Enhanced bioluminescence photoproteins and application thereof as intracellular calcium indicators

FIELD: medicine.

SUBSTANCE: invention refers to chlitin derivative photoproteins and to application thereof both as intracellular calcium indicators, and in cellular studies. Said proteins are produced by mutagenesis of a coding sequence of chlitin. Also, there are offered nucleic acids coding said protein, a vector containing said nucleic acids and a host cell carrying the vector. They can find application in genetic communication technologies for monitoring the cellular events associated with signal transmission and gene expression. Besides, photoproteins of the present invention can be used as intracellular calcium indicators in diagnostic techniques based on calcium concentration measurement in response to the various effects.

EFFECT: produced proteins exhibit enhanced bioluminescence, high affinity to calcium and prolonged light emission.

19 cl, 16 dwg, 5 ex

 

The present invention relates to fotoalbum enhanced bioluminescence and their use as intracellular calcium indicators. Pocobelli obtained by mutagenesis of the coding sequence litina (clytin), and they show enhanced bioluminescence high affinity for calcium and long light emission. They are convenient to use in cellular studies to determine changes in the concentration of intracellular calcium, in particular in studies on the selection of molecules conducted using equipment with high and ultra-high bandwidth.

The LEVEL of TECHNOLOGY

Bioluminescence is a phenomenon in which visible light is emitted by living organisms or substances made from them, through a variety of chemiluminescent reaction systems. For bioluminescent reactions requires three main components: luciferin, luciferase and molecular oxygen. However, other components may also be required in some reactions, including cations (Ca++and Mg++) and cofactors (ATP, NAD(p)H). Luciferase are enzymes that catalyze the oxidation of substrate luciferin and produce an unstable intermediate. Light is emitted when an unstable intermediate collapses to the ground state with the image of the cation oxyluciferin. There are many different unrelated types of luciferin, although many species of at least seven types use the same enzyme, known as coelenterazine (coelenterazine). Some animals (e.g., jellyfish) system luciferin/luciferase can be extracted in the form of a stable “fotobanka”, which emits light when the binding of calcium. Pocobelli differ from luciferase that they represent a stable oxidized intermediate complexes luciferase and luciferin. Pocobelli represented in many marine coelenterate and allow these organisms to emit light for a variety of purposes, including breeding, nutrition and protection 1. There are many luminescent organisms, but still allocated only seven fotobelov, namely classically [2, 3], acorin [4-6], microgamin (synonym cholesterin) [7, 8], Klitin (synonym palidin) [8, 9], obelin[2, 6, 10, 11], Mnemiopsis [12, 13] and beromen [12, 13]. All these proteins are complexes formed by apolka, the chromophore imidazopyridines (coelenterazine) and oxygen. Their structures are highly conservative, especially in the regions containing three cellisvisible plot (EF-hand structure). The term “fotoblog” means Luciferians polypeptide which is capable of luminescence, while the term “apabila used for oboznacheniyalari without luciferin.

The most studied fotoalbumi are acorin isolated fromAequorea victoria[14], and obelin isolated fromObelia longissima[15]. Photoblog can be regenerated from abovetable incubation with coelenterazine, molecular oxygen, EDTA and 2-mercaptoethanol or dithiothreitol. Because coelenterazine represents the total fluorescent substrate used by fotoalbumi aquarium, microcamera, klitina and abelina, the reaction of light emission, probably the same in these four photoblog [16, 17].

Photoblog Klitin was cloned in 1993 Inouye and others [18]. To date, studies of this fotobanka is practically not carried out. Performed alignment of the primary structures aquarina, microsomia, litina and obelin the luminescent protein, and shows high amino acid sequence identity. Also found that the CA2+-binding sites are highly conservative [19]. It is established that CA2+-binding protein in hydrosoil (Hydrozoa) differs from other CA2+-binding proteins relatively high content of cysteine residues, histidine, tryptophan, Proline and tyrosine.

Analysis of the primary structure litina shows that it contains 198 amino acid residues (A.S.) and belongs to the family fotobelov.

Pocobelli widely used in gene technology re the ACI information for monitoring cellular events, associated with signal transmission and gene expression.

The study of the cellular events and their regulation requires a sensitive, non-invasive analytical methods. Pocobelli and, in General, the use of photoluminescence represent an excellent system for the transmission of information, because they have virtually no background radiation in contrast to fluorescent systems.

Pocobelli Express in mammalian cells to monitor changes in calcium concentration in response to various influences. The concentration of intracellular calcium can be measured by adding the cofactor coelenterazine to mammalian cells expressing photoblog and detecting photon emission, which shows the concentration of intracellular calcium. The use of cells which Express and fotoblog, and the receptor involved in the modulation of intracellular concentration of calcium, provides the applicable system for screening compounds and their effects on the release of intracellular calcium. High-performance screening methods can also be created using fotobanka as a system of information transmission. The sensitivity of this system and its high signal relative to noise ratio allows to conduct research in small volumes. Acorin up to the present time what is the most used Fotoalbom for specified research purposes. Research threads of calcium are usually held in HTS format using optical screening devices suitable for the simultaneous analysis of a large number of samples and are equipped with a system for obtaining a fluorescent image with a CCD camera detector. One of the most used tools in HTS is the reader FLIPR®(Fluorometric Imaging Plate Reader, Molecular Devices Corporation, Sunnyvale, CA, USA), which was developed as a high-performance optical device screening for fluorescent cell research. The device is equipped with an optical detector, which allows to isolate the signal on the cell monolayer, increasing, thus, the sensitivity of cellular research. The excitation source can be either an argon laser, or a source with a wide bandwidth, as a xenon lamp.

The latest version of the FLIPR system®(FLIPR3and FLIPRTETRAwith light sensitive camera with rapid shutter speed, with a flowing fluid dispenser is also suitable for fluorescent studies, albeit with lower sensitivity compared to the equipment based on a CCD camera.

To use the above tools FLIPR®, FLIPR3and FLIPRTETRAand, in General, for all instruments with low sensitivity in fluorescent studies is fotoblog with enhanced light emission seems highly demanded.

The INVENTION

According to the first aspect of the invention provides a selected photoblog containing the amino acid sequence, which

a) capable of binding coelenterazine and calcium, creating bioluminescence;

b) identical, at least 90%, preferably at least 95%, more preferably at least 98% of SEQ ID NO: 1 (Klitin);

c) sequence alignment with SEQ ID NO: 1 (Klitin) represents one of the following single or multiple substitutions (positions of the residues are related to SEQ ID NO: 1):

i) C54→S;

ii) S132→C;

iii) K48→R, N195→D;

iv) Q68→R, A90→V, T184→I;

v) Y82→F, K110→N, F125→L, S149→R;

vi) G142→C;

vii) I53→V, S149→R;

viii) N18→D, I40→V, K56→R;

ix) Gly58→Glu, Asp69→Val, Ala70→Cys, Lys76→Arg, Lys77→Gly, Ile78→Cys, Asp81→Glu, Val86→Ile, Glu87→Ala, Ala90→Gln, Val92→Leu and Glu97→Gln.

In the preferred embodiment of fotoblog consists of the amino acid sequence which is selected from the group of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9 and 10. In comparison with the known or commercially available fotoalbumi pocobelli of the present invention have increased bioluminescent activity and/or increased SRO is ETS to the calcium and/or continuous light emission.

In addition to substitutions indicator residues, which confirm the desired bioluminescent activity fotobanka, the sequence litina may be further modified without adversely affecting the bioluminescent activity fotobanka, especially with conservative substitutions of amino acid residues within the indicator range, identifying the sequence. In addition, the sequence litina can be cut small areas without changing botobekovy activity.

In another aspect the invention is directed to polynucleotide encoding fotobanka, as defined previously. In the preferred embodiment of the polynucleotide sequence to optimize the use of codons mammals according to SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18, 19. In another preferred embodiment the nucleic acid molecule merge with mitochondrial target sequences[20, 21, 22].

According to another aspect of the invention provides expression vectors and cells of the host containing the indicator polypeptide. Cell host, expressing photoblog, according to the present invention produce intense bioluminescence in response to stimulation by calcium, which is much higher than that observed with natural fotoalbumi, in particular with one of the most common and is used by aquolina.

In another aspect, the invention provides cell research to determine the intracellular calcium concentration through fotobanka according to the present invention.

In the preferred embodiment of changes in intracellular calcium concentration is determined using:

a) providing a cell expression fotobanka SEQ ID NO: 2-10, its variants or fragments;

b) load cells coelenterazine;

c) interaction of cells with an agent that stimulates calcium intake or calcium release from intracellular depots;

d) determining the bioluminescence fotobanka.

The study preferably carried out in high throughput format using optical screening tool or instrument suitable for mnogobrojnog analysis, such as system of a fluorescent image with a CCD camera detector for high and ultra-high performance or fluorometric tablet reader FLIPR®. In both of these systems pocobelli of the present invention provide higher signal compared with the known fotoalbumi commonly used in automated cellular functional studies.

In the preferred embodiment, the cells expressing photoblog and the receptor involved in the intracellular mobilization of calcium, is used for testrow is of molecules of candidates for their effects on receptor modulation. Usually cells transferout expression vectors containing the coding sequence of fotobanka, and in the absence of interest endogenous receptor or channel. Positive clones are selected and sown in a suitable medium, cultured cells saturate the substrate with coelenterazine and start the study of the addition of the test molecule or impact. Produced luminescence is considered a suitable detection system (CCD camera or a luminometer). The study can also be carried out in an automatic device equipped with a reader advance tablets, in particular FLIPR®system. In this case, cells expressing photoblog, placed in the wells of the microplate, which after adding the test molecule/impact read simultaneously with the recording signal.

High-performance screening, combined with a communication system based on fotobanka, have better sensitivity and signal-to-noise ratio. Cells expressing photoblog of the present invention, produce intense photoluminescence in response to calcium stimulation, which, as a rule, higher than that observed in natural fotobelov.

In another aspect, the invention provides a kit for research, including the preparation of cells expressing at asany in the invention of fotoblog under the control of stable or inducible promoter, and reagents needed to conduct this study.

In addition, pocobelli of the present invention can be used as indicators of intracellular calcium in diagnostic methods based on measurement of the concentration of cellular calcium ions and/or inflow/outflow of cellular calcium ions.

The present invention is described in detail in the following experimental part.

MATERIALS AND METHODS

Reagents

The enzymes become New England Biolabs and used according to manufacturer's instructions. A set of Ligation Independent Cloning (LIC) were obtained from Novagen (Nottingham, UK). For in vitro transcription and translation using the set of TNT Quick coupled kit from Promega (Madison, WI). Reagents for PCR and competent cells of E. coli strains XL-1Blue and BL21-Gold(DE3) were obtained from Stratagene (La Jolla, CA). Oligonucleotides get in Primm (Milan). Coelenterazine get in Pharma Tech. International Inc. (Fairfield, NJ). All other reagents were from standard sources and had the brand "pure" and above.

1. Creating libraries by random mutagenesis and screening

1.1 Optimization fotobanka for expression in mammalian cells (GENEART GmbH, Regensburg, Germany)

Using codon of the gene litina wild type adapted for codon sets offset vysokoagressivnyh mammalian genes. In addition, if possible, avoid regions with very high (gt; 80%) or very low (<30%) GC content.

For efficient translation initiation consensus Kozak sequence is injected before the start codon. Two stop-codon add for efficient termination.

1.2 Random mutagenesis

Set GeneMorph II Random Mutagenesis (Stratagene) used according to the manufacturer's instructions. To achieve a high degree of mutagenesis using two different initial amount of target DNA, 0.1 ng and 0.01 ng.

PCR primers create appropriate content 5' LIC extension segments (shown in italics), corresponding to sequences described in the set Ek/LIC Cloning Kit (Novagen)

top:GATGACGACGACAAG-ATGGCCGACACCGCCAG (SEQ ID NO: 20)

bottom:GAGGAGAAGCCCGGT-TTATCAAGGACACGAAGT (SEQ ID NO: 21)

Amplification is performed in thermal cycler Perkin Elmer 2400 according to the following Protocol:

once the next stage:

Pre-PCR2' at 94°C

30 times the following stages:

denaturation30” at 94°C
annealing30” at 56°C
the elongation40” at 72°C

once the next stage:

the elongation10' at 72°C

The expected length of the specific PCR product: 630 BP

For the quantitative determination of DNA amplification products analyzed by electrophoresis in 1% agarose gel in 1xTAE buffer according to the standard procedure as described by Maniatis with Soave. Samples are compared with the molecular weight marker DNA (MWXVI5 Roche).

1.3 Cloning Ek/LIC

Set Novagen Ligation Independent Cloning (LIC) used according to the manufacturer's instructions to obtain the directional cloning of PCR products without processing enzymes and reactions stitching. Choose the vector pET-30 Ek/LIC designed for expression of the target protein directly after cleavage site of enterokinase.

1.4 Transformation

For a good protein expression select cells BL21-Gold(DE3) (Stratagene), derivativesE.coli Bmodified BL21 strain. The genotype of this strain: E. coli B F-ompT hsdS(rB-mB-) dcm+Tetrgal λ (DE3) endA Hte. This strain lacks both proteaselonandompTthat can destroy proteins during purification. The Hte phenotype increases the transformation efficiency (>1×108 CFU/μg pUC18 DNA). In addition, geneendAthat encodes endonuclease I, inactivated (not origin the result of degradation of plasmid DNA).

To obtain competent cells with high efficiency transformation follow a standard Protocol for preparation and electrotransformation cells BL21-Gold(DE3)as described in the manual E. coli Pulser Transformation manual apparatus (BioRad).

Transformation efficiency is determined using pUC18 DNA and pET DNA vectors, and the obtained values are:

1×1010CFU/µg for pUC18 DNA

1×108CFU/µg for pET DNA

Using these Vysokomolekulyarnye cells receive a library of approximately 84,000 colonies expressing random mutant photoblog - Klitin.

1.5 Sowing on tablets, induction and charging

Transformed cells were seeded on the plates with LB agar and grown overnight at 37°C. After an overnight growth, colonies induction performed by adding 10 mm IPTG and 5 mm EDTA and incubation for 4 hours at 37°C. Colonies load 10 μm solution coelenterazine and incubated over night at 4°C and in the absence of light.

1.6 Measurement CCD camera

Bioluminescence examine the definition of the signal over a fixed period of time, 30 sec. At time 0, after 3 min and 5 min after the first measurement.

1.7 Collection of colonies and re-testing

The best colonies are picked and grown in 1 ml of liquid LB medium, and re-testing under the conditions op the toboggan previously.

2 Transcription and translation in vitro

Broadcast fotobelov carried out in a cell-free system from rabbit reticulocytes (TNT Quick coupled kit, Promega) according to manufacturer's instructions. For each reaction mixture for the transcription/translation ofin vitrouse 500 ng DNA. The reaction volume (10 µl) containing 8 μl of TNT T7 Quick Master Mix, and 1.6 μl of DNA, 0.2 µl methioninamide buffer and 0.2 μl coelenterazine (0.5 mm). At the end of 5 ál of each sample translation mixtures are tested for light emission by adding a solution of calcium and measured luminoskan Ascent (Labsystems).

3. The preparation of recombinant protein

To obtain recombinant protein using the Protocol of purification of small quantities of the protein under native conditions. Due to the presence of N-terminal His-tag in this arrangement, the expressed protein was purified on a column of Ni-NTA Spin Columns (Qiagen) according to the manufacturer's Protocol.

4. The concentration curve of calcium

To assess response fotobanka on different calcium concentration of recombinant protein in the amount of 0.05 ng/well (96-well plate) load 10 microns coelenterazine over night at 4°C.

After incubation add different concentrations of CaCl2and measure the emitted light luminoskan Ascent with an integration time of 20 MS for a total time of 10 sec.

5. Expression of a mutant fotobanka in the cells of Lampedusa

Reagents

The enzymes become New England Biolabs (Beverly, MA) and used according to manufacturer's instructions. Kit Rapid DNA ligation kit and Fugene transfection reagent acquire in Roche (Basel, CH). Coelenterazine get from Pharma Tech. International Inc. (Fairfield, NJ). All other reagents were from standard sources and had the brand "pure" and above.

The procedure of cloning

The most promising mutant botobekovy clones subcloning to test their expression in mammalian cells.

As a matrix in PCR analysis using 2 μl of the plasmid.

Standard PCR procedure corresponded to the specified Perkin Elmer. Use the following PCR Protocol:

Primers:

upper primer: TCGTTGGGATCCGCCACCATGGCCGACACCGCC (SEQ ID NO: 22)

lower primer: GGGCCCTCTAGATTATCAAGGCACGAA (SEQ ID NO: 23)

PCR reaction mixture:

2 álmatrix
5 ál10 × Pfx buffer (GIBCO-LifeTechnologies)
1,5 ál10 mm dNTPs
1 ál50 mm MgSO4(GIBCO-LifeTechnologies)
2,5 álthe upper primer (10 μm)
2,5 ál lower primer (10 μm)
2.5 UPlatinum Pfx (GIBCO-LifeTechnologies)
35 álH2O

The amplification Protocol, performed in thermocycler Perkin Elmer 2400:

once the next stage:

Pre-PCR2' at 94°C

25 times the following stages:

denaturation15” at 94°C
annealing30” at 56°C
the elongation40” at 68°C

once the next stage:

the elongation10' at 68°C

The expected length of the specific PCR product: 630 BP

Amplification products analyzed by electrophoresis in 1% agarose gel in 1xTAE buffer according to the standard procedure as described by Maniatis with co.

The PCR product purified on a Qiagen column with gel and treated with restriction enzymes BamHI and XbaI.

Creating pcDNA3neo-/mito-mutated litina

The vector pcDNA3 (Invitrogen) in a private modification content is t the coding sequence of the mitochondrial target peptide of subunit VIII of cytochrome C oxidase person (20, 21, 22), so that it can be used in the reading frame 5'-end using codon optimized gene fotobanka. The amplification product obtained by the above PCR clone in this modified pcDNA3 vector devoid of the gene of resistance to neomycin, for expression in cell lines mammals.

The signal sequence for mitochondrial orientation:

5'-ATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGC

CCGGCGGCTCCCAGTGCCGCGCGCCAAGATCCATTCGTTGGGATCCGCCACC-3' (SEQ ID NO: 24).

Creating pcDNA3neo-/cyto-mutated-litina

The gene mutated litina get from pcrScript/h-mutated-litinavector by cleavage with restriction enzymes BamHI and XbaI and purified. Then mutated gene litina placed in pcDNA3neo-vector to obtain pcDNA3neo-CYTO-h-mutant-litina.

Both of the resulting construction check the full dideoxy-sequencing.

Cell culture

Culture medium, inoculation and incubation: DMEM/F12 with glutamax (GIBCO cod. 31331-028), 10% ABS, 1% pen./strap. (Invitrogen cod. 15140-122), 25 mm Hepes buffer (GIBCO cod. 15630-056), 1.0 mm sodium pyruvate (GIBCO cod. 11360-039), 1.5 g/l sodium bicarbonate (GIBCO cod. 25080-060).

Precultural conditionsthe cells were seeded for experiments, when the degree of compression of the monolayer is 70-80%.

Conditions of cell culture:

the office twice a week to 3.0×105CL is current/fleshku Kzt75 (recovery: 8,0×10 6cells).

The process of selecting clone:

CHO-K1 transferout impact pcDNA3Neo-/MITO-h-mutant-litina or pcDNA3Neo-/CYTO-h-mutant-litina.

24 hours after transfection treated cells were seeded in 10×96-well plates in complete DMEM.

At the confluence of the monolayer 10×96-well plates duplicate on 10 white tablets. For 3.5 hours before measurement environment replaces 50 μl/well buffer Tirade (2 mm Ca2+plus coelenterazine, 10 μm).

Positive clones are choosing, evaluating:

The first selection is done lysira the cells with Triton X-100. Conditions for CCD cameras: low sensitivity, integration time 1 sec, read within 5 seconds.

Choose five clones, each diluted in 3×96-well plates.

At the confluence of the monolayer 15×96-well plates duplicate 15 white tablets. For 3.5 hours before measurement environment replaces 50 μl/well buffer Tirade (2 mm Ca2+and 10 μm coelenterazine).

The second selection is done with 10 μl of ATP, exploring the kinetics, and then cells are lysed by Triton X-100. Conditions for CCD cameras: low sensitivity, integration time 1 sec, read for 30 sec for the measurement of ATP, followed 30 seconds for Triton X-100.

Produce four limiting dilution and selected the best clone of 0.3 cells per well in 10×96-well plates.

Final CL is n choose after 4 limiting dilutions, selected from 0.25 μm DNA, 5 μm coelenterazine.

Full optimization studies performed on the clone with the best answer.

The parameters of the measurement CCD camera:

The CHO cells were seeded at various concentrations in 384 MTP (500, 750, 1000, 1500 cells/well) in growth medium, supplemented as described above and measure the CCD camera 24 and 48 hours after seeding on tablets. Before experiments remove growth medium and load cells buffer Tirade plus coelenterazine at 37°C for 3 hours. In conclusion, the observed luminescence CCD camera after the addition of agonist (30 sec kinetically).

Fluorometric measurement of tablet reader (FLIPR®)

Parameters FLIPR3for standard research Protocol definition luminescence

tablets with 384 white holes with clean bottom

seeding cells for 24 hours prior to the experiment

the destruction of the environment

adding the buffer Tirade plus coelenterazine 25 µl/well

incubation for 4 hours at 37 °C

experiments carried out in FLIPR3: double (2×) introduction to buffer Tirade (25 µl/well).

All settings are standard measuring values except for the following:

The preliminary stage of research:

1) the camera Configuration:

shutter speed = 0,7

magnification = 200

2) the sequence Settings:

RA is predelay nozzle 384 wells

level = 30 ál

speed = 25 ál/sec.

Parameters FLIPRTETRAfor standard research Protocol for determining luminescence

tablets with 384 white holes with clean bottom

seeding cells for 24 hours prior to the experiment

the destruction of the environment

adding the buffer Tirade plus coelenterazine 25 µl/well

incubation for 4 hours at 37 °C

experiments carried out in FLIPRTETRA: double (2×) introduction to buffer Tirade (25 µl/well).

All parameter values are standard measuring values except for the following:

Setting the readout mode:

1) the camera Configuration:

magnification = 200

shutter speed = 0,5

2) the sequence Settings:

level = 30 ál

speed = 25 ál/sec.

Control connections:

ATP(Sigma, A-7699) dissolved in H2O at a concentration of 100 mm and stored in aliquot at -20°C. Do freshly prepared working solution in the buffer Tirade.

The composition of the buffer Tirade: NaCl 130 mm, KCl 5 mm, CaCl22 mm MgCl21 mm NaHCO35 mm, HEPES 20 mm, pH 7,4.

IMETIT(Sigma, I-135)

DESCRIPTION of FIGURES

Figure 1:Re-testing of mutant colonies with three concentrations of calcium.

Figure 2:Transcription and translation ofin vitro. Measurement of light emission after injection of 5 mm calcium.

Figure 3:Transcription and Tran is the transmission of in vitro. Measurement of light emission after the introduction of 1 mm calcium.

Figure 4:Kinetics measurement of light emission after the introduction of 1 mm calcium for recombinant fotobelov.

Figure 5:The curve is dependent on the dose of calcium for recombinant fotobanka 25N03b.

6:Peak luminous intensity for recombinant fotobelov after the introduction of 1 mm calcium.

Fig.7:The kinetics of the response to 10 μm ATP in CCD camera for CHOK1 cell line/mito25N03b.

Fig:The curve is dependent on the dose of ATP for cell lines CHOK1/mito25N03b.

Fig.9:Kinetics dependent on the dose of ATP for cell lines CHOK1/mito12mutCly obtained in the CCD camera when testing 500 cells/well 24 hours after seeding.

Figure 10:The curve is dependent on the dose of ATP for cell lines CHOK1/mito12mutCly obtained in the CCD camera with a different number of cells/well with different concentrations coelenterazine and incubation time.

11:The curve is dependent on the dose of ATP for cell lines CHOK1/cyto12mutCly obtained in the CCD camera, with a different number of cells/well.

Fig:The curve is dependent on the dose IMETIT for CHOK1 cell line/mito12mutCly/H3 obtained in the CCD camera, with a different number of cells/well.

Fig:The curve is dependent on the dose IMETIT for CHOK1 cell line/mito12mutCly/H3 obtained in the FLIPR3.

Fig:The curve is dependent on the dose of the A3 agonist (IB-MECA) is La CHOK1 cell line/mito25N03b-A3, received in Lumitox CCD camera, 500 cells/well, 24 hours after seeding, 5 μm coelenterazine. The sensitivity of the camera 5, the measurement is 60 seconds.

Fig:The curve is dependent on the dose of the A3 agonist (IB-MECA) for CHOK1 cell line/mito25N03b-A3 obtained in CyBi Lumax HT CCD camera, 2500 cells/well, 24 hours after seeding, 5 μm coelenterazine. The sensitivity of the camera HV 10 analog measurement 60 seconds.

Fig:The curve is dependent on the dose of the A3 agonist (IB-MECA) for CHOK1 cell line/mito25N03b-A3 obtained in FLIPTTETRA, 2500 cells/well, 24 hours after seeding, 10 μm coelenterazine. The exposure time of 2 seconds, an increase of 240.

EXAMPLES

1. Creating libraries by random mutagenesis and screening

A library of random mutants obtained using the set GeneMorph II Random Mutagenesis (Stratagene). To achieve high frequency of mutations using two different initial amounts of target DNA: 0.1 ng and 0.01 ng. All fluorescent activity check 83305 bacterial colonies. Of them 1089 are positive and, therefore, have bioluminescent properties. Just collect 289 the best of the colonies, one of them testing again finally selected the 16 best.

Figure 1 shows the results obtained on the curve depending on the dose CaCl2received 8 mutants.

2. The study fotobelov

Mix 5 ál) is operating mixed with 95 μl of phosphate buffer directly in 96-well tablet, which is installed in luminometer (Berthold). To initiate light emission fotobanka in the hole injected 5 PM CaCl2and record the luminescence for 10 sec.

Figure 2 shows the results of in vitro transcription and translation DNA 8 mutants.

Conduct a new experiment in vitro transcription and translation with the best mutant 25N03b (sequence ID n°16) and Fotoalbom aquarium (figure 3) for comparison of the light emission with the introduction of 1 mm CaCl2.

3. Recombinant photoblog curve and the concentration of calcium

Recombinant pocobelli, correspond to some of the mutants get under native conditions, following the Protocol of purification of small quantities of protein. Measure light emission after the introduction of 1 mm calcium, the corresponding kinetic curves presented in figure 4.

Recombinant mutant photoblog corresponding to clone 25N03b, better characterized by a full curve, depending on the dose of calcium, which is shown in figure 5.

In another experiment comparing recombinant photoblog 25N03b with recombinant aquarium. Light emission, recorded after the introduction of 1 mm CaCl2was higher in the case of mutant 25N03b, as shown in Fig.6.

4 Cellular functional studies

4.1CHOmito25N03b-expressing clone (CHOK1/mito25N03b) produced by transfection of cells CHO-Kl (see Materials and methods). After 48 hours the settlement of the E. transfection cells trypsinized and placed in a 10×96-well tablets MTP (Microtiter Plates) in a full environment MEM. At the confluence of the monolayer of cells 10×96 MTP duplicate using MATRIX (Hudson, NH, USA) in 10×96 white MTP. 3 hours before the measurement environment in the hole replaces 50 ál buffer Tyrode containing 2 mm Ca2+and 10 μm coelenterazine. Clones selected on the basis of their functional response (fluorescent signal) on ATP, which stimulates CHO endogenous P2Y receptor and increases the concentration of cytoplasmic Ca2+. At the end of each experiment, cells are lysed by perfusion of a solution of Triton X-100. Active photoblog restore, incubare cells with 10 µm coelenterazine dissolved in the buffer Tyrode containing 2 mm Ca2+in the dark at 37°C, 5% CO2atmosphere for 3 hours. For the measurement of light emission cells are lysed in the presence of calcium and record the emitted luminescence. The number of photons emitted in the first 30 seconds, integrating CCD camera and produce images on the screen. Cells transfetsirovannyh empty plasmid or not transfetsirovannyh, do not increase the emission of photons. To determine changes in the concentration of calcium injected with 10 μm ATP and determine the kinetics of the response. The obtained curve is presented on Fig.7.

The final clone were seeded in 384-well plate and check with the increasing concentrations of ATP, as shown on the curve depending on the dose Fig.

CHOK1 cell line/mito25N03b transferout G-blackwashed the m receptor, adenosine A3 receptor and chimeric Gα protein to switch the signal to the PLC/IP path. Create a stable cell line (hereinafter referred to as CHOK1/mito25N03b/A3 clone).

After stimulation by the agonist at the A3 receptor causes an increase in intracellular calcium concentration, which is measured by luminescence mito25N03b.

The final clones of CHO cell lines expressing mito25N03b and adenosine A3 receptor man, grow up to 80-95% confluence in monolayer culture Pleskach and collect trypsinization. Prepare cell cultivation of different density in 384-well the tablet in the growth medium (DMEM/F12 containing 10% fetal bovine serum), and incubated for 24 and 48 hours at 37°C in a humid incubator with 5% CO2. On the day of the experiment, remove the culture medium and to experiment with luminescence load cells 5 microns coelenterazine for 3 hours at 37°C in 5% CO2. Calcium response stimulated by the addition of ATP at different concentrations in each well. The kinetics of the monitor CCD camera, which introduces reagents and records the light emission for each hole.

Prepare cultivation of agonist and antagonist in various concentrations in the buffer Tirade. Approximately 25 μl of these solutions are injected separately into each well and measure the response of the CCD camera, the results are presented on Fig.

4.2To obtain cell lines CHOK1/mtol2mutCly CHOK1 cells transferout mutant 12mutCly (SEQ ID NO: 19), cloned in pcDNA3neo-mito (see Materials and methods).

The final clone is chosen based on the functional response (fluorescent signal) on ATP, which stimulates CHO endogenous P2Y receptor and increases the concentration of cytoplasmic Ca2+. At the end of each experiment, cells are lysed by perfusion of a solution containing Triton X-100. Active photoblog restore, incubare cells with 2.5 or 5 μm coelenterazine dissolved in the buffer Tyrode containing 2 mm Ca2+in the dark at 37°C, 5% CO2atmosphere for 3 hours. For the measurement of light emission cells are lysed in the presence of calcium and record the emitted luminescence. The number of photons emitted in the first 30 seconds, integrate with a luminometer-based CCD camera and produce images on the screen. Cells transfetsirovannyh empty plasmid or not transfetsirovannyh, do not increase the emission of photons. Cells in different number seeded in 384 MTP. 24 hours later to determine changes in the concentration of calcium is administered various concentrations of ATP and determine the kinetics of the response. Examples of kinetic curves obtained by seeding 500 cells/well 24 hours prior to the test presented on Fig.9.

High light emission and the sensitivity of Ca2+observed in cell lines CHOK1/mitol2mutCly, allow you to use fewer cells and more Nisku the concentration coelenterazine even with less time compared to the standard conditions for cell-based studies fotobelov.

On figa and 10b show examples of curves depending on the dose of ATP obtained by seeding from 100 to 600 cells/well 24 hours before the test and incubation of the cells with 2.5 and 5 μm coelenterazine dissolved in the buffer Tyrode containing 2 mm Ca2+in the dark at 37°C, 5% CO2atmosphere for 2 and 3 hours.

CHOK1 cell line cytol2mutCly produced by transfection of cells CHO-Kl (see Materials and methods).

The final clone is chosen based on the functional response (fluorescent signal) on ATP, which stimulates CHO endogenous P2Y receptor and increases the concentration of cytoplasmic Ca2+. At the end of each experiment, cells are lysed by perfusion of a solution of Triton X-100. Active photoblog restore, incubare cells with 2.5 or 5 μm coelenterazine dissolved in the buffer Tyrode containing 2 mm Ca2+in the dark at 37°C, 5% CO2atmosphere for 3 hours. For the measurement of light emission cells are lysed in the presence of calcium and record the emitted luminescence. The number of photons emitted in the first 30 seconds integrate with a luminometer-based CCD camera and produce images on the screen. Cells transfetsirovannyh empty plasmid or not transfetsirovannyh, do not increase the emission of photons. Cells in different quantities seeded in 384 MTP. After 24 and 48 hours to determine changes in concentrations of calcium injected Atpv various concentrations and determine the kinetics of the response. Figure 11 shows curves of the dose of ATP obtained by seeding 500, 1000 and 2000 cells/well 24 hours before the test, and incubation of the cells with 2.5 and 5 μm coelenterazine dissolved in the buffer Tyrode containing 2 mm Ca2+in the dark at 37°C, 5% CO2atmosphere for 2 and 3 hours.

CHOK1 cell line mitol2mutCly transferout G-alexvasilevsk receptor, a histamine-3 receptor and chimeric Gα protein to switch the signal to the PLC/IP path. Create a stable cell line (hereinafter referred to as CHOK1/mito12mutCly/H3 cell line) (see Materials and methods).

After agonist stimulation (IMETIT) H3 receptor causes an increase in intracellular calcium concentration, which is measured by luminescence mito12mutCly.

On Fig shows curves of the dose IMETIT, obtained by planting 250, 500, 750 and 1000 cells/well 24 hours before the test and during the incubation of cells with 5 μm coelenterazine dissolved in the buffer Tyrode containing 2 mm Ca2+in the dark at 37°C, 5% CO2atmosphere for 2 and 3 hours.

5. Cell research in FLIPR

CHOK1/mito25N03b/A3 and CHOK1/mitol2mutCly/H3 test in FLIPR by measuring the luminescence signal-induced activation transfecting receptor. Measured in FLIPR luminescence are presented in units changes luminescence at Fig, which shows the measurement results of the light emission caused by the article is a while accumulation IMETIT on CHOK1/mitol2mutCly/H3. Seeded at 500 cells/well in 384 MTP 24 hours before the experiment. The medium removed and replaced with 25 μl coelenterazine double (2×) concentration (10 μm)dissolved in the buffer Tyrode containing 2 mm Ca2+at 3 hours in the dark at 37°C, 5% CO2atmosphere. Connection IMETIT (2×) in various concentrations is added to the cells (25 μl/well).

On Fig luminescence measured by the FLIPRTETRApresented in EFE (relative light units), which shows the results of the light emission caused by IB-MECA stimulation on CHOK1/mito25N03b/A3. Sow 2500 cells/well in 384 MTP 24 hours before the experiment. The medium is removed and instead use 25 ál of double (2×) concentration coelenterazine (10 μm)dissolved in the buffer Tyrode containing 2 mm Ca2+at 3 hours in the dark at 37°C, 5% CO2atmosphere. Compound IB-MECA (2×) in various concentrations is added to the cells (25 μl/well).

References

1. Kendall, J.M. and Badminton, M.N. (1998)Aequorea victoriabioluminescence moves into an exciting new era. Trends Biotechnology. 16(5):216-24.

2. Campbell, A.K., Hallet, R. A., Daw, M.E., Ryall, R.C., Hart and Herring, P.J. (1981) Application of the photoprotein obelin to the measurament of free Ca++in cells. In Bioluminescence and Chemiluminescence, basic Chemistry and Analytical applications (Edited by M.A. deLuca and W.D. McElroy), pp. 601-607. Academy Press, New York.

3. Herring, P.J. (1979) Some features of the bioluminescence of the radiolarianThalassicola sp. Mar. Biol. 53, 213-216.

4. Shimomura, O., Johnson F.H., and Saiga, Y (1962) Extraction, purification and properties of aequorin, a bioluminescent protein rom the luminous hydromedusan, Aequorea. J. Cell. Comp. Physiol. 59,223-239.

5. Shimomura, O., Johnson F.H., and Saiga, Y (1963) Further data on the bioluminescent protein, aequorin. J. Cell. Comp. Physiol. 62, 1-8.

6. Morin, J.G. and J.W. Hastings (1971) Biochemistry of the bioluminescence of colonial hydroids and other coelenterates. J. Cell. Physiol. 77, 305-311.

7. Shimomura, O., Johnson, F.H. and Saiga, Y. (1963) Extraction and properties of halistaurin, a bioluminescent protein from the hydromedusanHalistaura. J. Cell. Physiol. 62, 9-15.

8. Shimomura, O. and Shimomura, A. (1985) Halistaurin, phialidin and modified forms of aequorin as Ca++indicator in biological systems. Biochem. J. 228,745-749.

9. Levine, L.D., and Ward, W.W. (1982) Isolation and characterization of a photoprotein “phialidin” and a spectrally unique green-fluorescent protein from the bioluminescent jellyfishPhialidium gregarium. Comp. Biochem. Physiol. 72B,77-85.

10. Morin, J.G. and Hastings (1971) Energy transfer in a bioluminescent system. J. Cell. Physiol. 77, 313-318.

11. Campbell, A.K. (1974) Extraction, partial purification and properties of obelin the calcium-activated protein from the hydroidObelia geniculata. Biochem.J. 143,411-418.

12. Ward, W.W. and Selinger (1974) Extraction and purification of calcium-activated photoprotein from the ctenophoresMnemiopsis sp. andBern ovata. Biochemistry 13, 1491-1499.

13. Ward, W.W. and H.H. Seliger (1974) Properties of mnemiopsin, and berovin, calcium-activated photoproteins from the ctenophoresMnemiopsis sp. andVague ovata. Biochemistry 13, 1500-1510.

14. Johnson, F.H. and Shimomura, O. (1978) Introduction to the bioluminescence of Medusa, with special reference to the photoprotein aequorin. Methods Enzymol. 57,271-291.

15. Illarionov B.A., V.S. Bondar, Illarionova VA, Vysotski E.S. Sequence of the cDNA encoding the Ca++-activated photoprotein obelin from the hydroid polypObelia longissima. Gene. 1995 14;153(2):273-4.

16. Blinks, J. R., Weir, G. W., Hess, P. and Prendergast, F.G. (1982). Measurement of Ca++concentrations in living cells. Prog. Biophys. Mol. Biol. 40,1-114.

17. Markova S.V., Vysotski E.S., J.R. Blinks, Burakova L.P., Wang, B.C., J. Le, (2002) Obelin from the bioluminescent marine hydroid Obelia geniculata: cloning, expression and comparison of some properties with those of other Ca2+-regulated photoproteins. Biochemistry. 2002 Mar 19;41(7):2227-36.

18. Inouye s, Tsuji F.I. (1993) Cloning and sequence analysis of cDNA for the Ca(2+)-activated photoprotein, clytin. FEBS Lett. Jan 11;315(3):343-6.

19. F.I. Tsuji, Y. Ohmiya, Fagan T.F., Toh H., Inouye, S. (1995) Molecular evolution of the Ca(2+)-binding photoproteins of the Hydrozoa. Photochem Photobiol. Oct 62(4):657-61.

20. Rizzuto, R., Simpson, A.W.M., Brini, M. and Pozzan, T. (1992) Rapid changes of mitochondrial Ca2+ revealed by specifically targeted recombinant aequorin. Nature, 358, 325-328.

21. Rizzuto, R., Brini, M., Murgia, M. and Pozzan, T. (1993) Microdomains with high Ca2+ close to IP3-sensitive channels that are sensed by neighbouring mitochondria. Science, 262, 744-747.

22. Rizzuto, R., Bastianutto, C., Brini, M., Murgia, M. and Pozzan, T. (1994) Mitochondrial Ca2+ homeostasis in intact cells. J. Cell Biol., 126, 1183-1194.

1. Selected photoblog, representing the intracellular calcium indicator containing the amino acid sequence, which
a) capable of binding coelenterazine and calcium, producing bioluminescence;
b) identical, at least 90% to SEQ ID NO: 1 (Klitin);
) the alignment of the sequences SEQ ID NO: 1, represents one of the following single or multiple substitutions (positions of the balance related to SEQ ID NO: 1):
i) C54→S;
ii) S132→C;
iii)48→R, N195→D;
iv) Q68→R, A90→V, T184→I;
v) Y82→F, K110→N, F125→L149→R;
vi) G142→C;
vii) I53→V, S149→R;
viii) N18→D, I40→V, K56→R;
ix) Gly58→Glu, Asp69→Val, Ala70→Cys, Lys76→Arg, Lys77→Gly, Ile78→Cys, Asp81→Glu, Val86→Ile, Glu87→Ala, Ala90→Gln, Val92→Leu and Glu97→Gln.

2. Photoblog according to claim 1, containing an amino acid sequence identical, at least 95% to SEQ ID NO: 1.

3. Photoblog according to claim 2, containing an amino acid sequence identical, at least 98% of SEQ ID NO: 1.

4. Photoblog according to claim 3, containing an amino acid sequence that is selected from the group consisting of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9 and 10.

5. Photoblog according to claims 1-4, where the sequence is additionally connected with a mitochondrial target sequence.

6. Selected polynucleotide encoding of fotoblog according to claims 1-5.

7. Polynucleotide according to claim 6, having the sequence SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18 or 19.

8. The expression vector containing polynucleotide on any of PP and 7.

9. Prokaryotic or eukaryotic cell-host for the radio is of fotobanka according to claims 1-5, containing the vector of claim 8.

10. A host cell of the mammal for product fotobanka according to claims 1-5, as defined in item 9.

11. Method for determining changes in intracellular calcium concentration in vitro, which includes:
a) providing a cell expression fotobanka according to claims 1-5;
b) load cells coelenterazine;
c) the interaction of a cell with an agent that causes calcium influx into the cell or the release of calcium from intracellular storage;
d) determining botobekovy bioluminescence.

12. The method according to claim 11, which is performed in high throughput format.

13. The method according to item 12, which is performed with high-performance optical screening device for mnogobrojnog analysis.

14. Method of screening compounds for modulation of the concentration of intracellular calcium, which includes:
a) providing a cell expression fotobanka according to claims 1-5;
b) load cells coelenterazine;
c) interaction of cells with the connection candidate;
d) determining the bioluminescence fotobanka.

15. The method according to 14, which is performed in high throughput format.

16. The method according to clause 15, which comply with high performance optical screening device for mnogobrojnog analysis.

17. Application fotobanka according to claims 1-5 as an indicator of intracellular calcium.

18. Application fotobanka on 17 in to Econom high-performance research.

19. Application fotobanka according to claims 1 to 5 for the manufacture of a diagnostic composition.



 

Same patents:

FIELD: medicine.

SUBSTANCE: in order to realise the method level of ferritin in blood serum and bile bladder tissue, rang point is defined, and ferritin values in serum from 0 to 10 ng/ml, and bile bladder from 0 to 0.25 mg/l - are taken for 1 point, respectively, level of ferritin in serum 70 ng/ml is taken as 7 points, and in bile bladder tissue 0.75 mg/l is taken as 3 point, and if sum is 10 points, conclusion is made about non-destructive cholecystitis, and if sum is from 10 points conclusion about destructive cholecystitis is made.

EFFECT: application of invention allows to increase accuracy of diagnostics of bile bladder tissue destruction in acute cholecystitis.

3 ex

FIELD: medicine.

SUBSTANCE: invention relates to pharmacology. Medication for brain cell protection contains dominant protein extract from placenta tissue, obtained by chromatographic separation of protein fraction of 8-10 components with total molecular weight from 15 to 200 kDa, 70-80% of fraction consisting of protein with molecular weight about 70 kDa. In order to obtain said medication powdered placenta is extracted by means of alkalescent buffer in presence of inhibitors of proteolytic protein cleavage and centrifuged. Centrifugate is passed through chromatographic column with anion-exchange carriers balanced by means of the same buffer, column is washed from unbound material, proteins are eluted with neutral salt solution. Collected material is diluted with water bringing pH to subacid value and diluted substrate is successively passed through column with anion-exchange carrier and column with cation-exchange carrier, balanced with buffer solutions to pH about 6.0. Final product is obtained after sterilisation.

EFFECT: method application allows to obtain efficient medication of high purity, normalising nervous system functions.

3 cl, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of medicine, namely to surgery. Blood is sampled from cubital vein in patients with acute pancreatitis on 1-3 and 7-10 day from disease beginning. Level of blood serum myoglobin is determined by method of performing reaction of passive hemagglutination. If level of blood serum myoglobin on 1-3 day increase from 95 to 128 ng/ml, acute fatty pancreatic necrosis is diagnosed, if myoglobin level in blood serum is higher than 128 ng/ml, hemorrhagic pancreatic necrosis is diagnosed, and if level of myoglobin in blood serum on 7-10 day increases higher than 256 ng/ml, hemorrhagic pancreatic necrosis in stage of infection of pancreatic necrosis nidus is diagnosed.

EFFECT: method allows to correct drug therapy and individually ground tactics of treating patients with acute pancreatitis depending on severity of disease form and presence of infection.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: there is offered an arteriosclerosis diagnostic technique based on the detection of various combinations of specific polypeptide markers. To detect the presence or absence of polypeptide marker, capillary electrophoresis, gaseous-phase ion spectrometry and/or mass spectrometry are used.

EFFECT: method allows early high-probability minimally invasive arteriosclerosis detection.

13 cl, 1 ex, 5 tbl

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to leprology, and can be used particularly for the detection of specific liver disease in the leprosy patients. Blood serum of the leprosy patients is analysed to determine the level of US-M.leprae and DIS-BSA leprosy mycobacteria antigen antibodies, and also the concentration of alpha-1-antitrypsin. If observing the level of antibodies to two antigens increased as compared to a norm and the concentration of alpha-1-antitrypsin increased higher than 346.7 mg/dl, liver disease is detected in the leprosy patients.

EFFECT: method provides higher accuracy.

4 ex

FIELD: medicine.

SUBSTANCE: essence of invention includes selection of sample for testing from area of malignant affection in patient, suffering from cancer of large intestine, selection of control sample, measurement of the level of one or several genetic markers, selected from the group, comparison of measured levels in experimental samples with control ones. Reducing of levels of one or several genetic markers in comparison with control sample, indicates increased resistance to docetaxel. Also described are sets which allow to predict or realise monitoring of patient's response to docetaxel.

EFFECT: identification of genetic markers, by which it is possible to realise patient's response to chemical therapy by docetaxel.

18 cl, 9 ex, 3 tbl, 16 dwg

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to molecular biology and can be used in designing agent and methods of modulating body functions associated with HGF/c-met signalling pathway. The invention discloses HGF/c-met polypeptide-antagonists which are mutant forms of HGF which contain a mutation in the N-terminal part of the β-chain and/or in its dimerisation part. The disclosed polypeptides have lower biological activity compared to wild type HGG and can be used in modulating activity of c-met, cell proliferation, cell migration and angiogenic cell activity.

EFFECT: invention describes a method of obtaining HGF muteins using DNA recombinant technology and agents which are necessary for its existence.

22 cl, 8 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: in order to predict insufficiency of saturation with oxygen of peripheral blood of pregnant women who have herpes-virus infection, content of glucose-6-phosphat-dehydrogenase and TNFα in peripheral blood is determined. Discriminant equation D=-0.589·G-6-PDG+{+1.23·TNFα} is solved. If value of discriminant function is equal or greater than 89.95, predicted is development of oxygen insufficiency, accompanied with reduction in peripheral blood of pregnant women of pO2 with titre of antibodies to Herpes simplex virus 1:12800 to 27.63±0.7 mm Hg, and of HbO2 to 90.2±0.47% (control: pO2 - 39.22±0.5 mm Hg; HbO2 - 95.3±0.27%).

EFFECT: increased accuracy of determining possibility of development of oxygen insufficiency in pregnant woman with herpes-virus infection.

3 tbl

FIELD: medicine.

SUBSTANCE: in estimation of local inflammation activity in case of background diseases of neck of uterus sampling of analysed biomaterial is performed by bringing of device for native material removal to external neck of uterus fauces. Said device has elongated holder in form of rod with length, exceeding length of vagina. From distal side of rod, at angle to it, located is operation element in form of roller. Proximal end of rod serves as manipulator-handle. Sampled material is placed until complete submergence into tightly closable test tube, filled with 1.0 ml of 0.155 M solution of sodium chloride. Mixture is centrifuged for 10 minutes. Obtained materials are analysed by method of solid phase ELISA analysis on boards by means of set of reagents "Vector-Best". Concentration of cytokine of interleukin-6 in analysed samples is determined spectrophotometrically. If value is higher than 50 pg/ml to 92 pg/ml, conclusion about presence of chronic inflammation process is made. If value is higher than 92 pg/ml, conclusion about active course of inflammatory process and expressed immune response is made.

EFFECT: application of method allows to increase quality of analysed native material and accuracy of obtained result without complicating analysis process.

2 cl, 3 ex

FIELD: medicine.

SUBSTANCE: invention can be used for diagnostics of presence of destructive process in uterine appendages in case of localised peritonitis if gynecological genesis, and for selection of optimal treatment tactics. In order to realise the method content of C-reactive protein (CRP) in blood serum is determined by turbodimetric method, if values of C-reactive protein content are 130 mg/l and higher, purulent-destructive process in uterine appendages in case of localised peritonitis is diagnosed, if values of C-reactive protein content are lower than 130 mg/l diagnosed is purulent salpingitis in case of pelvioperitonitis.

EFFECT: application of method allows to detect presence of purulent-destructive process in uterine appendages in case of pelvioperitonitis in urgent way, which determines tactics of further treatment.

2 ex

FIELD: medicine.

SUBSTANCE: invention can be used for screening of anti-tumour preparations in vivo, in particular for screening synthetic and natural substances with potential anti-tumour activity.

EFFECT: claimed invention makes it possible to create stable cell line of human ovarian adenocarcinoma.

2 dwg, 2 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to molecular biology and can be used in designing agent and methods of modulating body functions associated with HGF/c-met signalling pathway. The invention discloses HGF/c-met polypeptide-antagonists which are mutant forms of HGF which contain a mutation in the N-terminal part of the β-chain and/or in its dimerisation part. The disclosed polypeptides have lower biological activity compared to wild type HGG and can be used in modulating activity of c-met, cell proliferation, cell migration and angiogenic cell activity.

EFFECT: invention describes a method of obtaining HGF muteins using DNA recombinant technology and agents which are necessary for its existence.

22 cl, 8 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: purified RNA synthesised in vitro by nonviral transfection is introduced into placental and cord cells. RNA comprises at least one sequence providing cell transition to a pluripotent state.

EFFECT: method allows increasing efficiency of preparing selected somatic pluripotent cells, reducing probability of oncogenesis and other negative consequences of cell reprogramming, and eliminating invasiveness at the stage of preparation of the cell material.

10 dwg, 3 ex

FIELD: agriculture.

SUBSTANCE: nucleotide sequences, which code polypeptides of resistance to glyphosate are used in structures of DNA or expression cassettes for transformation or expression in organisms, including microorganisms and plants.

EFFECT: transformed organisms become resistant to herbicide.

17 cl, 5 dwg, 11 tbl, 23 ex

FIELD: medicine.

SUBSTANCE: method facilitates linkage of sequences, coding immunoglobulin variable regions, T-cells receptors or B-cells receptors. Method is instrument of higher effectivity for making sequence data libraries. Capability of multiple RT-PCR with chain extension by interruption with employment of matrix, derived from single cell, provides highly effective creation of sister pairs libraries.

EFFECT: method is effective for linkage of two or few nucleotide sequences, coding domens or subunits of heteromeric protein as a result of single reaction performance.

51 cl, 25 dwg, 27 tbl, 14 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, specifically obtaining hemopoietic cells from blood, and may be used in medicine. The homopoietic cell CD34+ is extracted from peripheral blood of cancer patients undergone a growth factor treatment course. The obtained cell is transduced by a ligand which induces apoptosis with participation of the tumour necrosis factor, and is used to treat tumours.

EFFECT: invention enables to obtain a hemopoietic cell CD34+ which has anti-tumuor activity.

6 cl, 3 dwg, 8 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, particularly to a method of treating ophthalmopathies. The method of treating an ophthalmopathy in a mammal by recovery from mammal's bone marrow of a population of haematopoietic stem cells of a negative lineage which includes precursor endotheliocytes, transfection of the prepared population with a gene which functionally codes a fragment of antiangiogenic protein T2 of human tryptophanyl-tRNA-synthetase, and the following introduction in a vitreous body of the population of transfected cells in amount sufficient for symptomatic relief. The method of transgene delivery in a retinal vasculature of the mammal by introducing in the mammal's vitreous body of the population of haematopoietic stem cells of the negative lineage including precursor endotheliocytes where the cells are transfected with the antiangiogenic fragment of protein T2 of human tryptophanyl-tRNA-synthetase.

EFFECT: method of treating the ophthalmopathy is novel and highly effective.

2 cl, 27 dwg, 2 tbl, 10 ex

FIELD: agriculture.

SUBSTANCE: invention includes compositions, methods and cell lines related to insect control. Substance of invention includes compositions that contains vegetable essences purposely acting at least at one receptor of insects selected from the following - tyramine receptor , olfactory receptor Or83b or olfactory receptor Or43a, as a result of which intracellular levels cAMP, Ca+2 or both vary in insects. Also invention includes method of insect control, line of insects cells including sequence of nucleic acid of above mentioned receptors and methods for selection of composition by activity in respect to insects with application of specified line of insect cells.

EFFECT: development of softer sparing compositions that are not toxic for mammals and other types.

20 cl, 34 dwg, 1 tbl, 33 ex

FIELD: food industry.

SUBSTANCE: strain Streptococcus thermophilus which produces lactic acid is described. Sequence of nucleic acids made of the strain producing polysaccharides are also described as well as food or pharmaceutical composition and milk product containing such strain.

EFFECT: strain has strong structural properties.

16 cl, 4 dwg, 6 tbl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: this invention is related to the field of biotechnology and may be used in production of various protein products with the help of recombinant DNA technology. New sequences of DNA are defined and generated, which are related to matrix attachment region, which are characterised by ability to improve producing of protein in eukaryotic cells.

EFFECT: methods are suggested for transfection of eukaryotic master cells, including new method of multiple transfection, based on use of active sequenes of DNA MAR according to invention and providing for substantial increase of recombinant protein expression level compared to similar cells transfected by traditional methods.

11 cl, 21 dwg, 9 tbl, 17 ex

FIELD: medicine.

SUBSTANCE: there is constructed recombinant plasmid protein-coding DNA pET22b(+)/"вд"-Links 1, which contains Ndel/BamHI -fragment of DNA of pET22b(+) plasmid and artificial DNA sequence, coding Ndel/BamHI fragment, which includes synthetic gene of human water-soluble domain Links 1, containing unique sites of recognition by restriction endonucleases, which have the following coordinates: Xhol - 158, Hindlll - 173, EcoRI - 192, BamHI - 198, Ndel - 430, Bglll - 534, Mlul - 1256, Pstl - 4495. Strain - protein-producent is obtained by transformation of competent cells of Escherichia coli BL21 (DE3) with recombinant plasmid pET22b(+)/"вд"-Links 1.

EFFECT: invention allows to obtain protein with structure and properties identical to structure and properties of natural water-soluble domain of human protein Links 1 in sufficient amount, measured in milligrams.

2 cl, 1 tbl, 4 dwg, 4 ex

Up!