precipitation of calcium phosphate with subsequent analysis of belascoaran on cells that have undergone transfection. Transfection effectively associated with this method, needs improvement, and her method requires simplification.

5. An improved Protocol weakening side effects caused by chemotherapy and radiotherapy

Over the last 20 years have been significant research in the field of treatment of tumors. Developed numerous approaches to the treatment of tumors. As a practical ways they include the use of many methods, including surgery, radiotherapy, patients default is s, bone marrow transplantation for treatment of patients with several types of hematological malignancies, particularly acute granulocytes leukemia), traditional Chinese herbal medicine, etc. the Protocol used to treat a specific type of malignant tumors depends on its nature, location, and type of disease. For the treatment of tumors, the most preferred method of treatment remains surgery, and it is used as a primary therapy for almost 60% of tumors. However, for a complete treatment Protocol surgical excision is often combined with radiation therapy and/or chemotherapy. If the cancer is not localized, or if its localization reduces the chance of successful removal or excision surgical manner, often use a combination of chemotherapy and radiotherapy.

Chemotherapy has demonstrated its effectiveness for the treatment of certain types of cancer, including disease Hodgkin, acute leukocyte and granulocyte leukemia, testicular cancer, lymphoma, other than lymphoma Hodgkin, and the like. For other types of tumors chemotherapy effectively used before surgery to reduce the size of tumors. Chemotherapy often use a combination of chimioth rapeutically funds. The medical community is continually developing and testing new treatment protocols.

However, the antineoplastic agents are drugs that, in addition to the destruction of cancer, can damage healthy tissue. Even with intensive studies conducted to determine the dosage and schedule of administration of drugs, chemotherapy often leads to unpleasant and sometimes dangerous side effects caused by the toxicity of the drugs. Similar problems arise with radiation therapy. The most common side effects are nausea, loss of appetite, alopecia and suppression of the bone marrow. Usually, but not always, these side effects are reversible. Some anticancer drugs can be harmful to the nervous system, heart, lungs, liver, kidneys, gonads and other organs. Some of the chemotherapeutic agents carcinogenic by themselves. Patients receiving radiotherapy or chemotherapy, can also to take preventive means or means intended to prevent life-threatening infections resulting from immune status induced by anticancer therapy.

Some strategies have been designed treatment the Oia in order to neutralize the side effects of radiotherapy and chemotherapy. For example, weakening of nausea you can use some medicines against infectious diseases can help antibiotics or being in a laminar air environments, to increase the number of hemocytes and platelets can be produced transfusion, etc.

Possible classification of chemotherapeutic agents that play an important role in the treatment of tumors in humans. Such chemotherapeutic agents include, but are not limited to, alkylating tools, antimetabolites (e.g., analogs of pyrimidine), radioactive isotopes (e.g., phosphorus and iodine), hormones (estrogen and adrenocorticosteroid), mixed funds (e.g., hydroxyurea) and natural products (for example, paclitaxel, vincaleukoblastine and antibiotics). Despite the fact that these tools are not curative, but in medicine they are recognized as useful for suppression, masking, braking and control of malignant tumors. Since it was found that these compounds are effective, and usually they find clinical application as a means of preventing proliferation, the disadvantages associated with their introduction as anticancer agents, are well recognizable. Alkylating agents have a noticeable cytotoxic effects, and the ability of these drugs the military means to inhibit the mitosis and proliferation of healthy cells can be lethal factor. Antimetabolites can lead to anorexia, progressive weight loss, depression and coma. Long-term administration of antimetabolites can cause severe suppression of the work of the bone marrow. As alkylating means, and antimetabolites usually have a dampening effect on the immune system. Prolonged use of natural products can also cause suppression of the work of the bone marrow. Hydroxyurea and other chemical derivatives can lead to rapid recovery adrenocorticosteroids and their metabolites. Introduction hormonal compounds or radioactive isotopes is also undesirable from the point of view of harm to the immune system, and thus, depriving the body's ability to resist common infections. In most cases it would be preferable to the use of chemotherapeutic agents that are effective for control, delay or suppression of malignant tumors, while simultaneously stimulating the immune system of the patient and providing assistance.

Tools of chemotherapy can be given or in the form of single dose, or as multiple large doses or, more commonly, you can give them small doses 1-4 times per day and continue for up to several weeks or months. For the treatment of cancer use a lot cytotoxic funds, but the tavern is ZM their actions are usually not very clear.

Regardless of the mechanism is known chemotherapeutic agents know that they damage and destroy cells into the tumor and healthy tissues. Successful application of chemotherapeutic agents in the treatment of tumors depends on the differential destruction of the specified tool tumor cells compared with its side effects on healthy tissues. Destruction of hepatocytes and lymphocytes can cause infection. Acute and chronic toxicity of destruction of the bone marrow are also the main factors limiting the use of chemotherapeutic agents in the treatment of tumors. They are both associated with reduced numbers of hematopoietic cells, and caused the destruction of these cells to cytotoxic drugs or irradiation. Such effects lead to the depletion of components of the bone marrow, thus contributing to the differentiation of stem cells by reverse mechanism and thereby reducing their total number (U.S. patent No. 5,595,973). Stimulators and inhibitors of the kinetics of bone marrow play an important role in the induction processes of destruction and recovery (Tubiana et al., Radiotherapy and Oncology, 29:1,1993).

Preventing side effects of chemotherapy or protection from them were a great success for cancer patients. However, numerous attempts to reduce these side effects were not successful. the respect life-threatening side effects, efforts were concentrated on reducing the dose and schedule of administration. In order to increase the number of healthy cells before chemotherapy treatment is available other possibilities, such as the use of colony-stimulating factor granulocyte (G-CSF), growth factor granulocyte-macrophage-CSF (GM-CSF), epidermal growth factor (EGF), interleukin-11, erythropoietin, thrombopoietin, factor in the reproduction and growth of megakaryocytes, growth factors, stem cells, FLT-ligand, and interleukin 1,3,6 and 7 (Jimenez and Yunis, Cancer Research, 52:413-415; 1992). Protection mechanisms with the help of these factors are still not fully understood, but most likely they are associated with the increase in the number of healthy target cells before chemotherapy, but not with an increase in the viability of the cells after chemotherapy.

During anticancer treatment is often due to cytotoxic chemotherapy, there is an acute myelosuppression, and it is determined as a factor limiting the dose of this treatment (U.S. patent No. 5,595,973). Although adverse effects may be given to healthy tissue, the bone marrow is particularly sensitive to the specific treatment (such as chemotherapy and radiotherapy), counter proliferation. For some cancer patients the toxicity of disorders caused by chemotherapeutics, often limits the possibility of increasing doses of chemotherapy. Repeated cycles of x is the treatment or high doses may be responsible for the strong depletion of stem cells, leading to long hypofunction of haematopoiesis and bone marrow depression.

The methods disclosed in the present invention, suitable for use in conjunction with chemotherapeutics. These funds can be any drug, including (but not limited to, cyclophosphamide, Taxol, 5-fluorouracil, cisplatin, methotrexate, citizenoriented, mitomycin C, prednisone, bendectin, carboplatin and vincristine. Cytotoxic agent may be an antimicrobial agent capable of destroying enlarged cells. The discussion used in cytotoxic chemotherapy funds contained in the work Sathe, M., et al., Cancer Chemotherapeutic Agents : Handbook of Clinical Data (1978).

The methods of the present invention is also particularly suitable for patients who need repeated or high doses of chemotherapy or radiotherapy. For some cancer patients, the toxicity caused by chemotherapeutics, often limits the possibility of increasing doses of chemotherapy. Repeated cycles of chemotherapy or high-dose may be responsible for the strong depletion of stem cells, leading to long hypofunction of haematopoiesis and bone marrow depression. The methods of the present invention in combination with the use together with chemotherapy to reduce the death the property, as well as increasing the number of hemocytes.

The active drug may be introduced by any convenient means, including (but not limited to) local intratumoral injection, intraperitoneal injection, intracavitary infusion, intrabronchial installation, injection into the hepatic artery, installation in a peripheral vein, etc. are All ways of introducing safe and effective. The currently recommended way of introduction is local intratumoral injection. Within this injection can be used standard vectors, pharmaceutical diluents and fillers.

The active drug can be prepared in the form of a solid form (granules, powders or suppositories, and the like) or liquid form (solution, suspension or emulsion, and the like), and it can be dissolved in various solutions, which must be aseptic and to contain a sufficient number of peptides to be harmless for the recommended applications to be highly stable under these conditions, however, may deteriorate under the action of strong acids or bases.

The dosage of active drug depends on many factors, such as tumor type, age, weight, sex and General health of the subject, the extent of the disease, the route of administration of the medicinal product and its composition.

Most predpochtite the flax local intratumoral injection in a dosage of 1×10 7VP to 7×107VP (maximum tolerant dose not specified). Currently, clinical trials are typically used weekly dose of 1×1012VP. This dosage is sufficient for the drug showed maximum therapeutic effect with minimal dose of agonist. This mode can minimize the cost of treatment and potential side effects.

In the most preferred embodiments, local injection with a weekly dose of 1×1012VP can be applied for 72 h before chemotherapy or radiotherapy. In other embodiments, the drug can be reused in multiple courses of treatment. Preferably, the blood cells (leukocytes, platelets and neutrophils) was restored to the level required for the next chemotherapy course of treatment, and that the next course was started immediately after the previous one.

In addition to the active ingredients of the pharmaceutical composition may also contain pharmaceutically suitable carriers including excipients and auxiliaries that facilitate the inclusion of the active compounds used in the recipe. Other details of the method of preparation can be found in the latest edition Remington''s Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa).

The following examples in more detail and describe the sludge is astronout the present invention, but they should not be considered limiting scope of the present invention.

Examples

Example 1. Getting gendicine (Gendicine) - preparation of recombinant adenovirus p53

Was prepared by the recombinant adenovirus p53, which is used in clinical trials. Its trade name - genticin (Gendicine). Detailed description getting this drug made in China patent no ZL 02115228.4, its full contents are hereby incorporated by reference.

The recombinant adenovirus of human p53 was designed and obtained as described in figure 1 and figure 2. In E. coli were jointly introduced the vector adenovirus and "Shuttle" the vector containing the gene p53; to obtain a positive recombinant clone was selected recombinant adenovirus. Recombinant clones were amplified in 293 cells, and after many stages of purification was assembled recombinant clinically clean adenovirus p53 person. Figure 3 shows the results of determining the structural stability of recombinant adenovirus p53 person. This figure shows that the structural stability of the indicated recombinant adenovirus remained after a large number of generations.

Figure 4 represents the results of Western blotting of recombinant adenovirus p53, which is specified by the recombinant can be treated with a high degree of expression of the cancer cells of the larynx man ner-2, and nemelka cancer cells H1299. Figure 5 shows the effect of the destruction of recombinant adenovirus p53 in cells ner-2. Cells were stained Trifanova blue, and then calculated the percentage of blue (dead) cells; the results are shown in figure 5.

Example 2

Material: recombinant human adenovirus p53 of gendicine (Gendicine) injection was obtained from Shenzhen Sibiono Gene Tech Co., Shenzhen, China, batch No. S010731. The drug was Packed 1×1012VP/dose, and each dose was contained in a 2-ml test tubes with saline solution. In each box there was a test tube.

The clinical trial was a randomized tests under attendant control, with only one agent and the open tag.

Recruitment procedure the patient was as follows: the Patient signs a consent to participate in clinical trials. Pathological analysis confirmed the presence of tumor patients neck and head, and then made the classification of tumors according to the TNM system. To participate in the trial allowed patients with measurable tumor, which could be observed and which were available for local injection of drugs. The patients ' age ranged from 18 to 70 years, and their life expectancy at least 3 months. In the trials could involved the women and the men.

Was selected following exclusion criteria patients from trials. Excluded were patients suffering from acute respiratory infection, or patients with uncontrolled fever as a result of this infection. Were also excluded patients whose observed lesions were treated with another drug for local purposes. Patients with serious heart disease, liver, lungs or kidneys, patients with a tendency to hemorragie, pregnant women or nursing mothers were also excluded.

During testing were excluded patients that met the following standards: patients not tolerating strong fever from the use of the tested drugs; patients who were obliged to suspend tests because of the emergence of unexpected toxicities; and patients excluded from the trial for personal reasons. The clinical trial lasted four clinics from June 2001 to may 2003. All they participated in 155 subjects.

The clinical Protocol was as follows.

1. The group treated with gene therapy with radiotherapy

Every Friday inside of the tumor was performed with the injection of gendicine (Gendicine), the dose was 1012VP/injection. Later, 3 days after injection, the patient performed a session of radiotherapy. Irradiation was carried out met the house standard 3-dimensional conformational therapy at the dosage of 70g/35 f for about 7-8 weeks. The first cycle was completed after 5 weeks and the cumulative dose of 40 Gy. The second cycle was completed after 8 weeks and the cumulative dose of 70 Gy. 12 week therapeutic results were confirmed by the results of computer tomography. According to the who standards for objective evaluation of solid tumors was calculated the rate of tumor suppression (%) in the 40 Gy, 70 Gy, and the time of confirmation of therapeutic results. The results were classified as complete response (CR), partial response (PR), stable disease state (SD) and progressive disease state (PD).

2. The group treated with gene therapy combined with chemotherapy

The injection of gendicine (Gendicine) inside the tumor was performed with a single dose 1 time per week. The full course of treatment was 8 weeks, and was made of 8 injections. Chemotherapy was started after 3 days after injection. The first day was spent intravenous injection DDP (cisplatin) in a dose of 80 mg/m2. From the first to the fifth day, continuously intravenously was administered 5-fluorouracil (5-Fluororacil) at a dose of 500 mg/m2.

3. Clinical laboratory analysis

Regular testing of patients began in the first week after the inclusion of the subject in the clinical trial and then were held weekly during the tests. Testing included physical examination, status is on KPS, a complete blood count, complete urine analysis, and a full analysis of faeces. Every month, conducted biochemical analysis, including total nitrogen, blood (BUN), creatinine (Cr), ACT and ALT; carried out an ECG (EKG) and a chest x-ray. Definition and registration of the toxicity of gendicine in these tests were performed every week on who standard in order to assess acute and pseudo-acute toxicity of anticancer drugs. Were allocated to the following categories of toxicity: low (I)moderate (II), (III) and life threatening (IV). In phase I clinical trials highlighted changes in body temperature.

4. The results and statistical analysis

Statistical analysis was performed using the software SPSS 11.0. The tests were performed according to the method of ITT. Comparison of the reduction of the size of the tumor was performed by t-test. To compare therapeutic significance was used Chi-square.

5. Impact on blood, urine, feces, and liver and kidney function

The results are shown in table 1.

Table 1
Complete blood count and blood biochemistry for a group of 37 subjects who received gene therapy/radiotherapy the
IndexBefore injection (A)4 weeks (In)8 weeks (C)P (a-b)The value of (a-C)
Leukocytes (109/l)for 6.81±2,105,48±1,475,41±1,580,003*0,002*
Hemoglobin (g/l)134,05±15,08126,03±14,73127,28±14,510,040*0,095
Platelets (109/l)250,49±69,67242,19±86,74250,58±110,330,8931,000

ACT (units/l)27,59±13,7025,5U12,8226,08±11,160,7010,829
ALT (units/l)31,14±29,39of 27.84±28,4426,76±27,060,835 0,734
Nitrogen (nmol/l)the 5.51±1,12a 4.83±1,214,80±1,660,046*0,110
Creatinine (nmol/l)80,59±12,3778,64±11,2177,53±11,410,6980,429
* shows the existence of differences between the two compared groups (P<0,05)

The results are shown in table 1, demonstrate that the levels of total blood count and blood chemistry, obtained before the injection of gendicine and 2 weeks after the injections, are in standard range. Before the injection, gendicine values of ALT, AST, nitrogen and blood creatinine levels were normal, but after 2 weeks after the injections, these values are only slightly decreased. Data ECG and chest x-rays did not show any change after the injection, gendicine.

Example 3. Treatment gendicine in combination with chemotherapy for patients with liver cancer

Injection of recombinant human adenovirus p53 were obtained as described in example 1.

The clinical trial was a randomized trial on the attendant control, with only one agent and the open tag.

Standards of patient selection were the following: first, patients sign a consent to participate in clinical trials. Pathological and histological analysis confirmed the presence of patients hepatocellular carcinoma (HCC). Assessment carcinoma was performed according to standard protocols of China for the diagnosis and treatment of malignant neoplasms. Lesions should be measured, they should be easy to observe and they should be available for local injection of drugs. The patients ' age ranged from 18 to 75 years, and their life expectancy at least 3 months. In the tests were able to participate both women and men.

Was selected following exclusion criteria patients from trials. Excluded were patients suffering from acute respiratory upper respiratory infection, or patients with uncontrolled fever as a result of this infection. Were also excluded patients whose observed lesions were treated with another drug for local purposes. Patients with serious heart disease, liver, lungs or kidneys, patients with a tendency to hemorragie, pregnant women or nursing mothers were also excluded.

During the trials excluded patients who, satisfy the following standards: patients not tolerating strong fever from the use of the tested drugs; patients who were obliged to suspend tests because of the emergence of unexpected toxicities; and patients excluded from the trial for personal reasons.

From March 2004 to July 2004 when treating gendicine in combination with chemotherapy were 35 cases of liver cancer.

1. Therapeutic protocols

In these clinical trials was involved 75 patients with hepatocellular carcinoma, 51 men and 24 women with advanced stages of the disease from the middle to late.

Randomly were left 2 groups.

In the first group, 40 patients underwent chemotherapy with the use of transcatheter chemo-embolization of the hepatic artery (TAS). Using the puncture of the femoral artery, the catheter is implanted in the thigh or into the hepatic artery. Subsequently, in order to determine the number of tumors, their location, type, size, feeding blood vessels and arteriovenous fistula, used a photograph of the superior mesenteric artery or phrenic artery; thus identified other artery feeding the liver cancer. Using blockages in blood vessels gelatin sponge into the hepatic artery was injected iny what Ktsia 5-fluorouracil, adriamycin, mitomycin, cisplatin and hydroxycamptothecin, manipulation was carried out for doing chemotherapy. After this branch supplies blood in the hepatic arterial catheterization and in the liver slowly ran the shot completely emulsified mixture containing 10 mg of adriamycin and 10-30 ml iodized oil, the process was carried out under x-ray control. Injection TACE was performed every 4 weeks, and after two injections was evaluated therapeutic effect.

The second group of 35 patients received gene therapy in combination with TACE (GT-TACE). For 48-72 h before TACE under control CT scan was done subcutaneous intratumoral injection of gendicine, the injection was performed at numerous points neoplasms. Depending on the size of the tumor each dosage was approximately 1-4×1012VP, process was performed once a week, making consistently 3-4 injections. TAS chemotherapy was carried out as described above.

According to the who standards for objective evaluation of solid tumors the results were classified as complete response (CR), partial response (PR), stable disease state (SD) and progressive disease state (PD).

2. Standard clinical testing

Regular testing of patients began in the first week after included the I of the subject in the clinical trial and then were held weekly during the tests. Testing included physical examination, status, KPS, complete blood count, complete urine analysis, and a full analysis of faeces. Every month, conducted biochemical analysis, including total nitrogen, blood (BUN), creatinine (Cr), ACT and ALT; carried out an ECG (EKG) and a chest x-ray. Definition and registration of the toxicity of gendicine in these tests were performed every week on who standard in order to assess acute and pseudo-acute toxicity of anticancer drugs. Were allocated to the following categories of toxicity: low (I)moderate (II), (III) and life threatening (IV). In phase I clinical trials highlighted changes in body temperature. The General condition of the patients was assessed according to the methodology of KPS.

3. The results and statistical analysis

Statistical analysis was performed using the software SPSS 11.0.

4. The effect on the white blood cell count, symptoms and assessment in KPS

Table 2 shows the effect on leukocytes. You can see that when TAS chemotherapy the number of cells is significantly reduced. The difference between the two groups was significant, p<0,05.

Table 2
The reduction in the number of leukocytes (×109/l) and the number what about the cases (%)
GroupThe degree of reduction in the number of cellsThe total number of cases, demonstrating a reduction
4,0-3,03,0-2,02.0 or below
GT-TACE12 (25,0)4 (8,3)2 (4,2)and 18(37.5)
TAS8(13,3)20 (33,3)11(18,3)39 (65,0)

Table 3 shows the results improve symptoms of patients. From this table it is seen that in the group GT-TACE after a month's course of treatment there was a dramatic improvement of symptoms. The difference between the two groups was significant, p<0,05.

Table 3
The improvement of patients after 1 month of treatment
GroupThe number of casesFeverThe reaction of the digestive tractThe mind is isenia pain
GT-TACE3525 (71,4)16 (45,6)30 (85,7)
TAS4018(45,0)24 (60,0)21 (52,5)

Table 4 shows the improvement of patients according to the scale KPS. From this table it is seen that in the group of patients GT-TACE after a month of treatment there was a significant improvement on a scale KPS.

The results of this example show that patients of group in which gene therapy was combined with chemotherapy (GT-TACE), compared with the control group (receiving only chemotherapy) demonstrated a stronger improvement related to the reduction of tumor size, reduce symptoms, and changes in the number of leukocytes and parameters on the scale KPS. In addition, mainly in the group GT-TACE improved appetite and sleep. The results show that if the product is recombinant human adenovirus p53 (gendicine) has been used to treat liver cancer, along with chemotherapy, genticin able to reduce the side effects of chemotherapy and improve the General condition and mental status of patients.

Example . The effectiveness of gendicine in improving the quality of life for cancer patients

40-year-old woman with progressive cancer of the left breast was subjected to surgery. The procedure included a mastectomy and excision of the auxiliary lymph nodes. After surgery it was discovered that 10 out of 12 surgically remote sites had cell metastasis. Later the patient received radiotherapy at a dose of 45 Gy/25f75w, and 9 cycles of chemotherapy (cyclophosphamide + Rubicon + 5-fluorouracil). However, after 6 months of combination therapy in many areas of the spine, including cervical vertebra, thoracic vertebra and lumbar vertebra, was discovered metastatic tumor. The patient was held additional therapy (Taxotere, vinorelbin, as well as new drug xeloda in oral form). In the interval between chemotherapy cycles in order to maintain the condition of the bone tissue of the patient, she was given the drug zometa. However, the desired therapeutic effect with all of the above actions could not be reached. By January 2004, the patient exhibited increased ALT, ACT and the number of leukocytes. Her physical condition began to deteriorate, she began to feel the ache, fatigue, weight loss, mental depression, and so on; all this indicated that her condition has progressed is.

After the failure to achieve effective treatment with chemotherapy and radiotherapy in the hospital the patient was given one treatment gendicine. Then the patient was sent home to continue treatment gendicine. Later, 1 month after the injection, gendicine the results of computed tomography and method of magnetic resonance imaging suggested that for the last 6 months the tumor's condition has improved. To her, it was a promising sign. "I felt very tired on the day of injection. However, before the next injection I felt better and more energetic, and did not feel any pain." After 3 months of therapy gendicine the results of the method of magnetic resonance imaging showed the presence of steatosis in injuries to the thoracic vertebrae 11 and 12 and lumbar vertebra 3. In other metastases no improvement was observed. The results of the blood tests were normal, and bilirubin level was significantly high. The patient no longer felt the pain return and had a good appetite. Later, 5 months after treatment gendicine the patient rested together with her family, she did not feel any discomfort and had a good mental status. After 7 months after treatment gendicine the results of the method of magnetic resonance imaging suggested the disappearance of the tumor in the thoracic vertebra 11, other damage not from eilis, but no new ones appeared. On the chest x-ray there was no turbidity. Blood has practically reached its normal level. The patient felt no pain and had a good mental status. After 9 months after treatment gendicine no signs of degradation of the tumor (according to magnetic resonance) was not observed. The x-rays of the lungs were good. The blood test was normal. The patient felt no pain and felt better than before.

Example 5

The 60-year-old woman was diagnosed with invasive cancer of the pancreas, the tumor diameter was equal to 5 cm, and life expectancy was only 1 year. The woman decided not to receive standard chemotherapy because they couldn't tolerate the side effects associated with chemotherapy. The patient was subjected to treatment gendicine, within 8 weeks by intravenous injection she received 20 doses of the drug.

After treatment, gendicine the results of the computer scan it was confirmed that the tumor of the patient in the pancreas has not increased, and minor damage in the liver disappeared. After further observation, it was found that damage became stable, suspicious lesions have disappeared, and swollen lymph nodes decreased.

Bookmark the value of

We found that injection of cancer patients with recombinant adenovirus p53 had a unique unexpected effect. It is that when combined with chemotherapy or radiotherapy is indicated recombinant able to reduce the side effects caused by treatment of tumor chemotherapy alone or radiotherapy.

This discovery is important because after the injection, gendicine General condition of cancer patients, especially at the late stage of the disease, has improved significantly. For example, significantly improved their physical and mental status, their appetite has also become better. We postulate that this effect is due to the global regulation of the nervous, endocrine and immune systems. Thus, genticin able to improve and strengthen the function of various organs of patients, and improve overall health.

The following describes a possible mechanism of action.

Genticin is a viral particle, obtained by genetic engineering. He can stimulate and modulate the nervous system of the body, the endocrine and the immune system to produce a series of nerve factors, hormones and cellular factors. As can be seen from the examples above, one of the phenomena experienced by the patients after the introduction of gendicine is increased body temperature, in other words, fever. Etonline can be explained as follows, that genticin able to activate the immune system of the patient. It turned out that due to the comprehensive regulation of the nervous, endocrine and immune system of the patient improves immune power, and effectively increases the ability of killer cells and T-cells to destroy cancer cells; thus increases the antitumor activity of humoral and cellular immunity. Genticin may also act regulating the physiological functions of the patient and thereby improving health in General.

Although the present invention has been described above in some detail with illustrations and examples are intended to explain the new manifestations of therapeutic action gendicine who is skilled in this technology, people should understand the practical application of various changes and modifications. Therefore, the above description and examples should not be considered limiting scope of the present invention; it is defined by the following claims.

1. A method of reducing side effects, including but not limited to side effects caused by anticancer chemotherapy and radiotherapy, which is to assign to a patient in need of such reduction of side effects, the pharmaceutical composition containing the eff is active for the treatment of a number of recombinant adenovirus p53 and pharmaceutically usable excipient.

2. The method according to claim 1, characterized in that said pharmaceutical composition is administered concurrently with chemotherapy.

3. The method according to claim 1, characterized in that one portion of the specified pharmaceutical composition is administered before administration of chemotherapeutic agents.

4. The method according to claim 3, characterized in that one portion of the specified pharmaceutical composition is administered on the day immediately prior to the date of the introduction of chemotherapeutic agents.

5. The method according to claim 3, characterized in that one portion of the specified pharmaceutical composition is administered in any of the three days before the day of the introduction of chemotherapeutic agents.

6. The method according to claim 1, characterized in that one portion of the specified pharmaceutical composition is administered after administration of chemotherapeutic agents.

7. The method according to claim 6, characterized in that one portion of the specified pharmaceutical composition is administered on the day immediately after the date of introduction of chemotherapeutic agents.

8. The method according to claim 6, characterized in that one portion of the specified pharmaceutical composition is administered in any of the three days after the introduction of chemotherapeutic agents.

9. The method according to claim 1, characterized in that one portion of the specified pharmaceutical composition is administered at any time of the cycle of chemotherapy treatment.

10. The method according to claim 1, otlichalis the same time, that a single dose of a specified pharmaceutical composition is administered on the day of radiotherapy.

11. The method according to claim 1, characterized in that one portion of the specified pharmaceutical composition is administered before radiotherapy.

12. The method according to claim 11, characterized in that one portion of the specified pharmaceutical composition is administered in any of the three days before radiotherapy.

13. The method according to claim 1, characterized in that one portion of the specified pharmaceutical composition is administered after radiotherapy.

14. The method according to item 13, wherein a single dose of a specified pharmaceutical composition is administered in any of the three days after radiotherapy.

15. The method according to claim 1, characterized in that one portion of the specified pharmaceutical composition is administered at any time of the cycle of radiotherapy treatment.

16. The method according to 1, characterized in that these side effects include, but are not limited to one of the following effects: loss of appetite, insomnia, weakness, nausea, retching and nausea, diarrhea, photophobia, and alopecia, or their combination.

17. The way to improve the quality of life of patients with neoplastic diseases, including the appointment of these patients pharmaceutical composition containing an effective treatment for a number of recombinant adenovirus p53 and pharmaceutically suitable wear the fir-tree.

18. The method according to 17, characterized in that said pharmaceutical composition is administered in a single dose.

19. The method according to 17, characterized in that the indicator of improving quality of life includes, but is not limited to one of the following indicators: improved appetite, weight gain, greater energy, less pain and better sleep, or a combination thereof.



 

Same patents:

FIELD: medicine.

SUBSTANCE: viral particle consists of non-alphavirus structural elements and contains an alphavirus vector replication-defective by deletion or substitution by at least one transgene. Besides said particle contains structural elements not coded by an alphavirus vector genome. A method for preparing said particle according to the invention implies the expression in trans of the genes coding the non-alphavirus structural elements, and the alphavirus vector, in a cell line and then recovery of the viral particles found in the cell culture supernatant.

EFFECT: invention allows preparing the viral particles with lower recombination risk.

24 cl, 5 dwg, 3 tbl, 2 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to genetic engineering and can be used to optimise expression of the antigen protein of the human epidermal growth factor-2 (HER2/neu). To obtain the HER2/neu protein, a nucleic acid synthetic molecule is used, which is codon-optimised for high level of expression of the said protein in a human cell.

EFFECT: invention increases production of the recombinant HER2/neu protein during expression in human cells.

8 cl, 10 dwg, 14 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to genetic engineering and virology. The expression vector for cloning Class I viral fusion protein gene contains Coronavirus M protein gene, Coronavirus E protein gene, IRES site, a first eukaryotic promoter linked to the M protein gene, Coronavirus Spike gene and MCS site and a second eukaryotic promoter linked to the Spike gene.

EFFECT: vector can be used as DNA vaccine candidate against virus infection diseases.

18 cl, 1 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: invention is related to preparation of protein, binding tumour necrosis factor (TNF), and may be used in medicine. Strain-producer of baculovirus BvG2RIgG is created with the help of recombinant plasmid DNA pFastBac-G2R-IgG with size of 6444 p.n. and molecular mass 4.18 mDa, which bears fragment of smallpox virus genome of strain India-1967, which codes protein that binds TNF, and fragment of human genome, which codes fragment of heavy chain of human antibody G. Produced strain produces soluble chimeric protein, which consists of smallpoz virus protein, which binds TNF, and fragment of heavy chain of human antibody G.

EFFECT: wider spectrum of new generation preparations intended for treatment of human diseases related to hyperproduction of tumour necrosis factor.

2 cl, 3 dwg, 1 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention is related to nucleic acids and multidomain proteins, which are able to bind vessel endotheliocyte growth factor (VEGF), and may be used in medicine. Recombinant method is used to produce polypeptide, which consists of component (R1R2)X and, unnecessarily, multidomain component (MC), which represents aminoacid sequence with length from 1 to 200 of amino acids, having at least one remainder of cysteine, where X≥1, R1 means antibody-like (Ig) domain 2 of VEGF receptor Llt-1, and R2 means Ig-domain 3 of VEGF receptor Flk-1. Produced fused polypeptide does not contain multidomain component in case, when X=2, and in case when X=1, multidomain component represents aminoacid sequence with length from 1 to 15 amino acids. Produced polypeptide is used in composition of pharmaceutical compound for VEGF-mediated disease or condition.

EFFECT: invention makes it possible to produce highly efficient trap of VEGF, special structure of which is suitable for local introduction into specific organs, tissues or cells.

16 cl, 3 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention claims compositions which can include one or several mammary gland tumour proteins, their immunogenic parts or polynucleotides encoding such parts. Alternatively the therapeutic composition can include antigen-presenting cell expressing mammary gland tumour protein, or T-cell specific to cells expressing such protein. These compositions can be applied in prevention and treatment of such diseases as mammary gland cancer. Invention also claims diagnostic methods based on determination of mammary gland tumour protein or mRNA encoding such protein in sample.

EFFECT: use of peptides obtained from protein expressed from mammary gland by tumour in diagnostics and therapy of mammary gland cancer.

37 cl, 6 ex, 1 dwg

FIELD: chemistry, organic, viruses.

SUBSTANCE: invention relates to medical and molecular genetics. Three geometric constructions are proposed on the basis of vector plasmid pEGFP-N1, the constructions producing siPHK: inhibitors of reproduction of the human immune deficiency virus of the 1 type. The invention may be used in development of more efficient anti-HIV preparations on the basis of interfering RNAs (siPHK) produced in cells with the aid of administered vector expressing constructions.

EFFECT: obtaining of genetic construction for development of anti-HIV preparations.

3 cl, 1 dwg, 5 tbl, 3 ex

FIELD: biotechnology, in particular gene engineering.

SUBSTANCE: Gene of B9R protein having high homology with extracellular segment of interferon-gamma receptor is isolated by PCR method from Mankeypox virus genome of strain Zaire-96-1-16. Then said protein is cloned in donor plasmid pFastbAC and via site-specific transposition recombinant bacmid is constructed. Said bacmid is used for pest cell transfection to generate target strain.

EFFECT: new drugs for treatment of human diseases associated with hyperproduction of interferon-gamma.

2 cl, 3 dwg, 6 ex

FIELD: gene engineering.

SUBSTANCE: the present innovation deals with the ways for obtaining transgenic poultry due to introducing retroviral vectors into blastodermal cells through the fissure in the shell of nonhatching egg from the side of its blunt end. With the help of insulin syringe one should introduce gene constructions for the depth of about 2-3 cm near a germinal disk. The innovation enables to simplify the procedure of introducing gene constructions into target cells at maintaining general efficiency of transgenesis that leads to the decrease of embryonic lethality.

EFFECT: higher efficiency.

FIELD: biotechnology, virology, medicine.

SUBSTANCE: invention relates to attenuated virus derived from modified Ankara vaccina virus. Said virus are not able for reproduction by replication in human cell lines. Also disclosed are application of virus or recombinant variants thereof as drug or vaccine, as well as method for inducing of immune response in patients with defected immunity, in patients having immunity to vaccine virus, or in patient during antiviral therapy.

EFFECT: variant of Ankara vaccina virus effective in medicine and veterinary.

86 cl, 15 dwg, 1 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: compounds, included into one of compositions represent polypeptides, which contain at least immunogenic fragment of protein CT858 or protein CT089 Chlamydia trachomatis with specific amino acid sequence, or polynucleotides, coding immunogenic fragments of said proteins. Compounds, included into other composition, represent fused polypeptides, which contain immunogenic fragment of protein CT858 or CT089 and fusion partner, selected from immunologic fusion partners, expression amplifiers, affine markers and unrelated known proteins of Chlamydia trachomatis. Said compositions can be used for stimulation of specific T-cell response to Chlamydia trachomatis, for inhibition of infection development and for treatment of infection induced by Chlamydia trachomatis, ensuring high level of immune response and therapeutic effect.

EFFECT: described are compositions based on compounds for prevention and treatment of Chlamydia infection.

11 cl, 16 dwg, 7 tbl, 13 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and is a lipolytic enzyme which is obtained from one Streptomyces. Such a lipolytic enzyme has an amino acid sequence reduced to SEQ ID No.4, or an amino acid sequence which is at least 70% identical to it. The invention also relates to use of a lipolytic enzyme in a method of producing lyso-glycolipid, lysophospholipid, in an oil refining method, in phospholipid processing methods, in bio-conversion of polar lipids and in production of food products.

EFFECT: invention enables to obtain a novel enzyme having glycolipid hydrolysing action.

46 cl, 17 dwg, 4 tbl, 12 ex

FIELD: agriculture.

SUBSTANCE: polypeptide homological to polypeptide expressed by Eurotinium amstelodami, has antimicrobial activity and may be used to administer as medical or prophylactic agent to a person or animal, and also in fodder for animals.

EFFECT: improved efficiency of application.

19 cl, 2 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention can be used in producing vaccines against Streptococcus agalactiae - a representative of streptococci group B (SGB) in diagnostics of the diseases - for creation of a detection system of immunoglobulin A level in biological fluids, in immunochemistry as accessible immunochemical reagents (affine recovered IgA fragments). Offered unique recombinant DNA are produced by polymerase chain reaction (PCR) with using chromosomal DNA of strain 219/4849 Ibc of serotype SGB and unique primers. One recombinant DNA contains three nucleotide substitutes in comparison with an initial site of chromosomal DNA. The following cloning of amplified fragments is carried out in a linear vector pGEM-T Easy, and at the final stage by the system of express ionic vectors pQE30/31/32 in E coli JM 109. The produced recombinant DNA code amino acid sequences of recombinant polypeptides exhibiting ability to connect selectively various molecular forms of IgA and designated as P6, P7, P8. Polypeptide P6 causes synthesis of long circulating high-affine anti-Rb antibodies possessing protective properties against SGB.

EFFECT: application of the invention provides production of recombinant polypeptides based N-terminal conservative part of surface Bac SGB of Ibc serotype and containing a first IgA-connecting site A with changed or native sequence MLKKIE, polypeptide exhibits immunologically relevant and protective properties, and they also high selectively connect IgA.

12 cl, 20 dwg, 4 tbl, 19 ex

Expressing system // 2385348

FIELD: medicine.

SUBSTANCE: invention concerns the method for making an immunogenic reagent which causes immune response on infection Bacillus anthracis, including one to several polypeptides which together represent three domains of a full-size protective antigen (PA) from B anthracis or their versions, and at least, one of specified domains contains domain 1 or domain 4 of the PA, or its version. Said polypeptides of specified immunogenic reagent, and the full-size PA are produced as a result of expression in a recombinant cell E.coli. The invention also discloses an expression vector and nucleic acid with percent of residual guanidine and cytosine more than 35%, coding immunigenic polypeptide which is said protective antigen (PA).

EFFECT: high-yield immunogenic polypeptide.

13 cl, 5 dwg, 3 tbl, 6 ex

FIELD: biotechnologies.

SUBSTANCE: invention is related to production of new hybrid polypeptide GST-CFP10 by microbiological synthesis with properties of species-specific protein-antigen CFP10 Mycobacterium tuberculosis, which may be used for early species-specific diagnostics of tuberculosis infection. Recombinant plasmid DNA pTB232 has been constructed, which codes hybrid polypeptide GST-CFP10 with properties of mycobacterial antigen CFP10, with average molecular weight (m.w.) 3.4 MDa and having size of 5257 p.n. Recombinant strain of bacteria E. coli BL21/pTB232 contains recombinant plasmid DNA pTB232, is producer of hybrid polypeptide GST-CFP 10 with properties of mycobacterial antigen CFP10 and is deposited in KM GNC VB "Vector" under number B-1027. Recombinant polypeptide GST-CFP10, produced with strain of bacteria E. coli BL21/pTB232, contains as protein-carrier N-end polypeptide fragment glutathione S-transferase S.j. (226 a.o. with m.w. of 26.3 kDa), joined via end site of thrombin hydrolysis (LVPRGS) with C-end polypeptide fragment of antigen CFP10 (100 a.o. with m.w. of 10.8 kDa) and has complete aminoacid sequence with length of 326 a.o. and m.w. of 37.1 kDa, given in text of description.

EFFECT: use of invention provides for the possibility to produce target highly pure hybrid polypeptide GST-CFP10 in preparative amounts with preservation of immunogenic properties of the latter.

3 cl, 4 dwg, 4 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention can be used in manufacturing of vaccines for Streptococcus pyogenes - streptococci of group A (SGA) and Streptococcus agalactiae - streptococci of group B (SGB). Substance of the invention involves development of recombinant DNA pB1 derived from PCR with using chromosomal DNA of strain 090R Ia of serotype SGB, primers Pb1 and Pb2 and following cloning with using expression plasmid pQE-30 in E coli M15. Recombinant DNA pB1 codes recombinant protein PB1 expressing protective properties in relation to specified streptococci which has no enzymatic activity and causes synthesis of anti-Pb1 antibodies expressing protective properties in relation to Streptococcus pyogenes and Streptococcus agalactiae. In the invention there is developed recombinant plasmid DNA pQE-pB1 representing plasmid DNA pQE-30 that bears recombinant DNA pB1, and strain-producer E. coli M15-PB1 enabling to express recombinant protein PB1.

EFFECT: no enzymatic activity of produced recombinant protein allows application as an ingredient of the vaccine for Streptococcus pyogenes and Streptococcus agalactiae.

7 cl, 7 dwg, 4 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention refers to genetic engineering and can be used in medicine. The mucosal vaccine contains effective amount of hybrid protein consisting of oncoprotein E7 of human papilloma virus fused with heat-shock protein of mycobacteria Hsp70, chitosan related to hybrid protein 1:0.1-10 and additives pharmaceutically acceptable manufacturing of suppositories. The mucosal vaccine is used in therapy of the diseases associated with human papilloma virus.

EFFECT: possibility for multiple improvement of clinical effectiveness of diseases associated with human papilloma virus, considerable reduction of treatment cost in comparison with common techniques of treating cervical carcinoma and "РПК"; elimination of injection by-effects undesirable and extremely dangerous for the patent's life, eg anaphylactic shock, owing to local application; simplification of medical process - the patient can receive medical treatment out of clinic by independent introduction of the preparation.

6 cl, 4 dwg, 2 tbl, 10 ex

FIELD: medicine.

SUBSTANCE: invention concerns protein NMB1870 which represents common surface protein Neisseria meningitidis expressed with all Neisseria serogroups. Protein is subdivided into three separate families. The whey induced against antigen of a certain family, has bactericidal effect within this family, but is inactive concerning strains expressing antigens of one of other two families, i.e. there is a cross protection within family, but not between families. It is established, that NMB1870 can be subdivided into domains and that antigen domains can be recovered from NMB1870 of all three families and expressed as a polypeptide chain that is implemented by the method disclosed in the invention. Also it is discovered that NMB1870 expresses some epitopes in surface loops located between alpha spirals, and that epitope substitution of the loop of one family with that of the other family enables making chimeric NMB1870 of antigenicity characteristic for proteins of several families. In the invention there are disclosed chimeric proteins NMB1870 (versions) partially containing NMB1870 of various families.

EFFECT: proteins produced according to the invention can be used as a medical agent as a component of immunological compositions for immunization against diseases caused by Neisseria meningitidis without family specificity of protection.

22 cl, 46 dwg

FIELD: medicine; microbiology.

SUBSTANCE: way is intended for reception of functionally active LF form, the basic toxic protein defining cellular disturbances, leading to death of an organism at infection with a malignant anthrax bacterium. For realisation of the way a recombinant plasmid pETHIS-LF (7816 items) is designed, containing a full-size gene of the lethal factor (LF) of malignant anthrax under the control of the promotor of bacteriophage T7 and to a determinant of ampicillin tolerance. The plasmide provides effective synthesis of LF protein of malignant anthrax merged with sequence of six Histidinums for clearing with the metal-chelate chromatography. The strain Escherichia coli BL-HISLF is designed using transformation of the specified plasmid DNA in the strain E.coli BL21 (DE3), synthesizing active LF protein. The target product is separated with the way including clearing on a metal-chelate sorbent with the subsequent additional clearing of the LF protein by gel-filtration.

EFFECT: reception of active recombinant protein LF on the simplified technology and with a high output of synthesised protein of the lethal factor.

3 cl, 3 dwg, 3 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to molecular biology and gene therapy. disclosed is a group siNA (siRNA) aimed at certain gene areas of the P2X7 (P2RX7) receptor and which efficiently inhibit expression of said receptor.

EFFECT: invention discloses use of siRNA directly, as well as a component of medicinal agents for treating diseases characterised by high expression and/or activity of the P2X7 receptor such as neural degeneration, Alzheimer disease, inflammatory diseases, certain types of malignant tumours etc.

26 cl, 5 dwg, 3 ex

Up!