Recombinant plasmid pfastbac-b17r dna containing cowpox virus genome fragment coding alpha/beta-interferon binding protein and bvb17rg baculovirus strain producing soluble alpha/beta-interferon binding protein of cowpox virus

FIELD: medicine.

SUBSTANCE: recombinant plasmid pFastBac-B17R DNA carries a cowpox virus genome fragment. BvB 17RG recombinant baculovirus strain is produced with the use of recombinant plasmid pFastBac-B 17R DNA and deposited in the Microorganism Cultures Collection of the Federal State Research Institution 'State Research Centre for Virology and Biotechnology 'Vector' of Federal Service for Supervision of Consumer Rights Protection and Human Welfare' (FGUN GNC VB 'Vector' of Rospotrebnadzor) under No. V-388, characterised as a producer of a soluble analogue protein of cowpox interferons type 1 cell receptor.

EFFECT: extended spectrum of preparations of new generation.

2 cl, 5 dwg, 8 ex

 

The invention relates to a substance that can modulate exogenous synthesis of α/β-interferon to create drugs for immune or used as a component of the test system to determine the interferon status in norm and pathology, biological samples (blood, tissue), and can be used in medicine and biotechnology, particularly genetic engineering.

Interferons of the I-th type (α - and β-IFN) produced by the cells of warm-blooded animals in response to viral infection [1] and induce the expression of several genes whose products have antiviral activity [2, 3]. In some cases shown promising therapeutic use of interferon-alpha [4-6].

However, the increase of the level of IFNα observed in several autoimmune diseases [7], in the initial stages of development of AIDS [8]; in various diseases of the Central nervous system and multiple sclerosis increases the production of IFNβ [9, 10].

Therefore, the search for substances capable of modulating the effects of IFNα and IFNβ, is of interest for development of new drugs for immune. Candidate for the role of such drugs may be α/βIFN - binding protein orthopoxviruses. This protein can also be used as a component test systems for determination of interferon in biological samples [11].

Known as alogi, presented in [12-14], describing proteins extracted from biological fluids of a person with the ability to bind the interferon of the I-th type (IFN_I).

The closest analogue (prototype) of the proposed technical solution is the interferon-binding protein is the expression product of the gene B18R recombinant strain of vaccinia virus (BOB) Western Reserve [15].

However, vaccinia virus (BOB) non-pathogenic to humans, i.e. has not sufficiently wide host range. It is known that TNF - and complement-binding proteins of orthopoxviruses, despite the high degree of homology ontologica genes differ on the biochemical level, and most of the biological activity of the protein corresponds more pathogenic human virus [16, 17].

The technical result of the invention is to expand the range of drugs (recombinant α/β-interferencecausing proteins) of the new generation, able to modulate exogenous synthesis of α/β-interferon to create drugs for immune, or used as a component test systems to determine the interferon status in norm and pathology.

The problem is solved by creating a recombinant baculovirus - producer soluble analogue cellular interferon receptor I-type (IFN_I-BP) BOK. The first step in created and producer strain is the construction of recombinant plasmid DNA pFastBac-B17R, containing a fragment of the genome BOK that encodes the amino acid sequence of the analogue cellular receptor for interferons of the I-th type. The target plasmid pFastBac-B17R has a size 5913 BP and the molecular weight of 3.85 MDA and consists of:

fragment of the genome BOK strain GRI-90 length of 1161 BP, encoding a protein-similar cell receptor interferon of the I-th type;

- vector plasmid pFastBac [19], length 4752 P.O. providing site-specific transposition of the target DNA fragment into the genome of the baculovirus.

Recombinant baculovirus obtained by site-specific transposition of the target DNA fragment from the donor plasmid pFastBac1-B17R in baculovirus vector (bacmid)in E. coli [19], after infection of insect cells Spodoptera frugiperda line Sf21 produces soluble protein wok strain GRI-90 (INF-BP) is similar to the interferon receptor I-th type.

The claimed recombinant strain wok has a broader host range among animals and in contact with sick animals can cause human disease, and the recombinant strain WWII prototype non-pathogenic for humans. As mentioned above, it is known that TNF - and complement-binding proteins of orthopoxviruses differ on the biochemical level, and most of the biological activity of the protein corresponds more pathogenic human virus [16, 17].

As a fragment GE is Ohm SAI using the DNA fragment length 1161 BP, obtained using polymerase chain reaction. Matrix for the amplification of DNA is wok strain GRI-90. Primers for the amplification of a gene similar to the receptor, INF-gamma SAI have the following structure:

1. 5' CGGGATCCTAGTGCCGTATAATGACGATGA 3'

2. 5' CCCAAGCTTGTATATAAAAATGCATTGTGTA 3'

The structure of the primer 1 and 2 laid the recognition sites of the restriction endonucleases BamHI and HindIIII, respectively. As a plasmid vector, providing site-specific transposition of the target DNA fragment in bacmid pMON14272 [18], using plasmid pFastBac [18], containing baculovirus specific promoter pPolh for protein expression in insect cells, mini-Tn7-transposon, gene resistance to gentamicin Gmrpolylinker for cloning the target gene and the signal for polyadenylation of the virus SV-40. Bacmid pMON14272 contains miscompiles mini-F replicon, a gene for resistance to kanamycin and the DNA fragment encoding the α-peptide of the gene of β-galactosidase of E. coli, and provides α-complementation during the reproduction of the strain E. coli DH10Bac™ in the presence of a chromogenic substrate X-gal and the inducer IPTG.

Selected baculovirus expression system provides a high level of synthesis of the target product and its proper post-translational modification in comparison with other systems of expression.

The essence of the invention is that of genome wok strain GRI-90-PCR is determined by a gene B17R, he then cloned into the donor plasmid pFastBac and by site-specific transposition is constructed recombinant bacmid used for transfection of insect cells, resulting generated recombinant virus BvB17RG expressing the indicated gene. The nucleotide sequence of the embedded portion and encoded them amino acid sequence is shown in figure 1.

The strain is characterized by the following features:

Morphological features. The strain has properties typical representative of baculoviruses, but unlike a virus vector has the phenotype Lac-.

Physiological and biochemical characteristics and cultural properties of the strain. DNA recombinant baculovirus has a length of about 140,000 BP the Presence in its genome of the target insertion length 1161 po confirmed using PCR method. When the reproduction of recombinant baculovirus for the culture of insect cells Spodoptera frugiperda line Sf21 his title does not differ from the titer obtained by multiplication of the virus, not containing in its genome a foreign DNA fragments.

The main difference of the strain is its ability to synthesize infected culture of insect cells line Sf21 protein IFN_I-BP/BOK linking of recombinant interferon α2 (IFNa2B). The level of synthesis of the target protein is 2.5 mg/l of culture liquid is barb infected Sf21 cells.

The resulting strain recombinant baculovirus BV-B17R deposited in the collection of microorganisms fgun "State research center of Virology and biotechnology "Vector" of Rospotrebnadzor number V-388.

The invention is illustrated by the following figures graphics:

Figure 1. The nucleotide sequence of the gene B17R wok (strain GRI-90) [20] and amino acid sequence of the recombinant protein is equivalent cell receptor interferon of the I-th type [GenBank CAD90743]. Bold italics and underlined DNA sequences complementary to the specific primers used for PCR. Unique sites for the restriction enzyme EcoRI highlighted in gray.

Figure 2. Presents physical map of the plasmid pFastBac-B17R. For the first nucleotide plasmids accepted the first nucleotide ministrone region of phage fl; Tn7L, n7R sites embed transposon Tn7; SV40polyA site of SV40 virus polyadenylation; B17R gene IFN_I-binding protein wok strain GRI-90; pPolh - polyhedrin promoter; Ori-the site of replication initiation; Arr, Gmrmarkers of antibiotic resistance.

Figure 3. Given electrophoretic analysis in 1% agarose, PCR fragments containing the gene B17R amplified using specific primers with DNA wok (GRI-90) (lane 1) and with bacmid bMON14272-B17R (lane 2) and BamH/HindIII-hydrolysates recom is anantnag DNA pFastBac and pFastBac-B17R (tracks 3 and 4, respectively). Lane M is DNA marker (100b.p.+1.5 Kb to+3 Kb, NGO "Simanim", Russia).

Figure 4. Presents electrophoretic analysis in 10% SDS page recombinant protein IFNJ_BP/BOK allocated by the method of affinity chromatography from insect cells line Sf-21 (lane 1); lane 2 - M - markers molecular mass proteins (103.7 kDa, 81.1 kDa, 47.7 kDa, 35.8 kDa, 27.1 19.3 kDa and kDa Prestained SDS-PAGE standards, BioRad, USA).

Figure 5. Presents a graph α2-interferon - and deltafire-binding activity of lysates of cells Sf-21 infected with recombinant baculovirus BvB17RG (-o -, and -, respectively) and α2-interferon-binding activity of lysates of cells Sf-21.

For a better understanding of the invention examples of its implementation.

Example 1. The method of amplification of a DNA fragment containing a gene B17R BOK.

Reaction amplification is carried out in Eppendorf tubes under the layer of mineral oil in a volume of 50 μl. The reaction mixture contains 10 mm Tris-HCl pH 8.8, 50 mm KCl, 2.5 mm MgCl2, 0.1% Tween 20, 0.2 mm dATP, 0.2 mm dCTP, 0.2 mm dGTP, 0.2 mm dTTP, oligonucleotide primers in the amount of 40 pmol each, 2 Ada. Tth polymerase, 2-10 ng DNA template. Amplification lead for 20 cycles under the scheme:

The cycle numberTemperature (°C)Time (min)
932 min
531 min
721 min
2-19931 min
531 min
721 min
20931 min
531 min
7210 min

Later in the reaction mixture was added chloroform, select the aqueous phase and transferred into a clean tube. The presence of the amplified product is checked by electrophoresis in 1% agarose gel (figure 3, lane 1).

Example 2. Construction of recombinant plasmid DNA pFastBac-B17R.

5-10 μg of plasmid pFastBac [18] and 1-5 μg of the amplified product corresponding gene B17R BOK, hydrolyzing the restriction endonucleases BamHI and HindIII in standard conditions. The resulting fragments emit electronic what roporta in 1% agarose gel, followed by elution. 0.2 ug of vector and 0.6 μg of the fragment are ligated under standard conditions and received ligase mixture transform competent cells of E. coli strain XL-blue. Cellular Apr-clones grown at 37°C in LB-broth containing 100 μg/ml ampicillin, until the stationary phase. Recombinant plasmid DNA secrete according to standard methods and analyzed using restriction endonucleases BamHI and HindIII. Clones containing an embedded fragment, isolated plasmid DNA, whose structure in the area of building-certify definition nuleotide sequence by the method of termination of the synthesized circuit for automatic sequencing machine AVM PRISM™ 310 (Perkin Elmer, Germany) (figure 1).

Thus obtained target plasmid, physical map of which is presented in figure 2, indicate pFastBac-B17R.

Example 3. Getting backside pMON14272-B17R.

To 100 μl of competent cells of E. coli strain DH10Bac™ add 1 ng of plasmid pFastBac-B17R. The resulting mixture was incubated in ice for 30 min, then at 42° C for 45 sec followed by cooling in ice for 2 minutes, the Reaction mixture was diluted 1:10 in LB-broth and pokasivaut on the rocking chair with intensive aeration at 37° for 4 hours. Next, cells are plated on selective Petri dishes with LB-agar containing 100 μg/ml X-gal, 40 μg/ml IPTG, 50 μg/ml kanamycin, 7 ág/ml gentamicin, 10 μg/ml tetracycline, thermostat is ri 37°C and incourt during the day. Clones with the Lac phenotype-sow in a test tube with 5 ml LB-broth containing 50 μg/ml kanamycin, 7 ág/ml gentamicin, 10 μg/ml tetracycline and grown under intensive aeration at 37° C to stationary phase. The culture is transferred into 1.5 ml Eppendorf tubes, precipitated cells by centrifugation for 40 seconds at 14000g, remove the environment. The process of adding the culture, deposition and removal environment, repeat two more times. Sediment resuspended in 0.3 ml of solution 1 (10 mm EDTA, 15 mm Tris-HCl pH 8.0, 100 μg/ml RNase), add 0.3 ml of solution 2 (0.2 M NaOH, 1% SDS) and incubated at room temperature for 5 minutes. To the mixture slowly add 0.3 ml of solution 3 (3 M KAc pH 5.2). Incubated in ice for 10 minutes. Centrifuged at 14000 rpm for 10 minutes. The supernatant transferred to a clean tube, add 0.8 ml of isopropanol, stirred and cooled at -20°C for 5 minutes, then precipitated at 14000 rpm for 15 minutes. The precipitate is washed two times with ethanol, dried, dissolved in 40 μl of buffer TE. The presence in the genome backside integrated DNA fragment confirmed by PCR (Figure 3, lane 2). Received backmenu DNA pMON14272-B17R used for transfection of insect cells line Sf21.

Example 4. Transfection of Sf21 insect cells recombinant backmenu DNA pMON14272-B17R and receiving recombinant virus BvB17RG.

The Sf21 cells seeded in wells of a 6-hole tablet based, so the next day was the monolayer (2×10 6cells/well)in 2 ml of medium Grays, containing 10% fetal cow serum (ECS) (OOO Biolot", Russia). The next day, prepare two solutions: 10 μl of viral DNA + 100 ál of medium Grays and 6 μl of CellFECTIN reagent (" LifeTechnologies, USA) + 100 ál environment of Grace. The solutions are mixed, incubated at room temperature for 25 minutes. At this time, wash the monolayer cells twice with medium Grays. To the cells was added 0.8 ml/well of medium Grays and 200 μl of the prepared solution. Incubate cells at 28°C for 5 hours After that, select the environment and add to the cells in 2 ml medium Grace with 10% ESK. Cells incubated at 28°C for 2-5 days. The cells resuspended (intensive pipetting), centrifuged 5 min at 5000 rpm and the clear supernatant Packed in sterile tubes. The titer of the virus is determined as follows. The monolayer cells Sf21 add 200 ál of dilution of the virus and carry out adsorption for 60 minutes at room temperature. Next, prepare a 2% low-melting the agarose (Sigma, USA) and mix it in molten form with the environment of Grace (10% ESC) in a 1:1 ratio. The resulting medium is cooled in an incubator to 37°C and add 2 ml per well, and after hardening, add 2 ml per well of medium Grace with 10% ESK. Incubated in an incubator at 28°C for 5 days. Next, add 2 ml per well of the dye neutral red (0,% aqueous solution), dissolved in an environment of Grace with 10% of the ESK, in the ratio of 1:20. Incubated at 28°C during the day. The titer is determined by counting stained plaques. The last is 107PFU/ml Suspension of recombinant virus titrated and stored at -20°C.

Example 5. Infection of Sf21 insect cells with the recombinant virus.

200 ál of thawed viral material with a titer of 107put on a monolayer of Sf21 insect cells in the mattress for the cultivation volume of 250 ml is Incubated for 30 min at room temperature. After incubation, add 25 ml of medium Grace with 10% ESK. Incubated at 28°C for 2-3 days. The cells resuspended intensive pipetting and centrifuged. The clarified supernatant is used for selection of the expression product of the gene B17R BOK in insect cells by the method of affinity chromatography.

Example 6. The separation by affinity chromatography protein IFN_I-BP/BOK - product of gene expression B17R wok in insect cells.

For preparation of affinity media 1 g of CNBr-activated sepharose 4B (Sigma, USA) was washed on a glass filter 3 mm HCl and resuspending 3.5 ml of 50 mm sodium bicarbonate buffer (pH 8.0)containing recombinant α2-interferon (fsri SRC VB "Vector", Russia, [20]). Immobilization of interferon spend 18 hours at a temperature of 5°C with gentle stirring. The obtained suspension fills the Alonso 0.5×4 cm washed it 10 ml of 0.2 M glycine-HCl (pH 2.5), and balance 10 mm Tris-HCl (pH 8.0). 200 ml of the clarified supernatant of cell line Sf21 infected with recombinant baculovirus, put on the prepared column α2-interferon-separate. The column was washed with 30 ml buffer (10 mm Tris-HCl, pH 6.0). Recombinant protein IFN_I-BP/BOK elute from the column with buffer containing 0.2 M glycine-HCl (pH 2,5). All operations are performed at a temperature of 8°C and the rate of elution of 4 ml/hour. The volume fractions during elution is 2.5 ml Detection of the target product are carried out spectrophotometrically on a spectrophotometer "Perlin-Elmer 550 (Germany), and then electrophoretic analysis of the fractions by the method of Lemli [21] (Figure 4). The yield of the target product IFN_I-BP/BOK is 2.5 mg from 200 ml of clarified lysate. The obtained recombinant protein is used to produce polyclonal antibodies.

Example 7. Obtaining polyclonal antibodies to recombinant protein IFN_I-BP/SAI.

To obtain polyclonal antibodies spend 3x the immunization of outbred rabbits weighing 2-3 kg by subcutaneous injection in the back area of the obtained recombinant protein. At the first introduction of the antigen emuleret in complete Freund's adjuvant (Sigma, USA), with a subsequent immunizations at intervals of 7 days to introduce the antigen in saline. One week after the last injection the animals OTB is given blood from the marginal vein of the ear and separate the serum. Immunoglobulins from the serum of a rabbit 3x vymalivayut ammonium sulfate at finite saturation of 33%.

Example 8. Determination of interferon-binding activity of the expression product of the gene B17R by the method of enzyme-linked immunosorbent assay.

In wells of 96-well polystyrene plate contribute to the adsorption of 100 μl of a solution α2-interferon or analogue of gamma-interferon - deltafina [22] (both cytokine production fsri SRC VB "Vector", Russia) in 50 mm sodium bicarbonate (concentration of interferon 2 μg/ml) and incubated for 18-20 hours at a temperature of 8°C. Then the wells are washed with buffer B (10 mm potassium phosphate, pH 7.4, containing 0.8% NaCl and 0.05% tween-20). After removing the contents of the tablet to suppress non-specific binding to the wells contribute 0.1% of BSA (Sigma, USA) in buffer and incubated at room temperature for 2 hours, then removing the solution from the wells by aspiration. In wells contribute 100 ál of different breeding clarified supernatants uninfected and infected with recombinant baculovirus BV-B17R Sf21 cells. For the preparation of breeding used by 0.1% BSA in buffer C. the Tablet incubated 18 h at 8°C. After three times washing with buffer B in wells contribute 100 ál of polyclonal antisera to recombinant protein IFN_I-BP/BOK, diluted in 0.1% BSA in the buffer in the ratio of 1:10000. Tablet Inc. is berout 18 h at 8°C. After triple washing with buffer B to each well make 100 ál of working solution of protein a conjugate with horseradish peroxidase (Sigma, USA), incubated 2 hours at room temperature. After incubation, the wells washed three times with buffer B, then in every hole making 100 ál of freshly prepared 0,04% solution of o-phenylenediamine (Sigma, USA) in 25 mm citrate-phosphate buffer (pH 4.5)containing 0.012% hydrogen peroxide. The tablet is incubated for 30 min at room temperature protected from light. The reaction is stopped by adding 100 μl/well of 1 M HCl. The results of enzyme immunoassay register by measuring the optical density at a wavelength of 495 nm on the device Microplate Reader ELX808 (BIO-TEK INSTRUMENTS, INC, USA) (Figure 5).

Thus, the resulting recombinant baculovirus BvB17RG providing gene expression B17R smallpox cows strain GRI-90 - analogue of the gene cell receptor interferon of the I-th type in insect cells line Sf21. The resulting strain can be used to produce recombinant protein IFN_I-BP/BOK, which, in turn, can be used to develop drugs that can modulate exogenous interferon synthesis, or new domestic test systems to determine the interferon status in norm and pathology.

1. Recombinant plasmid DNA pFastBac-17R intended for transposition into baculovirus and bearing a fragment of the genome of smallpox cows that encodes a soluble protein similar cell receptor interferon 1st type, molecular weight of 3.85 MD and size 5745 gel containing
RPS-fragment of the genome of smallpox cows strain GRI-90 containing the gene Into 17R, obtained using primers
1) 5' CGGGATCCTAGTGCCGTATAATGACGATGA 3',
2) 5' CCCAAGCTTGTATATAAAAATGCATTGTGTA 3',
encodes a protein similar cell receptor interferon 1st type, flanked by recognition sites of the restriction endonucleases BamHI and HindIII, size 1073 P.N.;
BamHI - HindII fragment of the vector plasmid pFastBac size 4672 P.N., including baculovirus promoter pPolh, mini TP-transposon and the signal for polyadenylation of the virus SV-40, providing site-specific transposition DNA gene 17R into the genome of the baculovirus;
genetic markers:
gene bla (β-lactamase), which determines resistance to ampicillin, and Gm generdetermining the resistance to gentamicin, transformation of E.coli;
unique restriction sites:
BamHI (4032);
HindIII(5105);
EcoRI(4133;4550).

2. The strain of recombinant baculovirus BvB17RG obtained using the recombinant plasmid DNA pFastBac-B17R according to claim 1, deposited in the culture collection of microorganisms fsri SRC VB "Vector" Rospotrebnadzor the while V-388, producing soluble protein analog cellular interferon receptor 1-type smallpox of the cow.



 

Same patents:

FIELD: medicine.

SUBSTANCE: viral particle consists of non-alphavirus structural elements and contains an alphavirus vector replication-defective by deletion or substitution by at least one transgene. Besides said particle contains structural elements not coded by an alphavirus vector genome. A method for preparing said particle according to the invention implies the expression in trans of the genes coding the non-alphavirus structural elements, and the alphavirus vector, in a cell line and then recovery of the viral particles found in the cell culture supernatant.

EFFECT: invention allows preparing the viral particles with lower recombination risk.

24 cl, 5 dwg, 3 tbl, 2 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology. Recombinant adenovirus expresses a protein selected from a group comprising E1B and E4 proteins and their combination, and then a second protein which is E1A. Recombinant adenovirus consists of an expression cassette which codes E1B and E4 proteins under the control of a promoter which is different from the promoter which regulates expression in the wild type adenovirus. The recombinant adenovirus optionally contains nucleic acid which codes YB-1, expression cassettes which contain promoters and nucleic acids which code different genes. Disclosed also is a nucleic acid which codes such a recombinant adenovirus and use thereof.

EFFECT: recombinant adenovirus can be used in medicine for treating tumoural diseases.

30 cl, 26 dwg, 19 ex

FIELD: medicine.

SUBSTANCE: recombinant virus containing human gene p53, its application, manufacture method and pharmaceutical composition are offered.

EFFECT: invention can be used for gene therapy in human malignant neoplasm treatment and prevention.

8 cl, 14 dwg, 7 ex

FIELD: medicine.

SUBSTANCE: invention is related to preparation of protein, binding tumour necrosis factor (TNF), and may be used in medicine. Strain-producer of baculovirus BvG2RIgG is created with the help of recombinant plasmid DNA pFastBac-G2R-IgG with size of 6444 p.n. and molecular mass 4.18 mDa, which bears fragment of smallpox virus genome of strain India-1967, which codes protein that binds TNF, and fragment of human genome, which codes fragment of heavy chain of human antibody G. Produced strain produces soluble chimeric protein, which consists of smallpoz virus protein, which binds TNF, and fragment of heavy chain of human antibody G.

EFFECT: wider spectrum of new generation preparations intended for treatment of human diseases related to hyperproduction of tumour necrosis factor.

2 cl, 3 dwg, 1 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention concerns medicine and biotechnology. There is disclosed application of coding DNA for making virus-like particles of hepatitis C virus, as well as the method for making the specified particles and a pharmaceutical composition using the same. The virus-like particles cause induction of interferon system in vivo.

EFFECT: invention can be used for making a preparation for prevention and treatment of the HCV-related conditions, as well as diagnostics thereof.

5 cl, 4 dwg, 1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention claims synthetic DNS molecule encoding L1 HPV58 protein, where codons are optimised for high expression level in yeast cell. Also invention claims expression vector, yeast host cell, HPV58 virus-like particle and method of its obtainment, and pharmaceutical composition including such VLP.

EFFECT: invention can be applied in medicine for efficient immune prevention of papillomavirus infection by neutralising antibodies and cell-mediated immunity, and for treatment of developed HPV infections.

10 cl, 10 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: invention concerns virology and medicine area. The synthetic DNA-molecule coding protein L1 HPV45 is presented. Thus DNA-molecule was Codonum-optimised for high-level protein expression in a yeast cell. The given synthetic molecules can be used for reception of virus-like particles (VLP) HPV45 and for reception of vaccines and the pharmaceutical compositions containing VLP-particles HPV45.

EFFECT: effective immunologic prophylaxis of infections with papilloma virus due to neutralised antibodies and cellular immunity.

9 cl, 6 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: there are offered recombinant protein molecule M2E-HBC, and virus-like particles formed of such molecules. The recombinant virus-like particle based on nuclear antigen of hepatitis B virus represents surface polypeptides of outer domain M2 of avian influenza virus protein. The produced virus-like particles are characterised with high immunogenicity. There is also disclosed vaccine for the infection caused by avian influenza virus, including such virus-like particles as an active agent.

EFFECT: preparations are active to various strains of avian influenza virus and can be considered as a candidate for universal avian influenza virus type A vaccine.

7 cl, 8 dwg, 4 tbl, 8 ex

FIELD: biology, genetic engineering.

SUBSTANCE: invention concerns molecular biology and genetic engineering. Invention claims synthetic DNA molecule encoding HPV31 L1 protein, virus-like HPV31 particles, vaccine and pharmaceutical composition including virus-like HPV31 particles.

EFFECT: papilloma virus therapy.

17 cl, 6 dwg, 8 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: invention relates to virology and genetic engineering. Claimed is recombinant virus of fowl pox, inducing immune response against hepatitis C (HCV) virus, containing DNA-fragment obtained from HCV. Said DNA-fragment codes fragment core-E1 polyprotein or chimeric protein, containing HCV epitopes, specific to helper and cytotoxic T-cells. Also claimed is pharmaceutical composition containing such virus.

EFFECT: invention can be used in medicine.

9 cl, 8 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: there are offered versions of an angiopoietin-2 (Ang-2) specific antibody and a pharmaceutical antibody composition for treatment of various diseases associated with angiopoietin-2 overexpression. Also there are described methods of inhibition, modulation and treatment of various diseases mediated by angiopoietin-2 activity. There are offered: coding nucleic acid, an expression vector and a vector-transformed cell, as well as a method for producing antibodies.

EFFECT: use of the invention ensures new high-cytotoxicity antibodies (according to ELISA analysis IC50=0,35 nM) comparable with a common antibody Ab536 that further can find application in medicine.

22 cl, 2 dwg, 11 tbl, 6 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and specifically to obtaining versions of glycoprotein IV alpha polypeptide of human thrombocytes (GPIbalpha) and can be used in medicine to treat vascular disorders. Using a recombinant technique, a polypeptide is obtained, which contains substitutes in SEQ ID NO:2 selected from: Y276F K237V C65S; K237V C65S; Y276F C65S; or Y276F Y278F Y279F K237V C65S. The obtained polypeptide is used to inhibit bonding of leucocytes to biological tissue or for treating disorders associated with activation of thrombocytes.

EFFECT: invention enables to obtain GPIbalpha polypeptide which bonds with von Willebrand factor with affinity which is at least 10 times higher than in natural GPIbα polypeptide, and also has low affinity for bonding with alpha-thrombin, lower aggregation and/or high resistance to proteolysis relative the polypeptide with SEQ ID NO:2.

41 cl, 3 dwg, 8 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: to obtain microbe-resistant plants plant cells are transformed with vector, which contains polynucleotide structure, which codes defensin polypeptide, which has amino-acid sequence C-x (3)-C-x (7, 9)-C-C, C-C-(8)-C-x-C and C-x-C-x (8, 11)- C.

EFFECT: obtaining polypeptide, which can be also applied as drug or veterinary medication, as well as in forage for animals.

23 cl, 4 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: there is claimed isolated human antibody or its fragment, which binds to human EGFR. Antibody contains corresponding CDR areas of light and heavy chain. Its conjugate with anti-neoplastic means or marker is described. Also described are: coding nucleic acid, expression vector, recombinant cell-host for obtaining antibodies and method of inhibiting growth of tumor, expressing EGFR on the basis of antibody.

EFFECT: application of invention provides antibodies with affinity comparable or higher, than in IMC-C225, which neutralises EGFR activation, what can be applied in medicine for treatment of tumours.

36 cl, 14 dwg, 6 tbl, 13 ex

FIELD: medicine.

SUBSTANCE: invention represents mutant photoprotein for determining intracellular calcium simultaneously in different cell organelles, which possesses light0emitting function and is characterised by amino acid sequence of wild type calcium-regulated photoprotein, in which natural residues of phenylalanine, related to conservative regions of said sequence and corresponding to residue 119 of photoprotein obelin Obelia longissima, as well as to residue 88 of obelin Obelia longissima, are substituted with other residues, different from phenylalanine, substitution of which results in the reduction of sensitivity of calcium-regulated photoprotein to calcium ions in comparison with wild type photoprotein and change of emitted light wavelength in comparison with wild type photoprotein. Invention also relates to one more mutant protein, which has substitution in position 144 of photoprotein obelin Obelia longissima. Invention also relates to DNA, which codes said proteins, as well as to vectors for expression of proteins.

EFFECT: invention allows to obtain novel forms of photoprotein with changed sensitivity to calcium and changes wavelength of emitted light.

13 cl, 5 dwg, 4 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to immunology and biotechnology. The invention discloses versions of a cytotoxically active CD3-specific binding structure. The structure comprises a first domain specifically binding to human CD3 and an Ig-derived second binding domain which is specific to molecules on the cell surface. The invention describes a coding nucleic acid, a vector for expressing the structure and an eukaryotic cell transformed by the vector. The invention discloses versions of compositions based on the structure for treating, preventing or alleviating various diseases and corresponding methods of treating the diseases. A method of obtaining the structure is disclosed.

EFFECT: use of the invention provides a structure with low immunological potency, which has cytotoxicity comparable to the initial structure, which may find further use in medicine.

60 cl, 18 dwg, 15 tbl, 8 ex

FIELD: chemistry.

SUBSTANCE: invention relates to anti-M-CSF-specific antibodies based on RX1 or originating from RX1, and which more than 785% compete with monoclonal antibodies RX1, MC1 and/or MC3 for bonding with M-CSF (macrophagal colony-stimulating factor). The non-mouse antibody is two-stranded, contains a certain amino acid sequence (given in the formula of invention and list of sequences) and retains high affinity towards M-CSF. The invention discloses an isolated nucleic acid which codes the said antibody, an expression vector, a host cell and a method of producing the anti-M-CSF-antibody using a host cell or hybridome, particularly ATCC PTA-6263 or ATCC PTA-6264 hybridome. The invention describes a pharmaceutical composition containing said antibodies, sets containing pharmaceutical compositions and methods of preventing and treating osteoporosis in a person suffering from an osteolytic disease.

EFFECT: disclosed antibodies can inhibit osteoclast differentiation, which facilitates their use as highly effective preparations for treating osteolysis, cancer with metastases and osteoporosis associated with cancer metastases.

131 cl, 44 dwg, 12 tbl, 16 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to genetic engineering and can be used to optimise expression of the antigen protein of the human epidermal growth factor-2 (HER2/neu). To obtain the HER2/neu protein, a nucleic acid synthetic molecule is used, which is codon-optimised for high level of expression of the said protein in a human cell.

EFFECT: invention increases production of the recombinant HER2/neu protein during expression in human cells.

8 cl, 10 dwg, 14 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to a novel fluorescent protein from Entacmaea quadricolor and its functional mutants. The invention discloses nucleic acids which code the said protein, a vector which contains the said nucleic acids, a transgenic cell which carries the vector and a method of obtaining the said fluorescent proteins from transgenic cells. The composition of the said proteins and nucleic acids can be used in various applications and methods, particularly for labelling biomolecules, cells or cell organelles. The disclosed protein and nucleotide sequences can be used for testing activity of promoters under various conditions.

EFFECT: obtaining proteins with primarily red or far-red fluorescence.

7 cl, 7 dwg, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to immunology and biotechnology. The invention discloses a monomer single-strand V93 nanoantibody which can bind and inhibit the human vascular endothelial growth factor. The invention describes a nucleotide sequence which codes the V93 nanoantibody and its expression vector with extra epitope(s) on the C-end for detection and extraction and a signal peptide on the N-end. The invention discloses a method of obtaining the V93 nanoantibody, a method of inhibiting proliferation of endothelial cells using the V93 nanoantibody, as well as use of the V93 nanoantibody for qualitative and quantitative determination of VEGF in a sample.

EFFECT: use of the invention provides high-affinity neutralising monovalent single-strand nanoantibodies which are more resistant to external factors (temperature, pH) and cheaper to produce compared to conventional VEGF antibodies, which can be useful in medicine for treating and diagnosing diseases associated with regulation of the activity of the vascular endothelial growth factor (VEGF).

7 cl, 7 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: invention relates to protein analogues of interferon-β, in which asparagine in position 25, in accordance with numeration of amino acids in native interferon-β, is deamidated, and cysteine in position 17, in accordance with numeration of amino acids in native interferon-β, is deleted or substituted with neutral amino acid, which demonstrate higher levels of biological activity of native human interferon-β and do not require HA for protein stabilisation. Deamidated product id suitable for wide-scale production for introduction into HA-containing or HA-non-containing therapeutic medications for treatment of diseases including disseminates sclerosis. Also claimed is method of peptide mapping by means of endoproteinase-C, which gives chromatographic profile of proteins with use of enzymatic breakdown with further RP-HPLC, is suitable for quality control as ID and/or quantitative test of deamidated products.

EFFECT: improvement of biological properties.

21 cl, 16 dwg, 6 tbl

Up!