Aptameric therapeutic agents applicable for treating complement-related disorders

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to substances and methods of treatment, prevention and improvement of the complement-related disease. There are offered various therapeutically effective aptamer/PEG conjugates. Aptamers under the present invention contain modified nucleotides that improves their resistance to enzymatic and chemical destruction, as well as to thermal and physical destruction. These aptamer/PEG conjugates are applicable as agent for therapy of the complement-related cardiac, inflammatory and autoimmune disorders, ischemia reperfusion injury and/or the other diseases or disorders wherein C5-mediated complement activation is involved.

EFFECT: development of the new agent and method of treatment, prevention and improvement of the complement-related disease.

20 cl, 67 dwg, 7 tbl, 6 ex

 

The technical FIELD TO WHICH the INVENTION RELATES.

The invention in General relates to the field of nucleic acids and more particularly to aptamers capable of contact with the protein C5 of the complement system, applicable as a means for therapy and diagnosis-related complement cardiac, inflammatory and autoimmune disorders, ischemic reperfusion injury and/or other diseases or disorders involving the C5 mediated activation of complement. In addition, the invention relates to agents and methods of administration of aptamers capable of contact with the protein of the complement system C5.

The LEVEL of TECHNOLOGY

Aptamers are molecules of nucleic acids with specific affinity binding molecules through other interactions other than classic pairing according to the Watson-Crick.

Aptamers like peptides created using phage display, or monoclonal antibodies ("Mat") can specifically bind to a selected target and modulate the activity of the targets, for example, by binding aptamers can block the ability of the target to function. Created by way of selection in vitro of pools of oligonucleotides with random sequences of the aptamers were established more than 100 is elkow, including growth factors, transcription factors, enzymes, immunoglobulins and receptors. A typical aptamer has a rate of 10-15 KD (30-45 nucleotides), binds its target with subnanomolar affinity and distinguishes between closely related targets (e.g., aptamers usually should not bind other proteins from the same gene family). The number of structural studies have shown that aptamers can use the same types of interactions at the binding (for example, hydrogen bonds, electrostatic complementarity, hydrophobic interactions, steric exclusion)that control the affinity and specificity of the complexes of the antibody-antigen.

Aptamers have a number of properties required for use as therapeutic agents and diagnostic tools, including high specificity and affinity, biological efficiency and excellent pharmacokinetic properties. In addition, they provide specific competitive advantages over antibodies and other proteins or biological means, such as the following:

1) Speed and control. Aptamers get a fully in vitro method that allows you to quickly create the initial options, including therapeutic options. Selection in vitro gives you the ability to carefully control the specificity and AF is innosti) and allows you to create options including options as against toxic and against non-immunogenic targets.

2) the Toxicity and immunogenicity. Aptamers as a class have maloprodaja toxicity or immunogenicity, or does not have. For chronic administration to rats or marmots doses containing high levels of aptamer (10 mg/kg / day for 90 days)were observed toxicity in any of the clinical, cellular, or biochemical measurements. While the effectiveness of many monoclonal antibodies can be severely limited by the immune response to the antibody, it is extremely difficult to induce formation of antibodies aptamers, most probably because aptamers can not be presented to T cells by MHC and immune response usually not prepared to learn the nucleic acid fragments.

3) Introduction. While the majority as currently approved by therapeutic antibody is administered by intravenous infusion (usually within 2-4 hours), aptamers can be administered by subcutaneous injection (bioavailability of aptamers after subcutaneous administration is >80% in studies on monkeys (Tucker et al., J. Chromatography B. 732: 203-212, 1999)). This difference mainly is a consequence of the relatively low solubility and, consequently, large volumes required in the case of most therapeutic the ski Mat. Thanks to the good solubility (>150 mg/ml) and relatively low molecular weight (aptamers: 10-50 KD; antibody: 150 KD) weekly dose of aptamer can be delivered by injection amount to less than 0.5 μl. In addition, the small size of aptamers allows them to penetrate in the field, conformationally restricted, which can not penetrate the antibodies or fragments of antibodies, which is another advantage of therapeutic or prophylactic agents based on aptamer.

4) Scalability and cost. Therapeutic aptamers are chemically synthesized, and therefore, their synthesis can easily scale to meet the need to obtain. While the difficulties of large-scale production currently restrict the availability of some biological resources, and capital costs for large-scale production of proteins huge, one large-scale synthesis of oligonucleotides can give more than 100 kg/year and requires a relatively modest initial investment. The current cost of materials for the synthesis of aptamers in scale, measured in kilograms, is estimated at $500/year, which is comparable to the cost of obtaining a highly optimized antibodies. Assume that the continuing improvement of the method development will reduce the cost of material is ealy to < $100/year for five years.

5) Stability. Therapeutic aptamers are chemically resistant. They actually adapted to the recovery of activity after exposure to factors such as heat and denaturing agents, and can be stored for long periods (>1 year) at room temperature in the form of lyophilized powder.

The complement system

The complement system consists of a group of at least 20 plasma and membrane proteins that act together in a regulated cascade system, attacking the extracellular forms of pathogens (e.g. bacteria). The complement system includes two separate enzyme-activated cascade, classic and alternative pathways (figure 1) and non-enzymatic way, known as the formation of the formation of the membrane attack complex.

The first enzyme-activated cascade, known as the classical path contains several components C1, C4, C2, C3, and C5 (listed in order of position in the path). Initiation of the classical pathway of the complement system occurs after binding and activation of the first component of complement (C1) both immune and non-immune activators. C1 contains Kalnyshevsky complex components C1q, C1r and C1s, and is activated by the binding component C1q. C1q contains six identical subunits, each with jedinica contains three chains (chains A, B and C). Each strand has a region of globular head, which is associated with collagenopathy tail. Binding and activation of C1q complexes antigen-antibody occurs through a region of C1q heads. Numerous non-antibody activators C1q, including proteins, lipids and nucleic acids that bind C1q and activate through the distal site on collagenopathy area "barrel". Then the C1qrs complex catalyzes the activation of complement components C4 and C2 to form C4bC2a complex, which functions as convertase C3.

The second enzyme-activated cascade, known as the alternative path is fast, independent of antibodies by activating and strengthening the complement system. An alternative path contains several components, C3, factor B and factor D (listed in order of position in the path). Activation of the alternative pathway occurs when C3b, shape, formed by the proteolytic cleavage of C3, is associated with activating a surface agent such as a bacterium. Factor B then binds to C3b and is cleaved by factor D, giving the active enzyme Ba. The enzyme Ba then further splits C3, creating additional amount of C3b, which leads to extensive deposition of C3b complexes-Ba on the activating surface.

Thus, both the classical and alternate wny way of complement produce convertase C3, which decompose the factor C3 to C3a and C3b. At this point both convertase C3 are going to convertase C5 (C4b2a3b and C3b3bBb). Then these complexes decompose a component of complement C5 into two components: the C5a polypeptide (9 KD) and the polypeptide C5b (170 KD). The C5a polypeptide associated with 7 transmembrane fragments associated with G-protein receptor, which was originally associated with leukocytes and which, as we know currently, is expressed in many tissues, including hepatocytes and neurons. Molecule C5a is a major chemotactic component of the human complement system and can run a variety of biological responses, including chemotaxis of leukocytes, smooth muscle contraction, activation of intracellular pathways of signal transduction, adhesion of neutrophils to the endothelium, the release of cytokines and lipid mediators and the formation of oxidants.

The larger fragment C5b consistently associated with more distant components of the complement cascade C6, C7, C8 and C9 with the formation of the formation of the membrane attack complex C5b-9 (MAC). MAC, C5b-9 can directly lyse the erythrocytes and in large quantities it is lytic for white blood cells and damage to tissues, such as muscle, epithelial and endothelial cells. In suboticki quantities MAC can stimulate increasing regulation of molecules and is gesie, the increase in intracellular calcium and the release of cytokines. In addition, MAC, C5b-9 can stimulate these cells, like endothelial cells and platelets, without causing cell lysis. Naliticheskie effects of C5a and MAC, C5b-9 is sometimes quite similar.

Although the complement system plays an important role in maintaining health, it can cause or contribute to disease. For example, the complement system is involved in the side effects related to transplant surgery for coronary artery bypass ("CABG"), numerous renal, rheumatologic, neurological, dermatological, hematological, cardiovascular/pulmonary, allergic, infectious and associated with biocompatibility/shock diseases and/or conditions and diabetic retinopathy. The complement system is not necessarily the only cause of pathological conditions, but it may be one of several factors that contribute to pathogenesis.

In Fitch et al., Circ. 100: 2499-506 (1999) tested the effect of single-chain fragment antibody against C5, pexelizumab on patients undergoing transplant surgery for coronary artery bypass in extracorporeal circulation ("CPB"). Individual patients were injected pexelizumab within 10 minutes, a single bolus dose immediately before CPB, the composition of the managing 0.5 mg/kg, 1.0 mg/kg and 2.0 mg/kg, Took blood samples and tested in relation to the activity of the complement before the introduction of the dose after 5 minutes after administration of the dose after 5 min at 28°C after re-warming, after 5 min at 37°C and up to 7 days after CPB. Pharmacodynamic analysis showed a significant dose-dependent inhibition of the hemolytic activity of the complement over a period of time up to 14 hours at a dose of 2 mg/kg and the formation of Pro-inflammatory by-products of complement (sC5b-9) effectively inhibited dependent on dose. However, as indicated previously, therapeutic antibodies have certain limitations.

Accordingly, it would be useful to have new inhibitors of the complement system for use as therapeutic and diagnostic tools in the treatment connected with complement disorders.

BRIEF DESCRIPTION of DRAWINGS

Figure 1 is an illustration depicting classical and alternative pathways of the complement system.

Figure 2 is a schematic representation of the method of selection of aptamers in vitro (SELEXTMfrom pools of oligonucleotides containing random sequence.

Figa is an illustration depicting the nucleotide sequence and secondary structure of the anti-C5-aptamer (SEQ ID NO: 1), in which the underlined residues are 2'-H-pyrimidine OST DAMI, or 2'-torpedinidae remains enclosed in the frame rests are either 2'-torpedinidae residues or 2'-OMe-pyrimidine residues, and residues indicated by an arrow (→)represent residues, which must contain 2'-fluoro-modification.

Figv is an illustration depicting the nucleotide sequence and secondary structure of the anti-C5-aptamer ARC330 (SEQ ID NO: 2), which are enclosed in circles residues are 2'-H-remnants, the remains of a pyrimidine is 2'-fluorine-substituted, and the majority of the purine residues are 2'-OMe-substituted except for three residues, 2'-OH purine shown by the path.

Figs is an illustration depicting the nucleotide sequence and secondary structure of the anti-C5-aptamer ARC186 (SEQ ID NO: 4), in which all 21 the remainder of pyrimidine 2'-fluoro-modification, and the majority of the purine residues (14 residues) are 2'-OMe modification except for three residues, 2'-OH purine shown by the path.

Figure 4 is an illustration of a branched PEG (1,3-bis(MPEG-[20 CD])-propyl-2-(4'-butamid) Mm 40 KD.

Figure 5 is an illustration of a branched PEG (1,3-bis(MPEG-[20 CD])-propyl-2-(4'-butamid) with 40 Mm KD associated with the 5'-end of the aptamer.

6 is an illustration depicting various methods of synthesis of macromolecular conjugates of PEG-nucleic acid.

On figa the rendered graph comparing a dose-dependent inhibition of hemolysis pegylated anti-C5-aptamers (ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5)) with inhibition of non-pegylated anti-C5-aptamer (ARC186 (SEQ ID NO: 4)); figv shows a table of values IC50the aptamers used in the analysis of hemolysis, depicted on figa; figs is a graph comparing dose-dependent inhibition of hemolysis pegylated anti-C5 the aptamers ARC187 (SEQ ID NO: 5), ARC1537 (SEQ ID NO: 65), ARC1730 (SEQ ID NO: (66) and ARC1905 (SEQ ID NO: 67); fig.7D shows a table of values IC50the aptamers used in the analysis of hemolysis, depicted on figs.

Fig is a graph of inhibition of hemolysis in the interest of anti-C5-aptamer ARC658 (SEQ ID NO: 62) for serum complement macaques-Griboedov compared with serum complement of man.

Fig.9 is a graph depicting the binding of ARC186 (SEQ ID NO: 4) with purified protein C5 as at 37°C and at room temperature (23°C) after 15 minutes of incubation.

Figure 10 shows another graph depicting the binding of ARC186 (SEQ ID NO: 4) with purified protein C5 as at 37°C and at room temperature (23°C) after 4-hour incubation.

11 is a graph showing the time course of dissociation of the complex C5•ARC186 at 23°C.

Fig is a graph showing the time course of the equilibrium in the formation of complex C5•RC186 at 23°C.

Fig is a graph depicting the binding of ARC186 (SEQ ID NO: 4) with C5 protein compared to the protein components located above and below in the complement cascade.

Fig is a graph depicting the percentage of radioactive ARC186 (SEQ ID NO: 4), which binds to C5 in the presence of unlabeled competitor ARC186 (SEQ ID NO: 4), ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) or ARC187 (SEQ ID NO: 5).

Fig is a graph depicting the amount of protein of the complement C5b produced in blood samples incubated for 5 hours at 25°C and 37°C in the presence of different concentrations of aptamer ARC186 (SEQ ID NO: 4).

Fig is a graph depicting the inhibition of complement in percent under the action of ARC187 (SEQ ID NO: 5) in the presence of zymosan in undiluted human serum, citrate whole blood or serum macaques-Griboedov.

Fig is a graph showing that ARC658 (SEQ ID NO: 62) completely inhibits the activation of complement (C5a) in the model through the loop of the tube described in example 1D.

Fig is a graph depicting the dissociation constants for pools, received a 10-round selection C5. Dissociation constants (Kd) were estimated by fitting data to the equation: fraction bound RNA = amplitude *Kd/(Kd+ [C5]). "ARC520" (SEQ ID NO: 70) refers to the native is not subjected to the selection pool dRmY, and "+" indicates the presence of Conquero is the pollutant specific (0.1 mg/ml tRNA, 0.1 mg/ml DNA salmon sperm).

Fig is a graph depicting curves dissociation constants clones C5. Dissociation constants (Kd) were estimated by fitting data to the equation: fraction bound RNA = amplitude*Kd/(Kd+ [C5]).

Fig is a graph depicting a curve IC50that illustrates the inhibiting effect on the activity of hemolysis of different concentrations of anti-C5-aptamer clone ARC913 (SEQ ID NO: 75), compared with ARC186 (SEQ ID NO: 4).

Fig is an illustration depicting the structure of ARC187 (SEQ ID NO: 5).

Fig is an illustration depicting the structure of ARC1905 (SEQ ID NO: 67).

On Fig shows a table, which outlines the design of the experiment in the first study isolated perfusing heart.

Fig is a graph comparing the entry pressure against intraventricular pressure in the left ventricle (LV) isolated rat heart, which was affected by human plasma (A), with a record of pressure LVP isolated rat heart, which was affected by solution control aptamer (B).

Fig is a graph comparing the entry pressure against intraventricular pressure in the left ventricle (LV), isolated hearts, which impacted molar equivalent of 10X and 50X solutions)/C5 (in this case it is considered that the concentration of C5 in normal undiluted p is the AZM person is about 500 nm).

Fig is a graph comparing the changes in heart rate in beats per minute (tank/min) in isolated hearts of mice after exposure to human plasma and various solutions plasma/aptamer.

Fig is a graph comparing the changes in the mass of the heart in isolated hearts of mice before and after exposure to human plasma containing 0-1X molar ratio of ARC186 (SEQ ID NO: 4) (failure of the heart) or 10-50X molar ratio (heart, protected by C5 aptamer).

Fig is a graph comparing the relative product C5a in plasma containing different concentrations of aptamer, after perfusion of isolated rat hearts. The relative concentrations of C5a pending on the graph in the form of units of absorption (Ab), with higher values reflect the presence of higher levels of C5a.

Fig is a graph comparing the relative products of soluble C5b-9 in plasma containing different concentrations of aptamer, after perfusion of isolated rat hearts.

Fig is a graph showing the influence of ARC186 (SEQ ID NO: 4) on the cleavage of C3 in the exudate heart of a mouse.

On Fig a table showing the results of immunohistochemical staining in the case study isolated perfusing mouse hearts.

On Fig a table showing molar the f ratio ARC658 (SEQ ID NO: 62), necessary in human serum or primacy to protect the heart from indirect C5b damage.

Fig is a graph showing the log-linear graph of the residual amount of full-ARC186 in percent as a function of time of incubation in plasma of rats and macaques-Griboedov.

On Fig presents a table showing the design of the experiment in the case of pharmacokinetic studies in rats, Sprague-Dawley, which is described in example 5.

On Fig presents a table showing the average concentration in plasma ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) or ARC187 (SEQ ID NO: 5) against time in rats, Sprague-Dawley.

Fig is a graph depicting the mean plasma concentration ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5) over time after intravenous injection of aptamer rats.

On Fig presents a table showing still made on the analysis of concentrations depending on the time data, is shown in Fig. 35 and 36.

On figa a table showing the design of pharmacokinetic studies ARC187 (SEQ ID NO: 5) and ARC1905 (SEQ ID NO: 67) in mice; figv is a graph depicting the pharmacokinetic profile of ARC187 (SEQ ID NO: 5) and ARC1905 (SEQ ID NO: 67) in mice CD-1 after a single bolus/-introduction; figs a table showing still made on the analysis of concentration depending on the time data, the image is Agen on figv.

On Fig a table showing the identification of the listed aptamers in the heart tissue of mice after intravenous injection.

On Fig a table showing the design of the experiment in case study 1 animals described in example 5E.

On Fig a table showing the concentration of aptamer plasma depending on time after intravenous bolus injection of aptamer makaka-rabadam.

On Fig presents a table that lists the pharmacokinetic parameters for ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5, intravenous makaka-rabadam in study 1.

Fig. 43A and 43C are diagrams depicting the concentration in the plasma sC5b-9 and C5a depending on time after intravenous administration of anti-C5 aptamer ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) or ARC187 (SEQ ID NO: 5) makaka-rabadam; Fig. 43B and 43D are graphs depicting the concentration in the plasma sC5b-9 and C5a against the concentrations of anti-C5 aptamer ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) or ARC187 (SEQ ID NO: 5).

On Fig presents a table showing the design of experiment study 2, described in example 5F.

Fig is a graph showing the average concentration of the aptamer in plasma at various time points after intravenous ARC658 (SEQ ID NO: 62) or ARC187 (SEQ ID NO: 5) makaka-rabadam.

On Fig table presents the and, showing double analysis of concentration depending on time after intravenous bolus injection of aptamer makaka-rabadam.

Fig is a graph depicting the concentration of C5b-9 depending on the concentration of ARC187 (SEQ ID NO: 5) or ARC658 (SEQ ID NO: 62) in the presence of zymosan plasma macaques-Griboedov.

Fig is a graph depicting the concentration of C5a depending on the concentration of ARC187 (SEQ ID NO: 5) or ARC658 (SEQ ID NO: 62) in the presence of zymosan plasma macaques-Griboedov.

On Fig table which summarises the research of FC-FD ARC187 (SEQ ID NO: 5) during and after the/in the bolus plus infusion makaka-rabadam.

On Fig table which summarizes the pharmacokinetic parameters of ARC187 (SEQ ID NO: 5) in macaques-Griboedov after/in the bolus injection.

Fig is a graph depicting the calculated and actually measured pharmacokinetic profiles ARC187 (SEQ ID NO: 5) during and after the/in the bolus plus infusion makaka-rabadam.

Fig is a graph showing that plasma levels of the active ARC187 (SEQ ID NO: 5) remain constant during and after the/in the bolus plus infusion makaka-rabadam.

On Fig presents a table showing the calculated human needs in doses of anti-C5 aptamer with CABG surgery.

Fig I have is the schedule showing that ARC187 (SEQ ID NO: 5), respectively, does not affect in vitro coagulation, which was measured by prothrombin time (PT) and activated partial thromboplastin time (APTT).

On Fig table which summarizes the effects of in vitro ARC187 (SEQ ID NO: 5) of the anticoagulant activity of heparin and procoagulation activity of Protamine.

Fig is a graph showing that ARC187 (SEQ ID NO: 5) does not affect the reversibility anticoagulative action of heparin in vivo.

Fig is a graph showing that heparin and Protamine does not affect the functioning of ARC187 (SEQ ID NO: 5), directed against the complement, as measured by inhibition of activation of complement simhasanam.

Fig is a graph depicting the inhibition percentage of hemolysis of sheep erythrocytes in the presence of human serum as a function of the concentration of anti-C5 aptamer ARC1905 (SEQ ID NO: 67) or ARC672 (SEQ ID NO: 63).

Figa is a graph depicting the inhibition of hemolysis percentage in the presence of human serum, macaques of having and rats under the action of ARC1905 (SEQ ID NO: 67); figv presents a table that summarizes the average values of the IC50for inhibiting activation of complement in human serum, macaques of having and rats under the action of ARC1905, anti-C5-aptamer or ARC127, irrelevant aptamer, which is not binding the em C5 (negative control).

Fig is a graph depicting the values of the IC50for inhibition of radioactively labeled ARC186 (SEQ ID NO: 4) (vertical axis) as a function of the concentration of unlabeled competing substances ARC1905 (SEQ ID NO: 67) or ARC672 (SEQ ID NO: 63) (horizontal axis) in the analysis of competitive binding.

Fig is a graph depicting the value of the IC50for inhibition of radioactively labeled ARC186 (SEQ ID NO: 4) (vertical axis) as a function of the concentration of unlabeled competing substances ARC1905 (SEQ ID NO: 67) (horizontal axis) at 37°C and 25°C in the analysis of competitive binding.

Fig is a graph depicting the standard curves for human C5a (hC5a) and C5a macaques-Griboedov (equivalent hC5a).

On Fig presents a table that summarizes the values of the IC50IC90and IC99for inhibition of C5 activation in human serum and macaques-Griboedov under the action of ARC1905 (SEQ ID NO: 67), measured in the analysis of induced simhasanam activation of complement.

Fig is a graph showing the inhibition percentage of education C5a as a function of the concentration of ARC1905 (SEQ ID NO: 67) in human serum and macaques-Griboedov measured in the analysis of induced simhasanam activation of complement.

Fig is a graph depicting the effect of ARC1905 (SEQ ID NO: 67) on the formation of C3a in human serum or macaques-Griboedov measured in the analysis of induced simhasanam activation of complement.

On Fig presents a table that summarizes the average values of the IC50IC90and IC99for inhibition of ARC1905 activation of complement (SEQ ID NO: 67) in human serum from 5 donors, measured in the model, activation of complement through the loop of the tube.

Fig is a graph depicting the inhibition percentage of education C5a and C3a as a function of the concentration of ARC1905, anti-C5-aptamer or ARC127, irrelevant aptamer, which does not bind C5 (negative control) in the model, activation of complement through the loop of the tube.

The INVENTION

The present invention relates to agents and methods for treating, preventing and improving the condition when the disease associated with complement. In one variant of the aptamer containing a nucleotide sequence corresponding to ARC186 (SEQ ID NO: 4), conjugated with the remainder of the PEG. In specific embodiments, such a conjugate aptamers ARC186/PEG has essentially the same affinity binding with respect to protein complement C5, and an aptamer comprising a sequence corresponding to SEQ ID NO: 4, but in which there is no remnant of the PEG. Essentially the same binding affinity of at used in this description means that no more than about 2 to ten-fold differences, preferably not more than from 2 to five is Alicia dissociation constant, measured by dot-blot analysis. In some embodiments, the dissociation constants measured in competitive dot-blot analysis as described in example 1A below. In some embodiments, the residue of the polyethylene glycol has a molecular weight, making more than 10 KD, in particular the molecular weight of 20 KD, more preferably 30 KD and more preferably 40 KD. In some embodiments, the remainder of the PEG kongugiruut with the 5'-end of ARC186 (SEQ ID NO:4). In some embodiments, the conjugate of the aptamer/PEG has a half-life, preferably a finite half-life in a two compartment model, which is determined by the method described in example 5E below, at least 15 hours, preferably at least 24 hours, more preferably at least 48 hours in primates. In some embodiments, the conjugate of the aptamer/PEG has a half-life, preferably a finite half-life in a two compartment model comprising at least 10, preferably at least 15 hours in rats. In some embodiments, the PEG conjugated to the 5'-end of ARC186 (SEQ ID NO: 4) is a PEG with Mm 40 KD. In specific embodiments, the PEG with 40 Mm KD is a branched PEG. In some embodiments, the branched PEG with 40 Mm KD represents a 1,3-bis(MPEG-[20 CD])propyl-2-(4'-butamid). In other embodiments, the branched PEG with 40 Mm KD represents a 2,3-bis(MPEG-[20 CD])propyl-1-carbarnoyl.

In embodiments in which the branched PEG-40 KD represents a 1,3-bis(MPEG-[20 CD])propyl-2-(4'-butamid), the aptamer having the structure indicated below:

where

means the linker.

Aptamers =

where fC and fU = 2'-formulated, and mG and mA = 2'-OMe-nucleotides and all other nucleotides are 2'-OH nucleotides, and 3T denotes an inverted deoxythymidine.

In embodiments in which the branched PEG-40 KD represents a 2,3-bis(MPEG-[20 CD])propyl-1-carbarnoyl, offers aptamer having the structure indicated below:

where

means the linker.

Aptamers =

where fC and fU = 2'-formulated, and mG and mA = 2'-OMe-nucleotides and all other nucleotides are 2'-OH nucleotides, and 3T denotes an inverted deoxythymidine.

In some embodiments of this aspect of the invention, the linker is an alkyl linker. In specific embodiments, the alkyl linker contains from 2 to 18 consecutive CH2-groups. In preferred embodiments, the alkyl linker contains from 2 to 12 consecutive CH2-groups. In particularly preferred embodiments, the alkyl linker contains from 3 to 6 consecutive CH2groups.

In a particular variant of the aptamer ARC187 (SEQ ID NO: 5), having the structure below:

where aptamers =

where fC and fU = 2'-formulated, and mG and mA = 2'-OMe-nucleotides and all other nucleotides are 2'-OH nucleotides, and 3T denotes an inverted deoxythymidine.

In another variant of the aptamer ARC1905 (SEQ ID NO:67), having the structure below:

where aptamers =

where fC and fU = 2'-formulated, and mG and mA = 2'-OMe-nucleotides and all other nucleotides are 2'-OH nucleotides, and 3T denotes an inverted deoxythymidine.

In another aspect the invention relates to pharmaceutical compositions. In one embodiment, features a pharmaceutical composition comprising a therapeutically effective amount of ARC187 (SEQ ID NO: 5) or ARC1905 (SEQ ID NO: 67) or their salts. The pharmaceutical composition according to the invention may contain a pharmaceutically acceptable carrier or diluent. In this aspect of the invention relates to pharmaceutical compositions containing a therapeutically effective amount of an aptamer that inhibits the decomposition of the protein complement C5 in vivo, or its salt and a pharmaceutically acceptable carrier or diluent. This aspect of the invention predlagaemaya composition ARC187 (SEQ ID NO: 5) or ARC1905 (SEQ ID NO: 67) for use for the treatment, prevention or improvement in the disease in vivo. Also in this aspect of the invention offers ARC187 (SEQ ID NO: 5) or ARC1905 (SEQ ID NO: 67) for the purpose of obtaining pharmaceutical compositions.

In another aspect according to the invention provides methods of treatment. In one embodiment, the method according to the invention is in the treatment, prevention or attenuation of a disease mediated by the protein of complement C5 and/or its derivatives C5a and C5b-9, the method includes the introduction of the vertebral pharmaceutical compositions containing ARC187 (SEQ ID NO: 5) or ARC1905 (SEQ ID NO: 67) or salt. In some embodiments, the method includes the administration to a mammal the pharmaceutical composition according to the invention. In some embodiments, the mammal is a human.

In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, are acute ischemic heart diseases (myocardial infarction, stroke, ischemic/reperfusion injury); acute inflammatory diseases (infectious disease, sepsis, shock, acute/hyperestraier graft rejection); chronic inflammatory and/or mediated immunity diseases (allergies, asthma, rheumatoid arthritis and other rheumatic diseases, multiple sclerosis and other neurological is Olesno, psoriasis and other dermatological diseases, bulbospinal palsy, systemic lupus erythematosus (SLE), subacute/chronic graft rejection, glomerulonephritis and other renal diseases). In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, include activation of the complement associated with dialysis or situations in which blood is passed over and/or through the plastic tube and/or foreign material. In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, selected from the group consisting of myocardial damage associated with CABG-surgery, myocardial damage associated with balloon angioplasty and myocardial damage associated with restenosis. In some embodiments mediated protein complement C5, C5a and/or C5b-9, the disorder being treated, selected from the group consisting of myocardial damage associated with CABG-surgery, myocardial damage associated with balloon angioplasty, myocardial damage associated with restenosis, mediated by the protein complement of the complications associated with CABG-surgery-mediated protein complement of complications associated with percutaneous intervention in the coronary artery, paroxysmal night hemoglobinuria, acute rejection Tran is plantat, hyperstrike transplant rejection, acute transplant rejection and chronic transplant rejection. In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, are complications associated with CABG-surgery. In a specific embodiment, the disease being treated is damaged infarction associated with CABG-surgery.

In some embodiments, the method according to the invention is the introduction of pharmaceutical compositions containing ARC187 (SEQ ID NO: 5) or ARC1905 (SEQ ID NO: 67) so as to achieve a concentration of aptamer plasma, which is about 0.5 to 10-fold higher plasma concentrations of the endogenous protein of complement C5. In some embodiments, the pharmaceutical compositions of the aptamer ARC187 (SEQ ID NO: 5) or ARC1905 (SEQ ID NO: 67), is administered so as to achieve a concentration of aptamer plasma, which is about 0.75 to 5 times, 0.75 to 3 times and 1.5-2 times higher than the plasma concentration of endogenous protein complement C5, whereas in other embodiments, the composition of the aptamer is administered so as to achieve a concentration equivalent to the concentration of endogenous protein complement. In some embodiments, the pharmaceutical composition according to the invention, containing ARC187 (SEQ ID NO: 5) or ARC1905 (SEQ ID NO: 67), is administered so as to achieve a concentration of aptamer in the plasma of approximately 5 μm, about 4 μm, about mcm, about 2 μm, about 1.5 μm, about 1 μm, or about 500 nm.

You can use any combination of path, duration and rate of administration, which is sufficient to achieve concentrations of aptamers in plasma according to the invention. In some embodiments, the pharmaceutical composition is administered intravenously. In some embodiments, the pharmaceutical composition is administered in a bolus or by continuous infusion.

In particular embodiments, treatment, prevention and/or attenuation of the complications associated with CABG-surgery, in particular myocardial damage associated with CABG-surgery, the method according to the invention includes the introduction of a pharmaceutical composition before surgery and continuing the introduction of at least 24 hours, in some embodiments, about 48 hours, or in some embodiments about 72 hours. In a particular embodiment of this aspect of the invention the concentration of the aptamer in the plasma is approximately two times higher than the concentration of endogenous protein complement achieve the introduction of an intravenous bolus of approximately from 0.75 to 1.25, preferably about 1 mg) per kg weight of the patient being treated prior to, simultaneously with or after intravenous infusion of a lower dose), and when this is specified in mg weight does not include weight of conjugated PEG. In some vari is nth lower dose infuziruut with speed, selected from the range from 0.001 to 0.005 mg/kg/min, if this is specified in mg weight does not include weight of conjugated PEG. In a specific embodiment, a lower dose infuziruut with a speed of approximately 0.0013 mg/kg/min In the following embodiments of this aspect of the invention, in which the aptamer/conjugate has a long enough half-life, a pharmaceutical composition) can be injected once or twice per day as an intravenous bolus dose.

In another aspect of the invention are available diagnostic methods. In one embodiment, the diagnostic method involves contacting ARC187 (SEQ ID NO: 5) or ARC1905 (SEQ ID NO: 67) with compositions suspected of containing the protein of complement C5 or its variant, and registration of the presence or absence of the protein complement C5 or its variants. In some embodiments, the protein or variant protein complement is a protein vertebrate, preferably mammalian and more preferably human. The present invention relates to compositions ARC187 (SEQ ID NO: 5) or ARC1905 (SEQ ID NO: 67) for use as a diagnostic in vitro or in vivo.

In another aspect of the invention features an aptamer containing a nucleotide sequence selected from the group consisting of ARC330 (SEQ ID NO: 2) and ARC188-189, ARC250, ARC296-297, ARC331-334, ARC411-440, ARC457-459, ARC473, ARC522 - 525, ARC532, ARC543-544, ARC550-554, ARC65-658, ARC672, ARC706, ARC1537, ARC1730 (SEQ ID NO: 6 - SEQ NO: 66). In another variant of any of ARC330 (SEQ ID NO: 2) and ARC 188-189, ARC250, ARC296-297, ARC331-334, ARC411-440, ARC457-459, ARC473, ARC522-525, ARC532, ARC543-544, ARC550-554, ARC657-658, ARC672, ARC706, ARC1537, ARC1730 (SEQ ID NO: 6 - SEQ NO: 66) for use in preparation of pharmaceutical compositions. In this aspect of the invention relates to pharmaceutical compositions containing a therapeutically effective amount of an aptamer that inhibits the decomposition of the protein complement C5 in vivo, or its salt and a pharmaceutically acceptable carrier or diluent.

In a particular variant of the aptamer containing a nucleotide sequence according to SEQ ID NO: 1. In a particular variant of the aptamer containing a nucleotide sequence selected from the group consisting of SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 64 to SEQ ID NO: 66. In some embodiments, in which the aptamer contains a nucleotide sequence selected from the group consisting of SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 64 to SEQ ID NO: 66, the aptamer has essentially the same affinity binding with respect to protein complement C5, as aptamers consisting of the sequence according to SEQ ID NO: 4, but without the rest of the PEG.

In some embodiments, in which the aptamer contains a nucleotide sequence selected from the group consisting of SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 64 to SEQ ID NO: 66, the aptamer has a half-life, preferred the compulsory end time half-life in a two compartment model, which was determined in example 5E below, of at least 15, preferably at least 30 hours in primates. In some embodiments, in which the aptamer contains a nucleotide sequence selected from the group consisting of SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 64 to SEQ ID NO: 66, the aptamer has a half-life, preferably a finite half-life in a two compartment model comprising at least an hour and a half, preferably at least seven hours in rats.

In some embodiments of this aspect of the invention, in which the aptamer contains a nucleotide sequence selected from the group consisting of SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 64 to SEQ ID NO: 66, aptamers are synthesized with 5'-linker as follows:wheremeans the linker. In some embodiments, the linker is an alkyl linker as follows: H2N-(CH2)n-5'-aptamer-3', where n= from 2 to 18, preferably n=2 to 12, more preferably n=3-6, more preferably n=6, and where the aptamer =

where fC and fU = 2'-formulated, and mG and mA = 2'-OMe-nucleotides and all other nucleotides are 2'-OH nucleotides, and 3T denotes an inverted deoxythymidine. The resulting aptamer-modified amino group, can be anywhereman with the remainder of the PEG selected from the group, with Toyama from PEG 10 KD, PEG 20 KD, PEG-30 KD linear PEG-40 KD. In some embodiments, features a pharmaceutical composition comprising a therapeutically effective amount of the aptamer containing a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 6 - SEQ NO: 66, especially from the group consisting of SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 64 to SEQ ID NO: 66, or its salt. The pharmaceutical composition according to the invention may contain a pharmaceutically acceptable carrier or diluent. This aspect of the invention features a pharmaceutical composition for use in the treatment, prevention or attenuation of disease in vivo, containing the aptamer, which contains the nucleotide sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 6 - SEQ NO: 66, especially from the group consisting of SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 64 to SEQ ID NO: 66.

In another embodiment proposes a method of treatment, prevention or attenuation of a disease mediated by the protein of complement C5, which includes the introduction of the vertebral pharmaceutical compositions containing the aptamer or its salt, in which the aptamer contains a nucleotide sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 6 - SEQ NO: 66, especially from the group consisting of SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 64 to SEQ ID NO: 66. In some embodiments of this aspect of the invention, the method includes the t in the introduction pharmaceutical compositions according to the invention to a mammal, preferably the person.

In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, are acute ischemic heart diseases (myocardial infarction, stroke, ischemic/reperfusion injury); acute inflammatory diseases (infectious disease, sepsis, shock, acute/hyperestraier graft rejection); chronic inflammatory and/or mediated immune system diseases (allergies, asthma, rheumatoid arthritis and other rheumatic diseases, multiple sclerosis and other neurological diseases, psoriasis and other dermatological diseases, bulbospinal palsy, systemic lupus erythematosus (SLE), subacute/chronic graft rejection, glomerulonephritis and other renal diseases). In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, include activation of the complement associated with dialysis or situations in which blood is passed over and/or through the plastic tube and/or foreign material. In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, selected from the group consisting of myocardial damage associated with CABG-surgery, myocardial damage associated with balloon angioplasty, the damage of the myocardium, associated with restenosis. In some embodiments mediated protein complement C5, C5a and/or C5b-9, the disorder being treated, selected from the group consisting of myocardial damage associated with CABG-surgery, myocardial damage associated with balloon angioplasty, myocardial damage associated with restenosis, mediated by the protein complement of the complications associated with CABG-surgery-mediated protein complement of complications associated with percutaneous intervention in the coronary artery, paroxysmal night hemoglobinuria, acute transplant rejection, hyperstrike transplant rejection, acute transplant rejection and chronic transplant rejection. In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, represents the complications associated with CABG-surgery. In a specific embodiment, the disease being treated is damaged infarction associated with CABG-surgery.

In some embodiments, the method according to the invention consists in the introduction to the patient a pharmaceutical composition comprising an aptamer having a nucleotide sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 6-66, especially from the group consisting of SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 64 to SEQ ID NO: 66, so as to achieve conc the AI aptamer plasma, which is about 0.5 to 10-fold higher plasma concentrations of the endogenous protein of complement C5. In some embodiments, the pharmaceutical compositions of the aptamer is administered so as to achieve a concentration of aptamer plasma, which is about 0.75 to 5 times, 0.75 to 3 times and 1.5-2 times higher than the plasma concentration of endogenous protein complement C5, whereas in other embodiments, the composition of the aptamer is administered so as to achieve a concentration equivalent to the concentration of endogenous protein complement. In some embodiments, the pharmaceutical composition according to the invention is administered to achieve a concentration of aptamer in the plasma of approximately 5 μm, about 4 μm, about 3 μm, about 2 μm, about 1.5 μm, about 1 μm, or about 500 nm.

You can use any combination of path, duration and rate of administration, which is sufficient to achieve concentrations of aptamers in plasma according to the invention. In some embodiments, the pharmaceutical composition is administered intravenously. In some embodiments, the pharmaceutical composition is administered in a bolus or by continuous infusion.

In particular embodiments, treatment, prevention and/or attenuation of the complications associated with CABG-surgery, in particular myocardial damage associated with CABG-surgery, the method according to the invention includes the introduction farmaceuticas the second song before surgery and continuing the introduction of at least 24 hours, in some embodiments, about 48 hours, or in some embodiments about 72 hours. In a particular embodiment of this aspect of the invention the desired concentration of the aptamer in the plasma, for example, two times higher than the concentration of endogenous protein complement achieve the introduction of the patient under treatment, intravenous bolus prior to, simultaneously with or after intravenous infusion of a lower dose of aptamer. In the following embodiments of this aspect of the invention, in which the aptamer/conjugate has a long enough half-life, a pharmaceutical composition) can be injected once or twice per day as an intravenous bolus dose.

In another aspect of the invention are available diagnostic methods. In one embodiment, the diagnostic method consists of contacting a composition suspected of containing the protein of complement C5 or its variant, with aptamer containing a nucleotide sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 6-66, especially from the group consisting of SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 64 to SEQ ID NO: 66, and registration of the presence or absence of the protein complement C5 or its variants. In some embodiments, the protein or variant protein complement is a protein vertebrate, preferably mammalian and more preferably human. Now izaberete the s refers to the composition of the aptamer, containing the aptamer having the nucleotide sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 6-66, for use as diagnostic agents in vitro or in vivo. The present invention offers the aptamer containing a nucleotide sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 6 - SEQ NO 66, for use in preparation of pharmaceutical compositions.

In another aspect of the invention features an aptamer containing a nucleotide sequence that is 80% identical to any of the sequences selected from the group consisting of SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 88-98. In some embodiments, features of the aptamer containing a nucleotide sequence that is 80% identical to the unique area of any of the sequences selected from the group consisting of SEQ ID nos: 75 to 81, and SEQ ID NO: 88-98. In another variant of the aptamer containing a nucleotide sequence that is 90% identical to any of the sequences selected from the group consisting of SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 88-98. In a particular variant of the aptamer containing a nucleotide sequence that is 90% identical to the unique area of any of the sequences selected from the group consisting of SEQ ID nos: 75 to 81, and SEQ ID NO: 88-98. In another variant of the aptamer containing Amu is amidou sequence of 40 continuously consecutive nucleotides, identical 40 continuously following each other nucleotides included in any of the sequences selected from the group consisting of SEQ ID nos: 75 to 81, and SEQ ID NO: 88-98. In another variant of the aptamer containing the nucleotide sequence continuously from 30 consecutive nucleotides identical 30 continuously following each other nucleotides included in any of the sequences selected from the group consisting of SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 88-98. In another variant of the aptamer that is specific contacts with the protein of complement C5, containing the nucleotide sequence continuously from 10 consecutive nucleotides identical 10 continuously following each other nucleotides included in any of the sequences selected from the group consisting of SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 88-98. In a preferred variant of the aptamer containing a nucleotide sequence according to any of the nucleotide sequences selected from the group consisting of SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 88-98.

In some embodiments, the aptamers according to this aspect of the invention described immediately above may further comprise a chemical modification selected from the group consisting of chemical substitution in position sugar; chemical substitution in which ogenyi phosphate and chemical substitution in the position of the base sequence of nucleic acid. In some embodiments, the modification is selected from the group consisting of the incorporation of the modified nucleotide; 3'-kupirovaniya, conjugation with high molecular weight non-immunogenic compound; conjugation to a lipophilic compound and a phosphate backbone modification.

In preferred embodiments of this aspect of the invention, the aptamer modulates the function of a protein of complement C5 or its variants. In particularly preferred embodiments, the aptamer inhibits the function of a protein of complement C5 or its variant, preferably in vivo, preferably in vivo in humans. In one embodiment of this aspect of the invention function, modulating, preferably inhibiting the aptamer, is the decomposition of the protein of complement C5.

In some embodiments, another aspect of the invention relates to pharmaceutical compositions containing a therapeutically effective amount of the aptamer that blocks protein complement C5 in vivo, or its salt and a pharmaceutically acceptable carrier or diluent.

In some embodiments, features a pharmaceutical composition comprising a therapeutically effective amount of the aptamer containing a nucleotide sequence that is 80% identical, preferably 90% identical to the nucleotide sequence selected from the group consisting of SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO:88-98, or its salts. In some embodiments, features a pharmaceutical composition comprising a therapeutically effective amount of the aptamer containing a nucleotide sequence that is 80% identical, preferably 90% identical to a unique region of the nucleotide sequence selected from the group consisting of SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 88-98, or its salt. In other embodiments, features a pharmaceutical composition comprising a therapeutically effective amount of the aptamer with 40, 30 and 10 continuously consecutive nucleotides that is identical to the 40, 30, or 10 nucleotides, respectively, of the nucleotide sequence selected from the group consisting of SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 88-98. The pharmaceutical composition according to the invention may contain a pharmaceutically acceptable carrier or diluent. This aspect of the invention features a pharmaceutical composition for use in the treatment, prevention or attenuation of disease in vivo, with the pharmaceutical composition comprises an aptamer having a nucleotide sequence selected from the group consisting of SEQ ID NO: 3-4, SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 88-98, or its salt. This aspect offers the aptamer having the nucleotide sequence selected from the group consisting of SEQ ID NO: 3-4, SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 8898, for use in the preparation of pharmaceutical compositions. In this aspect of the invention relates to pharmaceutical compositions containing a therapeutically effective amount of an aptamer that inhibits the decomposition of the protein complement C5 in vivo, or its salt and a pharmaceutically acceptable carrier or diluent.

In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, are acute ischemic heart diseases (myocardial infarction, stroke, ischemic/reperfusion injury); acute inflammatory diseases (infectious disease, sepsis, shock, acute/hyperestraier graft rejection); chronic inflammatory and/or mediated immune system diseases (allergies, asthma, rheumatoid arthritis and other rheumatic diseases, multiple sclerosis and other neurological diseases, psoriasis and other dermatological diseases, bulbospinal palsy, systemic lupus erythematosus (SLE), subacute/chronic transplant rejection, glomerulonephritis and other renal diseases). In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, include activation of the complement associated with dialysis or situations in which blood is passed over and/or through Sint the optical tube and/or foreign material. In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, selected from the group consisting of myocardial damage associated with CABG-surgery, myocardial damage associated with balloon angioplasty and myocardial damage associated with restenosis. In some embodiments mediated protein complement C5, C5a and/or C5b-9, the disorder being treated, selected from the group consisting of myocardial damage associated with CABG-surgery, myocardial damage associated with balloon angioplasty, myocardial damage associated with restenosis, mediated by the protein complement of the complications associated with CABG-surgery-mediated protein complement of complications associated with percutaneous intervention in the coronary artery, paroxysmal night hemoglobinuria, acute transplant rejection, hyperstrike transplant rejection, acute transplant rejection and chronic transplant rejection. In some embodiments mediated protein complement C5, C5a and/or C5b-9 disease being treated, represents the complications associated with CABG-surgery. In a specific embodiment, the disease being treated is damaged infarction associated with CABG-surgery.

In some embodiments, the method according to the invention is glycaemia in the introduction to the patient the pharmaceutical composition, containing the aptamer having the nucleotide sequence selected from the group consisting of SEQ ID NO: 3-4, SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 88-98 so as to achieve a concentration of aptamer plasma, which is about 0.5 to 10-fold higher plasma concentrations of the endogenous protein of complement C5. In some embodiments, the pharmaceutical compositions of the aptamer is administered so as to achieve a concentration of aptamer plasma, which is about 0.75 to 5 times, 0.75 to 3 times and 1.5-2 times higher than the plasma concentration of endogenous protein complement C5, whereas in other embodiments, the composition of the aptamer is administered so as to achieve a concentration equivalent to the concentration of endogenous protein complement. In some embodiments, the pharmaceutical composition according to the invention is administered to achieve a concentration of aptamer in the plasma of approximately 5 μm, about 4 μm, about 3 μm, about 2 μm, about 1.5 μm, about 1 μm, or about 500 nm.

You can use any combination of path, duration and rate of administration, which is sufficient to achieve concentrations of aptamers in plasma according to the invention. In some embodiments, the pharmaceutical composition is administered intravenously. In some embodiments, the pharmaceutical composition is administered in a bolus or by continuous infusion.

Specific treatment options, profilaktiki/or mitigate complications related CABG-surgery, in particular myocardial damage associated with CABG-surgery, the method according to the invention includes the introduction of a pharmaceutical composition before surgery and continuing the introduction of at least 24 hours, in some embodiments, about 48 hours, or in some embodiments about 72 hours. In a particular embodiment of this aspect of the invention the desired concentration of the aptamer in the plasma, for example, two times higher than the concentration of endogenous protein complement achieve the introduction of the patient under treatment, intravenous bolus prior to, simultaneously with or after intravenous infusion of a lower dose of aptamer. In the following embodiments of this aspect of the invention, in which the aptamer/conjugate has a sufficiently long half-life, a pharmaceutical composition) can be injected once or twice per day as an intravenous bolus dose.

In another variant of the diagnostic method, the method involves contacting a composition suspected of containing the protein of complement C5 or its variant, with aptamer containing a nucleotide sequence selected from the group consisting of SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 88-98, and registration of the presence or absence of the protein complement C5 or its variants. In some embodiments, the protein or select the ant protein complement is a protein vertebral, preferably mammalian and more preferably human. The present invention relates to the composition of the aptamer containing the aptamer having the nucleotide sequence selected from the group consisting of SEQ ID nos: 75 to 81, SEQ ID NO: 83 and SEQ ID NO: 88-98 for use as diagnostic agents in vitro or in vivo.

In some embodiments, features aptamers containing the nucleotide sequence, essentially consisting of a nucleotide sequence selected from the group consisting of SEQ ID nos: 68 and 69. In some embodiments, features of the aptamer containing a nucleotide sequence consisting of a nucleotide sequence selected from the group consisting of SEQ ID nos: 68 and 69. In some embodiments of this aspect of the invention, the aptamers can be used in the diagnostic method.

DETAILED description of the INVENTION

The details of one or more embodiments of the invention shown in the accompanying description below. Although in practice or testing of the present invention can be applied to any methods and materials similar or equivalent to the methods and materials described in this description describes the preferred methods and materials. Other distinctive features, objectives and advantages of the invention will be clear from the description. the description of the singular number also include the plural, if the context clearly dictates otherwise. Unless otherwise noted, all technical and scientific terms used herein have the same meaning, which usually means the person skilled in the art to which this invention. In case of conflict, the present invention will be checked.

The SELEX methodTM

The right way to build the aptamer is a method called "Systematic evolution of ligands with exponential enrichment" ("SELEXTM"overall shown in figure 2. The SELEX methodTMis the way of evolution in vitro nucleic acid molecules with highly specific binding to molecules of the target, and the method described, for example, in the application for the grant of a U.S. patent with registration No. 07/536428, filed January 11, 1990, now fallen away, in U.S. patent No. 5475096, entitled "Nucleic Acid Ligands", and in U.S. patent No. 5270163 (see also WO 91/19813), entitled "Nucleic Acids Ligands". Each identified in SELEXTMthe ligand in the form of nucleic acid, i.e. each aptamer is specific ligand of this compound or of a target molecule. The SELEX methodTMbased on the specificity of the idea that nucleic acids have sufficient capacity for forming a variety of two-dimensional and three-dimensional structures and sufficient chemical variability of their m the room, to act as ligands (i.e. to form specific binding pairs) with virtually any chemical compound, either Monomeric or polymeric. As targets can serve molecules of any size or composition.

SELEXTMfounded as a starting point for a large library or pool of single-stranded oligonucleotides containing a randomized sequence. Oligonucleotides can be a modified or unmodified DNA, RNA or hybrids of DNA/RNA. In some examples, the pool contains 100% random or partially random oligonucleotides. In other examples, the pool contains a random or partially random oligonucleotides containing at least one fixed and/or conservative sequence included in a randomised sequence. In other examples, the pool contains a random or partially random oligonucleotides containing at least one fixed and/or conservative sequence at its 5'and/or 3'-end, which may contain a sequence that is common to all molecules of the oligonucleotide pool. Fixed sequences are those sequences as hybridization sites for PCR primers, the sequences of promoters for RNA polymerases (e.g., T3, T4, T7 and P6), restriction enzymes cut sites or homopolymer sequences, such as stretches of poly-A or poly-T, catalytic centers, sites for selective binding affinity columns and other sequence to facilitate cloning and/or sequencing interest of the oligonucleotide. Conserved sequence represent the other sequences than described previously fixed sequences common to a number of aptamers that bind to the same target.

The pool of oligonucleotides preferably include randomised part of the sequence, as well as fixed sequences necessary for efficient amplification. Typically, the oligonucleotides of the original pool contain fixed 5'- and 3'-terminal sequences that flank the inner region of 30-50 random nucleotides. Randomized nucleotides can be obtained in several ways, including chemical synthesis and selection in size from accidentally split cellular nucleic acids. The variability of the sequences in the test nucleic acids can also introduce or increase the use of mutagenesis to or during cycles of selection/amplification.

The random part of the sequence of the oligonucleotide can be any length and can soda in order to reap the ribonucleotides and/or deoxyribonucleotides, and may include modified or non-natural nucleotides or nucleotide analogues. See, for example, U.S. patent No. 5958691, U.S. patent No. 5660985, U.S. patent No. 5958691, U.S. patent No. 5698687, U.S. patent No. 5817635, U.S. patent No. 5672695 and PCT publication WO 92/07065. Random oligonucleotides can be synthesized from associate fosfomifira communication nucleotides using the technique of solid phase synthesis of oligonucleotides are well known in this field. See, for example, Froehler et al., Nucl. Acid Res. 14: 5399-5467 (1986) and Froehler et al., Tet. Lett. 27: 5575-5578 (1986). Random oligonucleotides can also be synthesized using the synthesis methods in fluids, such as methods of synthesis of Trifonov. See, for example, Sood et al., Nucl. Acid Res. 4: 2557 (1977) and Hirose et al., Tet. Lett., 28: 2449 (1978). A typical synthesis is carried out on automated equipment for DNA synthesis, 1014-1016individual molecules, a quantity sufficient for most experiments SELEXTM. A large area of the random sequence in the design sequence increase the likelihood that each of the synthesized molecule, probably represents a unique sequence.

The original library of oligonucleotides can be created by automated chemical synthesis in a DNA synthesizer. To synthesize randomizirovannye the e sequence, a mixture of all four nucleotides added at each stage of addition of nucleotides during the synthesis process, providing random insertion of nucleotides. As indicated above, in one embodiment, the random oligonucleotides contain a completely random order; however, in other embodiments, random oligonucleotides can contain lots of non-random or partially random sequences. Partially random sequences can be created by adding four nucleotides in different molar ratios at each stage add.

The original library of oligonucleotides may be a library of RNA or DNA. In those cases where it is necessary to use the library RNA as the source of the library, which usually create a transcription of library DNA in vitro using RNA polymerase T7 or modified RNA polymerase T7 and clean. Then a library of RNA or DNA is mixed with the target under conditions favorable for binding, and subjected to stepwise repetition of binding, partitioning and amplification, using the same General sampling scheme, to achieve virtually any desired criterion of affinity and selectivity of binding. More specifically, starting with a mixture containing original pool of nucleic acids, the method SELEXTMincludes stages: (a) contacting the mixture with the target under conditions favorable for binding; (b) separating unbound nucleic acids from those nucleic acids that are specific contacted with target molecules; (c) dissociation of complexes of nucleic acid target; (d) amplifying the nucleic acids dissociated from the complexes of nucleic acid-target with getting rich ligand mixture of nucleic acids; and (e) repeating stages binding, separation, dissociation and amplification for the number of cycles required to obtain highly specific, high-affinity ligands in the form of nucleic acids to target molecules. In those cases, when the selected RNA aptamers and SELEX methodTMadditionally includes the stage of: (i) reverse transcription of the nucleic acids dissociated from the complexes of nucleic acid-target, before the amplification stage (d); and (ii) the transcription of the amplified nucleic acid from step (d) before repeating the process.

In a mixture of nucleic acids that contain a large number of possible sequences and structures, there is a wide range of affinely binding in relation to this target. The mixture of nucleic acids containing, for example, a 20-nucleotide randomized plot may have a 420possible candidates for the study. Candidates who have more high affinity constants with respect to the target, most likely associated with the target. After separation, dissociation and amplification creates a second mixture of nucleic acids enriched candidates with higher affinity binding. Additional rounds of selection gradually prefer the best ligands until the resulting mixture of nucleic acids is becoming mainly consisting only of one or more sequences. The resulting sequence can then be cloned, sequenced and tested separately in relation to the affinity of binding in the form of pure ligands or aptamers.

Cycles of selection and amplification is repeated until reaching the desired goal. In the most General case, the selection/amplification continues until a significant increase in the strength of bonding as the cycle is repeated. The method usually used in relation to the sample, consisting of approximately 1014different types of nucleic acids, but can be used in relation to the sample containing approximately 1018different types of nucleic acids. Usually the molecules of nucleic acid aptamers are selected in 5-20 cycles. In one embodiment, the heterogeneity is introduced only in the initial stages of selection and does not occur during the process of repetition.

In one embodiment, the SELEXTMthe sat process the work is so effective in the allocation of such nucleic acid-ligand, which are most strongly associated with the selected target that requires only one cycle of selection and amplification. Such an efficient selection can be performed, for example, in the way that type of chromatography in which the ability of nucleic acids to contact the targets associated with the column, is used so that the column is capable enough to provide separation and isolation of nucleic acid ligands with the highest affinity.

In many cases, are not necessarily required to perform repetitive stage SELEXTMuntil the identification of a single nucleic acid ligand. The solution is specific for the target nucleic acid ligands can contain a collection of structures or motifs nucleic acids, which have a number of conservative sequences and the number of sequences that can be replaced or added without significant effect on the affinity of the nucleic acid ligands to the target. At the end of the SELEX processTMbefore you finish, you can define a sequence of several representatives of the family of nucleic acid-ligand in solution.

It is known that there are several primary, secondary and tertiary structures of nucleic acids. Patterns or motifs that have been shown to be more often involved in interactions other than in the of immodesty Watson-Crick, called loops in the form of studs, symmetric and asymmetric loops, pseudo nodes and their various combinations. Almost all known cases of such motifs suggests that they can be formed in the sequence of nucleic acid, consisting of no more than 30 nucleotides. For this reason, it is often preferable to start the processes SELEXTMcontinuous randomized plots with sequences of nucleic acids containing randomized plot, having from about 20 to about 50 nucleotides, and in some embodiments from about 30 to about 40 nucleotides. In one example, the 5'-fixed:random:3'-fixed sequence contains a random sequence having from about 30 to about 50 nucleotides.

The main way SELEXTMwas modified so as to achieve some specific goals. For example, in U.S. patent No. 5707796 describes the use of SELEXTMtogether with gel electrophoresis to select nucleic acid molecule with specific structural characteristics, such as bent DNA. In U.S. patent No. 5763177 described based on SELEXTMmethods of selection of nucleic acid ligands containing photoreactive groups capable of binding and/or potassiun with molecule-target and/or to photoinactivation mo is ecoli target. In U.S. patent No. 5567588 and U.S. patent No. 5861254 described based on SELEXTMthe ways in which achieve high performance separation of oligonucleotides having high and low affinity to the molecule target. In U.S. patent No. 5496938 describes methods for obtaining improved nucleic acid ligands after SELEX methodTM. In U.S. patent No. 5705337 describe how covalent binding of a ligand to its target.

SELEXTMcan also be used to obtain nucleic acid ligands that are associated with more than one site on a molecule of the target and to obtain nucleic acid ligands that contain non-nucleic acid types of molecules that are associated with specific sites on the target. SELEXTMprovides a method of separating and identifying nucleic acid ligands that bind to any target that you can imagine, including large and small biological molecules such as proteins that bind nucleic acids, and proteins, which are not aware that they bind nucleic acids as part of its biological function, as well as cofactors and other small molecules. For example, in U.S. patent No. 5580737 described nucleic acid sequence identified using SELEXTMwho are able to communicate with all possible is the high affinity with caffeine and the closely related analogue, theophylline.

Counter-SELEXTMis a way to improve the specificity of nucleic acid-ligand to the molecule target by excluding sequences, nucleic acid-ligand cross-reactivity to one or more molecules that are not targeted. Counter-SELEXTMconsists of stages: (a) preparing a mixture of nucleic acids, selected for study; (b) contacting the mixture of the candidates with the target, while the nucleic acids having an increased affinity against the target as compared with a mixture of candidates can be separated from the rest of the mixture candidates; (c) separation of nucleic acids with high affinity from the rest of the mixture of the candidates; (d) dissociation of nucleic acids with high affinity of the complex with the target; (e) contacting nucleic acids with high affinity to one or more molecules that are not targeted for to remove nucleic acid ligands with specific affinity to the molecule(Lam), which is not a target; and f) amplifying the nucleic acids with specific affinity only to the molecule target, to obtain a mixture of nucleic acids enriched in nucleic acid sequences with relatively higher affinity and specificity the spine in relation to the binding molecule-target. As described above with respect SELEXTMcycles of selection and amplification if necessary, repeat until desired goals.

One possible problem faced when using nucleic acids as therapeutic agents and vaccines, is the fact that oligonucleotides in their fosfomifira form can quickly break down in the body fluids of intracellular and extracellular enzymes such as endonucleases and ectonucleoside, before the manifestation of the desired effect. Accordingly, the SELEX methodTMincludes identification of high-affinity nucleic acid ligands containing modified nucleotides, which impart improved properties to the ligand, such as increased stability in vivo or improved delivery options. Examples of such modifications include chemical substitutions in the positions of the ribose and/or phosphate and/or base.

Identified using SELEXTMnucleic acid ligands containing modified nucleotides are described, for example, in U.S. patent No. 5660985, which describes oligonucleotides containing derivatives of nucleotides, chemically modified at the 2'-position of ribose, in position 5 of the pyrimidine and in position 8 of the purine, in U.S. patent No. 5756703, which describes oligonucleotides containing various 2'-modified rimidine, and in U.S. patent No. 5580737, which describes highly specific nucleic acid ligands containing one or more nucleotides modified with substituents: 2'-amino (2'-NH2), 2'-fluorine (2'-F) and/or 2'-OMe (2'-OMe).

Modification of nucleic acid ligands that are included in the scope of the present invention, include, without limitation modifications, which provide other chemical groups that give additional charge, the ability to polarity, hydrophobicity, ability to form hydrogen bonds, electrostatic interactions and the flexibility of the bases of the nucleic acid ligand or nucleic acid ligand as a whole. Modifications to create populations of oligonucleotides that are resistant to nucleases, may also include one or more replacement mezhnukleotidnyh ties, modified sugars, modified bases or combinations thereof. Such modifications include, without limitation modifications at the 2'-position sugar modifications in position 5 of the pyrimidine, modifications in position 8 of the purine modifications in ekzoticheskih amines have had, substituting 4-thiouridine, substitution of 5-bromo - or 5-iodine-uracil; backbone modification, phosphorothioate or alkylphosphate modification, methylation and unusual combination by base pairing, such as Sosnovaya socitey and isoguanine. Mo is eficacia can also include 3'and 5'-modifications such as kierowanie.

In one embodiment, the complimentary oligonucleotides, in which the group P(O)O is replaced by P(O)S ("tiat"), P(S)S ("ditial"), P(O)NR2(amidate"), P(O)R, P(O)OR', CO or CH2(formatall") or 3'-amine (-NH-CH2-CH2- , where each R or R' independently denotes H or substituted or unsubstituted alkyl. Linking groups can be linked to adjacent nucleotides through link-O-, -N - or-S-. You do not want all the links in the oligonucleotides were identical. Used in this sense, the term phosphorothioate includes replacement of one or more does not form a bridge oxygen atoms in the phosphodiester bond by one or more sulfur atoms.

In the following embodiments, the oligonucleotides containing modified groups of sugars, for example, one or more hydroxyl groups are replaced with halogen, aliphatic groups or functionalitywith as ethers or amines. In one embodiment, the 2'-position of the furanose residue replaces any group OMe, O-alkyl, O-allyl, S-alkyl, S-allyl or halogen. Methods of synthesis of 2'-modified sugars are described, for example, Sproat, et al., Nucl. Acid Res. 19: 733-738 (1991); Cotten, et al., Nucl. Acid Res. 19: 2629-2635 (1991) and Hobbs, et al., Biochemistry 12: 5138-5145 (1973). Other modifications known to the person skilled in the art. Such modifications may represent a modification obtained to process the sa SELEX TMor modification received after the SELEX processTM(modification of previously identified unmodified ligands), or can be obtained in the SELEX process.

Modifications received prior to the SELEX process, and modifications received in the SELEX process, give nucleic acid ligands, as having specificity for their target SELEXTMand high stability, such as stability in vivo. Modifications received after the SELEX processTMin the nucleic acid ligands can lead to increased stability, such as stability in vivo without adverse effect on the ability of the nucleic acid ligand to bind.

The SELEX methodTMencompasses combining selected oligonucleotides with other selected oligonucleotides and polygonality functional units as described in U.S. patent No. 5637459 and U.S. patent No. 5683867. The SELEX methodTMin addition, encompasses combining selected nucleic acid ligands with lipophilic or non-immunogenic high molecular weight compounds in a diagnostic or therapeutic complex, as described, for example, in U.S. patent No. 6011020, U.S. patent No. 6051698 and PCT publication No. WO 98/18480. These patents and applications contain instructions regarding combining a wide range of forms and other properties with properties of oligonucleotides, provide efficient amplification and replication, and with the required properties of other molecules.

Also identification of nucleic acid ligands to a small flexible peptides using the SELEX methodTM. Small peptides have a flexible structure and usually exist in solution in the form of multiple conformers in equilibrium, and, therefore, initially believed that the affinity of binding may be limited by the loss of conformational entropy upon binding a flexible peptide. However, the possibility of identifying nucleic acid ligands to small peptides in solution was shown in U.S. patent No. 5648214. In the mentioned patent identified high-affinity nucleic acid ligands in the form of RNA to substance P, an 11-amino acid peptide.

Aptamers with specificity and affinity of binding to the target(s)according to the invention is usually selected by the SELEX methodTMthat is described in this publication. As part of the SELEX methodTMselected sequences that bind to a target, then not necessarily minimize, to determine the minimum sequence with the desired binding affinity of. Selected sequence and/or minimized sequence does not necessarily optimize, carrying cases is any or directed mutagenesis of the sequence, to increase the binding affinity of, or alternative, to determine which positions in the sequence are important for the binding activity. Additionally, the selection can be performed using sequences containing modified nucleotides, in order to stabilize the molecule aptamers from destruction in vivo.

2'-modified SELEXTM

To the aptamer was suitable for use as a therapeutic agent, it is preferably inexpensive, from the point of view of synthesis, safe and stable in vivo. RNA and DNA aptamers wild type are usually unstable in vivo because of their sensitivity to destruction by nucleases. Resistance to destruction by nucleases can be substantially increased by the inclusion of a modifying group at 2'-position.

Fluorine and amino groups were successfully incorporated into oligonucleotide libraries, which were then selected aptamers. However, such modifications significantly increase the cost of synthesis of the resulting aptamer and in some cases may introduce security problems due to the likelihood that the modified nucleotides can be reused in the host DNA in the destruction of modified oligonucleotides and subsequent use nucleotides as the sub is tretow for DNA synthesis.

Aptamers that contain 2'-OMe-nucleotides ("2'-OMe"), which are offered in some embodiments of the present invention overcome many of these shortcomings. Oligonucleotides containing 2'-OMe-nucleotides that are resistant to nucleases and their synthesis is not expensive. Although 2'-OMe-nucleotides common in biological systems, natural polymerases do not take 2'-O-methyl-NTP as substrates under physiological conditions, respectively, there are no problems concerning the dangers of re-using 2'-OMe-nucleotides in the DNA of the host. The SELEX methodTMused to create a 2'-modified aptamers described, for example, in the preliminary application for the grant of a U.S. patent with registration No. 60/430761, filed December 3, 2002, in the preliminary application for the grant of a U.S. patent with registration No. 60/487474 filed July 15, 2003, in the preliminary application for the grant of a U.S. patent with registration No. 60/517039, filed November 4, 2003, the application for the grant of U.S. patent No. 10/729581, filed December 3, 2003, and in the application for the grant of U.S. patent No. 10/873856, filed June 21, 2004, entitled "Method for in vitro Selection of 2'-OMe Substituted Nucleic Acids, each of which are included in this description by reference in full.

The present invention relates to aptamers that bind and modulate the function of a protein of complement C5, which contain mo is oficerowie nucleotides (e.g., the nucleotides that are modified at the 2'-position)to make the oligonucleotide more stable than unmodified oligonucleotides, enzymatic and chemical destruction, as well as to thermal and physical destruction. Although there are several examples of 2'-OMe-containing aptamers in the literature (see, for example, Green et al., Current Biology 2, 683-695, 1995), these aptamers were generated by in vitro selection of libraries of modified transcripts, in which the residues C and U were 2'-fluorine-substituted (2'-F), and the remnants of A and G had a 2'-OH group. After identification of functional sequences each residue A and G were tested in relation to tolerance to 2'-OMe-substitution and re-synthesized aptamers with all residues A and G, which are tolerant to 2'-OMe-substitution, in the form of 2'-OMe-residues. Most of the residues A and G in the aptamers generated in such a two-step method, tolerant to substitution of 2'-OMe-residues, although on average about 20% are not tolerant. Therefore, aptamers, created using this method, tend to contain from two to four 2'-OH residues, and as a result of deteriorating stability and increase the cost of synthesis. By incorporating modified nucleotides into the reaction transcription, which create a stable oligonucleotides used in oligonucleotide pools, the cat is which aptamers are selected and enriched by SELEX TM(and/or any of its variants and improvements, including options described in this publication), the methods according to the present invention eliminate the need for stabilization of selected aptameric oligonucleotides (for example, by re-synthesis aptameric oligonucleotides containing modified nucleotides).

In one embodiment, the present invention relates to aptamers containing combinations of 2'-OH, 2'-F, 2'-deoxy - and 2'-OMe-modified nucleotides ATP, GTP, CTP, TTP and UTP. In another embodiment, the present invention relates to aptamers containing combinations of 2'-OH, 2'-F, 2'-deoxy-, 2'-OMe, 2'-NH2and 2'-methoxyethyl-modifications of the nucleotides ATP, GTP, CTP, TTP and UTP. In another embodiment, the present invention relates to aptamers containing 56combinations of 2'-OH, 2'-F, 2'-deoxy-, 2'-OMe, 2'-NH2and 2'-methoxyethyl-modifications of the nucleotides ATP, GTP, CTP, TTP and UTP.

2'-modified aptamers according to the invention create using the modified polymerases, such as a modified T7 polymerase, with the rate of incorporation of modified nucleotides containing large substituents in position 2'-furanose, which is higher than the rate included in case the polymerase wild-type. For example, the T7 polymerase with a single mutation (Y639F), in which the tyrosine residue at position 639 was replaced by phenylalanine, easy COI is lesuit 2'-deoxy-, 2'-amino and 2'-fluorine-containing nucleosidase (NTP) as substrates, and found polymerase is widely used for the synthesis of modified RNA for many applications. However, it is reported that this mutant T7 polymerase cannot easily be used (i.e. enable) NTP with bulky 2'-substituents, such as 2'-OMe or 2'-azido- (2'-N3) deputies. To enable volume 2'-substituents has been described double mutant T7 polymerase (Y639F/H784A), with the replacement of histidine at position 784 for the remainder of the alanine in addition to mutations Y639F, and it was used in limited cases to include modified pyrimidine NTP. Cm. Padilla, R. and Sousa, R., Nucleic Acids Res., 2002, 30(24): 138. Also describes the T7 polymerase with a single mutation (H784A), with the replacement of histidine at position 784 on the balance of alanine. Padilla et al., Nucleic Acids Research, 2002, 30: 138. In both the T7 polymerase, c double mutation Y639F/H784A and a single mutation H784A, changing to a smaller amino acid residue, such as alanine, to enable more extensive nucleotide substrates, such as 2'-O-methyl-substituted nucleotides.

In General, it was found that described in this publication, the terms single mutant Y693F can be used for incorporation of all 2'-OMe-substituted NTP except GTP, and the double mutant Y639F/H784A can be used for incorporation of all 2'-OMe-substituted NTP, including GTP. PR is polagaetsa, that single H784A mutant has properties similar to mutant Y639F and Y639F/H784A, when used in the conditions described in this publication.

2'-modified oligonucleotides can be synthesized entirely of modified nucleotides or subgroup modified nucleotides. Modification may be the same or different. All the nucleotides can be modified and can contain the same modification. All the nucleotides can be modified, but can include various modifications, for example, all of the nucleotides containing the same basis, can have one type of modification, whereas nucleotides containing other reasons, may have other types of modification. All purine nucleotides can have one type of modification (or be non-modified), whereas all pyrimidine nucleotides are another great type of modification (or are unmodified). Thus, transcripts or pools of transcripts create using any combination of modifications, including, for example, ribonucleotides (2'-OH), deoxyribonucleotides (2'-deoxy), 2'-F and 2'-OMe-nucleotides. Mixture for transcription containing 2'-OMe-C and-U and 2'-OH-A and-G, called the mix "rRmY", and selected from it aptamers called "rRmY"aptamers. Mixture for transcription, containing deoxy-A and-G, and 2'-OMe-U and-C, are called what MESU "dRmY", and selected from it aptamers called "dRmY"aptamers. Mixture for transcription containing 2'-OMe-A, -C and-U and 2'-OH-G, called the mix "rGmH, and selected from it aptamers called "rGmH"aptamers. Mixture for transcription, alternately containing 2'-OMe-A, -C, -U and-G, and 2'-OMe A, U and C and 2'-F-G, is called a "mixture alternating nucleotides, and selected from it called aptamers aptamers containing the mixture of alternating nucleotides". Mixture for transcription containing 2'-OMe-A, -U, -C and-G, in which up to 10% of G are ribonucleotides, referred to as a mixture of "r/mGmH", and selected from it aptamers called "r/mGmH"aptamers. Mixture for transcription containing 2'-OMe A, U and C and 2'-F-G is called the mix "fGmH", and selected from it aptamers called "fGmH"aptamers. Mixture for transcription containing 2'-OMe-A, -U and-C and deoxy-G, called the mix "dGmH, and selected from it aptamers called "dGmH"aptamers. Mixture for transcription, containing deoxy-A and 2'-OMe-C, -G and-U, called the mix "dAmB", and selected from it aptamers called "dAmB"aptamers, and mix for transcription, containing all 2'-OH nucleotides, referred to as a mixture of "rN", and selected from it aptamers called "rN"or "rRrY"aptamers. Aptamers "mRmY" is an aptamer containing all 2'-OMe-nucleotides, and usually it is obtained from r/mGmH-oligonucleotide replacement after the implementation of SELEX, when possible, of any 2'-OH-G 2'-OMe-G.

repectfully option includes any combination of 2'-OH-, 2'-deoxy - and 2'-OMe-nucleotides. The preferred option includes any combination of 2'-deoxy - and 2'-OMe-nucleotides. Even more preferred option refers to any combination of 2'- deoxy - and 2'-OMe-nucleotides, in which the pyrimidines are 2'-OMe-nucleotides (such as dRmY, mRmY or dGmH).

The inclusion of modified nucleotides in the aptamer according to the invention is carried out until (before) the selection process (for example, modification, get to the SELEX processTM). Optional aptamers according to the invention, which have included modified nucleotides in the modification before the SELEX processTMcan be further modified in the modification after the SELEX processTM(i.e. modification received after the SELEX processTMperformed after modifications received prior to SELEXTM). Modifications received prior to the SELEX processTMgive the modified nucleic acid ligands with specificity towards the target SELEXTMas well as increased stability in vivo. Modifications received after the SELEX processTM(for example, shortening, deletion, replacement or additional modifications of nucleotides previously identified ligands having the nucleotides included in the modification implemented before the SELEX processTM ) can lead to additional increase stability in vivo, without exerting adverse influence on the ability to bind nucleic acid ligand having the nucleotides included in the modification implemented before the SELEX processTM.

To create pools 2'-modified (for example, 2'-OMe) RNA transcripts in the conditions in which the polymerase uses 2'-modified NTP, preferred polymerase is a double mutant Y693F/H784A or single mutant Y693F. Other polymerases, especially polymerases that exhibit high tolerance to volume 2'-substituents, can also be used in the present invention. Such polymerases can be subjected to screening for their potential through analysis of their ability to incorporate modified nucleotides under conditions of transcription described in this publication.

Identified a number of factors that are important for creating conditions for transcription applicable in the ways disclosed in this description. For example, the increase in the outputs of the modified transcript was observed in the case when included leader sequence at the 5'-end of a fixed sequence at the 5'end of the transcription of a DNA template, so that at least approximately the first 6 residues of the resulting transcript of the armed forces who were purines.

Another important factor for obtaining transcripts containing modified nucleotides, is the presence or concentration of 2'-OH GTP. Transcription can be divided into two phases: the first phase is initiation, during which the NTP is added to the 3'-hydroxyl end of GTP (or other substituted guanosine) getting dinucleotide, which is then lengthened by about 10-12 nucleotides; the second phase is the elongation, during which the transcription continues after you add about 10-12 of the first nucleotide. It was found that small amounts of 2'-OH GTP added to the mixture for transcription, containing an excess of 2'-OMe-GTP, enough to allow the polymerase to initiate transcription using 2'-OH GTP, but after transcription enters a phase of elongation, decreased ability to distinguish between the 2'-OMe and 2'-OH GTP, and an excess of 2'-OMe-GTP compared to the 2'-OH GTP allows you to include mostly 2'-OMe-GTP.

Another important factor to include 2'-OMe-substituted nucleotides in the transcript is the use of divalent magnesium and manganese in the transcription mixture. It was found that different combinations of concentrations of magnesium chloride and manganese chloride affect the outputs of the 2'-OMe-transcripts, with the optimal concentration of magnesium chloride and manganese dependent on the concentration of the reaction mixture datascript NTP, which form complexes with divalent metal ions. To get the most outputs a maximum of 2'-OMe substituted-transcripts (i.e., all A, C and U and about 90% G-nucleotides), the preferred concentration, approximately 5 mm of magnesium chloride and 1.5 mm of manganese chloride in the case when each NTP is present in a concentration of 0.5 mm. When the concentration of each NTP is 1.0 mm, the preferred concentration of about 6.5 mm of magnesium chloride and 2.0 mm of manganese chloride. When the concentration of each NTP is 2.0 mm, the preferred concentration of about 9.6 mm of magnesium chloride and 2.9 mm manganese chloride. In any case, the deviation from the indicated concentrations of up to two times still gives a significant amount of modified transcripts.

Also important priming transcription GMP or guanosine. This effect is a result of the specificity of the polymerase relative to the initiating nucleotides. In the 5'-terminal nucleotide of any transcript, thus created, is likely to be a 2'-OH-G. the Preferred concentration of GMP or guanosine) is 0.5 mm and even more preferably 1 mm. It was found that the introduction of PEG, preferably PEG-8000, the reaction mixture useful for transcription in order to maximize the incorporation of the modified nucleotide sequence that is the Chida.

For maximum incorporation of 2'-OMe-ATP (100%), UTP (100%), CTP (100%) and GTP (~90%) ("r/mGmH") in the transcripts preferred the following conditions: HEPES buffer 200 mm, DTT 40 mm, spermidine 2 mm, PEG-8000 10% (wt./vol.), Triton X-100 in 0.01% (wt./vol.), MgCl25 mm (6.5 mm, when the concentration of each 2'-OMe-NTP is 1.0 mm), MnCl21.5 mm (2.0 mm, when the concentration of each 2'-OMe-NTP is 1.0 mm), 2'-OMe-NTP (each) 500 μm (more preferably 1.0 mm), 2'-OH-30 μm GTP, 2'-OH GMP 500 μm, pH 7.5, RNA polymerase T7 Y639F/H784A 15 units/ml, inorganic pyrophosphatase 5 units/ml, and a fully-purine leader sequence of length of at least 8 nucleotides. Used in this sense, one mutant RNA polymerase T7 Y639F/H784A (or any other mutant RNA polymerase T7 specified in this description) is defined as the amount of enzyme required to enable 1 nmol 2'-OMe-NTP in the transcripts in terms of r/mGmH. Used in this sense, one unit of inorganic pyrophosphatase is defined as the amount of enzyme that will liberate 1.0 mol of inorganic orthophosphate per minute at pH 7.2 and 25°C.

For maximum incorporation (100%) 2'-OMe-ATP-UTP and CTP ("rGmH") in the transcripts preferred the following conditions: HEPES buffer 200 mm, DTT 40 mm, spermidine 2 mm, PEG-8000 10% (wt./vol.), Triton X-100 in 0.01% (wt./vol.), MgCl25 mm (9.6 mm, when the concentration of each 2'-OMe-NTP with the hat 2.0 mm), MnCl21.5 mm (2.9 mm, when the concentration of each 2'-OMe-NTP is 2.0 mm), 2'-OMe-NTP (each) 500 μm (more preferably 2.0 mm), pH 7.5, RNA polymerase Y639F T7 15 units/ml, inorganic pyrophosphatase 5 units/ml and a fully-purine leader sequence of length of at least 8 nucleotides.

For maximum incorporation (100%) 2'-OMe-UTP and CTP ("rRmY") in the transcripts preferred the following conditions: HEPES buffer 200 mm, DTT 40 mm, spermidine 2 mm, PEG-8000 10% (wt./vol.), Triton X-100 in 0.01% (wt./vol.), MgCl25 mm (9.6 mm, when the concentration of each 2'-OMe-NTP is 2.0 mm), MnCl21.5 mm (2.9 mm, when the concentration of each 2'-OMe-NTP is 2.0 mm), 2'-OMe-NTP (each) 500 μm (more preferably 2.0 mm), pH 7.5, RNA polymerase T7 Y639F/H784A 15 units/ml, inorganic pyrophosphatase 5 units/ml and a fully-purine leader sequence of length of at least 8 nucleotides.

For maximum incorporation (100%) of deoxy-ATP and GTP and 2'-OMe-UTP and CTP ("dRmY") in the transcripts preferred the following conditions: HEPES buffer 200 mm, DTT 40 mm, spermin 2 mm, spermidine 2 mm, PEG-8000 10% (wt./vol.), Triton X-100 in 0.01% (wt./vol.), MgCl29,6 mm MnCl22.9 mm, 2'-OMe-NTP (each) 2.0 mm, pH 7.5, RNA polymerase Y639F T7 15 units/ml, inorganic pyrophosphatase 5 units/ml and a fully-purine leader sequence of length of at least 8 nucleotides.

For maximum incorporation (100%) 2'-Oe-ATP -UTP and CTP and 2'-F-GTP ("fGmH") in the transcripts preferred the following conditions: HEPES buffer 200 mm, DTT 40 mm, spermidine 2 mm, PEG-8000 10% (wt./vol.), Triton X-100 in 0.01% (wt./vol.), MgCl29,6 mm MnCl22.9 mm, 2'-OMe-NTP (each) 2.0 mm, pH 7.5, RNA polymerase Y639F T7 15 units/ml, inorganic pyrophosphatase 5 units/ml and a fully-purine leader sequence of length of at least 8 nucleotides.

For maximum incorporation (100%) of deoxy-ATP and 2'-OMe-UTP-GTP and CTP ("dAmB") in the transcripts preferred the following conditions: HEPES buffer 200 mm, DTT 40 mm, spermidine 2 mm, PEG-8000 10% (wt./vol.), Triton X-100 in 0.01% (wt./vol.), MgCl29,6 mm MnCl22.9 mm, 2'-OMe-NTP (each) 2.0 mm, pH 7.5, RNA polymerase Y639F T7 15 units/ml, inorganic pyrophosphatase 5 units/ml and a fully-purine leader sequence of length of at least 8 nucleotides.

For each of the above cases (a) transcription is preferably carried out at a temperature from about 20°C to about 50°C, preferably from about 30°C to 45°C and more preferably at about 37°C for a time period of at least two hours, and (b) use 50-300 nm double DNA template for transcription (200 nm matrix used in round 1, to increase the diversity (300 nm matrix used in transcription dRmY)) and for subsequent rounds approximately 50 nm, a 1/10 dilution of optimizer is Anna the reaction mixture for PCR, using the conditions described in this publication). Preferred DNA template for transcription described below (where ARC254 and ARC256 are transcribed at all 2'-OMe-conditions, and ARC255 transcribed in terms rRmY).

In terms of transcription rN according to the present invention the reaction mixture for transcription contains 2'-OH-adenosintriphosphate (ATP), 2'-OH-guanozintrifosfata (GTP), 2'-OH-citydistrict (CTP) and 2'-OH-uridinediphosphate (UTP). The modified oligonucleotides produced using mixtures for transcription rN according to the present invention contain essentially all of the base form of 2'-OH adenosine, 2'-OH guanosine, 2'-OH-cytidine and 2'-OH uridine. In a preferred embodiment, transcription rN the resulting modified oligonucleotides containing the sequence in which at least 80% of all adenosine nucleotides are 2'-OH adenosine, at least 80% of all guanosine nucleotides are 2'-OH-guanosine, at least 80% of all saidinovich nucleotides are 2'-OH-citizen and at least 80% of all originaly nucleotides are 2'-OH-uridine. In a more preferred embodiment, transcription rN the resulting modified oligonucleotides according to the present invention contain a sequence is, in which at least 90% of all adenosine nucleotides are 2'-OH adenosine, at least 90% of all guanosine nucleotides are 2'-OH-guanosine, at least 90% of all saidinovich nucleotides are 2'-OH-citizen and at least 90% of all originaly nucleotides are 2'-OH-uridine. In the most preferred embodiment, transcription rN modified oligonucleotides according to the present invention contain a sequence where 100% of all adenosine nucleotides are 2'-OH adenosine, 100% of all guanosine nucleotides are 2'-OH-guanosine, 100% of all saidinovich nucleotides are 2'-OH-citizen and 100% of all originaly nucleotides are 2'-OH-uridine.

In terms of transcription rRmY according to the present invention the reaction mixture for transcription contains 2'-OH-adenosintriphosphate, 2'-OH-guanozintrifosfata, 2'-OMe-citydistrict and 2'-OMe-uridinediphosphate. The modified oligonucleotides produced using mixtures for transcription rRmY according to the present invention contain essentially all of the base form of 2'-OH adenosine, 2'-OH guanosine, 2'-OMe-cytidine and 2'-OMe-uridine. In a preferred embodiment, the resulting modified oligonucleotides containing the sequence W is at least 80% of all adenosine nucleotides are 2'-OH adenosine, at least 80% of all guanosine nucleotides are 2'-OH-guanosine, at least 80% of all saidinovich nucleotides are 2'-OMe-citizen and at least 80% of all originaly nucleotides are 2'-OMe-uridine. In a more preferred embodiment, the resulting modified oligonucleotides containing the sequence in which at least 90% of all adenosine nucleotides are 2'-OH adenosine, at least 90% of all guanosine nucleotides are 2'-OH-guanosine, at least 90% of all saidinovich nucleotides are 2'-OMe-citizen and at least 90% of all originaly nucleotides are 2'-OMe-uridine. In the most preferred embodiment, the resulting modified oligonucleotides containing the sequence in which 100% of all adenosine nucleotides are 2'-OH adenosine, 100% of all guanosine nucleotides are 2'-OH-guanosine, 100% of all saidinovich nucleotides are 2'-OMe-citizen and 100% of all originaly nucleotides are 2'-OMe-uridine.

In terms of transcription dRmY according to the present invention the reaction mixture for transcription contains 2'-deoxyadenosine, 2'-deoxyguanosine, 2'-O-metiltiometilatsetata and 2'-O-methyluric triphosphate. The modified oligonucleotides produced using conditions transcription dRmY according to the present invention contain essentially all of the base form of 2'-deoxyadenosine, 2'-deoxyguanosine, 2'-O-methylcytidine and 2'-O-methyluridine. In a preferred embodiment, the resulting modified oligonucleotides according to the present invention contain a sequence in which at least 80% of all adenosine nucleotides are 2'-deoxyadenosine, at least 80% of all guanosine nucleotides are 2'-deoxyguanosine, at least 80% of all saidinovich nucleotides are 2'-O-methylcytidine and at least 80% of all originaly nucleotides are 2'-O-methyluridine. In a more preferred embodiment, the resulting modified oligonucleotides according to the present invention contain a sequence in which at least 90% of all adenosine nucleotides are 2'-deoxyadenosine, at least 90% of all guanosine nucleotides are 2'-deoxyguanosine, at least 90% of all saidinovich nucleotides are 2'-O-methylcytidine, and at least 90% of all originaly nucleotides are 2'-O-methyluridine. In the most preferred embodiment, obtained is the result of modified oligonucleotides according to the present invention contain a sequence in which 100% of all adenosine nucleotides are 2'-deoxyadenosine, 100% of all guanosine nucleotides are 2'-deoxyguanosine, 100% of all saidinovich nucleotides are 2'-O-methylcytidine and 100% of all originaly nucleotides are 2'-O-methyluridine.

In terms of transcription rGmH according to the present invention the reaction mixture for transcription contains 2'-OH-guanozintrifosfata, 2'-OMe-citydistrict, 2'-OMe-uridinediphosphate and 2'-OMe-adenosintriphosphate. The modified oligonucleotides produced using the transcription mixtures rGmH according to the present invention contain essentially all of the base in the form of 2'-OH guanosine, 2'-OMe-cytidine, 2'-OMe-uridine and 2'-OMe-adenosine. In a preferred embodiment, the resulting modified oligonucleotides containing the sequence in which at least 80% of all guanosine nucleotides are 2'-OH-guanosine, at least 80% of all saidinovich nucleotides are 2'-OMe-citizen, at least 80% of all originaly nucleotides are 2'-OMe-uridine and at least 80% of all adenosine nucleotides are 2'-OMe adenosine. In a more preferred embodiment, the resulting modified oligonucleotides containing the sequence in which n is at least 90% of all guanosine nucleotides are 2'-OH-guanosine, at least 90% of all saidinovich nucleotides are 2'-OMe-citizen, at least 90% of all originaly nucleotides are 2'-OMe-uridine and at least 90% of all adenosine nucleotides are 2'-OMe adenosine. In the most preferred embodiment, the resulting modified oligonucleotides containing the sequence in which 100% of all guanosine nucleotides are 2'-OH-guanosine, 100% of all saidinovich nucleotides are 2'-OMe-citizen, 100% of all originaly nucleotides are 2'-OMe-uridine and 100% of all adenosine nucleotides are 2'-OMe adenosine.

In terms of transcription r/mGmH according to the present invention the reaction mixture for transcription contains 2'-OMe-triphosphate, 2'-OMe-citydistrict, 2'-OMe-GTP-independent, 2'-OMe-uridinediphosphate and 2'-OH GTP-independent. The resulting modified oligonucleotides produced using the transcription mixtures r/mGmH according to the present invention contain essentially all of the base form of 2'-OMe-adenosine, 2'-OMe-cytidine, 2'-OMe-guanosine and 2'-OMe-uridine, while the population guanosine nucleotides has a maximum of about 10% of the 2'-OH guanosine. In a preferred embodiment, the resulting r/mGmH-modified oligonucleotides according to the us is oedema invention contain a sequence in which at least 80% of all adenosine nucleotides are 2'-OMe adenosine, at least 80% of all saidinovich nucleotides are 2'-OMe-citizen, at least 80% of all guanosine nucleotides are 2'-OMe-guanosine, at least 80% of all originaly nucleotides are 2'-OMe-uridine and not more than about 10% of all guanosine nucleotides are 2'-OH-guanosine. In a more preferred embodiment, the resulting modified oligonucleotides containing the sequence in which at least 90% of all adenosine nucleotides are 2'-OMe adenosine, at least 90% of all saidinovich nucleotides are 2'-OMe-citizen, at least 90% of all guanosine nucleotides are 2'-OMe-guanosine, at least 90% of all originaly nucleotides are 2'-OMe-uridine and not more than about 10% of all guanosine nucleotides are 2'-OH-guanosine. In the most preferred embodiment, the resulting modified oligonucleotides containing the sequence in which 100% of all adenosine nucleotides are 2'-OMe adenosine, 100% of all saidinovich nucleotides are 2'-OMe-citizen, 90% of all guanosine nucleotides are 2'-OMe-guanosin and 100% in the ex originaly nucleotides are 2'-OMe-uridine, not more than about 10% of all guanosine nucleotides are 2'-OH-guanosine.

In terms of transcription fGmH according to the present invention the reaction mixture for transcription contains 2'-OMe-adenosintriphosphate, 2'-OMe-uridinediphosphate, 2'-OMe-citydistrict and 2'-F-guanozintrifosfata. The modified oligonucleotides produced using conditions transcription fGmH according to the present invention contain essentially all of the base form of 2'-OMe-adenosine, 2'-OMe-uridine, 2'-OMe-cytidine and 2'-F guanosine. In a preferred embodiment, the resulting modified oligonucleotides containing the sequence in which at least 80% of all adenosine nucleotides are 2'-OMe adenosine, at least 80% of all originaly nucleotides are 2'-OMe-uridine, at least 80% of all saidinovich nucleotides are 2'-OMe-citizen and at least 80% of all guanosine nucleotides are 2'-F-guanosin. In a more preferred embodiment, the resulting modified oligonucleotides containing the sequence in which at least 90% of all adenosine nucleotides are 2'-OMe adenosine, at least 90% of all originaly nucleotides are 2'-OMe-uridine, at least 90% of all saidinovich nucleotides PR is astavliaut a 2'-OMe-citizen and at least 90% of all guanosine nucleotides are 2'-F-guanosin. In the most preferred embodiment, the resulting modified oligonucleotides containing the sequence in which 100% of all adenosine nucleotides are 2'-OMe adenosine, 100% of all originaly nucleotides are 2'-OMe-uridine, 100% of all saidinovich nucleotides are 2'-OMe-citizen and 100% of all guanosine nucleotides are 2'-F-guanosin.

In terms of transcription dAmB according to the present invention the reaction mixture for transcription contains 2'-deoxyadenosine, 2'-OMe-citydistrict, 2'-OMe-guanozintrifosfata and 2'-OMe-uridinediphosphate. The modified oligonucleotides produced using the transcription mixtures dAmB according to the present invention contain essentially all of the base form of 2'-deoxyadenosine, 2'-OMe-cytidine, 2'-OMe-guanosine and 2'-OMe-uridine. In a preferred embodiment, the resulting modified oligonucleotides containing the sequence in which at least 80% of all adenosine nucleotides are 2'-deoxyadenosine, at least 80% of all saidinovich nucleotides are 2'-OMe-citizen, at least 80% of all guanosine nucleotides are 2'-OMe-guanosin and at least 80% of all originaly nucleotides are 2'-OMe-uridine. More PR is doctitle embodiment, the resulting modified oligonucleotides containing the sequence in which at least 90% of all adenosine nucleotides are 2'-deoxyadenosine, at least 90% of all saidinovich nucleotides are 2'-OMe-citizen, at least 90% of all guanosine nucleotides are 2'-OMe-guanosin and at least 90% of all originaly nucleotides are 2'-OMe-uridine. In the most preferred embodiment, the resulting modified oligonucleotides according to the present invention contain a sequence where 100% of all adenosine nucleotides are 2'-deoxyadenosine, 100% of all saidinovich nucleotides are 2'-OMe-citizen, 100% of all guanosine nucleotides are 2'-OMe-guanosin and 100% of all originaly nucleotides are 2'-OMe-uridine.

In each case, the products of transcription can then be used as a library in the SELEX methodTMto identify aptamers and/or to determine a conservative motif sequences that have the binding specificity towards the target. The resulting sequences are stable, which excludes from the process stage for obtaining a stabilized sequence of the aptamer and results in more vysokodetalizarovannye aptamers. Other advantages of the m method 2'-OMe-SELEX TMis the fact that the resulting sequence will likely have less than 2'-OH nucleotides required in the sequence, and may not have any. In those cases, when the 2'-OH nucleotides remain, they can be removed when making modifications after SELEX.

As described below, lower, but still acceptable outputs transcripts, fully containing 2'-substituted nucleotides can be obtained in other conditions, other than the optimized conditions described above. For example, change the above conditions transcription include:

The concentration of HEPES-buffer may be in the range from 0 to 1 M. the Present invention also encompasses the use of other buffer means, having a pKa of from 5 to 10, including, for example, Tris(hydroxymethyl)aminomethan.

The concentration of DTT can be in the range from 0 to 400 mm. The methods according to the present invention also provides for the use of other reducing agents, including, for example, mercaptoethanol.

The concentration of spermidine and/or spermine may be in the range from 0 to 20 mm.

The concentration of PEG-8000 can be in the range from 0 to 50% (wt./vol.). The methods according to the present invention also provides for the use of other hydrophilic polymer, including, for example, PEG with different molecular weight or other polyalkylene glycols.

p> The concentration of Triton X-100 can be in the range from 0 to 0.1% (wt./vol.). The methods according to the present invention also provides for the use of other non-ionic detergents, including, for example, other detergents, including other detergents on the basis of Triton-X.

The concentration of MgCl2may be in the range from 0.5 mm to 50 mm. The concentration of MnCl2may be in the range from 0.15 mm to 15 mm. Both salt MgCl2and MnCl2must be in the above ranges, and in the preferred embodiment, are present in a ratio of MgCl2:MnCl2about 10 to 3, preferably the ratio is about 3-5:1, more preferably the ratio is about 3-4:1.

The concentration of 2'-OMe-NTP (each NTP) may be in the range from 5 μm to 5 mm.

The concentration of 2'-OH GTP can be in the range from 0 μm to 300 μm.

The concentration of 2'-OH GMP may be in the range from 0 to 5 mm.

the pH may be in the range from pH 6 to pH 9. The methods according to the present invention can be implemented in the pH range of activity most polymerases that include modified nucleotides. In addition, the methods according to the present invention provide for the optional use of chelating agents in the reaction conditions, transcription, including, for example, EDTA, EGTA and DTT.

Selected aptamers that have the most high is th the affinity and specific binding, which shows in the biological assays described in the examples below, are appropriate therapies for treating conditions in the pathogenesis of which involved a protein of complement C5.

Aptamers having binding affinity of proteins of the complement system C5

Although the complement system plays an important role in maintaining health, it can cause or contribute to disease. Accordingly, requires the development of inhibitors of the complement system for therapeutic applications. Especially, it is desirable to obtain inhibitors of protein complement C5, as it is a component of both classical and alternative routes in the cascades, activation of complement (Matis and Rollins (1995) Nature Medicine 1(8): 839-842). Accordingly, inhibition of C5 can prevent is mediated by complement damage caused by any of the ways. Some proteins of the complement system, such as C1q and C3, which are important for the normal defense mechanisms against microorganisms and for clearance of immune components and cleaning the damaged tissue; however, the C5 does not play a significant role for these functions. Thus, the function of C5 can be ingibirovany for short or long periods of time without undermining the protective role of the complement system.

Therapeutic inhibitor of C5 is also desirable due to the fact that ingibirovany the splitting C5 prevents the formation of two potentially damaging activities complement. First, inhibition of the formation of C5a in the decomposition of C5 eliminating a major chemotactic effect on blood vessels activity of complement. Secondly, inhibition of the formation of C5b from the decomposition of C5 block Assembly cytolytic formation of the membrane attack complex C5b-9 (MAC). Inhibition of C5 cleavage blocks the effects of C5a and C5b on leukocytes and tissue, such as epithelial cells (Ward (1996) Am. J. Pathol. 149: 1079).

C5a and MAC are involved in acute and chronic inflammation associated with human disease, and their role in pathological conditions has been confirmed in animal models. C5a is required for dependent complement and neutrophils damage the blood vessels of the lung (Ward (1997) J. Lab. Clin. Med. 129: 400; Mulligan et al., (1998) J. Clin. Invest. 98: 503) and is associated with activation of neutrophils and platelets in shock and burn injury (Schmid et al., (1997) Shock 8: 119). MAC mediates muscle damage in acute autoimmune bulbospinal paralysis (Biesecker and Gomez (1989) J. Immunol. 142: 2654), the rejection of organs after transplantation (Baldwin et al., (1995) Transplantation 59: 797; Brauer et al., (1995) Transplantation 59: 288; Takahashi et al., (1997) Immunol. Res. 16: 273) and kidney damage in autoimmune glomerulonephritis (Biesecker (1981) J. Exp. Med. 39: 1779; Nangaku (1997) Kidney Int. 52: 1570). And C5a and MAC are involved in acute myocardial ischemia (Homeister and Lucchesi (1994) Annu. Rev. Pharmacol. Toxicol. 34: 17), acute (Bednar et al., (1997) J. Neurosurg. 86: 139) and chronic on the establishment of the Central nervous system (Morgan (1997) Exp. Clin. Immunogenet. 14: 19), activation of leukocytes during cardiopulmonary bypass (Sun et al., (1995) Nucleic Acids Res. 23: 2909; Spycher and Nydegger (1995) Infushionsther. Transfusionsmed. 22: 36) and in tissue damage associated with autoimmune diseases, including arthritis and lupus (Wang et al., (1996) Immunology 93: 8563 in order).

Activation of complement is also involved in diabetic retinopathy and may inhibit or initiate damage to the blood vessels of the retina (Zhang et al., (2002) Diabetes 51: 3499). The low level of constitutive activation of complement is usually in the eye in the absence of diabetes, the proof of which is the presence of MAC and regulatory proteins of complement in the eyes neadiabaticheskikh rats, which suggests that patients with diabetes is dysregulation of the complement (Sohn et al., (2000) IOVS 41: 3492). In addition, the deposition of C5b-9 was detected in retinal vessels donors in people with diabetes, which was absent from donors, not diabetes (Zhang et al.), reduced expression of CD55 and CD59 shown in the retina in diabetes (Zhang et al.), and glycated CD59 is present in the urine of diabetic patients but not in patients without diabetes (Acosta et al., (2002) PNAS 97, 5450-5455). In addition, it is known that diabetes type I is activated complement and vascular system. See, for example, Hansen, T.K. et al., Diabetes, 53: 1570-1576 (2004). C5a activates endothelial cells by interacting with and annoy system and the complement system. See, for example, Albrecht, A. et al., Am. J. Pathology, 164: 849-859 (2004). The vascular system is activated when ocular diseases, including diabetic retinopathy. See, for example, Gert, V.B. et al., Invest. Opthalmol. Vis. Sci., 43: 1104-1108 (2002). The complement system is also activated in diabetic retinopathy. See, for example, Gert, V.B. et al., Invest. Opthalmol. Vis. Sci., 43: 1104-1108 (2002) and Badouin, C. et. al., Am. J. Opthalmol., 105: 383-388 (1988).

In some embodiments, the substances according to the present invention include a number of aptamers nucleic acids in length from about 15 to about 60 nucleotides, which are specific contacted with the protein of complement C5 and which functionally modulate, e.g. inhibit, the activity of the protein of complement C5 in the analysis of in vivo and/or cell-based assays.

This paper presents aptamers that are capable of specific contact and to modulate protein of complement C5. These aptamers provide non-lethal, safe and effective treatment, reduction and/or prevention of various related complement of diseases or disorders, including, for example, associated with complement cardiac disorders (e.g., damage to the myocardium; mediated protein complement C5 complications associated with transplantation surgery for coronary artery bypass (CABG), such as postoperative bleeding, the system and the motivation of neutrophils and leukocytes, increased risk of myocardial infarction and cognitive dysfunction; restenosis; and mediated protein complement C5 complications associated with percutaneous intervention in the coronary artery), ischemic-reperfusion injury (e.g. myocardial infarction, stroke, hypothermia), associated with complement inflammatory disorders (e.g. asthma, arthritis, sepsis, and rejection after organ transplantation) and associated with complement autoimmune disorders (for example, bulbospinal palsy, systemic lupus erythematosus (SLE). Other indications in which it is desirable inhibition of C5, include, for example, pneumonia (Mulligan et al. (1998) J. Clin. Invest. 98: 503), in vitro activation of complement (Rinder et al. (1995) J. Clin. Invest. 96: 1564)antibody-mediated activation of the complement (Biesecker et al. (1989) J. Immunol. 142: 2654), glomerulonephritis and other renal diseases, eye diseases, such as C5 mediated tissue damage in the eye, such as diabetic retinopathy, and paroxysmal night hemoglobinuria. These aptamers can also be used in diagnosis.

These aptamers may contain modifications that are described in this publication, including, for example, conjugation with lipophilic or high molecular compounds (e.g., PEG), the inclusion of kairouseki balance, the inclusion of modi the data of the nucleotide and the phosphate backbone modification.

In one embodiment, the invention features isolated not a naturally occurring aptamer that binds to a protein of complement C5. In some embodiments, the isolated not a naturally occurring aptamer has a dissociation constant (Kd") in relation to protein complement C5 constituting less than 100 microns, less than 1 μm, less than 500 nm, less than 100 nm, less than 50 nm, less than 1 nm, less than 500 PM, less than 100 PM, less than 50 PM. In some embodiments of the invention, the dissociation constant determined from the dot-blot titration as described in example 1 below.

In another embodiment, the aptamer according to the invention modulates the function of a protein of complement C5. In another embodiment, the aptamer according to the invention inhibits the function of C5, whereas in another embodiment, the aptamer stimulates the function of the C5. Variant protein of complement C5 in used in this sense encompasses variants that perform essentially the same function as the protein complement C5. Variant protein of complement C5 preferably has essentially the same structure and in some embodiments has 80% sequence identity, more preferably 90% sequence identity and more preferably 95% sequence identity with the amino acid sequence of the protein of complement C5, containing the following aminokislot the th sequence (SEQ ID NO: 102) (shown in Haviland et al., J. Immunol. 1991 Jan 1; 146(1): 362-8):

In some embodiments of the invention the identity of the target sequences of the options determined using BLAST, as described below. The term "sequence identity" in the context of two or more sequences of nucleic acids or proteins refers to two or more sequences or subsequences that are the same or have a specific percentage of amino acid residues or nucleotides that are the same when compared and aligned in relation to the maximum matching, which is measured using one of the following algorithms comparison of sequence or in the visual view. When comparing sequences, typically one sequence acts as a reference sequence, with which compare the test sequence. When using the comparison algorithm, test sequences and the reference sequence is introduced into the computer, if necessary, indicate the coordinates of the subsequences and enter the parameters of the program algorithm of sequence comparison. The comparison algorithm sequences then computes the sequence identity in percent DL the test sequence(s) compared to a reference sequence based on the specified parameters of the program. Optimal alignment of sequences for comparison can, for example, be performed using algorithm local homology described in Smith and Waterman, Adv. Appl. Math. 2: 482 (1981), using an alignment algorithm to determine the homology according to Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970), by way of finding similarities according to Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85: 2444 (1988), computerized methods of using these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the package of computer programs Wisconsin Genetics, Genetics Computer Group, 575 Science Dr., Madison, Wis.) or through the visual view (see Ausubel et al., above).

One example of algorithm that is suitable for determining sequence identity in percent, is the algorithm used in the primary search tool, based on the local alignment ("BLAST"), see, for example, Altschul et al., J. Mol. Biol. 215: 403-410 (1990) and Altschul et al., Nucleic Acids Res., 15: 3389-3402 (1997). A computer program for performing BLAST analyses publicly available from the National Center for Biotechnology Information ("NCBI"). The default settings used when determining the identity of the sequence using a computer program, available from NCBI, for example, BLASTN (for nucleotide sequences) and BLASTP (for amino acid sequences) described in McGinnis et al., Nucleic Acids Res., 32: W20-W25 (2004).

In another embodiment, the implementation of the Oia, the invention features an aptamer, which has essentially the same ability to bind protein complement C5, and aptamers containing any of the sequences: SEQ ID NO: 1-2, 5-67, 75-81, 83 or 88-98. In another embodiment according to the invention, the aptamer has essentially the same structure and ability to bind protein complement C5, and aptamers containing any of the sequences: SEQ ID NO: 1-2, 5-67, 75-81, 83 or 88-98. In another embodiment, the aptamers according to the invention have the sequence, including any chemical modification according to any one of SEQ ID NO: 2, 5-67, 75-81, 83 or 88-98. In another embodiment, the aptamers according to the invention are used as active ingredient in pharmaceutical compositions. In another embodiment, the aptamers or compositions containing aptamers according to the invention, used to treat a variety associated with complement of diseases or disorders, including any disease or disorder selected from the group consisting of associated with the complement of cardiac disorders (e.g., myocardial damage; mediated protein complement C5 complications associated with transplantation during coronary artery bypass (CABG), such as postoperative bleeding, systemic activation of neutrophils and leukocytes, increased risk of myocardial infarction and cognitive dysfunction; restenosis; and mediated protein included the enta C5 complications associated with percutaneous intervention in the coronary artery), ischemic-reperfusion injury (e.g. myocardial infarction, stroke, hypothermia)associated with complement inflammatory disorders (eg, asthma, arthritis, sepsis, and rejection after organ transplantation) and associated with the complement of autoimmune disorders (e.g., bulbospinal palsy, systemic lupus erythematosus (SLE), inflammation of the lungs, in vitro activation of complement-mediated antibody activation of complement and eye diseases, such as mediated by complement damage the tissue of the eye, such as diabetic retinopathy.

In one embodiment, the anti-C5 aptamers according to the invention contain a mixture of 2'-fluoro-modified nucleotide, 2'-OMe-modified nucleotides ("2'-OMe) and 2'-OH purine residues. Illustrative General sequence (SEQ ID NO: 1) for the modified anti-C5-aptamer shown below in table 1, and the structure shown in figa. The vast majority of purines (A and G) were modified to 2'-OMe, excluding only two remnant G, in which were preserved the 2'-OH residues are shown by contour). Circled in circles residues represent a subgroup of pyrimidines, which have been simultaneously modified to 2'-H essentially without changing the anti-C5-activity of the aptamer (see ARC330 in table 1 below SEQ ID NO: 2, figv)). The underlined residues shown in figa mean pyrimidine residues, which can contain either 2'-fluoro or 2'-H-modification (but not 2'-OMe), whereas the marked rectangles remains mean pyrimidine residues, which can contain either 2'-fluoro or 2'-OMe-modified (but not 2'-H). Residues indicated by an arrow (→)must contain 2'-fluoro-modification. Without 2'-fluoro-modification residues indicated by an arrow (→)obtained hemolytic activity of the resulting aptamer decreases significantly. In a preferred embodiment, the anti-C5 aptamer according to the invention contains a nucleotide sequence according to SEQ ID NO: 1.

Example of anti-C5-aptamer according to the invention is ARC186 (SEQ ID NO: 4), which is shown in Figs and described in U.S. patent registration No. 6395888, which is included in this description by reference in full. All 21 pyrimidine residue ARC186 are 2'-fluoro-modification. Most of purines (14 residues) are 2'-OMe modification with the exception of three 2'-OH purine residues (shown in outline on figs). Anti-C5 aptamers according to the invention can also contain various mixtures of 2'-fluoro - and 2'-H-modifications. For example, other anti-C5-aptamer according to the invention is ARC330 (SEQ ID NO: 2)shown in figv. ARC330 (SEQ ID NO: 2) contains seven 2'-H-modifications (circled in circles remains the and figv), 14 pyrimidine residues with 2'-fluoro-modification, 14 purine residues with 2'-OMe-modifications and three 2'-OH purine residue (shown in outline on figv).

Other combinations of aptamers containing a mixture of 2'-fluoro-modification, 2'-OMe-modifications, 2'-OH purine residues, and conjugation with non-immunogenic high molecular compounds (e.g., PEG) of different sizes, each of which is obtained from ARC186 (SEQ ID NO: 4), described in table 1 below. The invention relates to aptamers, which are described in table 1 below. The invention also relates to aptamers, which are described below, but are not specified 3'-cap (e.g., inverted deoxythymidine CEP) and/or aptamers below, but contains 3'-cap (e.g., inverted dT) in cases where the 3'-cap is not specified.

Unless otherwise noted, the nucleotide sequence in table 1 below are listed in 5'-3'direction. For each sequence in table 1, all 2'-OMe-modified purine or pyrimidine marked "m" in front of the appropriate nucleotide; all 2'-fluoro-modified pyrimidines marked "f" in front of the appropriate nucleotide; all deoxy-modified purine or pyrimidine labelled "d" in front of the appropriate nucleotides; any purine or pyrimidine specified without "m", "f" or "d" in front of the nucleotide is 2'-OH residue. The stage is niteline "3T" indicates an inverted deoxythymidine, "NH" indicates hexylamine linker, "NH2" specifies hexylamino end group, "PEG" means a polyethylene glycol having a specified molecular weight, and "Biotin" means the aptamer with conjugated to the 5'-end Biotin.

Table 1

where branched PEG with 40 Mm KD represents,3-bis(MPEG-[20 CD])propyl-2-(4'-butamid)

where branched PEG with 40 Mm KD represents a 2,3-bis(MPEG-[20 CD])propyl-1-carbarnoyl

Other aptamers according to the invention, which bind to the protein of complement C5, described below in example 3.

In some embodiments attornye therapeutic agent according to the present invention have high affinity and specificity towards their targets, while reducing dangerous side effects are not occurring nucleotide substitutions, if attornye therapeutic agent are decomposed in the body of patients or subjects. In some embodiments, therapeutic compositions containing attornye therapeutic agent according to the present invention, does not have the t or have a reduced amount of fluorinated nucleotides.

The aptamers according to the present invention can be synthesized using any method of synthesis of oligonucleotides known in this field, including the method of solid-phase synthesis of oligonucleotides known in the art (see, e.g., Froehler et al., Nucl. Acid Res. 14: 5399-5467 (1986) and Froehler et al., Tet. Lett. 27: 5575-5578 (1986)) and methods of synthesis in solutions, such as methods of synthesis of Trifonov (see, for example, Sood et al., Nucl. Acid Res. 4: 2557 (1977) and Hirose et al., Tet. Lett., 28: 2449 (1978)).

The pharmaceutical composition

The invention also relates to pharmaceutical compositions containing molecule aptamers that bind to a protein of complement C5. In some embodiments, compositions suitable for use inside and contain an effective amount of the pharmacologically active compounds according to the invention alone or in combination with one or more pharmaceutically acceptable carriers. The connection is particularly applicable, because they have very low toxicity or no toxicity.

Compositions according to the invention can be used to treat or prevent the pathology, such as a disease or disorder, or mitigate symptoms of such disease or disorder in a patient. For example, compositions according to the present invention can be used to treat or prevent the pathology, St. the marks caused by complement cardiac disorders (e.g., damage to the myocardium; mediated protein complement C5 complications associated with transplantation surgery for coronary artery bypass (CABG), such as postoperative bleeding, systemic activation of neutrophils and leukocytes, increased risk of myocardial infarction and cognitive dysfunction; restenosis; and mediated protein complement C5 complications associated with percutaneous intervention in the coronary artery), ischemic-reperfusion injury (e.g. myocardial infarction, stroke, hypothermia)associated with complement inflammatory disorders (e.g. asthma, arthritis, sepsis, and rejection after organ transplantation) and associated with complement autoimmune disorders (e.g., bulbospinal palsy, systemic lupus erythematosus (SLE or lupus); inflammation of the lungs, in vitro activation of complement-mediated antibody activation of complement and eye diseases such as diabetic retinopathy. Compositions according to the invention is applicable for administration to a subject suffering from or Prednisolonum to the disease or disorder that is associated or is the result of the action of the protein complement C5, with which the aptamers according to the invention specific contact.

Compositions according to the finding can be used in a method of treatment of a patient or subject, with pathology. The methods according to the invention consist in the introduction to the patient or subject) or compositions containing aptamers that bind to a protein of complement C5, so that the binding of aptamers to protein complement C5 modifies its biological function, thereby treating the pathology.

The patient or subject having a pathology, i.e. the patient or subject, which is treated by the methods according to this invention, may be a vertebrate, more specifically a mammal, or more specifically the people.

In practice, the aptamers or their pharmaceutically acceptable salts are administered in amounts which will be sufficient for the manifestation of their biological activity, for example, for inhibition of the binding target of the aptamer to its receptor, preventing cleavage of the protein target.

According to one aspect of the invention relates to the composition of the aptamer according to the invention in combination with other medications for treatment of disorders mediated by C5 complement. The composition of the aptamer according to the invention may contain, for example, more than one aptamer. In some examples, the composition of the aptamer according to the invention, containing one or more compounds according to the invention, is administered in combination with other applicable composition, such as an anti-inflammatory, immunogenes the ant, antiviral agent or the like. In addition, the compounds according to the invention can be introduced in combination with a cytotoxic, cytostatic or chemotherapeutic agent such as an alkylating agent, an antimetabolite, an inhibitor of mitosis or cytotoxic antibiotic that described above. In General, the currently available dosage forms known therapeutic agents are suitable for use in such combinations.

"Combination therapy" (or "co-therapy") is the introduction song of the aptamer according to the invention and at least a second means in the form of a specific treatment regimen intended to provide a healing influence in the result of joint action of these therapeutic agents. The healing effect of the combination includes, but is not limited to the above, the pharmacokinetic or pharmacodynamic joint effect of the combination of therapeutic agents. The introduction of these therapeutic agents in combination typically is carried out for a certain period of time (usually within minutes, hours, days or weeks depending on the selected combination).

"Combination therapy" may imply, but as a rule does not imply that the introduction of two or more of these therapeutically the funds as part of a separate schemes monotherapy who accidentally and arbitrarily result in the combinations according to the present invention. It is understood that "combination therapy" embraces the introduction of these therapeutic agents sequentially, that is, when each therapeutic agent is administered at different times, as well as the introduction of these therapeutic agents, or at least two therapeutic agents essentially simultaneously. Essentially, co-administration can be accomplished, for example, by introducing the subject of one capsule containing a fixed ratio of each therapeutic agent or in multiple, separate capsules for each therapeutic agent.

Sequential or substantially simultaneous introduction of each therapeutic agent can be accomplished in any suitable way, including, without limitation, local route, oral route, intravenous route, intramuscular route, and direct absorption through the tissues of the mucous membranes. A therapeutic agent can be entered the same way or in different ways. For example, the first therapeutic agent is selected combinations can be administered by injection, while the other therapeutic agent combinations can be entered locally.

Alternatively, for example, all therapeutic agent can be introduced locally or all terapeuticas the e funds may be introduced by injection. The sequence in which the injected therapeutic agent, is not strictly necessary, unless otherwise stated. "Combination therapy" also can embrace the introduction of therapeutic agents, as described above, in a different combination with other biologically active ingredients. In the case where combination therapy further includes a non-drug treatment, non-drug treatment can be performed at any appropriate time, provided that the healing effect is achieved from the joint action of the combination of therapeutic agents and non-drug treatment. For example, in suitable cases, the curative effect is still achieved when non-drug treatment is separated in time from the introduction of therapeutic agents, may be several days or even weeks.

Therapeutic or pharmaceutical compositions according to the present invention, as a rule, must contain an effective amount of the active component(s) for therapy, dissolved or dispersed in a pharmaceutically acceptable medium. Pharmaceutically acceptable medium or carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and slowing down the absorption of the agents and the like. The use of such CPE and agents for pharmaceutically active substances is well known in this field. Supplementary active ingredients can also be included in therapeutic composition according to the present invention.

Preparation of pharmaceutical or pharmacological compositions will be clear to experts in this field in the light of the present description. Typically, such compositions can be prepared in the form of an injection of funds, either in the form of liquid solutions or suspensions; solid forms suitable for solution or suspension in liquid prior to injection; in the form of tablets or other solid preparations for oral administration; in the form of capsules to release over time or in any other form currently used, including eye drops, creams, lotions, ointments, means for inhalation and the like. It may also be useful sterile preparations, such as based on physiological solution lotions, surgeons, therapists or medical professionals to handle a specific area of the surgical field. The compositions can also be delivered through miroustroistva, microparticles or sponge.

After preparing a therapeutic agent must enter in a manner compatible with the dosage of the drug, and in such a quantity, which is pharmacologically effective. Drugs are easily administered in the form of RA is personal dosage forms, for example in the form of injectable solutions described above, but can also be used capsule, releasing the drug, and the like.

In this context, the amount of the active ingredient and volume of injected composition depends on the animal host being treated. The exact amount of active compound required for the introduction, will depend on the decision of the attending physician and are unique to each entity.

Usually use the minimum amount of the composition required for dispersion of the active compounds. Suitable schemes also vary, but can be determined through the initial introduction of the connection and monitoring of results and then the appointment of the following controlled doses at certain intervals of time.

For example, for oral administration in the form of tablets or capsules {for example, a gelatin capsule) active ingredient of medicines can be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol, water and the like. In addition, if desired or necessary, the mixture may also be included suitable connecting means, sliding substances, dezintegriruetsja tools and dyes. Suitable binding agents include starch, lamosil the cat magnesium, starch paste, gelatin, methylcellulose, sodium carboxymethyl cellulose and/or polyvinylpyrrolidone, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums, such as Arabian gum, tragacanth gum or sodium alginate, polyethylene glycol, waxes and the like. Sliding substances in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, silicon dioxide, talc, stearic acid, its magnesium or calcium salt and/or polyethyleneglycol and the like. Dezintegriruetsja agents include without limitation, starch, methylcellulose, agar, bentonite, xanthan gum, starches, agar, alginic acid or its sodium salt, or effervescent mixtures and the like. Diluents include, for example, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine.

Injectable compositions are preferably aqueous isotonic solutions or suspensions, and suppositories mainly prepared from fatty emulsions or suspensions. The compositions may be sterilized and/or may contain adjuvants such as preservatives, stabilizers, moisturizers or emulsifiers, dissolution accelerators, salts for regulating osmotic pressure and/or schedule the s. In addition, they can also contain other therapeutically valuable substances. Compositions prepared according to conventional methods of mixing, granulating or coatings, respectively, and they usually contain from about 0.1 to 75%, preferably about 1 to 50% of the active ingredient.

Compounds according to the invention can also be entered in such oral dosage forms as tablets or capsules with controlled time-release and extended-release pills, powders, granules, elixirs, tinctures, suspensions, syrups and emulsions.

Liquid, especially injection, the composition may be, for example, prepared by dissolving, dispersing, etc. an Active compound is dissolved or mixed with pharmaceutically pure solvent, such as water, saline, aqueous dextrose, glycerol, ethanol and the like, with the formation thus injectable solution or suspension. In addition, can be prepared solid forms suitable for dissolution in liquid prior to injection.

Compounds according to the present invention can be administered during intravenous (both bolus and infusion), intraperitoneal, subcutaneous or intramuscular form, in all cases using forms well known to experts in the field farm is tion. Injectable preparations can be prepared in conventional forms, either as liquid solutions or suspensions.

Parenteral injection is usually used for subcutaneous, intramuscular or intravenous injection and infusion. In addition, in one way parenteral use implantation systems slow release or extended release, maintaining a constant level of dose, according to U.S. patent No. 3710795 included in this description by reference.

In addition, preferred compounds according to the present invention can be introduced in intranasal form via topical use of suitable intranasal vehicles, inhalers, or via transdermal route, using the forms of transdermal skin patches well known to specialists in this field. With the introduction in the form of a transdermal delivery system, the dose, of course, be continuous rather than intermittent throughout the dosing schedules. Other preferred local preparations include creams, ointments, lotions, aerosol sprays and gels, the concentration of the active ingredient, as a rule, can be in the range from 0.01% to 15% wt./mass. or mass./about.

In the case of solid compositions excipients that can be used include headlight is asepticheski pure mannitol, lactose, starch, magnesium stearate, saccharin sodium, talc, cellulose, glucose, sucrose, magnesium carbonate and the like. The active compound, as defined above, can also be prepared in the form of suppositories using as a carrier, for example, polyalkylene glycols, such as propylene glycol. In some embodiments, suppositories mainly prepared from fatty emulsions or suspensions.

Compounds according to the present invention can also be entered in the form of delivery systems based on liposomes, such as small single-layer vesicles, large single-layer and multi-layered vesicles vesicles. Liposomes can be formed from a variety of phospholipids, cholesterol, stearylamine or phosphatidylcholine. In some embodiments, the film of lipid components gidratirovana aqueous solution of a medicinal product with the formation of the lipid layer that encapsulates the drug, as described in U.S. patent No. 5262564. For example, molecules of the aptamers described in this publication can be obtained in the form of a complex with a lipophilic compound or non-immunogenic, high molecular weight compound, constructed using methods known in this field. An example associated with nucleic acid complexes described in U.S. patent No. 6011020.

Compounds according to astasia the invention can also be associated with soluble polymers as carriers allocated to the target drug. Such polymers can include polyvinylpyrrolidone, a copolymer of Piran, polyhydroxyethylmethacrylate, polyhydroxyalkanoates or polyethylenepolyamine, substituted residues of Palmitoyl. In addition, the compounds according to the present invention can be associated with a class biorazlagaemykh polymers applicable for achieving controlled release of a drug, for example polylactic acid, polietilentireftalat, polyhydroxyalkanoic acid complex prioritaire, polyacetylene, policyidreference, polycyanoacrylates and cross stitched or amphipatic block copolymers of hydrogels.

If desired, enter the pharmaceutical composition may also contain minor amounts of nontoxic auxiliary substances, such as moisturizers or emulsifiers, buffer means for maintaining pH and other substances, such as, for example, sodium acetate and triethanolamine oleate.

Scheme dispensing with the use of aptamers are selected in accordance with various factors including type, species, age, weight, sex and health status of the patient; the severity of the condition being treated; the route of administration; the functioning of the kidneys and liver of the patient and specific aptamers or its salt. The skilled physician or veterinarian can easily determine who to assign an effective amount of the medicinal product, required to prevent, counter or delay progression of the condition.

Oral dose according to the present invention when used for obtaining the above effects should be in the range of from about 0.05 to 7500 mg/day orally. The composition preferably offer in the form of tablets with notches containing 0,5, 1,0, 2,5, 5,0, 10,0, 15,0, 25,0, 50,0, 100,0, 250,0, 500,0 and 1000,0 mg of the active ingredient. Compounds according to the present invention can be introduced as a single daily dose or the total daily dose may be introduced fractional doses two, three or four times per day.

Infusion dose, intranasal and transdermal dose, the dose should be in the range from 0.05 up to 7500 mg/day. Subcutaneous, intravenous and intraperitoneal dose should be in the range from 0.05 to 3800 mg/day.

Effective plasma levels of the compounds according to the present invention are in the range from 0.002 mg/ml to 50 mg/ml

Modulation of the pharmacokinetics and bearsdley therapeutic aptamers

It is important that the pharmacokinetic properties of all based on the oligonucleotide therapeutics containing aptamers were adjusted to match the desired pharmaceutical use. Although in the case of aptamers directed against extracellular targets, does not occur in the t difficulties associated with intracellular delivery (as in the case of antimuslim tools and therapies based on RNA), such aptamers have yet to be able to distributed to organs and target tissues and stored in the body (non-modified) during the period of time corresponding to the desired scheme dosing.

Thus, the present invention relates to substances and ways to affect the pharmacokinetics of aptamer compositions and, in particular, on the possibility to adjust the pharmacokinetics of aptamers. The possibility of regulation (i.e. the possibility of modulation) of the aptamer pharmacokinetics is achieved by conjugation of modifying residues (for example, polymers PEG) with the aptamer and/or the inclusion of modified nucleotides (e.g., 2'-fluoro - or 2'-OMe-nucleotides), to change the chemical composition of nucleic acids. The possibility to adjust the aptamer pharmacokinetics is used to improve existing therapeutic applications or alternative for the development of new therapeutic applications. For example, in the case of some therapeutic applications, for example in the case of anticancer applications or in conditions of emergency, when you might require quick clearance or termination of the medicinal product, the same is consequently to reduce the retention time of the aptamer in the circulation. Alternate with other therapeutic applications, for example during maintenance therapy, when required systemic circulation therapeutic agent may be desirable to increase the retention time of aptamers in blood circulation.

In addition, the possibility of regulation of aptamer pharmacokinetics is used to modify the biodistribution Atamanova therapeutic agent in the subject. For example, in some therapeutic applications may require a change bearsdley Atamanova therapeutic agent to try to direct it to a specific tissue type or to a specific organ or group of organs). In such applications optimalnoe therapeutic agent preferably accumulates in a specific tissue or organ(s). Other therapeutic applications, it may be necessary to direct the tool to the tissues with cellular marker or symptom associated with this disease, cell damage or other abnormal pathology, so that optimalnoe therapeutic agent preferably accumulated in the affected tissue. For example, as described in the concurrently pending provisional application for patent U.S. registration No. 60/550790 filed March 5, 2004 and entitled "Controlled Modulation of the Pharmacokinetics and iodistribution of Aptamer Therapeutics), tahilramani Atamanova a therapeutic agent (e.g., tahilramani using polymer PEG with 20 Mm KD) is used for sending funds to the inflamed tissue, so that pegylated aptamers therapeutic agent preferably accumulates in inflamed tissue.

To determine the pharmacokinetic profiles and bearsdley aptameric therapeutic agents (e.g., conjugates of aptamers or aptamer with changed chemical composition, for example, modified nucleotides) register many options. Such parameters include, for example, the half-life (t1/2), clearance from plasma (Cl), volume of distribution (Vss), the area under the curve of concentration-time (AUC), maximum observed concentration in serum or plasma (Cmax) and the mean retention time (MRT) of the composition of the aptamer. Used in this sense, the term "AUC" refers to the area under the graph of concentration Atamanova therapeutic agent in plasma versus time after injection of aptamer. The value of AUC is used to assess the bioavailability (i.e. the percentage of introduced Atamanova therapeutic agent in the circulation after the introduction of the aptamer and/or total clearance (Cl) (i.e. the speed at which aptamers therapeutic agent is removed from circulation) the data Atamanova therapeutic agent. The volume of distribution sets the ratio of the concentration Atamanova therapeutic agent in the plasma to the number of aptamer present in the body. More than Vss, the more aptamer is detected outside the plasma (i.e., radiolabeled).

The present invention relates to agents and methods of modulating a controlled way pharmacokinetics and bearsdley stabilized compositions of the aptamer in vivo by conjugation of the aptamer with the modifying residue, such as low molecular weight, peptide or polymer end-group, or by incorporation of a modified nucleotide in aptamer. As indicated in this description, the conjugation of reactive residue and/or chemical modification of the nucleotide changes the basic aspects related to the retention time of the aptamer in the circulation and distribution in the tissues.

In addition to the clearance with the participation of nucleases oligonucleotide therapeutic agent are removed by renal filtration. As such, resistant to nucleases oligonucleotides, administered intravenously, typically have a half-life in vivo <10 min, if the filter cannot be blocked. This can be done either by ensuring rapid distribution of blood flow in the tissue, or by increasing the apparent molecular weight is of oligonucleotide to the value exceeding the effective cut-off size in the glomeruli. Conjugation of small therapeutic agents to the polymer PEG (tahilramani), described below, can significantly prolong the retention time of aptamers in circulation, thereby reducing the frequency of dosing and increasing effectiveness against vascular targets.

Aptamers can be conjugated with various modifying residues, such as high molecular weight polymers, such as PEG; peptides, e.g., Tat (13-amino-acid fragment of the Tat protein of HIV (Vives, et al. (1997), J. Biol. Chem. 272(25): 16010-7)), Ant (16-amino acid sequence derived from the third helix semioticheskogo protein in Drosophila antennapedia (Pietersz, et al. (2001), Vaccine 19(11-12): 1397-405)) and Arg7(short positively charged penetrating into cells peptides consisting of polyalanine (Arg7) (Rothbard, et al. (2000), Nat. Med. 6(11): 1253-7; Rothbard, J et al. (2002), J. Med. Chem. 45(17): 3612-8)); and small molecules, such as lipophilic compounds, such as cholesterol. Among the various conjugates described in this publication, the properties of aptamers in vivo stronger just change with the formation of complexes with PEG groups. For example, the formation of complex mixed 2'-F and 2'-OMe-modified Atamanova therapeutic agent to the polymer PEG with 20 Mm KD inhibits renal filtration and stimulates the distribution of aptamers as in healthy and inflamed tissue. In addition, it is confirmed that the conjugate polymer PEG 20 KD-aptamer almost as effective as the polymer PEG-40 KD in preventing renal filtration of aptamers. Although one of the effects provided by tahilramani, sent on clearance of aptamers, prolonged systemic effects of the presence of the residue with 20 Mm KD, also contributes to the distribution of the aptamer in the tissue, especially tissue well perfuziruemah organs and tissue at the site of inflammation. Conjugated aptamer with polymer PEG 20 KD directs the aptamer in the distribution at the site of inflammation, so pegylated aptamer preferably accumulates in inflamed tissue. In some cases, the conjugate of the aptamer with 20 KD-PEG can pass into the cells, such as cells of the kidney.

In General, the impact on the pharmacokinetics and distribution of the aptamer in the tissues, provide low-molecular-weight modifier residues, including cholesterol and penetrating into the cells, peptides, less pronounced than the effects tahilramani or modification of nucleotides (for example, the modified chemical composition). Without intending to be bound by any theory, suggest that mediated by cholesterol binding to plasma lipoproteins, presumably occurring in the case of antisense conjugate, is excluded in particular Conte is the extent subjected to the folding structure of the aptamer conjugate is cholesterol and/or is related to the lipophilic nature of the group of cholesterol. Like the presence of cholesterol at the end of the Tat-peptide stimulates the clearance of the aptamer from the blood stream, with relatively high levels of conjugate appear in the kidneys within 48 hours. Other peptides (e.g., Ant, Arg7), which was reported in this region mediates the passage of macromolecules across cell membranes in vitro, apparently, does not stimulate the clearance of the aptamer from the circulation. However, like Tat conjugate Ant largely in comparison with other aptamers accumulate in the kidneys. Without intending to be bound by any theory, suggest that the likely adverse presentation of modifying residues of peptides Ant and Arg7in the context of three-dimensional Packed aptamer in vivo impairs the ability of these peptides to influence the transport properties of aptamers.

Modified nucleotides can also be used to modulate the clearance of aptamers from plasma. For example, the unconjugated aptamer, which contains a stabilizing chemical groups are 2'-F and 2'-OMe, which is a typical representative of the aptamers of the modern generation, as it has a high degree of stability towards nucleases in vitro and in vivo, quickly disappears from the plasma (i.e. has a rapid clearance from plasma) and has a rapid distribution into tissues, mainly in the kidneys, compared to the unmodified aptamer.

Nucleic acid derivateservlet PEG

As described above, the derivatization of nucleic acids of high molecular weight non-immunogenic polymers makes it possible to change the pharmacokinetic and pharmacodynamic properties of nucleic acids, making them more effective therapeutic means. Preferred activity modification may include increased resistance to destruction by nucleases, reduced filtration by the kidneys, less impact on the immune system and altered the distribution of therapeutic agent in the body.

The composition of the aptamers according to the invention can be derivationally the rest of polyalkyleneglycol ("PAG"). Examples PAG-derivatizing nucleic acids given in the application for the grant of a U.S. patent with registration No. 10/718833, filed November 21, 2003, which is incorporated in this description by reference in full. Typical polymers used in the invention include poly(ethylene glycol) ("PEG"), also known as poly(ethylene oxide) ("PEO") and polypropylenglycol (including polyisopropylene). In addition, many applications can be used in random or block copolymers of different alkalisation (for example, ethylene oxide and propylene oxide). In the most General form of polyalkyleneglycol, such as PEG is a linear polymer, Zack is givaudins at each end with hydroxyl groups: HO-CH 2CH2O-(CH2CH2O)n-CH2CH2-OH. Such a polymer, alpha-, omega-dihydroxyindole(ethylene glycol)can also be represented as HO-PEG-OH where it is assumed that the symbol-PEG - means the following structural unit: -CH2CH2O-(CH2CH2O)n-CH2CH2-, where n is typically in the range of from about 4 to about 10000.

As shown, the PEG molecule is bifunctional and it is sometimes referred to as "PEG-diol". Integral parts of the PEG molecules are relatively chemically inactive hydroxy residues, OH-groups, which can be activated or converted into the functional residues for the binding of PEG with other compounds in the active sites of the connection. Such activated PEG-diols in this description referred to as iactiveaware PEG. For example, the limit remains of PEG-diol were functionalized to form an active complex carbonate ester for selective engagement with aminooctane substitution is relatively inactive hydroxyl residues, -OH, an active ester residue Succinimidyl of N-hydroxysuccinimide.

In many applications it is desirable to caproate molecule PEG on one end essentially inactive residue, so that the PEG molecule was monofunctional (or monoactive). In the case of therapeutics is their proteins, which usually have many sites of interaction with activated PEG, bifunctional activated PEG lead to extensive cross-stitching, giving enough functional units. To create monooctylamine PEG, one hydroxyl residue at the end of a molecule of PEG-diol usually replace the inactive terminal methoxy group, -OCH3. Another necatibey the end of the PEG molecules usually transform into an active terminal residue, which can be activated to bind to the active site on the surface or with this molecule as a protein.

PAG are polymers which usually have the properties of solubility in water and in many organic solvents, have no toxicity and are non-immunogenic. One of the applications of PAG is the covalent linking of a polymer insoluble molecules to make the resulting "conjugate" PAG-soluble molecule. For example, it was shown that the water-insoluble drug paclitaxel when linking with PEG becomes water-soluble. Greenwald, et al., J. Org. Chem., 60: 331-336 (1995). Conjugates PAG is often used not only to improve the solubility and stability, but also to increase the half-life of molecules in the circulation.

Polyalkylene compounds according to the invention typically have a size from 5 to 80 KD, however, you can use any size, the choice depends on the aptamer and application. Other compounds PAG according to the invention have a size of from 10 to 80 KD. Other compounds PAG according to the invention have a size of from 10 to 60 KD. For example, the PAG polymer may have a size of at least 10, 20, 30, 40, 50, 60 or 80 KD. Such polymers can be linear or branched.

Unlike biologically expressed therapeutic proteins therapeutic nucleic acid is usually chemically synthesized from activated monomers nucleotides. The conjugates of PEG-nucleic acid can be obtained by introducing PEG, using the same repetitive synthesis of monomers. For example, PEG activated by turning in phosphoramidite form, can be introduced during solid-phase synthesis of oligonucleotides. Alternative synthesis of oligonucleotides may end in site-specific incorporation of active site binding of PEG. In most cases this can be done by adding a free primary amine to the 5'-end (input using the modified phosphoramidite at the last stage of binding during solid-phase synthesis). Using this method, the active PEG (e.g., PEG, which activate so that he interacted and formed a bond with the amine) are combined with purified oligo what nucleotide and the binding reaction is carried out in solution. In some embodiments, the polymers are branched PEG molecules. In the following embodiments, the polymers are branched PEG with MM 40 KD, see, for example, (1,3-bis(MPEG-[20 CD])-propyl-2-(4'-butamid), depicted in figure 4. In some embodiments, the branched 40 CD-PEG - (1,3-bis(MPEG-[20 CD])propyl-2-(4'-butamid) associated with the 5'-end of the aptamer, as shown in figure 5.

The ability of PEG-conjugates to modify the biodistribution therapeutic agent linked to a number of factors, including the apparent size (for example, measured by hydrodynamic radius) conjugate. It is known that larger conjugates (>10 KD) is more effective in blocking filtering by the kidneys and, consequently, increase the half-life in serum of small macromolecules (e.g., peptides, antisense oligonucleotides). It is shown that the ability of PEG-conjugates block filtering increases with increasing amount of PEG approximately 50 KD (a further increase is minimal curative effect, as determining the half-life becomes mediated by macrophages metabolism, not elimination through the kidneys).

Receiving PEG with high molecular weight (>10 KD) can be difficult, inefficient and costly. As the path of synthesis of macromolecular conjugates of PEG-nucleic acid, the previous work of the conference had been focused on the creation of activated PEG with high molecular weight. One way of creating such molecules is the formation of branched activated PEG, in which two or more PEG linked to the Central core, bearing an activated group. End of such PEG molecules with high molecular weight, i.e. a relatively inactive hydroxyl (-OH) residues, can be activated or converted into the functional residues for binding one or more PEG with other compounds in the active sites of the connection. Branched activated PEG must have more than two ends, and in cases where two or more end activated, such activated PEG molecules with high molecular weight referred to in this description multiactivity PEG. In some cases, not all ends in a branched PEG molecule is activated. When activated any two ends of the branched PEG molecules, such molecules PEG called iactiveaware PEG. In some cases, when activated, only one end of the branched PEG molecule, such molecules PEG called monoethanolamine. As an example of such a method is described activated PEG, obtained by linking two monomethoxy-PEG with lysine core, which is then activated for interaction (Harris et al., Nature, vol. 2: 214-221, 2003).

The present invention relates to another profitable is the way of the synthesis of the macromolecular conjugates of PEG-nucleic acid (preferably aptamers), including multiply pegylated nucleic acid. The present invention also covers associated with PEG multimeric oligonucleotides, for example diarizonae aptamers. The present invention also relates to compositions of high molecular weight, in which a stabilizing residue PEG represents a linker that separates the different parts of the aptamer, for example, PEG kongugiruut in one sequence), so that the linear arrangement of macromolecular composition of the aptamer was, for example, nucleic acid - PEG - nucleic acid - PEG - nucleic acid)nwhere n is greater than or equal to 1.

Macromolecular compositions according to the invention include compositions having a molecular weight of at least 10 KD. Compositions typically have a molecular weight of from 10 to 80 KD. Macromolecular compositions according to the invention have a size of at least 10, 20, 30, 40, 50, 60 or 80 KD.

Stabilizing residue is a molecule or part of a molecule that improves the pharmacokinetic and pharmacodynamic properties of the composition of the aptamer with high molecular weight according to the invention. In some cases, a stabilizing residue is a molecule or part of a molecule that makes two or more aptamers or aptamer domains spatially close or on especial reduced total freedom of rotation of the aptamer composition of high molecular weight according to the invention. Stabilizing residue may be polyalkyleneglycol, such as polyethylene glycol, which may be linear or branched, homopolymers or heteropolymers. Other stabilizing residues include such polymers as peptidoglycan acid (PNA). Oligonucleotides can also be stabilizing residues; such oligonucleotides may contain modified nucleotides and/or modified connection, such as phosphorothioate. Stabilizing residue may be an integral part of the composition), i.e. covalently bind to the aptamer.

Compositions according to the invention include compositions of the aptamer with high molecular weight, in which two (or more) of the residue of the nucleic acid covalently conjugated to at least one remaining polyalkyleneglycol. The remains of polyalkyleneglycol serve as a stabilizing residues. Say that to the composition, in which the remainder of polyalkyleneglycol covalently bonded to each end of the aptamer, so polyalkyleneglycol binds to residues of nucleic acids together in one molecule, polyalkyleneglycol is a linking residue. In such compositions the primary covalent structure of the molecule has a linear arrangement of nucleic acid-PAG-nucleic acid. One example is a composition having the PE the primary structure of nucleic acid-PEG-nucleic acid. Another example is the linear location: nucleic acid - PEG - nucleic acid - PEG - nucleic acid.

To obtain the conjugate nucleic acid - PEG - nucleic acid, nucleic acid source are synthesized so that she was carrying one active area (for example, it is monoactive). In the preferred embodiment, this active site is an amino group introduced at the 5'-end joining of modified phosphoramidite as the last stage solid-phase synthesis of the oligonucleotide. After removal of the protection and purification of the modified oligonucleotide his pererastayut in high concentration in the solution that minimizes the hydrolysis of activated PEG. In a preferred embodiment, the concentration of the oligonucleotide is 1 mm, and the resulting solution contains 200 mm NaHCO3buffer, pH of 8.3. Synthesis of conjugate start slow gradual addition of purified bifunctional PEG. In a preferred embodiment, the PEG-diol activate on both ends (biktimirova) by derivatization with succinimidylester. After interaction conjugate PEG-nucleic acid purified by gel-electrophoresis or liquid chromatography to separate fully, partially or unconjugated species. Multiple connected in chain molecules PAG (EmOC is emer, in the form of random or block copolymers) or smaller chain PAG can be connected to achieve different length (or molecular weight). Between circuits PAG different lengths can be used linkers, non-PAG.

2'-OMe, 2'-fluoro and other modifications of nucleotides stabilize the aptamer against nucleases and increase its half-life in vivo. The cap 3'-3'-dT also increases resistance to nucleases. See, for example, the U.S. patents 5674685, 5668264, 6207816 and 6229002, each of which is incorporated in this description by reference in full.

PAG-derivatization reactive nucleic acid

Conjugates PAG-nucleic acid-PAG with high molecular weight can be obtained by the interaction of monofunctional activated PEG with a nucleic acid that contains more than one reactive site. In one embodiment, the nucleic acid is biactive or iactiveaware and contains two active site: 5'-amino group and the 3'-amino group introduced into the oligonucleotide through the normal synthesis of phosphoramidite, for example: 3'-5'-dipylidiasis, which is shown in Fig.6. In alternative embodiments, the active areas may be entered in the internal position using, for example, 5-position pyrimidine, 8-position purine or 2'-position of ribose as Uch the rates of binding of primary amines. In such embodiments, the nucleic acid can have several activated or active sites, and say that it is repeatedly activated. After synthesis and purification of modified oligonucleotide combined with monoctyogenes PEG under conditions that promote selective interaction with the active sites of the oligonucleotide, while minimizing spontaneous hydrolysis. In a preferred embodiment, monomethoxy-PEG activate succinimidylester and the binding reaction is carried out at a pH of 8.3. To stimulate the synthesis dogsleding PEG provide a stoichiometric excess of PEG compared to the oligonucleotide. After interaction conjugate PEG-nucleic acid purified by gel-electrophoresis or liquid chromatography to separate fully, partially or unconjugated species.

Binding domains can also have one or more associated residues polyalkyleneglycol. Such PAG may have different lengths and can be used in suitable combinations to obtain the desired molecular weight of the composition.

The impact of specific linker may depend on its chemical composition and length. A linker that is too long, too short or becomes unfavorable steric and/or ionic interactions with the target will prep estvovati the formation of a complex between the aptamer and the target. The linker, which is longer than necessary to cover the distance between the nucleic acids, can reduce the stability of the binding by reducing the effective concentration of the ligand. Thus, it is often necessary to optimize the composition and length of the linker, in order to maximize the affinity of the aptamer to the target.

All publications and patent documents cited herein, are included in this description by reference as if specifically stated that each such publication or document included in this description by reference. Assume that the citation of the publications and patent documents is not an admission that any of them is material relating to the prior art, the citation is not an assumption neither on the content, nor for the date. Based on the above, in writing, the characteristics of the invention, the experts in this field will be clear that the invention can be implemented in different ways and that the above description and the following examples are intended to illustrate and not to limit the claims which follows.

EXAMPLE 1

The activity of the anti-C5-aptamer in the classical and alternative ways which complement

Example 1A: Analysis of hemolysis

In CH50 test measures the ability of the complement system in the tested serum sample to lyse 50% of the cells in a standardized suspension of antibody coated sheep erythrocytes. A solution of 0.2% human serum was mixed with antibody coated erythrocytes of sheep (Diamedix EZ set for analysis of complement CH50, Diamedix Corp., Miami, FL) in the presence or absence of various anti-C5 aptamer. Analysis was performed according to the Protocol attached to the kit, in buffered by veronella physiological solution containing calcium, magnesium and 1% gelatin (buffer to complement GVB++), and incubated for 30 minutes at 37°C. After incubation the samples were centrifuged to precipitate intact erythrocytes. Recorded optical density nadeshiko at 412 nm (OD412)in order to quantify the release of soluble hemoglobin, which is proportional to the degree of hemolysis (Green et al., (1995) Chem. Biol. 2: 683-95). To confirm that the aptamers blocked the activation of C5, some nadeshiko after hemolysis were analyzed regarding the presence of C5a and C5b-9 ELISA (ELISA kit C5b-9, Quidel, San Diego, CA; set for C5a ELISA, BD Biosciences, San Diego, CA), following the protocols supplied with the kits ELISA.

Adding naegeliana anti-C5-aptamer (ARC186) (SEQ ID NO: 4) to the reaction mixture inhibited hemolysis may the m dose-dependent manner, as shown in the graph presented on figa, with IC50component of 0.5±0.1 nm (see figv), a value that is consistent with KDdetermined by filtration on nitrocellulose. At very high concentrations of aptamer (>10 nm), the degree of hemolysis is not significantly different from the background (without added serum), indicating that ARC186 (SEQ ID NO: 4) is able to completely block the activity of complement. Conjugation of the aptamer ARC186 (SEQ ID NO: 4) 20 CD (ARC657; SEQ ID NO: 61), 30 KD- (ARC658; SEQ ID NO: 62), branched 40 KD (1,3-bis(MPEG-[20 CD])propyl-2-(4'-butamidom) (ARC187; SEQ ID NO: 5), branched 40 KD (2,3-bis(MPEG-[20 CD])-propyl-1-carbamoyl) (ARC1905; SEQ ID NO: 67), line 40 CD (ARC1537; SEQ ID NO: 65) and linear C CD (ARC 1730; SEQ ID NO: 66) groups PEG had little impact on the inhibitory activity of the aptamer in the analysis of hemolysis CH50 (figa-fig.7D).

In an additional study, the inhibitory activity of pegylated anti-C5-aptamer ARC1905 (branched 40 KD (2,3-bis(MPEG-[20 CD])propyl-1-carbarnoyl); SEQ ID NO: 67) was compared with its non-pegylated predecessor ARC672 (SEQ ID NO: 63), which contains the terminal 5'-amine, in the analysis of hemolysis CH50 described above. A solution of human serum (Innovative Research, Southfield, MI) was mixed with antibody coated erythrocytes of sheep (Diamedix EZ set to complement CH50, Diamedix Corp., Miami, FL) in the presence or absence of various concentrations of ARC1905 and ARC627 accordingly, the AK to the final concentration of serum in each assay was 0.1%, and analysis were performed according to the Protocol recommended by the manufacturer. The reaction mixture for hemolysis were incubated for 1 hour at 37°C with shaking to ensure that the cells remained in suspension. At the end of incubation of intact cells was besieged by centrifugation (2000 rpm, 2 min at room temperature), 200 μl nadeshiko was transferred to a polystyrene plate with flat bottom (VWR, No. in catalogue 62409-003). Recorded optical density nadeshiko at 415 nm (OD415)in order to quantify the release of soluble hemoglobin. The measured inhibition in % at each concentration) was calculated using the equation % inhibition = 100 - 100 × (Asample- Awithout serum)/(Awithout aptamer- Awithout serum), where Asamplemean optical density of the sample at various concentrations of aptamer, Awithout serummean optical density due to the background of hemolysis in the absence of serum (100% inhibition) and Awithout aptamermean optical density due to the primary activity of complement in the absence of aptamer (control 0% inhibition). The values of the IC50was determined on the basis of the schedule of inhibition in % against the [inhibitor], using the equation % inhibition = (% inhibition)maxH [Inga is itor] n/(IC50n+ [inhibitor]n+ background. The values of the IC90and IC99was calculated based on the values of IC50using equation IC90= IC50H [90/(100-90]1/nand IC90= IC50H [99/(100-99]1/n. The values of the IC50for ARC1905 and ARC627 in this parallel study was 0,648±0,0521 and 0,913±0,0679 respectively (see also Fig), which further confirms that tahilramani little effect or no effect on the function of the aptamer.

The ELISA analysis of nadeshiko after hemolysis showed that this functional inhibition correlated with the blockade of C5a release. Thus, the data of hemolysis show that ARC186 (SEQ ID NO: 4) and its pegylated conjugates are potent inhibitors of complement, which function by blocking catalyzed convertase activation of C5.

Analyses of hemolysis using naegeliana material showed that anti-C5 aptamer cross does not interact with C5 few species other than primates, including rat, Guinea pig, dog and pig. However, a significant inhibitory activity was observed when screening serum primates, including serum macaques-Griboedov, rhesus and chimpanzee. The effectiveness of anti-C5-aptamer in vitro additionally investigated in the serum of monkeys-Griboedov using ARC658 (SEQ ID NO: 62), containing 30 CD-P Is G similar ARC186 (SEQ ID NO: 4). In a parallel comparison (n=3) ARC658 inhibited the activity of the human complement with IC500,21±0,0 nm, and the activity of complement macaques-Griboedov with IC50of 1.7±0.4 nm (Fig). Thus ARC658 (SEQ ID NO: 62) 8±3 times weaker effect in the serum of monkeys-Griboedov compared with the serum of a person with this dimension.

In a related study investigated the effect of anti-C5-aptamer, branched pegylated 40 KD (2,3-bis(MPEG-[20 CD])propyl-1-carbamoyl), ARC1905 (SEQ ID NO: 67), the activation of the classical pathway of complement, which were analyzed by hemolysis of sheep erythrocytes in the presence of human serum (Innovative Research, Southfield, MI), macaques of having (Bioreclamation, Hicksville, NY) or rats (Bioreclamation, Hicksville, NY). These analyses were carried out in highly diluted serum, 0.1% in the case of human serum and macaques-having and 0.3% in the case of serum rats under the same conditions as the conditions used to compare the inhibitory effect of ARC1905 in comparison with ARC672 on the hemolysis of sheep erythrocytes, as described above. In a parallel comparison of complete inhibition (90-99%) activity of complement in vitro can be achieved when using ARC1905 in human serum and in serum of monkeys-having, while ARC1905 was weak or does not show specific inhibitory activity in the sample complement rats (Figa). Like ARC658, ARC1905 was is ~10 times weaker activity against complement macaques is having in terms of analysis, as reflected in the values of the IC90and IC99listed on figv.

Analyses of binding to nitrocellulose filters

Individual aptamers were labeled32P at the 5'-end by incubation with γ32P-ATP and polynucleotide (New England Biolabs, Beverly, MA). Radioactively-labeled aptamers were purified from free ATP by gel-filtration followed by polyacrylamide gel electrophoresis. To measure the affinity of anti-C5-aptamer radioactively labeled aptamer (≤10 PM) were incubated with increasing concentrations (0.05 to 100 nm) of purified protein C5 (Quidel, San Diego, CA) in phosphate-buffered saline containing 1 mm MgCl2at room temperature (23°C) and at 37°C for time intervals of 15 min and 4 hours. Binding assays were analyzed by filtration through nitrocellulose, using 96-well manifold vacuum dot blot filter Minifold I (Schleicher and Schuell, Keene, NH). Used a three-layer filter material, consisting (from top to bottom) from Protran nitrocellulose (Schleicher and Schuell), nylon Hybond-P (Amersham Biosciences, Piscataway, NJ) and paper for blotting of GB002 gel (Schleicher and Schuell). Nitrocellulose layer, which selectively binds the protein compared with nucleic acid, preferably held anti-C5 aptamer in complex with the protein-ligand, while not formed a complex anti-C5 aptamer passed through nitrocellulose and what was relial to nylon. Paper for blotting of the gel was used as substrate for other filters. After filtration of the filter layers were separated, dried and subjected to screening for phosphorus (Amersham Biosciences) and quantitatively assessed using the visualization system blots Storm 860 Phosphorimager® (Amersham Biosciences).

As shown in figures 9 and 10, increasing the concentration of C5 increase the share of ARC186 captured on the nitrocellulose. The dependence of the number of associated ARC186 from increasing concentrations of C5 is well described by the model binding in the same area (C5+ARC186 ↔ C5•ARC186; % bound = Cmax/(1+KD/[C5]); Cmaxmean maximum % bound at saturation [C5]; KDmeans the dissociation constant). Curves binding ARC186 at two temperatures or after 15 min, or after 4 hours of incubation are shown in figures 9 and 10 respectively. After 15-minute incubation curves binding ARC186 at 23 and 37°C is not essentially differ, the differences are within the errors, the corresponding values of KD0,5-0,6 nm (Fig.9). Differences between the curves of binding at 23 and 37°C become more apparent by lengthening the incubation time. After 4-hour incubation (figure 10) KDobserved at 23°C, is reduced to 0.08±0.01 nm, whereas KDobserved at 37°C, remains unchanged (0,6±0,1 nm).

To justify the need for long Incubus and at room temperature, the affinity for a given temperature additionally investigated using kinetic methods. The rate of the reverse reaction, describing the dissociation C5•ARC186 equal to vrev= k-1[C5•ARC186], where vrevmean speed (units M·min-1and k-1means the rate constant for the dissociation of the first order (units min-1). Speed direct reaction describing the formation of the complex C5•ARC186 equal to Vfor= k1[C5][ARC186], where Vformean speed (units M·min-1and k1means the rate constant for the Association of the second order (units M·min-1). Data were analyzed using the approximation of pseudobersama order, where the concentration of one reactant (in this case, C5) is supported in large excess compared to the other ([C5]>>[ARC186] and, thus, remains essentially unchanged during the reaction. In these conditions, the direct reaction is described by the rate equation for a first order process, Vfor=k1'[ARC 186], where k1'=k1[C5].

To analyze the dissociation C5-ARC186, radioactively labeled ARC186 (≤10 PM) pre-balanced with 5 nm C5 protein in phosphate-buffered saline containing 1 mm MgCl2at room temperature (23°C). The dissociation reaction was initiated by addition of unlabeled ARC186 (1 μm), which acts as a trap for St. the free C5, and was stopped by filtration through nitrocellulose separating bound and free radioactively labeled ARC186. The time course of dissociation of ARC186 obtained by varying the duration of the period between the initiation of the dissociation reaction and filtration. The time course of dissociation found in the form of lower interest radioactively labeled ARC186 captured on the nitrocellulose filter (equal to the percentage associated with C5), is well described ownexperience decay, where % associated ARC186=(see 11). The value of the rate constant for dissociation, k-1defined this way, is 0,013±0,02 min-1that corresponds to the time of half-life (t1/2=ln2/k-1) 53±8 minutes

To analyze the reaction of the Association, we measured the equilibrium rate constant (keqeducation C5•ARC186 in the presence of different concentrations of protein C5 (1-5 nm). The complex formation was initiated by blending together the protein C5 and radioactively labeled ARC186 in PBS containing 1 mm MgCl2at room temperature (23°C) and were stopped by separation by filtration through nitrocellulose. As described for the reactions of dissociation, the time course of complex formation obtained by varying the duration of the period between the initiation of the reaction and filtered. The time course of equilibrium observed in the form of increasing the percentage of radioactively labeled ARC186, captured on the nitrocellulose filter, is well described ownexperience decay, where % associated ARC186=. The time course of equilibrium for 1, 2 and 4 nm C5 shown in Fig. As expected, the value of keqincreases linearly with increasing [C5] (keg(1 nm)=0,19±0,02 min-1; keq(2 nm)=0,39±0,03 min-1; keq(3 nm)=0,59±0,05 min-1; keq(4 nm)=0,77±0,06 min-1; keq(5 nm)=0,88±0,06 min-1). In the experiment, we have the following relationship between keq, k1and k-1keq=k1[C5]+k-1. Thus, the evaluation of k1get on the basis of the slope of the plot of keq[C5] (see box on Fig), in this case of 0.18±0.01 nm-1·min-1.

These data indicate that in low concentration C5 (e.g., 0.1 nm) required prolonged incubation to reach equilibrium for a mixture of C5 and radioactively labeled ARC186. Under these conditions keg=(0,18±0,01 nm-1·min-1) (0.1 nm)+0,013 min-1=0,03 min-1matching the time half-life of 22 minutes Thus requires about 2 hours incubation at room temperature (~5 times the half-life) for a complete (>95%) equilibrium. At short incubation period (e.g. 15 min) will be a significant underestimation of the actual affinity of the complex is, as shown above in the form of differences of affinely observed for a 15-minute incubation (KD=0.5 nm) compared with the 4-hour incubation (KD=0,08 nm). Alternative estimate of KDat room temperature can be calculated on the basis of kinetic data according to KD=k-1/k1. In this case the calculated KDis of 0.07±0.01 nm, which fully corresponds to KDdefined above thermodynamic methods.

The specificity of ARC186 (SEQ ID NO: 4) for C5 was also evaluated in the analysis filtration through nitrocellulose by comparing with the components of complement, located above and below the C5 in the complement cascade. Purified proteins of man and the protein complexes were purchased from Complement Technologies (Tyler, TX), including: C1q (No. in catalogue A099.18; 2,3 µm), C3 (No. in catalogue A113c.8; 27 μm), C5 (No. in catalogue A120.14; 5.4 μm), C5a des-Arg (No. in catalogue A145.6; 60 μm), sC5b-9 (No. in catalogue A127.6; 1 μm), factor B (No. in catalogue A135.12; 11 μm) and factor H (No. in catalogue A137.13P; 6.8 microns). Binding assays were performed, performing a serial dilution of the protein in PBS plus 1 mm MgCl2, 0.02 mg/ml BSA, and 0.002 mg/ml tRNA, incubare within 1-4 hours at 25°C or 37°C, and then used the device for filtration through nitrocellulose as described above. Dissociation constants KDwas determined on the basis of semi-log graphs based % is wyzwania on the nitrocellulose from [C5] by fitting data to the equation: % binding to the nitrocellulose = amplitude × [C5]/(K D+[C5]).

The results, depicted in Fig show that the aptamer essentially't know C5a (KD>>3 μm), although it exhibits weak affinity to soluble C5b-9 (KD>0.2 μm), probably due to interactions with the component C5b. Other complement components are of moderate to low affinity with respect to the aptamer. Inactivated C3 essentially does not bind to the aptamer; however, the factor H (KD~100 nm) and many times less C1q (KD>0.3 μm) contact. Taken together the data show that ARC186 (SEQ ID NO: 4) bound with high affinity with C5 person, mainly through the recognition domain C5b. Thus, ARC186 and its pegylated derivatives, for example ARC1905, should not interfere with the formation of C3b, which is important for opsonization of bacteria, or the natural regulation of the activation of C regulatory factors.

Conjugation of aptamers with the remnants of PEG with high molecular weight creates the opportunity for steric hindrance, leading to reduced affinity. PEG-modified aptamers are difficult to assess in relation to the direct link in the analysis of filtration through nitrocellulose due to trends such aptamers to adhere to the nitrocellulose even in the absence of the protein target. However, the relative affinity of such aptamers can is about to evaluate their relative ability to compete with radioactively-labeled the non-pegylated aptamer (≤10 PM) for binding to the target, which is measured through an analysis based on filtration through nitrocellulose, known as the analysis of competitive binding conducted at 37°C. as the concentration of cold (i.e. non-radioactively labeled competitor increases, the percentage of radioactively labelled aptamer associated with the protein target is reduced. As shown in Fig, increasing concentrations of cold ARC186 (SEQ ID NO: 4) or pegylated aptamer (ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5)) (0.05 to 1000 nm) can easily compete with radioactively labeled ARC186 (SEQ ID NO: 4) for binding in the presence of 2 nm protein C5. In addition, titration curves for all four aptamers almost overlap, indicating that PEG-conjugation in the case ARC657, ARC658 and ARC187 little effect or no effect on the affinity of the aptamer with respect to C5.

In a similar study tested the effect of PEG-conjugation on the binding of C5 by comparing ARC672 (ARC186 with 5'-terminal amine; SEQ ID NO: 63) ARC1905 (ARC627 conjugated branched PEG-40 KD (2,3-bis(MPEG-[20 CD])-propyl-1-carbamoyl)), using analysis of competitive binding. 10 µm source solutions each aptamer was prepared in PBS plus 1 mm MgCl2, 0.01 mg/ml BSA, 0.002 mg/ml tRNA and serially diluted to obtain a series of 10 specimens covering >100-fold range of concentration of the aptamer. Then an aliquot volume of the IOM 12 ál of each sample were added in 96-well plates to 96 μl of radioactively labelled 32P ARC186 to obtain 1.1 × solution label and cold competitor. Then, 90 μl of label solution/competitor was added to 10 μl of 10× C5 protein to initiate the reaction. The final concentration of radioactively-labeled ARC186 in each reaction was maintained constant. The reaction mixture to bind balanced within 15-30 min at 37°C and then filtered the device with nitrocellulose filters, as described above. For the purposes of data analysis, competitive cold aptamers considered competitive inhibitors of the interaction of ARC186/C5; % inhibition was calculated by normalizing the data against the control reactions in the absence of competitor (control 0% inhibition). The values of the IC50was determined on the basis of semi-log graphs based % inhibition of [ARC672] or [ARC1905] by fitting data to the equation: % inhibition = amplitude × [competitor]n/(IC50n+ [competitor]n).

As shown in Fig, adding a branched 40 KD PEG (2,3-bis(MPEG-[20 CD])propyl-1-carbamoyl) has a weak effect or no effect on the affinity of the aptamer, which was measured in the analysis of competitive binding. Values of KD0,46±0,149 nm and 0.71±0,130 nm was approximatively for ARC672 and ARC1905, respectively, cut, clip on the axis line fit to the data based IC50from SNA Fig. Both values are close to the value of KDdefined for ARC186 at 37°C.

The temperature dependence of the interaction between ARC1905 and C5 also assessed in a competitive analysis. ARC1905 serially diluted, receiving a series of 10 samples, as described above. The reaction mixture to bind balanced within 1-4 hours at 25°C or 37°C and then filtered the device with nitrocellulose filters. The inhibition percentage was calculated by normalizing the data against the control reactions in the absence of competitor (control 0% inhibition) or in the absence of protein C5 (100% inhibition). The values of the IC50was determined on the basis of semi-log graphs based % inhibition of [ARC672] or [ARC1905] by fitting data to the equation: % inhibition = amplitude x [competitor]n/(IC50n+ [competitor]n). As shown in Fig, ARC1905 binds to C5 with high affinity as at 25°C and at 37°C. values of KD0,15±0,048 nm, and 0.69±0,148 nm was obtained at 25°C and 37°C respectively at the intersection with the axis of the graph data based IC50from C5. Both values correspond to the values of KDdefined for interaction ARC186/C5, as described above.

Example 1B: Analysis of whole blood.

The effect of anti-C5-aptamer on the alternative complement system was analyzed with the use of what Finance following the analysis of whole blood. Blood was taken from healthy human volunteers without anticoagulant. Aliquots of blood (containing no anticoagulant) were incubated with increasing concentrations of ARC186 (SEQ ID NO: 4) for 5 hours at room temperature or at 37°C. Samples were centrifuged to separate serum, and recorded the presence of C5b in serum by ELISA sC5b-9 (set for ELISA C5b-9, Quidel, San Diego, CA). As shown in Fig directed against complement activity, which is reflected in the production of C5b-9, dispersed in the samples incubated at different temperatures, at 3 μm. Data obtained at room temperature, showed that the concentration of aptamer needed for the quantitative inhibition, is in the range of 3-6 μm, whereas the reported concentration of C5 is approximately 400 nm. The obtained results show that more than 10-fold molar excess of anti-C5-aptamer (ARC186; SEQ ID NO: 4) may be required for complete inhibition of the activity of C5.

Example 1C: Activation of complement simhasanam.

Zymosan is a polysaccharide component of the cell wall of yeast and a strong activator of the alternative complement cascade. Add zymosan to samples of blood, plasma or serum ex vivo leads to the accumulation of products of activation of complement, including C5a and a soluble variant of C5b-9 (sC5b-9). The undiluted samples the first human serum (Center for Blood Research, Boston, MA), citrate whole blood of man (Center for Blood Research, Boston, MA) or serum macaques-Griboedov (Charles River Labs, Wilmington, MA) pulse was treated with increasing concentrations ARC658 (SEQ ID NO: 62), containing 30 CD-PEG analogue ARC186 (SEQ ID NO: 4). To activate the complement, the samples were added zymosan (Sigma, St. Louis, MO) in 10×-suspension to a final concentration of 5 mg/ml After 15-minute incubation at 37°C the particle zymosan was removed by centrifugation and determined the extent of activation of complement through the analysis of C5a ELISA and/or sC5b-9 (set for ELISA C5b-9, Quidel, San Diego, CA; set for C5a ELISA, BD Biosciences, San Diego, CA).

In the absence of aptamer processing simhasanam activates ~50% C5 serum or whole blood compared to ~1% activation in untreated sample. Adding anti-C5-aptamer to 50 nm (~10% of the concentration of C5 in the blood) had little effect on the formation of sC5b-9. However, further titration C5 increasing concentrations ARC658 (SEQ ID NO: 62) inhibited the activation of C5 dependent on the dose of the image, visible on Fig. Serum or whole blood quantitative inhibition (~99%) was observed at a concentration of 0.8 to 1 μm ARC658 (SEQ ID NO: 62), corresponding to ~2 molar equivalents) compared to C5. Higher concentrations of aptamer was required to achieve comparable inhibition in serum macaques-Griboedov. In this case, 99% inhibition on Stivali only in the presence of 10 μm) or ~20 molar equivalents) compared to C5.

In a similar study tested the inhibitory effect of ARC1905 (branched pegylated 40 KD (2,3-bis(MPEG-[20 CD])propyl-1-carbamoyl) option ARC186) in samples of human and macaque-Griboedov using zymosan for activation of complement via the alternative path in the following way. Zymosan A from Saccharomyces cerevisiae were obtained from Sigma-Aldrich, Inc. (No. in catalogue Z4250-1G, St. Louis, MO). Zymosan comes in A powder form, and it resuspendable in Dulbecco PBS (Gibco, Carlsbad, CA, No. in catalogue 14190-144), receiving the suspension 50 mg/ml Frozen pooled serum of healthy people (no directory IPLA-SER) was purchased from Innovative Research (Southfield, MI). Frozen pooled serum macaques-Griboedov (No. in catalogue CYNSRM) was purchased from Bioreclamation (Hicksville, NY). The vials containing 5-10 ml of serum from a vendor frozen, was thawed at 37°C, divided into aliquots (~1 ml) and kept at -20°C. Aliquots were thawed if necessary, immediately prior to use by incubation at 37°C and kept on ice during the experiments. The final concentration of serum in each assay was ~100%. The original 20 μm solution of ARC1905 was prepared in 0.9% salt solution and serially diluted, receiving a series of 10 samples, covering ~90-fold range of concentrations of aptamer. The sample without aptamer (salt solution) is also included in kacestvennogo control (0% inhibition).

90 μl of serum pipette carried in the wells of 96-hole tablet for PCR (VWR, No. in catalogue 1442-9596). 10 μl of the sample) was diluted directly in serum at room temperature and mixed. 8 ál of 50 mg/ml solution zymosan pipette carried in individual wells of 96-hole tablet for PCR. Both the tablet at the same time pre-incubated at 37°C for 15 minutes. Immediately after pre-incubation, 80 μl of a mixture of serum/aptamer was added directly to 8 μl of zymosan and mixed, obtaining a final concentration zymosan 5 mg/ml Tablet with the reaction mixture tightly closed and incubated for 15 minutes at 37°C. At the end of the incubation the reaction was suppressed by adding to the wells with the pipette 8 ál of 0.5m EDTA and mixing. Zymosan besieged by centrifugation (3700 rpm, 5 min at room temperature) and ~80 ál suppressed nadeshiko was transferred into a new 96-well plate for PCR and hermetically closed. Nadeshiko immediately frozen in liquid nitrogen and kept at -20°C. For control independent from zymosan background activation serum samples were prepared and treated exactly as described above except that instead of zymosan was added 8 μl of saline.

The degree of activation of C5 was determined on the basis of the relative levels of C5a formed in each activated C is mosana sample, measured in the analysis of C5a ELISA (ALPCO Diagnostics, Windham, NH, n in the directory EIA-3327), following the Protocol supplied with the kit C5a ELISA. Set for C5a ELISA contains specific for human reagents and comes in the form of analysis of human C5a (hC5a) in samples of serum or plasma. It is therefore necessary to characterize the ELISA response to C5a macaques-Griboedov, using standards of concentration for macaques-Griboedov. To prepare a set of special standards, aliquots of 0.5 ml of human serum or macaques-Griboedov incubated with 5 mg/ml zymosan for 15 min at 37°C, reduce to 12.5 μl of 0.5m EDTA and centrifuged to remove zymosan. Determined the concentration of C5a in the sample activated simhasanam human serum of approximately 2 µg/ml hC5a, when compared with the standards hC5a plasma, supplied in the kit. Determined that the concentration of C5a in the sample macaques-having, expressed in equivalents of human C5a (EQ. hC5a)was approximately 0.6 mg/ml EQ. hC5a. Prepared a series of standards covering the range from 0.4 to 400 ng/ml hC5a or 0.12-120 ng/ml EQ. hC5a, breeding in the serum of rats (which does not interfere with ELISA). Standards pre-processed protein precipitating reagent as specified in the Protocol to set for ELISA, and were made without additional dilution across the plate for ELISA. Registration of optical density in the tablet to ELISA maximum 450 nm (A 450using the device for reading optical density in tablets in the UV/visible region VersaMax (Molecular Dynamics, Sunnyvale, CA). A450changed with changes in the concentration of C5a from a low of 0.1-0.2 at low concentrations of C5a with a plateau approximately 3.5 at high concentrations of C5a. For a quantitative assessment of C5a in the analyzed samples of the upper and lower limits of quantitation were respectively 25 and 0.78 ng/ml hC5a for humans and 15 and 0.94 ng/ml EQ. hC5a for macaques-Griboedov. The dependence of the A450concentration hC5a in ng/ml or EQ. hC5a depicted graphically, as shown in Fig, and a standard curve was obtained on the basis of fit by 4 parameters to the data using the equation y = ((A - D)/(1 + (x/C)B)) + D.

Immediately prior to analysis, C5a analyzed samples (including control containing only saline solution, and a control not containing zymosan) pre-processed protein precipitating reagent, as described in the Protocol supplied with the ELISA kit, then serially diluted in 0.9% salt solution. The C5a levels in undiluted analyzed samples (including some controls without zymosan) usually exceeded the upper limit of quantification (ULOQ). Therefore, the tested dilution of 1/5, 1/50 and 1/250 to provide a full range of C5a concentrations in the analyzed samples. The levels of C5a Kolichestvennaya by comparison with an appropriate standard curve (for humans or macaques-Griboedov) and corrected in relation to breeding. % inhibition for each concentration) was calculated using the equation % inhibition = 100 - 100 × (C5asample- C5awithout Sumosan)/(C5aonly saline- C5awithout zymosan). The values of the IC50was determined on the basis of the plot of % inhibition of [ARC1905], using the equation % inhibition = (% inhibition)max× [ARC1905]n/(IC50n+ [ARC1905]n+ background. The values of the IC90and IC99was calculated based on the values IC50using equation IC90= IC50× [90/(100-90]1/nand IC99= IC50× [99/(100-99]1/n.

The degree of activation of C3 (stage in the common pathway of complement just before C5) was determined based on the relative levels of C3a formed in each activated simhasanam sample, which was measured in ELISA C3a (set for C3a ELISA Becton-Dickinson OptiEIA, No. in catalogue 550499, Franklin Lakes, NJ), following the Protocol supplied with the kit C3a ELISA.

Immediately prior to analysis, C3a samples (including control containing only saline solution, and a control not containing zymosan) were serially diluted in 0.9% salt solution. C3a ELISA is more sensitive than ELISA in the case of C5a; therefore been necessary dilution 1/500, 1/5000 and 1/25000 to provide the full range of concentrations of C3a in the samples. The standards set obtained from savor the TCI person, used instead of special standards, obtained for the analysis of C5a. As the levels of C3a not very varied, specific to human standards provides sufficient indication of the relative levels of C3a.

Data obtained from both analyses C5a ELISA and C3, were analyzed using Microsoft Excel, and the mean values of inhibition in % depicted graphically using Kaleidagraph (v. 3.51, the computer program Synergy). The values of the IC50IC90and IC99was determined using XLfit 4.1, built-in in Excel. Comparative influence of ARC1905 in activation of the complement of human and macaque-Griboedov, which was measured by the above method, are summarized in Fig and Fig. As can be seen in these figures, a complete inhibition of C5 activation through the alternative path is achieved in vitro using ARC1905 in human serum and in serum of monkeys-Griboedov. In human serum the concentration of ARC1905 required for 90% inhibition of C5 activation in the undiluted sample was 442±23 nm, which is roughly equivalent to the average molar concentration of C5. However, ARC1905 acted in 4-6-fold weaker activity against complement macaques-Griboedov in terms of analysis, which is reflected in the values of the IC90and IC99.

The influence of ARC1905 in the activation of C3, which is measured by the level of C3a, summarized on Fig. The rationale for the specific a whole is targeted impact on the tail end of the path of complement is blocking proinflammatory functions of C5a and formation of the membrane attack complex (MAC) without creating obstacles for functions against pathogens located above factors, culminating in the formation of C3a and C3b. Data on Fig show that ARC1905 up to 2 μm did not inhibit the formation of C3a, and show that ARC1905 not have a negative impact on the activation of the complement cascade above. Essentially complete blockade of C5 activation in the alternative path is achieved in the serum samples of humans and macaques-Griboedov using ARC1905. ARC1905 operates roughly an order of magnitude weaker in the inhibition of C5 activation macaques-Griboedov than the activation of C5 person in terms of this analysis. Without intending to be bound by any theory, suggest that the inhibitory effect of ARC1905 in activation of the complement is specific to C5, since the activation of C3 was not ingibirovany.

Example 1D: Model activation of complement, based on the use of loops of tubing

To test the ability of anti-C5-aptamer to block the activation of complement induced by impact of foreign materials, which occurs in the case of artificial blood, the authors used a model based on the loop of the tube described Nilsson and co-authors (Gong et al., (1996) Journal of Clinical Immunology 16, 222-9; Nilsson et al., (1998) Blood 92, 1661-7). Medical/surgical tubing Tygon S-50-HL (with an inner diameter of 1/4 inch (United States Plastic Corp. ((Lima, OH), No. in catalogue 00542) cut into pieces primerno mm (volume of about 9 ml) and was filled with 5 ml of donor blood of man, containing 0.4 units/ml of heparin (Celsus) and various concentrations ARC658 (SEQ ID NO: 62) (0 - 5 μm). Each piece of Tygon tube was closed in a loop with the help of short pieces (~50 mm) connecting tube of non-surgical silicone (with an inner diameter of 3/8 inches) (United States Plastic Corp. (R-3603, No. in catalogue 00271), as described in Gong et al. The loops of the tubes were rotated for 1 hour at about 30 rpm in a water bath at 37°C. Then the contents of the loops was poured into polypropylene conical tubes containing EDTA (final concentration 10 mm)to suppress the activation of complement. Plasma low-platelets were isolated by centrifugation and analyzed in relation to C5a and C3a, using ELISA (ELISA kit C3a, Quidel, San Diego, CA; set for C5a ELISA, BD Biosciences, San Diego, CA).

General activation of complement in the absence of aptamer was small compared with the analysis using zymosan. Usually the C5a levels were increased by approximately 6 ng/ml after 1 hour of incubation, which corresponded to activation <1% of the available C5. However, this increase was produced and is inhibited by titration ARC658 (SEQ ID NO: 62). As shown in Fig, 300-400 nm ARC658 (SEQ ID NO: 62) was sufficient to achieve a 99% inhibition of C5 activation level, which is approximately equivalent to or slightly lower than the molar concentration of C5 in the blood. Without intending to be bound by any theory, predpolagajut, although fewer aptamer to obtain a 99% inhibition of C5 activation in this model than in the model with simhasanam, the findings may reflect significant differences activating the complement of the stimuli used in the two analyses. Also oversaw the formation of C3a as a control to confirm that ARC658 (SEQ ID NO: 62) is not blocked at an earlier stage activation than C5, complement cascade. The C3a levels were increased by about 4000 ng/ml after 1 hour of incubation, which corresponds activate approximately 10% of the available C3. Unlike education C5a observed a small dose-dependent inhibition of the formation of C3a during the titration ARC658 (SEQ ID NO: 62), which suggests that ARC658 (SEQ ID NO: 62) specific blocks the cleavage of C5.

Research in model-based loops of the tubes was repeated using anti-C5-aptamer ARC1905 (SEQ ID NO: 67). ARC1905 serially diluted in 0.9% salt solution, receiving a series of 20 specimens covering a 100-fold range of concentrations of aptamer (final concentration in the analysis of 10-1000 nm). Samples containing irrelevant aptamer (ARC127), included to control nonspecific actions of oligonucleotides. The sample without aptamer (only saline) was also included as a negative control. Blood samples from individual donors were selected standard ways of phlebotomy the good is Olav. Whole blood was taken from 5 different donors directly into the syringe a volume of 60 ml (Becton-Dickinson, (Franklin Lakes, NJ), No. in catalogue 309653) and immediately divided into aliquots in bivalirudin (final concentration 20 μm) (Prospec-Tany Technogene Ltd., (Israel), batch No. 105BIV01) +/-aptamers. The anticoagulant bivalirudin, a direct thrombin inhibitor, was used instead of heparin, which prevents activation of complement.

The model loops of the tubes was carried out essentially as described above. ~300 mm pieces of tubing (1/4 " diameter, volume ~9 ml) was filled with 5 ml samples of blood/aptamer/bivalirudin immediately after taking blood from a donor. Then the tube is securely fixed in the form of loops short pieces (~50 mm) silicone tubing, getting gas volume ~4 ml Loop of the tubes were rotated vertically at 32 rpm during incubation in a water bath at 37°C for 1 hour. After incubation, 5 ml of sample was transferred into a conical tube with a volume of 15 ml (Corning (Corning, NY), No. in catalogue 430766)containing 100 μl of 0.5m EDTA, receiving a final concentration of 10 mm EDTA. 1 ml nadeshiko plasma was collected from each quenched sample after centrifugation (Eppendorf Centrifuge 5804) at 4°C (3300 rpm, 20 minutes). Nadeshiko immediately frozen in liquid nitrogen and kept at -20°C. For the control of background activation of the prepared sample to CPB by adding 5 ml of fresh blood directly into the conical tube with a volume of 15 ml n the ice, containing 100 μl of 0.5m EDTA. The specified sample was processed to obtain plasma and stored as described above.

The degree of activation of C5 was determined on the basis of the relative levels of C5a formed in each activated sample, which was measured in C5a ELISA as described above. C5a ELISA was performed on undiluted plasma samples according to the Protocol attached to the kit ELISA, and C5a levels in the samples was quantitatively determined by comparison with standards C5a supplied by the manufacturer. % inhibition of the formation of C5a at each concentration) was calculated using the equation % inhibition = 100 - 100 × (C5asample- C5apre-CPB)/(C5aonly saline- C5apre-CPB). The values of the IC50was determined on the basis of the plot of % inhibition of [ARC1905], using the equation % inhibition = (% inhibition)maxx [ARC1905]n/(IC50n+ [ARC1905]n+ background. The values of the IC90and IC99was calculated based on the values IC50using equation IC90= IC50× [90/(100-90]1/nand IC99= IC50× [99/(100-99]1/n.

The degree of activation of C3 was determined based on the relative levels of C3a formed in each activated sample, which was measured in C3a ELISA as described above. Immediately prior to analysis, C3a samples (VK is UCA control, containing only saline, and control obtained before CPB) were serially diluted in 0.9% salt solution. C3a ELISA is more sensitive than ELISA in the case of C5a; therefore been necessary dilution 1/5000 to provide the full range of concentrations of C3a in the samples. Levels of C3a in the samples was quantitatively evaluated by comparing with the standards set and % inhibition was calculated as described for C5a. Data were analyzed using Microsoft Excel, and average values of % inhibition depicted graphically using Kaleidagraph (v3.5, the computer program Synergy). The values of the IC50IC90and IC99was determined using XLfit 4.1, built-in in Excel.

The average impact of ARC1905 and irrelevant aptamer ARC127 on activation of the complement of five donors are summarized in Fig. As shown in Fig, full blockade of C5 activation, which is reflected in the formation of C5a, was achieved with the use of <500 nm ARC1905, whereas irrelevant aptamer had no inhibition effect up to 1 μm. Average values IC50IC90and IC99whole blood was 119±28,6 nm, 268±39,2 nm and 694±241 nm, respectively (Fig). Without intending to be bound by any theory, consider it fair to assume that ARC1905 is not contained in the volume occupied by blood cells, which is approximately 45% of the total. Therefore, the value is of the IC 50IC90and IC99adjusted so that they reflect the inhibition of C5 in plasma was 216±52,0 nm, 487±71 nm and 1261±438 nm. These values are consistent with the parameters calculated for the inhibition of ARC1905 induced simhasanam activation of complement in the serum, suggesting that the cellular components of blood does not substantially interfere with the anti-C5-activity ARC1905. The formation of C3a was not ingibirovalo no ARC1905 or irrelevant aptamer up to 1 μm. Without intending to be bound by any theory, I believe that this suggests that ARC1905 not inhibited ConvertTo reaction C3 and does not block other stages that contribute to the alternative cascade activation, such as the deposition of C3 and Assembly convertase.

EXAMPLE 2

Selection of de novo and sequence

Selection of C5 using pool dRmY

Spent two breeding to identify aptamers dRmY to the full-size protein C5 person. Protein C5 (Quidel Corporation, San Diego, CA or Advanced Research Technologies, San Diego, CA) was used in full-size form ("FL") and partially treated trypsin form ("TP"), and both the selection was a direct selection against protein targets that have been immobilized on hydrophobic tablet. Both breeding gave pools, largely enriched in relation to linking with Polner smirnym C5 compared with native, not subjected to the breeding pool. All sequences listed in the example shown in the direction 5'-3'.

Getting pool: DNA template with the sequence TAATACGACTCACTATAGGGAGAGGAGAGAACGTTCTACN(30)GGTCGATCGATCGATCATCGATG (ARC520; SEQ ID NO: 70), was synthesized using a DNA synthesizer ABI EXPEDITETMand removed protection standard ways. Matrix amplified using 5'-primer TAATACGACTCACTATAGGGAGAGGAGAGAACGTTCTAC (SEQ ID NO: 71) and 3'-primer CATCGATGATCGATCGATCGACC (SEQ ID NO: 72), and then used as template for in vitro transcription RNA polymerase, T7, having a single mutation Y639F. Transcription was carried out using 200 mm HEPES, 40 mm DTT, 2 mm spermidine, 0.01% of Triton X-100, 10% PEG-8000, 9.5 mm MgCl2, 2.9 mm MnCl2, 2 mm NTP, 2 mm GMP, 2 mm spermine, 0.01 units/ml inorganic pyrophosphatase and single mutant Y639F T7 polymerase.

SelectionIn round 1 the stage of positive selection was performed on columns to link containing nitrocellulose filters. Briefly, 1×1015molecules (0.5 nmol) from a pool of RNA were incubated in 100 μl of buffer for binding (1×DPBS) with 3 μm full-C5 or 2.6 μm partially trypsinization C5 for 1 hour at room temperature. Complexes of RNA:protein and free RNA molecules were separated using centrifuge column with 0.45 µm nitrocellulose from Schleicher and Schuell (Keene, NH). The column was pre-washed in 1 ml of 1× DPBS click the in column added solutions containing RNA:protein and spun in a centrifuge at 1500 g for 2 minutes was Carried out by three washing buffer 1 ml, to remove non-specific binding substances with filters, then the complexes of RNA:protein associated with the filters was twice suirable, 200 ál washing eluting buffer (7 M urea, 100 mm sodium acetate, 3 mm EDTA, preheated to 95°C). Elyuirovaniya RNA precipitiously (2 μl of glycogen, 1 volume isopropanol, 1/2 volume of ethanol). RNA was back transcribable using the system for RT-PCR ThermoScript (Invitrogen, Carlsbad, CA)according to the manufacturer's instructions, using the 3'primer described in SEQ ID NO: 72, with subsequent PCR amplification (20 mm Tris pH of 8.4, 50 mm KCl, 2 mm MgCl2, 0.5 µm of primers SEQ ID NO: 71 and SEQ ID NO: 72, 0.5 mm of each dNTP, of 0.05 units/μl Taq polymerase (New England Biolabs, Beverly, MA). PCR-matrix was purified using column Centricep (Princeton Separations, Princeton, NJ)and used for transcription of the pool for the next round.

In subsequent rounds of selection the separation of bound and free RNA was performed on hydrophobic tablets Nunc Maxisorp (Nunc, Rochester, NY). The round started immobilization 20 pmol full-C5 and partially trypsinization C5 on the tablet surface for 1 hour at room temperature in 100 μl of 1×DPBS. Then adosados was removed and the wells were washed 4 times with 120 μl of buffer for washing (1X DPBS). Then the wells with protein b which was Acireale buffer 1×DPBS, containing 0.1 mg/ml yeast tRNA and 0.1 mg/ml DNA salmon sperm competitors. The concentration used pool was always at least five-fold excess compared to the concentration of protein. The RNA pool was incubated for 1 hour at room temperature in the empty hole, to remove any bind with plastic sequence, and then incubated in a blocked hole without protein, to remove any competitive binding sequence from the pool at the stage of positive selection. Then RNA pool was incubated for 1 hour at room temperature and RNA associated with immobilized C5, back transcribable directly in the tablet for breeding, adding the mixture FROM (3'primer, SEQ ID NO: 72 and Thermoscript RT, Invitrogen), followed by incubation at 65°C for 1 hour. The resulting cDNA was used as template for PCR (Taq polymerase, New England Biolabs). Amplificatoare DNA template pool was absoluely using Centrisep column (Princeton Separations), in accordance with the manufacturer's recommended conditions and used for programming the transcription of the RNA pool for the next round of selection. Transcribed pool was cleaned in 10% polyacrylamide gel in each round.

The course selection was controlled using analysis of binding filter "sandwich is (dot-blot). 5'-32P-labeled RNA pool (trace concentration) were incubated with C5, 1× DPBS plus 0.1 mg/ml tRNA and 0.1 mg/ml DNA salmon sperm for 30 minutes at room temperature and then put on consisting of nitrocellulose and nylon filter sandwich in a device for dot-blotting (Schleicher and Schuell). Expected percentage of RNA pool associated with nitrocellulose and monitored approximately every 3 rounds, conducting screening at one point (+/-300 nm C5). Dimension Kdthe pool was obtained using the titration of protein and device for dot-blotting as described above.

The results of the selection: In two sections received enrichment after 10 rounds compared with native pool. Cm. Fig. In round 10 Kdpool was approximately 115 nm for selection on the full-size protein and 150 nm for breeding trypsinization protein, but the degree of binding was only about 10% at the plateau in two sections. R10-pools were cloned using the set for cloning TOPO TA (Invitrogen) and sequenced.

Sequence information: 45 clones from each pool sequenced. In R10-pool for full-length protein was dominated by a single clone ARC913 (SEQ ID NO: 75), which was 24% of the pool, 2 sets of duplicated and single sequences accounted for the remainder. R10-pool for trypsinization protein contains 8 copies of one and the e sequence ARC913 (SEQ ID NO: 75), but the pool was dominated by another sequence (AMX221.A7; 46%). Clone ARC913 (SEQ ID NO: 75) had Kdabout 140 nm and the degree of binding was close to 20%. Cm. Fig.

A separate sequence, are shown in table 5, shown in 5'-3'-direction and corresponds ribonucleotidic sequence of the aptamer, which was selected in the proposed conditions dRmY SELEXTM. In the variants according to the invention, obtained as a result of this selection (and reflected in the list of sequences), purines (A and G) are deoxynucleotide and pyrimidines (U and C) are 2'-OMe-nucleotides. The sequence indicated in table 5, can contain or not contain kupirovaniya (for example, the 3'inverted dT). Unique sequence below) begins with a 23 nucleotide immediately after a fixed sequence GGGAGAGGAGAGAACGUUCUAC (SEQ ID NO: 73) and continues until the meeting with the 3'fixed sequence of nucleic acid GGUCGAUCGAUCGAUCAUCGAUG (SEQ ID NO: 74).

Table 5

The nucleotide sequence of C5-dRmY-aptamer

Analysis of hemolysis: Effects ARC913 (SEQ ID NO: 75) on the classical path of the complement system were analyzed using analysis of hemolysis, described earlier, compared with ARC186 (SEQ ID NO: 4) (anti-C5 aptamer, positive control) and not subjected to selection dRmY-pool(negative control). In the analysis of inhibition of hemolysis solution of 0.2% of whole human serum was mixed with antibody coated with sheep erythrocytes (test for analysis of complement Diamedix EZ CH50, Diamedix Corporation, Miami, FL) in the presence of titrated ARC913 (SEQ ID NO: 75). The analysis was carried out in buffered by veronella physiological solution containing calcium, magnesium and 1% gelatin (buffer to complement GVB++), and incubated for 1 hour at 25°C. After incubation the samples were centrifuged. Recorded optical density nadeshiko at 415 nm (OD415). The inhibition activity of hemolysis expressed as % activity of hemolysis compared with the control. Cm. Fig. Calculated IC50the aptamer of approximately 30 nm.

EXAMPLE 3

Composition and optimization sequences

Example 3A: Minimizing ARC913:

Six designs based on ARC913 (SEQ ID NO: 75), transcriptional, was gel purified and tested on dot-blots against binding to C5. ARC954 was similar to the original clone with Kd130 nm and the degree of binding 20%, while ARC874 (SEQ ID NO: 76) was the only other clone, which was associated with C5 with Kd1 micron.

Individual sequences listed in table 6 are listed in 5'-3'direction, and they are derived from aptamers that were selected in the proposed conditions SELEX dRmY. In the variants according to the invention, obtained in the result of the this selection (and reflected in the list of sequences), purines (A and G) are deoxynucleotide and pyrimidines (U and C) are 2'-OMe-nucleotides. Each of the sequences listed in table 6, may contain or may not contain kupirovaniya (for example, the 3'inverted dT).

Table 6

The nucleotide sequence is minimized clones ARC913

Example 3B: Optimization ARC913: re-breeding with the introduced impurities

To optimize the clone ARC913 (SEQ ID NO: 75) in relation to the affinity of binding of C5 and identify key elements of the binding, they were re-selection with the introduced impurities. Re-selection with the introduced impurities were used for studying the requirements for the sequence in the active clone or minimera. Selection was performed using a synthetic degenerate pool, which was constructed on the basis of one sequence. The level of degeneracy typically varies from 70% to 85% nucleotide of the wild type. In General, see neutral mutations, but in some cases changes in sequence can lead to an improvement in the affinity. Information on the combined sequence can then be used to identify the minimal binding motif, and it can help in the optimization.

Getting pool: Posledovatel the ness matrix taatacgactcactataGGGAGAGGAGAGAACgttctacn (30)GTTACGACTAGCATCGATG (SEQ ID NO: 82) based on ARC913 (SEQ ID NO: 75) and synthesized so that each residue of the random region was doped at the level of 15%, i.e. in each random ("N") position, there is a 85% probability that the remainder is a nucleotide found in the sequence of the wild type CTTGGTTTGGCACAGGCATACATACGCAGGGGTCGATCG (SEQ ID NO: 83), and a 15% probability that it will be one of the other three nucleotides.

Matrix and a pool of RNA for re-selection with the introduced impurities was prepared essentially as described above. Matrix amplified using primers taatacgactcactataGGGAGAGGAGAGAACgttctac (SEQ ID NO: 84) and CATCGATGCTAGTCGTAAC (SEQ ID NO: 85). Spent two selection using full-C5, with one selection was performed using a higher concentration of salt at the stage of washing. Followed the Protocol selection, which is described above, with two exceptions: 1) round 1 was performed on hydrophobic tablets (as well as all subsequent rounds), using only the stage of positive selection; and 2) not used competitor during breeding. The concentration of C5 and the concentration of the pool RNA was kept constant at 200 nm and 1 μm, respectively.

Data re-selection with the introduced impurities

Under normal breeding and selection in conditions of high salt concentration was obtained enrichment after 5 rounds of the battle is to the native pool. Kdpool in round 5 was approximately 165 nm for breeding at high salt concentration and 175 nm for breeding with a normal concentration of salt. The degree of binding was approximately 20% at the plateau in both cases. R4-the pools were cloned using the set for cloning TOPO TA (Invitrogen, Carlsbad, CA), and 48 clones from each pool sequenced. 12 clones from each pool were transcribable and analyzed in the dot-blot analysis at a single point at 500 nm C5. Dissociation constants (Kdagain measured using the dot-blot analysis, as described earlier. Kdwas evaluated for 11 of the best clones identified by screening at one point, fitting data to the equation: fraction bound RNA=amplitude*Kd/(Kd+[C5]). These clones had the best three values of Kd: SEQ ID NO: 91 (73 nm), SEQ ID NO: 96 (84 nm) and SEQ ID NO: 95 (92 nm). The sequence of these 11 clones are shown below in table 7.

Sequences listed in table 7 are listed in 5'-3'-direction and represent the nucleotide sequences of aptamers that were selected in the proposed conditions dRmY-SELEX. In the variants according to the invention obtained in this selection (and reflected in the list of sequences), the corresponding sequences contain combinations of residues dRmY, which are indicated in the text where the purines (A and G) are deoxynucleotide, the pyrimidines (U and C) are 2'-OMe-nucleotides. Each of the sequences listed in table 7, may contain or may not contain kierowanie (for example, the 3'inverted dT). The unique sequence of each below) begin with the nucleotide 23 immediately after the 5'fixed sequence GGGAGAGGAGAGAACGUUCUAC (SEQ ID NO: 86) and continue up to the meeting with the 3'fixed sequence of nucleic acid GUUACGACUAGCAUCGAUG (SEQ ID NO: 87).

Table 7

The nucleotide sequences of the clones obtained by repeating the selection with the introduced impurities

Example 3C: Modification of ARC186 branched PEG with a molecular mass of 40 KD

Oligonucleotide

UmGfCmG-3T-3' (ARC672, SEQ ID NO: 63) was synthesized in the Expedite DNA synthesizer (ABI, Foster City, CA) according to the methods recommended by the manufacturer using standard commercially available 2'-OMe-RNA and 2'-F-RNA and TBDMS-protected RNA phosphoramidites (Glen Research, Sterling, VA) and containing inverted deoxythymidine substrate CPG. Terminal amine function was associated with 5'-amino-modifier, 6-(triptorelin)hexyl-(2-cyanoethyl)-(N,N-aminobutiramida)phosphoramidite, C6-TFA (Glen Research, Sterling, VA). After deciphering the oligonucleotides were purified by ion-exchange chromatography on resin Super Q 5PW (30) (Tosoh Biosciences) and precipitable ethanol.

Modi is economony Amin aptamers after synthesis conjugatively with different residues of PEG. The aptamer was dissolved in a solution of water/DMSO (1:1) to a concentration of from 1.5 to 3 mm. Was added sodium carbonate buffer, pH 8.5, to a final concentration of 100 mm and the oligonucleotide was subjected to interaction during the night with a 1.7 molar excess of the desired PEG-reagent (for example, ARC1905 - 40 KD Sunbright GL2-400NP para-nitrophenylarsonic [NOF Corp, Japan], or ARC187 - 40 KD, MPEG2-NHS-ester [Nektar, Huntsville AL]), dissolved in an equal volume of acetonitrile. The resulting products were purified by ion-exchange chromatography on resin Super Q 5PW (30) (Tosoh Biosciences) and absoluely using reversed-phase chromatography is carried out on the resin Amberchrom CG300-S (Rohm and Haas), and liofilizirovanny. The structure of ARC187 (SEQ ID NO:5) shown in Fig, and the structure of ARC1905 (SEQ ID NO:67) is shown in Fig.

EXAMPLE 4

The model of isolated perfusing heart

Example 4A: Proof of principle using ARC186

The average concentration of the component of complement C5 in human plasma is approximately 500 nm. When exposed to the isolated hearts of mice, perfezione buffer Krebs-Henseleit, 6% human plasma, activates the complement cascade of the person, leading to the cleavage of C5 to C5a and C5b. Component C5b then forms a complex with components of the complement C6, C7, C8 and C9, also known as "membranaceous complex (MAC or C5b-9), which damages the blood from the UDA hearts and cardiomyocytes, thus leading to myocardial dysfunction (increased end-diastolic pressure, arrhythmias and asystole (Evans et. al., Molecular Immunology, 32, 1183-1195 (1995)). Earlier this model was tested monoclonal and single-chain antibodies that block the cleavage of C5 person (pexelizumab or single-chain scFv-option pexelizumab) and showed that they inhibit damage to and dysfunction of the myocardium (Evans et al., 1995).

This model was also used to establish that the blocking C5 aptamer ARC186 (SEQ ID NO: 4) like pexelizumab inhibited C5 mediated human damage by complement isolated perfuziruemah hearts of mice. Mice C57B1/6 were purchased from Charles River Laboratories (Wilmington, MA). Briefly, after induction of deep anesthesia, each mouse was removed heart and fixed on a blunt needle that is inserted into the aorta, through which the heart has been continuously perfesional buffer Krebs-Henseleit. The pressure sensor (Mouse Specifics, Boston, MA) was inserted into the left ventricle, allowing continuous measurement of heart rate, vnutrijeludockova pressure. After a 15-minute period of equilibration, during which the received measurement reference level, the heart was perfesional buffer and 6% human plasma+/ -) in various concentrations (see Fig). During these studies, and as described in Evans et al. authors for whom Asali, that heart, which was perfesional buffer Krebs-Henseleit + 6% human plasma, stopped working within 5 minutes after the addition of plasma to the perfusion solution, while the heart, which has been continuously perfesional only buffer, continued to fight for more than two hours. Therefore, the duration of each experiment were randomly chosen equal to 15 minutes. The plan of this study using ARC186 presented on Fig.

Intraventricular pressure is continuously monitored and recorded, obtaining a curve of the pressure wave (Fig. 24 and 25). The lowest point of deviation is end-diastolic pressure ("EDP") and the highest point deviation represents the systolic pressure (SP). Pressure wave source is shown to the left of the vertical black line marked "0"is shown on each curve. As described previously (Evans et al., 1995), hearts were perfesional 6% human plasma, has undergone a rapid increase in end-diastolic pressure in the left ventricle, ultimately ending asistoliei (cardiac arrest) within 5 minutes (Fig). Adding to the plasma irrelevant aptamer 50-fold molar excess was also observed increased EDP and asistoliei (Fig).

When was added to the system ARC186 in molar equivalent amount, there were also rapidly increased the e EDP, ending asistoliei (Fig). In all three groups of hearts that have experienced mediated complement damage, increased EDP and asistoliei, heart looked swollen and swollen by the end of the experiment. When ARC186 was added to the plasma in a 10-fold or 50-fold (Fig) molar excess, wave ventricular pressure remained within the normal range, and asystole was observed. In addition, such groups were not observed previously described edema and swelling.

During each experiment we recorded the heart rate with 5-minute intervals, and the average heart rate for the group for each interval depicted graphically. As shown in Fig, hearts, perfuziruemah without aptamer or with irrelevant aptamer, quickly developed asystole, usually within 5 minutes. ARC186 added to the system in a molar equivalent amount, a little slowed the onset of asystole. However heart in this group eventually stopped. ARC186 added to the plasma in a 10-fold or 50-fold molar excess, kept heart rate during each experiment.

The increase in the mass of the heart in percent compared to the baseline level was calculated for a typical sample terminated hearts (no) or 50-fold molar excess of irrelevant and is tamera) and compared with the protected ARC186 hearts (10-fold and 50-fold molar excess of ARC186). As shown in Fig, mass protected ARC186 hearts grew significantly less than the mass of the terminated hearts in the control group.

As ARC186 inhibits C5, but did not inhibit the cleavage of C3, the exudate arising from isolated hearts, protected ARC186, should be detected cleavage products C3 (C3a), and not the products of the cleavage of C5 (C5a or C5b). To directly show that ARC186 inhibited the cleavage of C5 in human plasma, we measured the relative levels of proteins of the human complement C5a and C5b (products of the cleavage of C5 and C3a (the product of the cleavage of C3) in buffered exudate in different groups, using commercially available ELISA kits (set for ELISA C5b-9, Quidel, San Diego, CA; kit ELISA C5a and C3a, BD Biosciences, San Diego, CA). ARC186 inhibited the cleavage of C5 in plasma and production of C5a (Fig) and C5b-9 (Fig) dependent on dose. On the contrary, ARC186 had no effect on the cleavage of C3 person to C3a and C3b (Fig), which further demonstrates the specificity of the molecule with respect to C5.

After the formation of fragments of complement C3b and C5b are deposited locally in the tissues near the site of activation of complement. After completion of the experiments the hearts of the mice froze in the environment OCT (Sakura Finetek, Torrance, CA), made the cut and then painted using standard immunohistochemistry, in relation to the presence of C3b human (clone H1l, Chemicon, Temecla, CA), C5b-9 person (clone aE11, DAKO, Carpinteria, CA) or control mouse IgG (Vector Laboratories, Burlingame, CA). The results of the study are presented in Fig.

As described in this study, blocking C5 aptamer ARC186 tested in a model of ex vivo mediated component of complement C5 tissue damage, which used the isolated hearts of mice, perfezione buffer Krebs-Henseleit and 6% heparinized human plasma, and which is based on a model described in a previously published study that tested the effect of anti-C5 antibodies pexelizumab on the complement system (Evans, Molecular Immunol 32: 1183, (1995). Using this model, it was shown that blocking C5 aptamer (a) inhibited the cleavage of C5 human plasma (but not C3), (b) inhibit the deposition of C5b person (but not C3b) on tissues of mouse hearts and (c) inhibited mediated by C5b-9 human myocardial dysfunction in clinically relevant concentrations (5 μm, a 10-fold molar excess) compared to C5). The data obtained show that, when the complement cascade person is activated physiologically accordingly, blocking C5 aptamers capable of inhibiting the cleavage of C5 in the plasma and to prevent damage to and dysfunction of the myocardium.

Example 4B: Effectiveness of pegylated aptamer

Materials and methods the present study, were the same as described in example 4A above. The design of the experiment and the results are presented on Fig. In the first half of the experiment used heparinised human plasma (Center for Blood Research, Harvard Medical School, Boston, MA) as a source of complement, and the second half used heparinised plasma macaques-Griboedov (Charles River Laboratories, Wilmington, MA) as the source of complement. Pegylated aptamer (ARC658; SEQ ID NO: 62) was added to the system at increasing molar ratios. Although collected all relevant curves pressure in the ventricle, the table shows the presence or absence of increasing end-diastolic pressure (EDP), was there asystole or did not occur and the time before the termination of the work of the heart (defined as the presence of elevated EDP and asystole).

In experiments using human plasma was determined that the optimal dose AR658 (SEQ ID NO: 62) is equal to the molar equivalent quantity (500 nm), whereas in experiments using plasma primates other than man, was necessary 50-fold molar excess (25 μm)to protect the heart from indirect C5b damage (see Fig).

The obtained data are consistent with the differences in the affinity of anti-C5-aptamer against C5 person and C5 primates, non-human data, p is obtained in vitro. Without intending to be bound by any theory, in subsequent PK/PD studies in monkeys-grabado described in example 5, the authors have additionally shown that a 30-fold molar excess) was required for inhibition mediated simhasanam C5 cleavage in plasma, which further confirms the view that the aptamer binds C5 primates with lower affinity than C5 person.

Described studies taken together show that the blocking C5 aptamers ARC 186 (SEQ ID NO: 4) and to a greater extent ARC658 (SEQ ID NO: 62) are effective in models of isolated perfusing heart of a mouse. The model also demonstrates that it is necessary to use much more ARC658 (SEQ ID NO: 62) for inhibiting damage to the heart, C5 mediated plasma macaques-Griboedov (30-fold molar excess) in comparison with the inhibition of heart damage, mediated C5 person (molar equivalent), which further confirms the in vitro data, which showed that the aptamer has a lower affinity to C5 primates. Finally, our data indicate that makaka-rabadam need to get a dose of greater than 30-fold molar excess to demonstrate the blockade of C5 in vivo during PK/PD studies.

EXAMPLE 5

Metabolism and pharmacokinetics of anti-5-aptamer animals

In examples 5A-5G are all based on the mass of data on concentrations reflect only the molecular weight of the oligonucleotide portion of the aptamer, regardless of the weight added by conjugation with PEG.

Example 5A: the Metabolic stability of the inhibitor C5 ARC186 in the plasma of rats and primates

Naegeliana oligonucleotide precursor of aptamers (i.e ARC186; SEQ ID NO: 4) was tested in the plasma of rats and macaques-Griboedov (Charles River Labs, Wilmington, MA)to assess its stability, kinetic parameters of speed and path of destruction. Testing was performed using radioactively labeled at the 5'-end (32P)), inquirey at 37°C in 95% of the combined plasma (citrate) for 50 hours. At selected time points were selected aliquots containing the aptamer plasma, immediately frozen in liquid nitrogen and kept at -80°C. the Identification and analysis of aptamer and its metabolites in plasma was carried out using the extraction with a mixture of liquid-liquid (phenol-chloroform) followed by gel-electrophoresis (10% denaturing polyacrylamide sequanorum gel) and autoradiography high resolution.

On Fig shows a linear-logarithmic graph of the percentage of residual full-length aptamer as a function of time of incubation in plasma of rats and macaques-Griboedov. Profile of destruction in the plasma of both species has the essentially monophasic type, at this rate constant is approximately k~0.002 h-1.

Example 5B: Pharmacokinetics ARC657, ARC658 and ARC187 in rats after intravenous injection

To evaluate the pharmacokinetic profile ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5) and to assess the required level of dose and frequency of dose in primates and humans, conducted a pharmacokinetic study in rats, Sprague-Dawley (Charles River Labs, Wilmington, MA), which was introduced catheter. Aptamers were prepared for injection at a concentration of 10 mg/ml (weight of the oligonucleotide) in a standard saline solution and sterile filtered (0.2 μm) in a pre-sterilized vial under aseptic conditions. The route of administration used in the study on rats, was an intravenous bolus via the tail vein at a dose of 10 mg/kg Branches of the study consisted of 3 animals per group, from which repeatedly took the blood before the dose and at specified time points over 48 hours. Design research in General presents on Fig. Blood samples were obtained through a surgically implanted into the jugular vein catheters, immediately transported in covered EDTA tubes were mixed by inversion and placed on ice until processed for plasma.

Plasma was collected by centrifugation tubes containing a mixture of blood-EDTA, at 5000 rpm menu for 5 minutes and adosados (plasma) was transferred into new pre-labeled tube. Plasma samples were stored at -80°C until analysis. Analysis of plasma samples in respect of ARC187 was carried out, using the form homogeneous analysis using the direct addition of aliquot plasma into the wells for analysis containing commercially available fluorescent reagent for detecting nucleic acid OligreenTM(Molecular Probes, Eugene, OR). After a short incubation period (5 min) at room temperature with protection from light analyzed the tablets were subjected to registration by using the device for recording fluorescence tablets (SpectraMax Gemini XS, Molecular Devices, Sunnyvale, CA). The fluorescence signal from each well was proportional to the concentration of the aptamer in the hole, and the concentration in the sample was calculated by interpolation of the values of fluorescence based on the standard curve of fluorescence-concentration (average value on the basis of the curves in two or three repetitions repetition). Average plasma concentrations were obtained for each time point based on the data for three animals in each group. The data dependence of the concentration in plasma was subjected still made on the analysis (NCA)using industry standard computer software for pharmacokinetic modeling WinNonLinTMv.4.0 (Pharsight Corp., Mountain View, CA). Received the following assessment of the primary pharmacokinetic parameters: maximum concentration in plasma is e C max; the area under the curve of concentration-time (AUC); the end of time half-life t1/2; end clearance Cl and volume of distribution at steady state of Vss.

The dependences of the average plasma concentration against time is shown in Fig and plotted on Fig. Data dependence of concentration on time subjected still made on the analysis (NCA)using WinNonLinTMv.4.0. The specified analysis gave values presented on Fig.

As expected, 40 KD-aptamer ARC187 (SEQ ID NO: 5) had the longest half-life, and the 20 KD-aptamer, ARC657 (SEQ ID NO: 61) is the shortest. The observed Vssrelatively known volume of plasma (~40 ml/kg) testified to a reasonable degree of binding/sequestration ARC187 (SEQ ID NO: 5) protein and/or tissue matrix in the extravascular space. Based on the need to maintain a 5-fold molar excess of the aptamer results of this study indicate that ARC187 (SEQ ID NO: 5) provides a significant advantage in terms of frequency of doses and the total number of aptamer necessary to maintain the required levels in plasma.

Previous studies (data not shown) in rodents and primates using aptamers similar composition showed proportionality/linearity doses at doses up to 30 mg/kg, so we can assume, is that this level of doses will not result in nonlinear behavior of pharmacokinetic parameters.

Example 5C: Pharmacokinetics and ARC187 ARC1905 in mice after intravenous injection

To evaluate the pharmacokinetic profile oligonucleotide backbone ARC186 (SEQ ID NO: 4), conjugated with other branched PEG with 40 Mm KD than ARC187 (SEQ ID NO: 5), conducted a pharmacokinetic study in female mice CD-1 (obtained from Charles River Labs, Wilmington, MA). Aptamers were prepared for injection at a concentration of 2.5 mg/ml (weight of the oligonucleotide) in a standard saline solution and sterile filtered (0.2 μm) in a pre-sterilized vial under aseptic conditions. The route of administration used in the study on mice, was an intravenous bolus via the tail vein at a dose of 10 mg/kg Branches of the study consisted of 3 animals per group, which took the blood before administration of the dose (i.e. in the control group, not receiving doses) and at specified time points over 72 hours. Design research in General presents on figa.

Blood samples were obtained through the terminal puncture of the heart, immediately transported in covered EDTA tubes were mixed by inversion and placed on ice until processed for plasma. Plasma was collected by centrifugation tubes containing a mixture of blood-EDTA, at 5000 rpm for 5 minutes, and adosados (plasma) was transferred into a new one before artelino marked test tube. Plasma samples were stored at -80°C until analysis. Analysis of plasma samples in respect of ARC187 and -1905 was carried out, using the form homogeneous analysis using the direct addition of aliquot plasma into the wells for analysis containing commercially available fluorescent reagent for detecting nucleic acid OligreenTM(Molecular Probes, Eugene, OR). After a short incubation period (5 min) at room temperature with protection from light analyzed the tablets were subjected to registration by using the device for recording fluorescence tablets (SpectraMax Gemini XS, Molecular Devices, Sunnyvale, CA). The fluorescence signal from each well was proportional to the concentration of the aptamer in the hole concentration in the samples was calculated by interpolation of the values of fluorescence based on the standard curve of fluorescence-concentration (average value on the basis of the curves in two or three repetitions repetition). Average plasma concentrations were obtained for each time point based on the data for three animals in each group. The data dependence of the concentration in plasma was subjected still made on the analysis (NCA)using industry standard computer software for pharmacokinetic modeling WinNonLinTMv.4.0 (Pharsight Corp., Mountain View, CA). Received the following assessment of the primary pharmacokinetic parameters: maximum concentration in which the lazma, Cmax; the area under the curve of concentration-time (AUC); the end of time half-life t1/2; end clearance Cl and volume of distribution at steady state of Vss. The dependences of the average plasma concentration against time plotted on figv.

Data dependence of concentration on time subjected still made on the analysis (NCA)using WinNonLinTMv.4.0. The specified analysis gave values presented on figs. As expected, the PEG with 40 Mm KD from both vendors were pharmacokinetic equivalents in mice.

The same samples for ARC187 and -1905, which was used in the analysis oligreen, described above, were analyzed using the approved analysis high performance liquid chromatography (HPLC) with UV-registration.

Average concentrations in plasma for ARC187 and ARC1905 was calculated using Microsoft Excel 2003. When concentrations in plasma were below the LLOQ bioanalytical analysis before the introduction of the dose (time 0), taking a value of zero. Values below LLOQ for samples taken after administration of the dose, is not included in the calculation of average concentration in the plasma. Data on the average concentration in the plasma was used in the independent model FC-analysis using WinNonlin, version 5.1 (Pharsight Corporation, Mountainview, CA). The area under the curve of plasma concentration-time (AUC0-last) was evaluated, use the I the trapezoid rule for a linear function. When calculating any value that was below the LLOQ of the analysis, with the exception of the sample taken before administration of the dose, were excluded from the calculation of FC-parameter. The apparent end of the half-life was calculated using the formula t1/2=0,693/λzwhere λzmeans the rate constant of elimination, estimated on the basis of the final regression slope for the curve of the dependence of concentration on time. At least three concentrations of plasma peak concentration in the final phase is used to determine λzand required that the determination coefficient (r2) was ≥0,85.

In General the analysis HPLC analysis confirms the oligonucleotides described above, indicating the detection of the fact that ARC1905 and ARC187 were biologically equivalent based on the comparison of mean estimates of the parameters Cmax, AUC0-lastand AUC0-∞. The difference in values of AUC0-lastand AUC0-∞for ARC1905 compared to ARC187 (measured by HPLC) well meet the eligibility criteria of bioequivalence ± 20%.

Example 5D: Study of accumulation in the tissue inhibitors C5 ARC657, ARC658 and ARC187 in mice after intravenous bolus injection

Female mice CD-1 were obtained from Charles River Labs (Wilmington, MA). Drugs ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5) were prepared for injection in Fiziol the technological solution at a concentration of 5 mg/ml Preparations for doses of sterile filtered (0.2 μm) in a pre-sterilized bottle for doses under aseptic conditions and introduced animals in the form of intravenous bolus via the tail vein at a dose of 25 mg/kg In the study included groups of 3 animals for each of the four time points, t = before the introduction of the dose after 3, 6, 12 hours. After bleeding, vascular network, each animal was carefully washed (V~30 ml) saline solution to remove all the blood remaining in the vascular system. Tissues (heart, liver, kidneys) were collected, weighed, and then homogenized at 50% wt./about. in standard saline solution and kept at -80°C until analysis.

Analysis of the tissue in relation to ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5) was performed using analysis type ELISA based on hybridization. In this analysis biotinylated capture probe previously was immobilized in the wells of 96-hole microplate, when the solution concentration for binding of 125 nm for 3 hours. Wells 5 times washed with 1×PBS. Then the plates were blocked with 150 μl/well 1X SuperBlock in TBS (Pierce Chemical, Rockford, IL). Tablets are again washed, covered and kept at 4°C until use. In separate tubes, the samples were annealed in buffer containing FAM-labeled (5'-fluorescein) a probe for identifying the sample, the ri 200 nm at 90°C for 10 min, then put on ice. Standards of concentration and control samples plasma/tissue also pre-annealed using the solutions of a probe for reception of the sample, and then the pipette carried in the wells for analysis containing immobilized biotinylated capture probe and annealed at 45°C for 2.5 hours. Then the tablets were again washed and filled with 100 µl/well of a solution containing 1×PBS containing 1 µg/ml of monoclonal antibodies against fluorescein conjugated to horseradish peroxidase (anti-FITZ-Mat-HRP, Molecular Probes, Eugene, OR)in 1×PBS, and incubated for approximately 1 hour. The tablets were again washed as described above. Wells for analysis were then filled with 100 μl of a solution containing fluorogenic HRP substrate (QuantaBlu, Pierce Chemical, Rockford, IL)and incubated for 20-30 min, protected from light. After a 45-minute incubation was added 100 μl/well of a solution to stop the reaction to quench the reaction, producing a fluorescent precipitate. The tablets immediately registered in the device for recording the fluorescence microplate (SpectraMax Gemini XS, Molecular Devices, Sunnyvale, CA)using the fluorescence excitation at 325 nm and recording the emission at 420 nm. Each well was recorded 10 times. All three aptamers were identified in the tissue of the heart in three time points (Fig).

Example 5E: Pharmacokinetics and pharmacode the Amica C5 inhibitors ARC657, ARC658 and ARC187 in macaques-Griboedov after intravenous injection

Study 1

Drugs ARC657 (SEQ ID NO: 61), ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5) for injection was prepared in a standard saline solution at a concentration of 10 mg/ml and dosed medications sterile filtered (0.2 μm) in pre-sterilized bottles for doses under aseptic conditions. The route of administration used in the study on monkeys, was an intravenous bolus via surgically implanted in the femoral vein catheter at a dose of 30 mg/kg (approximately 50-fold molar excess). Design research in General presents on Fig. Blood samples were obtained via implanted in the femoral vein catheters, immediately transported in covered sodium citrate tubes were mixed by inversion and placed on ice until centrifugation to separate plasma (3000 rpm for 5 minutes). Then the plasma was divided into aliquots of 250 ál, which was stored at -80°C, and one aliquot of each sample was evaluated in relation to the concentration of aptamer using based on fluorescence analysis OligreenTMdescribed above in the section FC in rats.

Data based primary plasma concentration against time is presented in table form on Fig. as expected, 40 CD-PEG-aptamer ARC187 (SEQ ID NO: 5) remained in plasma for the longest period of time, while 20 CD-PEG-aptamer ARC657 (SEQ ID NO: 61) remained within the shortest period of time. Viewing data shown in Fig indicates that the data best fit a two compartment model. Thus, evaluation of pharmacokinetic parameters on Fig were derived based on a two compartment model using industry standard computer simulation program WinNonLin pharmacokineticTMv.4.0 (Pharsight Corp., Mountain View, CA).

As shown in Fig, all the aptamers had a similar value of Cmaxfrom 23 to 30 μm, which suggests that the dose of aptamer (30 mg/kg) was sufficient to achieve a 50-fold molar excess) in plasma compared with the concentration C5 (50-fold molar excess of about 25 microns). Although aptamers ARC657 (20 KD PEG) (SEQ ID NO: 61) and ARC658 (30 KD PEG) (SEQ ID NO: 62) differed in molecular weight 10,000, they had similar exposure (AUC), t1/2(α) and t1/2(β). In contrast ARC187 (SEQ ID NO: 5) had significantly higher values of exposure (AUC), long t1/2(α) and a little longer t1/2(β)than other molecules.

Additional aliquots of plasma samples collected during the study of pharmacokinetics and then analyzed in vitro to determine the effectiveness of the blockade of C5 primates. Analysis of activation simhasanam sushestvovali, as described above, to determine the number of educated C5b-9 and C5a primates, respectively. The data were represented graphically in several different forms, including the dependence of concentration of C5b-9 from the time of sample (figa), the dependence of concentration of C5b-9 on the concentration of the aptamer (fig.43b), the dependence of the concentration of C5a from the time of sample (figs) and the dependence of the concentration of C5a concentration of aptamer (fig.43d).

40 CD-PEG-aptamer ARC187 (SEQ ID NO: 5) inhibited the cleavage of C5 primates (concentration of C5b-9 and C5a) for the longest period of time (figa and 43c). When data C5b-9 and C5a are laid on a graph against the concentration of aptamer, they showed that the concentration of aptamer, block C5, should be limited to 30-fold molar excess, regardless of the size of the PEG molecules to completely inhibit the cleavage of C5 (fig.43b and 43d).

In conclusion, the data obtained in the PK/PD study on monkeys-grabado, show that (a) as expected, at least 30-fold molar excess) (concentration) in the plasma of approximately 15 μm) was required for inhibition of C5 cleavage in vivo in macaques-Griboedov regardless of group size PEG, (b) C5-blocking aptamers do not cause overt toxicity in this species, and (c) in the case when animals were injected with a relatively high dose levels (50-fold m is regular excess), levels of aptamer plasma fell within appropriate for analysis of the range during the period of sampling, which allowed for calculation of pharmacokinetic parameters.

Example 5F: Pharmacokinetics and pharmacodynamics C5 inhibitors ARC658 and ARC187 in macaques-Griboedov after intravenous injection

Study 2

Study 2 was similar in design to study 1, described above, with the following exceptions: (a) has been evaluated only two connections (ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5); (b) the number of animals was increased to four in the group; and (c) plasma sample in the time point of 1 minute were excluded and replaced by the sample at time point 144 hours, to allow calculation of the end of time half-life, based on a larger number of points will receive the data. Methods of preparation and dispensing of these two aptamers, taking blood samples and selection of plasma were identical to the methods described above for study 1. The design of study 2 are summarized in Fig.

After completion of the study 2 aliquots of plasma were analyzed as described in study 1 to determine (a) the concentration of aptamer in plasma at different time points after intravenous injection, and b) the effectiveness of the blockade of C5.

The concentration of aptamer plasma depicted graphically as a function of time (Phi the .45), and the primary data for ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5) are presented in table form on Fig and 40, respectively. 40 CD-PEG-aptamer ARC187 (SEQ ID NO: 5) was maintained in the plasma for the longest period of time. View Fig shows that the data best fit a two compartment model. Thus, evaluation of pharmacokinetic parameters on Fig were derived based on a two compartment model using WinNonLinTMv.4.0 (Pharsight Corp., Mountain View, CA).

When comparing the pharmacokinetic parameters obtained in the course of PK/PD study 1 and study 2, described above, the data for ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5) were similar except for the measurement of t1/2(α) for ARC187. Without intending to be bound by any theory, suggest that differences in the measurements of t1/2(α) for ARC187 in the two studies may be a consequence of small sample in the pilot study.

As shown in Fig, the values of Cmaxwere similar for ARC658 (SEQ ID NO: 62) and ARC187 (SEQ ID NO: 5). In contrast, exposure to drug (AUC) was significantly greater in animals treated ARC187 (SEQ ID NO: 5). Also ARC187 had a longer values of t1/2(α) and t1/2(β) compared to ARC658 (SEQ ID NO: 62). These data along with data obtained during a PK/PD study 1 show that C5-lock the matter of aptamers ARC187 can provide the most effective blockade of C5 in vivo for a given dose.

Additional aliquots of plasma samples collected during the study of pharmacokinetics and then analyzed in vitro to determine the effectiveness of the blockade of C5 primates. As before, carried out the analysis of the activation simhasanam to determine the number of educated C5b-9 and C5a primates, respectively. The data were represented graphically in the form of the dependence of the concentration C5b-9 concentration of aptamer (Fig) and according to the concentration of C5a concentration of aptamer (Fig). As shown earlier in the course of the PK/PD study 1, the concentration of C5-blocking) should be limited to 30-fold molar excess (aptamer to the C5 concentration in plasma), or about 15 μm regardless of the size of the PEG molecules to completely inhibit the cleavage of C5 primates (Fig and 42).

When viewing data in the tables on Fig and 40 it is obvious that after the introduction/in-bolus 30 mg/kg ARC658 (SEQ ID NO: 62) was maintained at a concentration higher than 15 microns for about 4 hours, while ARC187 remained in concentrations above 15 microns for about 8 hours. Thus, with the introduction of a similar dose of the drug 40 KD-aptamer ARC187 provides clinical effectiveness within approximately two times longer period than 30 CD-aptamer ARC658 (SEQ ID NO: 62).

In conclusion, macaques-Griboedov should be treated at least 30-fold molar excess of eptam the RA compared to the C5 in the plasma, to block the conversion of C5 in vivo. The obtained data are consistent with previous in vitro studies (hemolysis) and ex vivo (isolated perfoirmance heart of a mouse), which indicate that binds C5 aptamers had lower affinity to C5 primates than to C5 person. It was shown that C5-blocking aptamers can be safely delivered as an intravenous bolus at a dose of 30 mg/kg, which is approximately equal to 50-fold molar excess) in comparison with the concentration of C5.

Example 5G: ARC1905 in macaques-Griboedov after/in the bolus injection

Pharmacodynamics inhibitor C5 ARC1905 evaluated in macaques-Griboedov after intravenous injection. Drugs ARC1905 for injection was prepared in a standard saline solution at a concentration of 7.5 mg/ml and preparations for a dose of sterile filtered (0.2 μm) in a pre-sterilized vials under aseptic conditions. Makaka-rabadam (n=4) were injected dose at concentrations of 0 (control in the form of saline or 30 mg/kg by intravenous bolus injection. Blood samples were obtained from a peripheral vein or port access artery and blood samples (0.5 ml) was transferred into tubes containing dicale (K2)- EDTA, were placed in ice water and centrifuged within 30 minutes of collection at about 4°C.

Specimen is plasma was analyzed in vitro, to determine the effectiveness of ARC1905 in relation to the blockade of C5 in primates. Analysis using zymosan previously described for ARC1905 in example 1C, was used to determine the number of educated C5a primates. The decrease in the values of C5a after activation simhasanam after 0.5 and 2 hours after a dose shows that ARC1905 inhibits the cleavage of C5 in vivo in macaques-Griboedov similar to ARC187, when a dose of approximately the same concentration and the same by introducing, as it was measured in vitro by analysis of activation simhasanam.

Example 5H: Pharmacokinetics and pharmacodynamics of a C5 inhibitor ARC187 in macaques-Griboedov after/in the bolus injection and infusion

Pharmacokinetic (PK) and pharmacodynamic (PD) profiles of ARC187 (SEQ ID NO: 5) was also evaluated in macaques-Griboedov shock after intravenous bolus followed immediately by the start of the intravenous infusion. The design of this study is shown in Fig.

Shock bolus dose and infusion rate required to achieve the target steady plasma concentration of 1 μm, was calculated using the pharmacokinetic parameters obtained on the basis of studies using only/in-bolus shown in Fig.

All three makaka-rabadam was introduced in/bolus ARC187 dose of 1 mg/kg followed by immediate early/in infusion from near the capacity of 0.0013 mg/kg/min for a time period of 48 hours. Samples of whole blood were collected from 0 to 192 hours after treatment, and kept on ice water, were processed to obtain plasma, and then kept frozen at -80°C. the Concentration of ARC187 in plasma samples were determined using analysis of fluorescent staining of nucleic acid (described in example 5B) and approved GLP analysis high performance liquid chromatography (HPLC). Method HPLC analysis for determination of ARC187 in the plasma of monkeys confirmed in ClinTrials Bio-Research (Montreal, Canada). Confirming the study was compliant with the provisions of good practice laboratory studies (GLP) Administration on quality supervision, food and drug administration (FDA) (21 CFR §58). The method of analysis HPLC was confirmed in terms of selectivity, linearity, lower limit of quantification (LLOQ), migration, accuracy and reliability inside the analysis, the accuracy and reliability when comparing different analyses, the stability of the initial solution, the stability of the injection medium, short-term stability matrix, stability during freezing-thawing, long-term stability of the matrix and integrity when diluted. Determined acceptable linear dynamic concentration range of 0,080 to 50.0 μm.

The measured FC-profile ARC187 in these conditions fit in well with aschiana profile created using FC-parameters for the case of introduction only, in/in bolus (see Fig). Target plasma concentration of 1 μm was installed later <5 min after administration of the dose and was maintained throughout the infusion. After the infusions, the aptamer had a finite half-life of t1/2(β) ~40-60 hour.

Pharmacodynamic activity of ARC187 (SEQ ID NO: 5) in macaques-Griboedov was evaluated ex vivo using plasma samples collected during FC-study, described earlier in the analysis of activation simhasanam modified so that the plasma samples macaques-Griboedov was diluted 10-fold in 10% human plasma and then was treated with 5 mg/ml zymosan. The activation of C5, the reflection of which is the appearance of the cleavage product C5a, were measured by ELISA specific for human C5a (set for C5a ELISA, BD Biosciences, San Diego, CA). Then the concentration of the active ARC187 in each sample was quantitatively evaluated by comparing with a standard curve obtained by analysis of activation simhasanam using samples prepared with known levels of ARC187 (see Fig). This study shows that ARC187 retains its activity directed against complement, during and after infusions at levels essentially coincident with the pharmacokinetic profile described above.

Primer: Prediction of doses, necessary for a person

The dose needed for the prevention, attenuation or treatment of complications in humans associated with CABG operation, based on the following assumptions: first, patients with CABG should enter a single intravenous bolus dose of anti-C5-aptamer before the operation followed by a continuous infusion for establishing and maintaining stationary plasma concentrations of 1.5 μm in 24-48 hours after CABG operation. Evaluation bolus dose and rate of infusion based on calculations using the pharmacokinetic parameters obtained in the course of the above studies with the introduction of the only in-bolus and intravenous bolus plus infusion in macaques-Griboedov. Certain bolus dose of ARC187 is 1 mg/kg, and the corresponding infusion rate is 0.0013 mg/kg/min For this scheme - bolus plus 48-hour infusion of projected total demand of the medicinal product is 0.4 g for ARC187, the mass applies only to the mass of the oligonucleotide (see column 7 in table Fig). Column 2 of the table shown in Fig, refers to a mass group of PEG conjugated to oligonucleotide part of ARC187, column three refers to the molecular weight of the oligonucleotide part of ARC187 (and will be the same for all aptamers according to the invention, which contain ARC186 (SEQ ID NO: 4) as oligonucleotide the sequence), column 4 refers to the molecular weight of 40 KD-PEG conjugated to ARC186 (SEQ ID NO: 4) via chemical groups, active in relation to the amine as described in example 3C above, column 5 refers to the time-life ARC187 in phase α in the two-chamber model, and column six refers to the time-life ARC187 in phase β in a two compartment model.

EXAMPLE 6

The interaction of anti-C5 aptamer and heparin/Protamine

One of the prospective applications of anti-C5-aptamer is used as a prophylactic agent to prevent or reduce inflammatory side effects associated with transplantation surgery for coronary artery bypass (CABG). High concentrations of the anticoagulant heparin (3-5 units/ml or 1-2 μm) is usually administered during CABG to prevent thrombosis and to maintain the patency through the pump bypass; eliminating the effect caused by heparin after the procedure and restore normal homeostasis is achieved by introducing high concentrations of Protamine (~5 µm). Taking into account the potential risk to patients of any interference in the performance of each of these drugs, it was necessary to show that anti-C5 aptamers (1) do not modify the activity of each of the medicines and (2) does not have its own effect which I homeostasis, which can complicate anticoagulation treatment.

Heparin is a sulfated polysaccharide with the resulting negative charge and an average molecular weight of approximately 15 KD, which has an inhibitory effect on a number of proteases in the coagulation cascade, stimulating interaction with antithrombin. Protamine, a polypeptide with a high positive charge that can block the activity of heparin by poorly characterized interactions, which at least partly is electrostatic in nature. The functional core of ARC187 (SEQ ID NO: 5) is similar to heparin is largely anionic. Thus, it is possible that ARC187 could not specific contact sites of binding of heparin or Protamine and interfere with the activities of these molecules. In the following studies have examined natural anticoagulant properties ARC187 (similar to properties of heparin), the influence of ARC187 function of heparin, the influence of ARC187 on neutralization of heparin by Protamine and the effect of Protamine on inhibiting complement the properties of ARC187.

Example 6A: Effect of ARC187 on coagulation in vitro

Investigated the influence of ARC187 (SEQ ID NO: 5) on the ability of plasma to coagulate, using standard clinical tests of internal and external pathways of the coagulation cascade, prothrombin time (PT) and Aktivera the data partial thromboplastin time (aPTT), respectively. As shown in Fig, titration citrate human plasma concentrations, corresponding to a large excess of the planned doses (up to 20 μm), did not lead to changes in the PT and led only to a slight increase in aPTT.

In order to assess the impact of ARC187 function of heparin and Protamine in vitro, 3 people took the blood, adding 4-5 units/ml heparin, dose, appropriate levels of heparin used in CABG operations. The ability of such samples for coagulation was assessed using the active coagulation (ACT) test for coagulation of whole blood, usually used to control the activity of heparin during surgery. When the indicated concentrations of heparin in the absence of other additives ACT significantly increased compared to baseline levels from ~150 seconds to ~500 seconds in the presence of 4 units/ml of heparin or ~800 seconds in the presence of 5 units/ml heparin. The addition of 10 μm ARC187 to these samples had little effect on the clotting time, which suggests that ARC187 does not interfere with the anticoagulant activity of heparin.

Anticoagulate the effect of heparin easily neutralized by titration with Protamine 6-8 µm (4 units/ml of heparin) or 12 mm (5 units/ml heparin). Values ACT in the presence of heparin and neutralizing concentrations of Protamine essentially do not differ from baseline. As consisting of a nucleic acid core RC187 (12 KD) has a large molecular weight, than Protamine (5 KD), one can expect that equimolar concentrations of ARC187 added to the Protamine could adequately or entirely neutralizing the activity of Protamine. However, pre-incubation of Protamine approximately equivalent concentrations of ARC187 had little impact on the ACT. In blood samples containing neutralizing concentrations of Protamine, watched the same values ACT in the presence or absence of 10 μm ARC187, which suggests that ARC187 has only weak or no influence on procoagulation activity of Protamine. The results obtained are summarized in Fig.

Example 6B: Effect of ARC187 on coagulation in vivo

Investigated the interaction between heparin and Protamine with concomitant introduction of the anti-C5-aptamer ARC187 (SEQ ID NO: 5) in clinical doses of heparin and clinical/subclinical/sverkhkriticheskikh doses of Protamine to determine whether to interfere with the presence of subclinical/sverkhkriticheskikh concentrations in plasma ARC187 cancellation anticoagulative action of heparin with Protamine. The results of the study are summarized in Fig. Briefly, values ACT initial level was not influenced by the addition of 10 μm (i.e. a 10-fold molar excess of the clinical dose) ARC187 at all tested doses of heparin. Similarly, 10 μm ARC187 did not influence the degree of the Academy of Sciences of koaguliruemogo action of heparin. In the absence of ARC187 minimum effective dose of Protamine was ~30% (clinical dose = 100%). In addition, the abolition of anticoagulative action of heparin 30% Protamine was not affected by 10-fold molar excess of the clinical dose (i.e. 10 microns) ARC187. Thus, the use of ARC187 for inhibition of complement in clinical conditions (e.g., CABG) should not be affected by concurrent administration of heparin and Protamine in normal doses.

Example 6C: Effect of heparin and Protamine directed against the complement function ARC187

Investigated the effect of heparin and Protamine directed against the complement activity of ARC187 (SEQ ID NO: 5) in samples of citrate whole blood activated simhasanam as described in example 1. Directly before activating simhasanam ARC187 was titrated in samples of citrate blood processed in four conditions: 1) without treatment (without heparin or Protamine); 2) 4 units/ml of heparin; 3) 6 microns Protamine; 4) 4 units/ml of heparin 4+6 μm Protamine. After activation simhasanam activation of C5 quantitatively assessed by ELISA-measurement of sC5b-9 in plasma (set for ELISA C5b-9, Quidel, San Diego, CA). For each condition, the results, expressed as percentage of inhibition of C5 activation depending on the concentration of ARC187 were indistinguishable, the differences were within the errors (see Fig). In all cases, a complete inhibition of access to the Gali at 1-2 μm ARC187. Thus, heparin and Protamine, separately or in combination at concentrations corresponding to their use in CABG operations, apparently, does not affect the activity of ARC187 directed against complement.

Although the invention is characterized by using the description and examples, the experts in this field will be clear that the invention can be implemented in different ways and that the above description and examples are offered for purposes of illustration and not limitation the following further claims.

1. Composition for treating disorders that involved C5 mediated activation of complement-mediated Sa activation of complement or indirect 5b-9 activation of complement containing a therapeutically effective amount of the conjugate of the aptamer/PEG having a sequence according to SEQ ID NO:5, SEQ ID NO:67, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:65 or SEQ ID NO:66 or its salts, where the conjugate of the aptamer/PEG modulates the function of a protein of complement C5, Sa or 5b-9.

2. The composition according to claim 1, in which the aptamer anywhereman with PEG via a linker.

3. The composition according to claim 2, in which the linker is an alkyl linker.

4. The composition according to claim 3, in which the alkyl linker comprises from 2 to 18 consecutive groups of CH2.

5. The composition according to claim 1, further containing a pharmaceutically acceptable the th carrier or diluent.

6. A method of treating disorders that involved C5 mediated activation of complement-mediated Sa activation of complement or indirect 5b-9 activation of complement, including the stage of introduction to a patient in need of such treatment, a composition according to claim 1, where the disorder, which involved C5 mediated activation of complement-mediated Sa activation of complement or indirect 5b-9 activation of complement is damaged infarction associated with CABG-surgery, myocardial injury associated with balloon angioplasty, myocardial injury associated with restenosis, mediated protein complement complications associated with CABG-surgery-mediated protein complement complications associated with percutaneous intervention in the coronary artery, paroxysmal nocturnal hemoglobinuria, acute graft rejection, hypertree graft rejection, subacute graft rejection, and chronic graft rejection.

7. Composition for treating disorders that involved C5 mediated activation of complement-mediated Sa activation of complement or indirect 5b-9 activation of complement containing a therapeutically effective amount of the conjugate of the aptamer/PEG, having the structure below, or salts thereof:

wheremeans the linker.
Aptamers=
fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfcfumgmamgfufcfumgmamgfufufu
AfCfCfUmGfCmG-3T (SEQ ID NO:4),
where fC and fU=2'-formulated, a mG and mA=2'-OMe-nucleotides and all other nucleotides are 2'-HE-nucleotides, and 3T denotes an inverted deoxythymidine, where the conjugate of the aptamer/PEG modulates the function of a protein of complement C5, Sa or 5b-9.

8. The composition according to claim 7, in which the linker is an alkyl linker.

9. The composition according to claim 8, in which the alkyl linker contains from 2 to 18 consecutive groups of CH2.

10. The composition according to claim 7, in which conjugate the aptamer/PEG has the structure indicated below:

where aptamers=
fCmGfCfCGfCmGmGfUfUfCmAmGmGfCGfCfumgmamgfufcfumgmamgfufufu
AfCfCfUmGfCmG-3T (SEQ ID NO:4)
where fC and fU=2'-formulated, a mG and mA=2'-OMe-nucleotides and all other nucleotides are 2'-HE-nucleotides, and 3T denotes an inverted deoxythymidine.

11. The composition of claim 10, further containing a pharmaceutically acceptable carrier or diluent.

12. A method of treating disorders that involved C5 mediated activation of complement-mediated Sa activation of complement or indirect 5b-9 activation of complement, including the stage of introduction to a patient in need of such treatment the composition of claim 10, where the disorder, which involved indirect C5 asset is the s complement, indirect Sa activation of complement or indirect 5b-9 activation of complement is damaged infarction associated with CABG-surgery, myocardial injury associated with balloon angioplasty, myocardial injury associated with restenosis, mediated protein complement complications associated with CABG-surgery-mediated protein complement complications associated with percutaneous intervention in the coronary artery, paroxysmal nocturnal hemoglobinuria, acute graft rejection, hypertree graft rejection, subacute graft rejection, and chronic graft rejection.

13. Conjugate the aptamer/PEG having a sequence according to SEQ ID NO:5, SEQ ID NO:67, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:65 or SEQ ID NO:66 or its salt.

14. Conjugate the aptamer/PEG in item 13, in which the aptamer anywhereman with PEG via a linker.

15. Conjugate the aptamer/PEG through 14, in which the linker is an alkyl linker.

16. Conjugate the aptamer/PEG indicated in paragraph 15, in which the alkyl linker comprises from 2 to 18 consecutive groups of CH2.

17. Conjugate the aptamer/PEG having the structure indicated below or its salt:

wheremeans the linker.
Aptamers=
fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfcfumgmamgfufcfumgmamgfufufu
AfCfCfUmGfCmG-3T (SEQ ID NO:4),
where fC and fU=2'-formulated, a mG and mA='-OMe-nucleotides, and all other nucleotides are 2'-HE-nucleotides, and 3T denotes an inverted deoxythymidine.

18. Conjugate the aptamer/PEG on 17, in which the linker is an alkyl linker.

19. Conjugate the aptamer/PEG on p, in which the alkyl linker comprises from 2 to 18 consecutive groups of CH2.

20. Conjugate the aptamer/PEG on 17, where the conjugate of the aptamer/PEG has the structure indicated below:

wheremeans the linker.
Aptamers=
fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfcfumgmamgfufcfumgmamgfufufu
AfCfCfUmGfCmG-3T (SEQ ID NO:4),
where fC and fU=2'-formulated, and mG and mA=2'-OMe-nucleotides and all other nucleotides are 2'-HE-nucleotides, and 3T denotes an inverted deoxythymidine.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention refers to polymer conjugates of formula (I) comprising nucleotide or oligonucleotide residue, which can be applied for treatment of cancer and methods for their obtaining. where R1 and R2 independently represent H or polyalkylenoxyde, not necessarily having capping group selected from OH, NH2, SH, CO2N, C1-6 alkyls, compounds of formula (II) X2-(L2)n-(L1)o- and the formula (III) -(L4)p-(L3)m-X3, and when (o+n)≥2 each of n and o is a positive integer, each p and m are equal to zero, and R2 represents H, and when (p+m)≥2 each p and m is a positive integer, each n and o are equal to zero and R1 represents H; X1, X2, X3 are independently selected from a single-stranded or double-stranded oligonucleotide residue; L1 and L4 independently represent released link fragments; L2 and L3 are independently selected from bifunctional spacer groups.

EFFECT: developing of new nucleotide conjugates with antitumor activity.

21 cl, 25 ex, 7 tbl, 12 dwg

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to bioengineering and specifically to genetic engineering. Proposed are synthetic oligonucleotide primers which are complementary to conservative parts of genes which code the Varicella-Zoster (VZV) protein, and specifically to the UL-36 part of the gene. The invention enables detection of Varicella-Zoster DNA through such oligonucleotide primers with high degree of specificity in clinical samples.

EFFECT: obtaining novel synthetic oligonucleotide primers which can be used in scientific research for studying infections caused by the virus DNA.

2 ex, 2 dwg

FIELD: food industry.

SUBSTANCE: strain Streptococcus thermophilus which produces lactic acid is described. Sequence of nucleic acids made of the strain producing polysaccharides are also described as well as food or pharmaceutical composition and milk product containing such strain.

EFFECT: strain has strong structural properties.

16 cl, 4 dwg, 6 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: method of producing cyclopropyl-condensed inhibitors of dipeptidyl peptidase IV involves using BOC-protected amine with structural formula (3) , obtained through reductive amination of acid with formula (1) by treating the said acid with ammonium formate, nicotinamide adenine dinucleotide, dithiothreitol and partially purified concentrate of phenyl alanine dehydrogenase and formate dehydrogenase (PDH/FDH) enzymes and without separation - by treating the obtained amine of formula (2) with ditertbutyl dicarbonate, obtaining BOC-protected amine.

EFFECT: cutting on costs.

13 cl, 7 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to genetic therapy and concerns nucleotide sequence that codes insulin-like human growth factor IGF-1 presented with a synthetic gene including a sequence SEQ ID NO:1, recombinant plasmid DNA, containing this sequence, an eukaryotic cell containing recombinant plasmid DNA, construction for genetic therapy and a pharmaceutical composition for genetic therapy with regenerative and wound healing action.

EFFECT: advantage of the invention consists in decreased doses and introduction rate of injected preparations.

5 cl, 2 ex, 2 tbl, 4 dwg

FIELD: medicine.

SUBSTANCE: present invention concerns to immunostimulating phosphorothioate CpG-oligonucleotides which can be used for stimulation of the immune response.

EFFECT: obtaining of CpG-oligonucleotides.

49 cl, 76 fig, 19 tbl, 34 ex

FIELD: chemistry.

SUBSTANCE: invention concerns process of obtaining deoxyribo- and ribooligonucleotide 5'-triphosphate salts represented by the general formula shown in description. Initial reagent, deoxyribo- and ribooligonucleotide 5'-triphosphate tetra- or trialkylammonium salt in the form of 0.1-0.5 M solution, is activated in the solvent composition of dimethylsulphoxide and dimethylformamide in the ratio of 2:1 by fivefold to fifteenfold excess of oxidation-reduction composition of triphenylphosphine and dipyridyldisulphide in the ratio of 1:1 in the presence of 50 to 80-fold excess of 1-methylimidasol or N,N-dimethylaminopyridine for 5-10 minutes. Then 10 to 20-fold excess bis-tributylammonium pyrophosphate solution in acetonitrile is added, and the reacting mix is held for 15-30 minutes, followed by extraction and purification of target product.

EFFECT: increased output of target products and reduction of excess reagents and solvent volume.

1 cl, 6 ex, 3 tbl, 1 dwg

FIELD: biochemistry, molecular biology.

SUBSTANCE: invention proposes a method for isolation of genome DNA from yeast and gram-positive microorganisms associated with cellular envelopes and useful for direct using in PCR-amplification. Method involves treatment of cells with buffer solution of neutral pH containing salt - chaotrop chosen from guanidinium salts at heating followed by isolation of the end product. Before isolation of DNA cellular deposit is treated additionally with a buffer solution containing proteinase K in the concentration 50-100 mcg/ml for 0.5-1.0 h at 37-40°C. Realization of the invention provides enhancing the effectiveness of process in preparing genome DNA and to use microorganisms with extra strength cellular walls for isolation of DNA. Invention can be used in development of test-systems for different designation suggesting using PCR-amplification of DNA from cells of yeast, fungi and microorganisms with extra strength cellular walls.

EFFECT: improved preparing method of DNA.

1 cl, 6 ex

FIELD: biochemistry, molecular biology.

SUBSTANCE: invention proposes a method for purification of double-stranded DNA (dsDNA) for a mixture of other components comprising the natural or artificially added sequence A-G-A-A-A-A-A-A-A-G-G-A or A-A-G-A-A-A-A-A-A-A-A-G-A-A. Method involves carrying out the following steps: (a) passing a solution containing indicated dsDNA through a support containing a covalently bound a single-stranded oligonucleotide of the sequence T-C-T-T-T-T-T-T-T-C-C-T and T-T-C-T-T-T-T-T-T-T-T-C-T-T that is completely complementary to the specific sequence represented with dsDNA to be isolated and forming with the latter the stable triplex structure; (b) eluting the end DNA by washing out the support at alkaline values of pH, and (c) isolation of dsDNA from eluate. Realization of the invention provide possibility for preparing the significant amounts of pharmaceutically pure dsDNA that can be used, for example, in genetic therapy or in aims for vaccination. Invention can be used in medical-biological industry.

EFFECT: improved purifying and preparing method.

20 cl, 11 ex

FIELD: bioorganic chemistry.

SUBSTANCE: disclosed is oligonucleotide-peptide conjugate of general formula 3'TTCTCTAGG5'-dRib-dRib-dRib-N-terminal-Leu-Arg-Leu-Arg-Leu-Arg-Arg-Gly-NH2-C-terminal (wherein T is thymine residue; C is cytosine residue; A is adenosine residue; G is guanosine residue; drib is deoxyribose residue; Leu is leucine residue; Arg is arginine residue; Gly is glycine residue). Said conjugate cleaves phosphodiester bonds in single-stranded RNA sites in 5'GpN3' (wherein G is guanosine; N is any ribonucleotide) sequences only.

EFFECT: new conjugate being functional analog of T1 ribonuclease.

3 dwg, 4 ex

Neuroprotector // 2406488

FIELD: medicine, pharmaceutics.

SUBSTANCE: there is offered a neuroprotective agent. The agent represents 4-methyl-2,6-diisobornylphenol formerly known for its antiplatelet and antithrombogenic action.

EFFECT: means prevents transient cerebral ischemia death, reduces a degree of post-ischemic neurological deficiency.

3 tbl, 2 ex

Retinoprotector // 2406487

FIELD: medicine, pharmaceutics.

SUBSTANCE: there is offered a retinoprotective agent. The agent represents 4-methyl-2,6-diisobornylphenol and prevents epitheliocytus neurosensorius destruction.

EFFECT: means promotes a complete integrity of the retinal inner nuclear layer neurons from the damaging action of permanent prolonged hyperglycemia.

5 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention belongs to medicine, notably to haematology and cardiology and refers to reduction of spontaneous erythrocytes aggregation in patients with stable effort angina functional class I-II. To achieve this complex treatment including hypolipidemic diet, controlled activity, at least 30 minutes swimming daily and 20 mg of simvastatin once daily after supper is administered.

EFFECT: method allows spontaneous erythrocytes aggregation correction during 2 months providing blood rheological properties enhancement and, correspondingly, thrombotic complication risk decrement in this group of patients.

2 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: there is described a new compound - 1-(β-phenylethyl)-4-amino-1,2,4-triazolium bromide exhibiting cardioprotective, anti-ischemic, antihypertensive, antioxidant, protein synthetic and energotropic action.

EFFECT: improved clinical effectiveness.

1 cl, 5 ex, 4 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: claimed invention relates to compounds of formula IB , where radicals R1-R5 have values, given in invention formula. In range of claimed invention also described are pharmaceutical compositions, which include compounds of IB formula, and methods of application of such compounds and compositions for treatment of different malfunctions, mainly selected from immune response reactions.

EFFECT: compounds by claimed invention have inhibiting action with respect to proteinkinases and, in particular with respect to JAK-3, ROCK or Aurora kinases.

55 cl, 6 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: there are described novel acylsulfonamide peri-substituted condensed bicyclic compounds of general formula (I), values of radicals are given in invention formula. Also described is pharmaceutical composition based on formula (I) compound.

EFFECT: compounds can be used for inhibition of prostaglandin E2 binding with receptor EP3.

30 cl, 371 ex, 4 tbl

FIELD: medicine.

SUBSTANCE: there are offered a pharmaceutical composition for prevention or treatment of cardiovascular disturbances, containing Amlodipine or its pharmaceutically acceptable salt and Losartan or its pharmaceutically acceptable salt wherein Amlodipine or its pharmaceutically acceptable salt and Losartan or its pharmaceutically acceptable salt are physically separated from each other, and a method for preparing thereof. The method includes the following stages: a) wet granulation and drying of mixed Amlodipine or its salts and pharmaceutically acceptable excipients to prepare a portion containing Amlodipine granules; and b) mixing of the portion containing Amlodipine granules prepared at the stage a) and pre-mixed Losartan or its salt and pharmaceutically acceptable excipients.

EFFECT: improved preventive and therapeutic effects in cardiovascular disturbances, better stability, solubility, absence of hygroscopicity in making the tablets.

12 cl, 5 dwg, 1 tbl, 15 ex

FIELD: chemistry.

SUBSTANCE: invention relates to novel crystalline modifications of [6-methoxy-5-(2-methoxyphenoxy)-2-pyridin-4-ylpyrimidin-4-yl]amide-5-methylpyridine-2-sulfonic acid, which produces an endothelial antagonistic effect and is suitable for treating diseases associated with abnormal vascular tone and endothelial dysfunction, such as heart failure, pulmonary hypertension etc. The crystalline modification which is denoted modification B is characterised by a powder X-ray diffractogram with characteristic peaks expressed through the d-parametre value (interplanar distance) (Å) obtained on a conventional X-ray powder diffractometre using Cuka radiation: 10.7 (m), 9.4 (m), 8.6 (vs), 8.3 (m), 7.6 (m), 6.7 (m), 6.4 (m), 6.0 (m), 5.69 (m), 5.30 (m), 5.17 (m), 4.95 (vs), 4.76 (m), 4.56 (m), 4.43 (s), 4.13 (vs), 3.80 (s), 3.45 (s), 3.41 (s), 3.37 (s) and 3.03 (m). The invention also relates to crystalline pseudopolymorphous modifications of [6-methoxy-5-(2-methoxyphenoxy)-2-pyridin-4-ylpyrimidin-4-yl]amide-5-methylpyridine-2-sulfonic acid selected from: a) pseudopolymorphous modification, solvate with ethanol, denoted modification D; b) pseudopolymorphous modification, polysolvate with acetone, denoted modification E; c) pseudopolymorphous modification, solvate with tetrahyrofuran, denoted modification F; d) pseudopolymorphous modification, solvate with methanol, denoted modification G; e) pseudopolymorphous modification, solvate with isopropanol, denoted modification H; f) pseudopolymorphous modification, solvate with dichloromethane, denoted modification I; and g) pseudopolymorphous modification, solvate with 2-butanol, denoted modification J. The invention also relates to a method of obtaining crystalline modification B, a pharmaceutical composition and use.

EFFECT: wider field of use of the compounds.

8 cl, 9 dwg, 9 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: invention refers to pharmacology. A solid pharmaceutical dispersion contains bazedoxifene acetate dispersed in a dispersant, and said dispersant contains polyvinylpyrrolidone, poloxamer, polyethylene glycol, or a mixture or copolymer of said substances. The invention refers also to the compositions containing said dispersion, to methods for making the solid pharmaceutical dispersion containing bazedoxifene acetate and the composition and a dosage form containing the solid pharmaceutical dispersion containing bazedoxifene acetate for treatment of a disease or a syndrome associated with oestrogen hunger or excess, a disease or a disorder associated with proliferation or pathological development of endometrial tissues, cholesterol reduction, bone loss inhibition and breast cancer treatment. Besides the invention covers the methods of treating mammals suffering a disease or a syndrome associated with oestrogen hunger or excess, or a disease or a disorder associated with proliferation or pathological development of endometrial tissues, or cholesterol reduction in a mammal, bone loss inhibition in a mammal or breast cancer treatment in a mammal, treatment of one or more vasomotor disorders in postmenopausal women, including the introduction of therapeutically effective amounts of the solid pharmaceutical dispersion, and also to the application of the solid pharmaceutical dispersion containing bazedoxifene acetate for preparing a drug for treatment of a disease or a syndrome associated with oestrogen hunger or excess, a disorder associated with proliferation or pathological development of endometrial tissues, cholesterol reduction, bone loss inhibition and breast cancer treatment.

EFFECT: invention provides higher clinical effectiveness.

38 cl, 6 tbl, 2 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to cardiology and concerns normalising functional responsiveness of cardiovascular system (CVS) in stenocardia function classes I-II. That is ensured by estimating the condition of functional responsiveness of the CVS in psychoemotional load by recording systolic, diastolic, average dynamic pressure. These data are used to evaluate a functional responsiveness index (FRI) before and after load by formula: FRI=(BPav.dyn. × HR)/100 (standard units). The post-load FRI gain by more than 20 standard units requires the administration of lisinopril in a dose 20 mg a day in the morning and metoprolol in a dose 50 mg a day in the morning.

EFFECT: method provides normalising functional responsiveness of the cardiovascular system and higher psychoemotional load tolerance in the given group of patients within two-month therapeutic course.

2 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and the DNA version related to adult hypolactasia. The substance of invention includes a nucleic acid molecule containing the 5'-end part of the intestinal digestive lactase-phlorizin hydrolase (LPH) gene which participates or serves as an indicator of adult hypolactasia. The said nucleic acid molecule is selected from a group consisting of: (a) nucleic acid molecules having the SEQ ID N0:1 sequence or containing it, where the SEQ ID NO:1 sequence and (b) nucleic acid molecules having the SEQ ID NO:2 sequence or containing it, (c) nucleic acid molecules consisting of at least 20 nucleotides whose complementary strand is hybridised in strict conditions with the nucleic acid molecule at point (a) or (b), where the said polynucleotide/or nucleic acid molecule contains a cytosine residue in a position corresponding to position -13910 in the 5'-direction from the LPH gene; and (d) nucleic acid molecules consisting of at least 20 nucleotides whose complementary strand is hybridised in strict conditions with the nucleic acid molecule at point (a) or (b), where the said polynucleotide/nucleic acid molecule contains a guanine residue in a position corresponding to position -22018 in the 5'-direction from the LPH gene.

EFFECT: design of a method of testing presence or predisposition to adult hypolactasia, which is based on SNP analysis, contained in the said nucleic acid molecule.

65 cl, 7 ex, 8 tbl, 9 dwg

Up!