Method of measuring resistance and sensitivity to docetaxel

FIELD: medicine.

SUBSTANCE: essence of invention includes selection of sample for testing from area of malignant affection in patient, suffering from cancer of large intestine, selection of control sample, measurement of the level of one or several genetic markers, selected from the group, comparison of measured levels in experimental samples with control ones. Reducing of levels of one or several genetic markers in comparison with control sample, indicates increased resistance to docetaxel. Also described are sets which allow to predict or realise monitoring of patient's response to docetaxel.

EFFECT: identification of genetic markers, by which it is possible to realise patient's response to chemical therapy by docetaxel.

18 cl, 9 ex, 3 tbl, 16 dwg

 

The SCOPE of the INVENTION

The present invention relates to new and useful and is still not well-known methods that can predict or monitor a patient's response to molecules takayanagi family by measuring the increase or decrease of specific genetic markers compared to control. The present invention also provides kits that allow you to predict or monitor the patient's response to a molecule takayanagi family through changes in the level of nucleic acid or protein for specific genetic markers and comparison of their levels of control or a control token.

BACKGROUND of the INVENTION

Docetaxel belongs to antimitoticescoy drugs widely used to treat breast cancer, lung and ovaries and to a lesser extent used for the treatment of carcinomas of the head and neck, and stomach, and prostate (Hong,Oncology16:9, 2002). Docetaxel inhibits the dynamics of microcannulas by binding to beta-tubulin and preventing the separation of heterodimeric alpha - and beta-tubulin, thereby inhibiting tumor growth (Ringel and Horwitz,J Natl Cancer Inst83:288, 1991). The antitumor activity of docetaxel and related taxane of paclitaxel occurs as a result of their actions at the micro canals mitotic wants is a, in order to prevent the building and the splitting of the chromosomes, to block the cell division cycle and activate the pathway of apoptosis (Wanget al.,Cancer88:2619, 2000). Proapoptotic activity of paclitaxel was associated with the phosphorylation and inactivation of Bcl-2 through the processes of cell signaling, which include p53/p21waf1/Cip1, raf/ras and mitogen-activated protein kinase (MAPK) (Wanget al.,Cancer88:2619, 2000). Although docetaxel is more powerful anticancer drug than paclitaxel, mechanism of cytotoxicity is determined less accurately (Katsumata,Br J Cancer89:S9, 2003). Caused by docetaxel apoptosis was observed in the sample cell lines by a mechanism involving phosphorylation of Bcl-2 and activation of caspase-3 (Kolfschotenet al.,Biochem Pharmacol63:733, 2002). Other proteins that modulate induced taxonomy destruction of cells in various cultured lines include Aurora-A in HeLa cells (Anandet al.,Cancer Cell3:51, 2003), HER-2 in breast cancer cells (Tanabeet al.,Int J Oncol22:875, 2003), p21waf1/Cip1 in glioblastoma cells (Liet al.,J Biol Chem277:11352, 2002) and JNK/MKK1 in ovarian cancer cells (Leeet al.,J Biol Chem273:28253, 1998).

In this area, there remains a need to identify proteins that mediate resistance to docetaxel and can be used as drugs that could privest is to their application to drug development, in order to find the chemicals (small molecules, miRNAs and other), which interfere with their function in vivo and potentially sensibiliser cells to anticancer drug treatment. Saved and need in this area in the analysis, which could with high reliability, to chemotherapeutic treatment, to predict patients who will and who will not respond to anticancer chemotherapy on the basis of docetaxel. In this document, the applicants describe a new analysis, which allows to predict resistance or sensitivity to docetaxel, and lead screening methods of analysis to develop new approaches to therapy, excluding drug resistance in the treatment of cancer.

BRIEF description of the INVENTION

In accordance with the present invention are useful and it is still not known methods of monitoring and/or predicting a patient's response to molecules takayanagi family through a comparison of the levels of activation and/or expression of specific genetic markers in patients and control group.

In one of the embodiments of the present invention provides a method for predicting or monitoring the response of cancer patient molecule takayanagi family, which includes the following stages:

a) from the PR sample for testing from the field of malignant lesions in the patient;

b) selection of the control sample;

c) measuring the level of one or more genetic markers and

(d) comparison of measured levels mentioned one or more genetic markers in a sample for test and control sample;

while reducing mentioned one or more genetic markers measured in the sample for testing, compared with the control sample indicates an increased resistance to the molecule takayanagi collection.

Specific genetic markers provided in this aspect of the present invention include:

BubR1, mRNA Homo sapiens similar to protein kinase (BUBR1), full code (catalog number GenBank: AF046079);

Mad2, mRNA Homo sapiens protein MAD2 (catalog number GenBank: AJ000186);

Mps1, mRNA Homo sapiens protein kinase TTK (TTK) (catalog number GenBank: NM_003318);

GEFT for Rac1/CDC42, the exchange factor Homo sapiens RAC/CDC42 (GEFT), transcript variant 2, mRNA (catalog number GenBank: NM_133483);

Bub1, homolog 1 (yeast) [Homo sapiens BUB1 budding, eingeborenen-benzimidazole (BUB1), mRNA (catalog number GenBank: NM_004336);

hSepharase, extra spindle poles like 1 Homo sapiens (S. cerevisiae) (ESPL1), mRNA (catalog number GenBank: NM_012291);

CamKIId, calcium/calmodulin-dependent protein kinase (CaM kinase) II Delta (CAMK2D), transcript variant 3, mRNA (catalog number GenBank: NM_001221);

CDK6, cyclin-dependent is inasa 6 (CDK6), mRNA (catalog number GenBank: NM_001259); and

GRB2, growth factor Homo sapiens protein 2 associated with the receptor (GRB2), transcript variant 1, mRNA (catalog number GenBank: NM_002086).

In another embodiment, the present invention relates to a method for predicting or monitoring the response of cancer patient molecule takayanagi family, which includes the following stages:

a) selection of sample for testing from the field of malignant lesions in this patient;

b) selection of the control sample;

c) measuring the level of one or more genetic markers and

(d) comparison of measured levels mentioned one or more genetic markers in a sample for test and control sample;

while reducing mentioned one or more genetic markers measured in the sample for testing, compared with the control sample indicates an increased sensitivity to the molecule takayanagi collection.

This aspect of the invention, one or more genetic markers can be selected from a group including:

P21(Waf1), an inhibitor of cyclin-dependent kinase 1A Homo sapiens (p21, Cip1) (CDKN1A), transcript variant 1, mRNA (catalog number GenBank: NM_000389);

Pim-1, pim-1 oncogene Homo sapiens (PIM1), mRNA (catalog number GenBank: NM_002648); GBP-1, guanylate-binding protein 1 Homo sapiens, ind the dummy interferon, 67 kDa (GBP 1), mRNA (catalog number GenBank: NM_002053);

RXRA, retinoid X-receptor Homo sapiens, alpha (RXRA), mRNA (catalog number GenBank: NM_002957);

SPF45 protein 17 with RNA-binding motif Homo sapiens (RBM17), mRNA (catalog number GenBank: NM_032905);

Hec1 associated with centromeres 2 Homo sapiens (KNTC2), mRNA (catalog number GenBank: NM_006101);

Raf1, human mRNA for raf oncogene (catalog number GenBank: X03484);

Aurora A kinase 1 family beautiful Aurora Homo sapiens (ARK1), mRNA, complete code (catalog number GenBank: AF008551);

TACC3, transforming acidic bipedally protein 3 [Homo sapiens (TACC3), mRNA (catalog number GenBank: NM_006342);

RelB, a homologue of the viral oncogene of reticuloendotheliosis v-rel Homo sapiens nuclear factor gene enhancer light chain polypeptide Kappa in b-cells 3 (birds) (RELB), mRNA (catalog number GenBank: NM_006509);

PRKCD, Homo sapiens protein kinase C, Delta (PRKCD), transcript variant 1, mRNA (catalog number GenBank: NM_006254);

BRAF35, high-mobility group Homo sapiens 20B (HMG20B), mRNA (catalog number GenBank: NM_006339);

HSPA1L, heat shock protein 70 kDa 1A Homo sapiens (HSPA1A), mRNA (catalog number GenBank: NM_005345);

STK11, serine-trionychinae 11 Homo sapiens (polyposis intestines II) (STK11), mRNA (catalog number GenBank: NM_000455); and

MKK3, MAP kinase kinase 3 [Homo sapiens (MKK3), mRNA, complete code (catalog number GenBank: L36719).

In yet another embodiment, the present invention relates to a method for predicting or monitoring the response on Oncology is formed of a patient molecule takayanagi family, includes the following stages:

a) selection of sample for testing from the field of malignant lesions in this patient;

b) measuring the level of one or more genetic markers selected from the group consisting of:

BubR1, mRNA Homo sapiens similar to protein kinase (BUBR1), full code (catalog number GenBank: AF046079);

Mad2, mRNA Homo sapiens protein MAD2 (catalog number GenBank: AJ000186);

Mps1, mRNA Homo sapiens protein kinase TTK (TTK) (catalog number GenBank: NM_003318);

GEFT for Rac1/CDC42, the exchange factor Homo sapiens RAC/CDC42 (GEFT), transcript variant 2, mRNA (catalog number GenBank: NM_133483);

Bub1, homolog 1 (yeast) [Homo sapiens BUB1 budding, eingeborenen-benzimidazole (BUB1), mRNA (catalog number GenBank: NM_004336);

hSepharase, extra spindle poles like 1 Homo sapiens (S. cerevisiae) (ESPL1), mRNA (catalog number GenBank: NM_012291);

CamKIId, calcium/calmodulin-dependent protein kinase (CaM kinase) II Delta (CAMK2D), transcript variant 3, mRNA (catalog number GenBank: NM_001221);

CDK6, cyclin-dependent kinase 6 (CDK6), mRNA (catalog number GenBank: NM_001259); and

GRB2, growth factor Homo sapiens protein 2 associated with the receptor (GRB2), transcript variant 1, mRNA (catalog number GenBank: NM_002086).

c) measuring the level of one or more of the control of genetic markers selected from the group consisting of:

GAPDH, glyceraldehyde-3-phosphatedehydrogenase Homo sapiens (this causes), mRNA (catalog number GenBak: NM_002046); and

RPS9, the cDNA clone Homo sapiens IMAGE:6647283, partial code (catalog number: BC071941);

(d) comparison of measured levels mentioned one or more genetic markers and mentioned one or more of the control of genetic markers in the sample for testing;

while reducing mentioned one or more genetic markers in comparison with the level of one or more control genetic markers indicates an increased resistance to the molecule takayanagi collection.

In yet another embodiment, the present invention relates to a method for predicting or monitoring the response of cancer patient molecule takayanagi family, which includes the following stages:

a) selection of sample for testing from the field of malignant lesions in this patient

b) measuring the level of one or more genetic markers selected from the group consisting of:

P21(Waf1), an inhibitor of cyclin-dependent kinase 1A Homo sapiens (p21, Cip1) (CDKN1A), transcript variant 1, mRNA (catalog number GenBank: NM_000389);

Pim-1, pim-1 oncogene Homo sapiens (PIM1), mRNA (catalog number GenBank: NM_002648);

GBP-1, guanylate-binding protein 1 Homo sapiens induced by interferon, 67 kDa (GBP 1), mRNA (catalog number GenBank: NM_002053);

RXRA, retinoid X-receptor Homo sapiens, alpha (RXRA), mRNA (catalog number GenBank: NM_02957);

SPF45 protein 17 with RNA-binding motif Homo sapiens (RBM17), mRNA (catalog number GenBank: NM_032905);

Hec1 associated with centromeres 2 Homo sapiens (KNTC2), mRNA (catalog number GenBank: NM_006101);

Raf1, human mRNA for raf oncogene (catalog number GenBank: X03484);

Aurora A kinase 1 family beautiful Aurora Homo sapiens (ARK1), mRNA, complete code (catalog number GenBank: AF008551);

TACC3, transforming acidic bipedally protein 3 [Homo sapiens (TACC3), mRNA (catalog number GenBank: NM_006342);

RelB, a homologue of the viral oncogene of reticuloendotheliosis v-rel Homo sapiens nuclear factor gene enhancer light chain polypeptide Kappa in b-cells 3 (birds) (RELB), mRNA (catalog number GenBank: NM_006509);

PRKCD, Homo sapiens protein kinase C, Delta (PRKCD), transcript variant 1, mRNA (catalog number GenBank: NM_006254);

BRAF35, high-mobility group Homo sapiens 20B (HMG20B), mRNA (catalog number GenBank: NM_006339);

HSPA1L, heat shock protein 70 kDa 1A Homo sapiens (HSPA1A), mRNA (catalog number GenBank: NM_005345);

STK11, serine-trionychinae 11 Homo sapiens (polyposis intestines II) (STK11), mRNA (catalog number GenBank: NM_000455) and

MKK3, MAP kinase kinase 3 [Homo sapiens (MKK3), mRNA, complete code (catalog number GenBank: L36719).

c) measuring the level of one or more of the control of genetic markers selected from the group consisting of:

GAPDH, glyceraldehyde-3-phosphatedehydrogenase Homo sapiens (this causes), mRNA (catalog number GenBank: NM_002046); and

RPS9, the cDNA clone Homo sapiens IMAGE:6647283, partial to the d (catalog number: BC071941);

(d) comparison of measured levels mentioned one or more genetic markers and mentioned one or more of the control of genetic markers in the sample for testing;

while reducing mentioned one or more genetic markers in comparison with the level of one or more control genetic markers indicates high sensitivity molecule takayanagi collection.

The present invention relates to methods for predicting or monitoring the response of cancer patient molecule takayanagi family. Thus, another application of the present invention includes molecules takayanagi family - paclitaxel, docetaxel XRP9881 and XRP6258.

The genetic markers described in this invention can be assessed by measuring the levels of RNA, DNA or protein using a variety of methods, which are described in detail below. Other applications of the present invention relate to kits for predicting or monitoring the response of cancer patient molecule takayanagi collection.

The above aspects and other aspects, features and advantages of the present invention will be better understood from the subsequent detailed description considered in conjunction with the accompanying drawings which.

BRIEF DESCRIPTION of DRAWINGS

Figure 1 presents the characteristics of the genes, a decrease in functional activity which provides resistance to docetaxel. Obtained in the presence of docetaxel dose dependence curves are given for HCT116 cells, transfected miRNAs RB1, BubR1, Mad2 and Mps1 (shaded squares), compared with the control siRNA (where there's no shading squares). RB1 was an example of miRNAs, which gave no results at screening. Cell viability was measured by the absorption at 450 nm after addition of WST-1. The minimum ratio (MR) is the value of WST-1 gene compared to the control at 40 nm of docetaxel.

Figure 2 contains curves dose-response relationships for short RNA hairpins BubR1 and Mps1 (shaded squares) compared to control short RNA hairpin (where there's no shading squares).

Figure 3 presents the results of the analysis of PCR TaqMan real-time levels of the endogenous BubR1 and Mps1 in cells containing a short RNA hairpin BubR1 and Mps1, respectively.

Figure 4 shows the viability and morphology of cells, demonstrated for HCT116 cells, transfected miRNAs Mad2, BubR1 and Mps1 handling docetaxel in his absence. Twenty-four hours after transfection cells were left untreated (-docetaxel) or processed is ü 200 nm of docetaxel (+docetaxel) and was painted Calcein-AM for visualization of living cells through 16 and 72 hours after treatment.

Figure 5 shows the mitotic indices for HCT116 cells, transfected with Mad2, BubR1, Mps1 and control miRNAs after treatment with docetaxel. Twenty-four hours after transfection, cells were added 200 nm of docetaxel on 16 and 72 hours, after which they made their processing. Mitotic cells were detected in phosphorylated histone H3 antibody, shown here with a red dotted line around the nucleus of cells (set to mitotic indexes, Cellomics). Nuclei were stained in blue with Hoechst dye.

Figure 6 presents the results of the analysis of PCR TaqMan real-time levels of the endogenous Mps1, BubR1 and Mad2 in HCT116 cells, transfected miRNAs Mps1, BubR1 and Mad2, respectively.

7 reflects the cell cycle analysis of HCT116 cells, transfected with the three miRNAs mitotic control genes. After transfection with miRNAs Mps1, BubR1 and Mad2 cells were left untreated (-docetaxel) or were treated with 200 nm of docetaxel (+docetaxel) within 24 hours. In seventy-two hours after the addition of docetaxel cells were incubated and analyzed from the point of view of the cell cycle. Numbers above the peaks indicate the content of DNA, for example, 2N, 4N, 8N, 16N or 32N.

On Fig results of survival analysis count of clonogenic cells using stable cell lines after knockdown. The HCT116 cells containing BubR1 or vector control is performance communications short RNA hairpin were inoculated in a Cup with a diameter of 10 cm and was maintained at 5 nm docetaxel for 10 days. Colonies were washed PBS and were stained with crystal violet.

Figure 9 provides some curves dose-response relationships for genes, a decrease in functional activity which provides increased sensitivity to docetaxel. Obtained in the presence of docetaxel dose dependence curves are given for HCT116 cells, transfected miRNAs RB1, Pim-1, p21, Aurora A and TACC3 (shaded squares), compared with the control siRNA (where there's no shading squares). The minimum ratio (MR) is the value of WST-1 gene compared to the control at 40 nm of docetaxel. The ratio of IC50 (IR) represents the ratio of IC50 for gene compared to control.

Figure 10 provides curves dose-response relationships for short RNA hairpins Aurora A (shaded squares) compared with the vector control (where there's no shading squares).

Figure 11 presents the results of the analysis of PCR TaqMan real-time levels of the endogenous Aurora A in cells containing a short RNA hairpin Aurora A.

On Fig are differences in proliferation of HCT116 cells, transfected miRNAs Pim-1 and TACC3 (shaded squares), compared with the control siRNA (where there's no shading squares). The number of cells remaining in the 6-cell tablets in the hypoxia time points after transfection Pim-1, TACC3 and control miRNAs.

On Fig shows the results of the TaqMan analysis of the levels of Pim-1 and TACC3 mRNA after transfection with miRNAs.

On Fig are the levels of active caspase-3 in HCT116 cells, transfected miRNAs Pim-1 and BubR1. The levels of active caspase-3 are shown as the intensity of the fluorescence measured using a kit for the analysis of active caspase-3 column with beads (Upstate). Analyzed three concentrations of docetaxel, 0, 5, and 40 nm, and three points in time, 24, 48 and 72 hours after addition of docetaxel.

On Fig are the levels of phosphorylation ACT in HCT116 cells, transfected miRNAs Pim-1 and BubR1. The ratio of the levels of phosphorylated and total ACT was determined by analysis on a column of pellets (Biosource). Twenty-four hours after transfection cells were left untreated or were treated with 5 and 40 nm of docetaxel. Forty-eight hours after treatment with docetaxel was analyzed lysates of cells. The level of phosphorylation was calculated as the ratio of phosphorylated AKT (p-AKT) and total ACT (t-AKT).

On Fig is a Western blot showing reduced levels of Pim-1 and BubR1 48 hours after transfection.

FULL description of the INVENTION

The present invention is in General based on the identification of applicants genetic markers that can predict the two is as if a tested object-resistant or drug-sensitive takayanagi family. Using cellular screening interference RNA (Rnci) the applicants have found that drug resistance or sensitivity to docetaxel was associated with specific genetic markers.

It is noted that a variety of terms and key phrases used in the detailed description and the claims. The definitions of these key terms and phrases below.

Used in this document, the term "prognosis" refers to the prediction or probability associated with cancer death or progression, including drug resistance and relapse, the spread of metastasis and neoplastic disease.

Used in this document, the term "prognosis" refers to the likelihood that the patient will be beneficial or adverse to respond to the drug or set of drugs, and the extent of such reactions, for example the survival of the patient after surgical removal of primary tumor and/or chemotherapy within a certain period of time without recurrence of cancer. The forecasting methods presented in this invention can be clinically used for making decisions about treatment by selecting the most appropriate therapeutic approaches for any particular patient, in particular chemotherapy taxoides Sebastopol forecasting of the present invention are important tools for predicting the probability of a favorable response by the patient to the treatment regimen, for example chemotherapy with the use of a particular drug or combination of drugs and/or radiation therapy, or how likely long-term survival of the patient after termination of chemotherapy or other treatment methods.

Used in this document, the term "tumor" refers to all forms of growth and proliferation of neoplastic cells, both malignant and benign, and all pre-cancerous and cancerous cells and tissues.

Used herein the term "cancer" and "cancer" refers to a physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer, among other things, include: breast cancer; colon cancer; lung cancer; prostate cancer; hepatocellular cancer; stomach cancer; pancreatic cancer; uterine cancer and ovarian cancer; liver cancer; bladder cancer; cancer of the urinary tract; carcinoma; melanoma; brain cancer, including glioblastomas and Protocol; cancer of the biliary tract; horiokartsinoma; esophageal cancer; gastric cancer; hematological neoplasm, including acute lymphocytic and myelogenous leukemia; multiple myeloma; AIDS-related leukemia and leukemia/lymphoma Mature T-cells; intraepithelial neoplasma, including lenticular discoid diskeratoz and Paget's disease; lymphoma, in which the first number of Hodgkin's disease and lymphocytic lymphomas; neuroblastomas; oral cancer, including squamous cell carcinoma, sarcomas, including leiomyosarcoma, rhabdomyosarcoma, liposarcoma, fibrosarcoma and osteosarcoma; skin cancer, including melanoma, Kaposi's sarcoma, basal cell cancer and squamous cell cancer; testicular cancer, including germinoma, such as seminoma, aspermatogenesis tumors (teratoid tumors, choriocarcinoma), stromal tumors and genocidally; thyroid cancer, including adenocarcinoma of the thyroid gland and medullary carcinoma; kidney cancer, including adenocarcinoma and Wilms tumor.

Used in this document the term "patient"preferably refers to a person, but may also include nonhuman primates, cows, horses, pigs, sheep, goats, dogs, cats or rodents. A preferred object is a man or suspected cancer or a diagnosis of cancer, or classified as high risk of developing cancer, for example, having a family history of cancer. In the preferred application of the invention under cancer refers to cancer of the breast. Methods of identifying patients, presumably suffering from cancer may include manual examination, biopsy, history of disease, the patient's family, medical history of the patient, or a number of medical imaging, for example m is mography, magnetic resonance imaging, spectroscopy, magnetic resonance or positron emission tomography. Methods of cancer diagnosis and clinical description of cancer diagnoses are well known to experts in the field of medical science.

Used herein the term "sample" is a fabric obtained by methods that are well known to experts in the allied health Sciences. Methods such as biopsy, include the total separation of the masses, Microdissection, laser Microdissection or others known in the field methods of separating cells. Due to the variability of cell types in disease-affected the biopsy tissue and variability in the sensitivity of diagnostic methods the sample size required for analysis, may be from 1, 10, 50, 100, 200, 300, 500, 1000, 5000, 10000 up to 50,000 or more cells. The appropriate sample size can be determined on the basis of cell structure and conditions of the biopsy, and the standard preparative procedure for its determination and subsequent selection of nucleic acids for use in the invention are well known to specialists in this field. For example, the biopsy may be sufficient to assess the expression of RNA without amplification. On the contrary, the lack of the required number of cells in a small area of the biopsy may require that a use is educational methods of conversion and/or amplification of RNA or other methods, improves the separation of molecules of nucleic acids. Such methods, which allow you to use a limited amount of biopsy specimens, well known to specialists in this field. Some examples, among others, include direct amplification of RNA, reverse transcription of RNA into cDNA, the cDNA amplification or generation of radioactively-labeled nucleic acids.

Used herein the term "test" in respect of sample means a sample taken from the cancerous area of the body or of the body, which demonstrates a certain stage or characteristics of cancer. Used in this document, the term "control" in relation to the sample mean of the samples, which are used for mapping. Preferably, these samples represent "control" from the point of view that the samples do not show or are not showing any signs of any disease or illness that could affect gene expression, particularly in relation to diseases for which they are intended to be used as a standard. In the alternative case, it is obvious that there is a possibility to compare different stage of the disease or health condition, and in such cases the "control" sample corresponds to the earliest stage of the disease or health condition. E.g. the measures the control may be a sample taken from not cancerous, but comparable area of the body. In addition, a control sample can be comparable area of the body of the same patient or not cancerous area of the body at the second patient, which is essentially similar to the first one (the same or similar species, age, weight, gender etc). Finally, the control sample can also be taken from the cancerous area in the second patient, which effectively responds to treatment with molecules takayanagi collection.

The term "nucleic acid molecule" refers to FastEthernet polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine or deoxycytidine; "DNA molecules") or any FastEthernet analogues, such as phosphorothioates and thioethers as in single-stranded form, and double-stranded helix. Possible double-stranded helix DNA-DNA, DNA-RNA and RNA-RNA. The term "nucleic acid molecule" and, in particular, DNA or RNA, refers only to the primary or secondary structure of the molecule and does not limit it to any particular tertiary forms. Thus, this term applies to double-stranded DNA, which, inter alia also present in linear or circular DNA molecules (e.g., the restriction fragments, plasmids, and chromosomes. When discussing the structure of particular double-stranded DNA molecules to describe the sequences in this document uses the standard agreement, according to which only specifies the sequence in the direction from 5' to 3' on retranscribing chain DNA (that is, the chain having a sequence homologous to the mRNA). A "recombinant DNA molecule" is a DNA molecule that has been processed in accordance with the principles of molecular biology.

Used in this document, the term "part" of the selected nucleic acid molecule which encodes a specific protein, refers to a part or portion of the selected nucleic acid molecule that includes a sufficient number of consecutive nucleotides that encode a peptide or polypeptide. Naturally, a "part" of the selected nucleic acid molecule more than one nucleotide, and peptide or polypeptide encoded by this part, contains many amino acid residues as described below in the determination of the peptide or polypeptide. Used herein, the term "peptide" refers to two or more amino acids covalently linked by peptide bonds. In a specific implementation, the peptide comprises at least 10, preferably, n is at least 20, and even more preferably at least 30, and even more preferably at least 40, and most preferably, 50 or more amino acids.

Used herein the term "polypeptide" refers to a linear polymer consisting of a set of consecutively linked amino acids. In particular, the polypeptide may have a molecular weight of more than 100 kDa.

Used herein the term "genetic marker" refers to a physiological composition, for which the measured level of RNA, DNA or protein in the sample is used to predict the resistance or sensitivity of the test drugs takayanagi family. Moreover, the genetic marker can encode a specific protein or, alternatively, may serve as a surrogate marker for protein, whose activity is associated with a genetic marker taken in in the body sample. This relationship may be direct, in which the reduced level of activity of a protein corresponds to a decrease in the level of the genetic marker, or, alternatively, the ratio may be reversed, thus reducing the activity of a protein corresponding to an increase of the level of genetic marker. Such physiological compositions, among others, include cellular proteins (e.g., stem cells-precursors is of enikov), polypeptides, DNA, RNA, carbohydrates or fatty acids. In a particular application of the present invention measured the levels of certain genetic markers may predict whether the subject is resistant or sensitive to medications takayanagi family. Examples of such genetic markers, among others, include:

BubR1, mRNA Homo sapiens similar to protein kinase (BUBR1), full code (catalog number GenBank: AF046079);

Mad2, mRNA Homo sapiens protein MAD2 (catalog number GenBank: AJ000186);

Mps1, mRNA Homo sapiens protein kinase TTK (TTK) (catalog number GenBank: NM_003318);

GEFT for Rac1/CDC42, the exchange factor Homo sapiens RAC/CDC42 (GEFT), transcript variant 2, mRNA (catalog number GenBank: NM_133483);

Bub1, homolog 1 (yeast) [Homo sapiens BUB1 budding, not inhibited by benzimidazole (BUB1), mRNA (catalog number GenBank: NM_004336);

hSepharase, extra spindle poles like 1 Homo sapiens (S. cerevisiae) (ESPL1), mRNA (catalog number GenBank: NM_012291);

CamKIId, calcium/calmodulin-dependent protein kinase (CaM kinase) II Delta (CAMK2D), transcript variant 3, mRNA (catalog number GenBank: NM_001221);

CDK6, cyclin-dependent kinase 6 (CDK6), mRNA (catalog number GenBank: NM_001259); and

GRB2, growth factor Homo sapiens protein 2 associated with the receptor (GRB2), transcript variant 1, mRNA (catalog number GenBank: NM_002086).

P21(Waf1), an inhibitor of cyclin-dependent kinase 1A Homo sapiens (p21, Cip1) (CDKN1A), transcript variant 1, mRNA (a room in cat is the log GenBank: NM_000389);

Pim-1, pim-1 oncogene Homo sapiens (PIM1), mRNA (catalog number GenBank: NM_002648);

GBP-1, guanylate-binding protein 1 Homo sapiens induced by interferon, 67 kDa (GBP 1), mRNA (catalog number GenBank: NM_002053);

RXRA, retinoid X-receptor Homo sapiens, alpha (RXRA), mRNA (catalog number GenBank: NM_002957);

SPF45 protein 17 with RNA-binding motif Homo sapiens (RBM17), mRNA (catalog number GenBank: NM_032905);

Hec1 associated with centromeres 2 Homo sapiens (KNTC2), mRNA (catalog number GenBank: NM_006101);

Raf1, human mRNA for raf oncogene (catalog number GenBank: X03484);

Aurora A kinase 1 family beautiful Aurora Homo sapiens (ARK1), mRNA, complete code (catalog number GenBank: AF008551);

TACC3, transforming acidic bipedally protein 3 [Homo sapiens (TACC3), mRNA (catalog number GenBank: NM_006342);

RelB, a homologue of the viral oncogene of reticuloendotheliosis v-rel Homo sapiens nuclear factor gene enhancer light chain polypeptide Kappa in b-cells 3 (birds) (RELB), mRNA (catalog number GenBank: NM_006509);

PRKCD, Homo sapiens protein kinase C, Delta (PRKCD), transcript variant 1, mRNA (catalog number GenBank: NM_006254); BRAF35, high-mobility group Homo sapiens 20B (HMG20B), mRNA (catalog number GenBank: NM_006339);

HSPA1L, heat shock protein 70 kDa 1A Homo sapiens (HSPA1A), mRNA (catalog number GenBank: NM_005345);

STK11, serine-trionychinae 11 Homo sapiens (polyposis intestines II) (STK11), mRNA (catalog number GenBank: NM_000455) and

MKK3, MAP kinase kinase 3 [Homo sapiens (MKK3), mRNA, complete code (catalog number GenBank: L3679).

Used herein, the term "control genetic marker" refers to a physiological composition, for which the measured level of RNA, DNA or protein in the sample remains unchanged before, during or after exposure to drugs takayanagi family. "Control of genetic markers are called obligate genes. These include genes that are selected on the basis of relatively constant levels of expression in the analyzed system, for example, if a particular disease such as cancer. Obligate genes are used for normalization of the results of the expression. Examples of such genetic markers, among others, include:

GAPDH, glyceraldehyde-3-phosphatedehydrogenase Homo sapiens (this causes), mRNA (catalog number GenBank: NM_002046) and

RPS9, the cDNA clone Homo sapiens IMAGE:6647283, partial code (catalog number: BC071941).

Used herein, the term "molecule takayanagi family" refers to a class of chemotherapeutic compounds belonging to taxonomy family. Individual representatives takayanagi family, among others, are paclitaxel (Taxol), docetaxel (Taxotere) and their analogues (i.e. XRP9881 and XRP6258; see Ojima and Geney,Curr Opin Investig Drugs4:737, 2004). Because this class of molecules binds to beta-tubulin and stabilizes the polymeric form microcannulas, like docetaxel, it is expected that Klinicheskaya the expression of the biomarker, described in this document will reflect similar state response to these drugs.

Used herein, the terms "molecule", "compound" or "agent" refers to any composition that is currently known or will be opened in the future. Examples of compounds or agents used in the present invention include organic compounds (for example, synthetic or natural origin and optically active), peptides (synthetic or natural origin and optically active, that is D or L amino acids), carbohydrates, molecules of nucleic acids, etc.

Used herein, the term "rigidity hybridization or hybridization in stringent conditions" refers to conditions that will easily determined by the person skilled in the art and generally depend on empirical calculations, taking into account the length of the sample, temperature of washing and concentration of salts. As a rule, longer samples require higher temperatures for proper renaturation, whereas shorter samples required a lower temperature. Hybridization generally depends on the ability of denatured DNA to re-renaturation in the presence of complementary chains in an environment with a temperature below their melting point. The higher the degree desired homola the GII between the sample and hybridizing sequence, the higher the relative temperature which can be used. As a result, we can conclude that the higher the relative temperature will usually define more stringent reaction conditions, and a lower or less stringent. Additional information and clarification in relation to the stiffness of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

Used herein, the term "stringent conditions" or "terms " high rigidity" refers to such conditions, if: (1) low ionic strength and high temperature for washing, for example, of 0.015 M sodium chloride/0,0015 M sodium citrate/0.1% sodium dodecyl sulphate at 50°C; (2) in the process of hybridization is used denaturing agent, such as formamide, for example, 50% (vol.) formamide with 0.1% bovine serum albumin/0.1% of Ficoll/0.1% polyvinylpyrrolidone/50 mm buffer phosphate at pH 6.5 with 750 mm sodium chloride, 75 mm sodium citrate at 42°C; or (3) hybridization overnight in a solution containing 50% formamide, 5x SSC (0,75 M NaCl, of 0.075 M sodium citrate), 50 mm sodium phosphate (pH of 6.8), 0.1% sodium pyrophosphate, 5× denhardt's solution, processed by the ultrasound DNA from salmon ROE (50 µg/ml), 0.1% sodium dodecyl sulfate, and 10% extrasolar at 42°C with a 10 minute wash at 42°C in 0.2× SSC (sodium chloride/sodium citrate) followed by a 10-minute washing in ill is such conditions with the use of 0.1× SSC, containing EDTA at 55°C. Moderately stringent conditions can be determined in accordance with the description given in Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and less stringent hybridization conditions (e.g., temperature, ionic strength and % SDS) than described above. An example of moderately stringent conditions is incubation over night at 37°C in a solution containing 20% of formamide, 5× SSC (150 mm NaCl, 15 mm trinatriytsitrat), 50 mm sodium phosphate (pH of 7.6), 5× denhardt's solution, 10% textresult and 20 mg/ml denatured fragmented DNA from salmon ROE, followed by washing the filters in 1× SSC at about 37-50°C. the skilled in the art knows how to adjust the temperature, ionic strength, etc. necessary to take into account such factors as the length of the sample and other Necessary degree of rigidity conditions of hybridization of nucleic acids depends on the length of nucleic acids and the level of complementarity parameters, which are well known in the art. The higher the degree of similarity or homology between two nucleotide sequences, the greater the value of Tmfor hybrids of nucleic acids containing such sequences. The relative stability (corresponding more high-Tm) hybridized nucleic acid is acid decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. The preferred minimum length for hybridizing nucleic acid is at least 12 nucleotides, preferably about 16 nucleotides; and more preferably, at least 24 nucleotides; and most preferably, at least 36 nucleotides.

Used herein, the term "label" or "label detected" refers to detectivemisa marker compound or composition that is directly or indirectly conjugated with the antibody, Oligopeptide or other organic molecule to form a "labeled" antibody, Oligopeptide or other organic molecule. You can label itself is detectable (e.g., radioisotope labels or fluorescent labels)or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate or composition, which are amenable to detection.

Used herein, the term "direct label" refers to an object that in its natural state is clearly visible either to the naked eye or through an optical filter and/or applied effects, such as UV radiation, to cause fluorescence. Examples, among others, include colored labels, particles, metal sols, particle sols dyes, colored latex or liposomes with encapsulated the diversified dyes (described in U.S. patent No. 4313734, 4373932, WO 88/08534), EP-A 0280559, 0281327, U.S. patent No. 4703017). Other direct labels include radioactive nucleotides, radiopaque substances, fluorescent or luminescent substance.

Used herein, the term "indirect labels" refers to enzymes that can also be used in accordance with the present invention. Specialists known various types of immunoassay, for example, alkaline phosphatase and horseradish peroxidase, lysozyme, glucose-6-phosphatedehydrogenase, lactate dehydrogenase, urease - these and other enzymes discussed in greater detail in Eva Engvall, Enzyme Immunoassay ELISA and EMIT inMethods in Enzymology, 70: 419-439, 1980 and in U.S. patent No. 4857453.

Used herein the term "set" refers to a product containing one or more containers and label or the liner on the container or attached to them. In the preferred application of the containers may contain antibodies labeled detectable label, antibody fragments labeled with detectable label, or oligonucleotides labeled with detectable label. In another application containers provide a means of extracting total RNA from taken from the body of the sample, reverse transcription of total RNA to obtain cDNA and polymerase chain reaction with cDNA using a set of primers, one or both of p is Aymara have detektiruya tag. May be accompanied by additional containers that contain, for example, diluents and buffers, control antibodies, oligopeptides or small organic molecules. The label or the liner may include a description of the composition, and instructions for storage and the proposed use of "in vitro" or for diagnostic purposes.

In addition, in accordance with the present invention is within the knowledge of experts in this field can be used standard techniques of molecular biology, Microbiology and recombinant DNA technology. The content of such methods is described in detail in the literature. See, for example, Sambrook, Fritsch &Maniatis,Molecular Cloning: A Laboratory Manual,Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (herein "Sambrook et al., 1989");DNA Cloning: A Practical Approach,Volumes I and II (D.N. Glover ed. 1985);Oligonucleotide Synthesis(M.J. Gait, ed. 1984);Nucleic Acid Hybridization[B.D. Hames &S.J. Higgins, eds. (1985)];Reduced And Translation[B.D. Hames &S.J. Higgins, eds. (1984)];Animal Cell Culture[R.I. Freshney, ed. (1986)];Immobilized Cells And Enzymes[IRL Press, (1986)]; B. Perbal,A Practical Guide To Molecular Cloning(1984); F.M. Ausubel et al. (eds.),Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).

In General, the technology of RNA interference using synthetic or vector of double-stranded RNA to induce degradation of mRNA containing homologous sequences (McManus and Sharp,Nat Rev Genet3:737, 2002). Screening RNA-interf the event were used to establish the functions of genes in many organisms, for example, Caenorhabditis elegans (Simmeret al.,PloS Biol1:E12, 2003), Drosophila (Lumet al.,Science299:2039, 2003) and mammalian cells (Aza-Blancet al.,Mol Cell12:627, 2003).

In the present invention the cells of colon cancer HCT116 was used for screening siRNA directed against 101 gene associated with cancer, mainly including representatives of the family kinases, and destroys the effect of docetaxel was quantitatively determined by dose-response curves based high resolution. Using this approach, applicants have demonstrated that the lack of expression of 9 genes, including BubR1, Bub1, Mad2, Mps1 and GEFT Rac/CDC, may inhibit the destruction with docetaxel, whereas the lack of expression of 15 other genes, including Pim1, p21, TACC3 and Aurora-A may enhance cell death induced by docetaxel.

Thus, the present invention generally applies to diagnostic methods and kits that can be used in order to determine whether the person taking or considering taking docetaxel, to show resistance or sensitivity to the drug.

Applicants have observed resistance to docetaxel, and resistance to the drug is associated with the loss of a wide set of control genes, including BubR1, Bub1, Mad2, Msp1 and GEFT Rac/CDC.

Increased sensitivity to d is setaccel corresponds to the loss of any of several genes, including GBP-1, STK11, RXRA, Hec1, SPF45, Raf1, RELB, MKK3, PRKCD, HSPA1A, BRAF35, Aurora-A, Pim-1, TACC3 and p21waf1/Cip1, and inhibitors of these genes can serve as an important addition to therapy with docetaxel.

Mitotic control genes serve as a failsafe mechanism delay anafazy through inhibition of Cdc20-APC (complex, anaphase stimulating) up until the kinetochore sister chromatid will not be properly attached to the mitotic spindle and line up at the equator (Zhouet al.,J Cell Sci115:3547, 2002), thus giving the cells the ability to reliably exit from mitosis and go to additional cell cycles with the exact complement of the DNA. In the presence of inhibitors microcannulas cells exiting mitosis, no longer able to properly divide their chromosomes and usually undergo apoptosis immediately or after several cell cycles (Taylor and McKeon,Cell89:727, 1997). The combination of the inhibitors microcannulas with the loss of mitotic checkpoint genes, such as BubR1, allows cells to bypass the stop mitosis without apoptosis and leads to chromosomal instability (CIN) and aneuploidy (Shinet al.,Cancer Cell4:483, 2003). Recently, data on resistance to the drug were obtained using an inhibitor of microanalyses of paclitaxel for treatment of MCF-7 cells, suppressed using BubR1 and Mad2 (Sudoet al.,Cancer Res64:2502, 2004)

Gene Pim-1 encodes a serine/trionychinae, which belongs to a small family of related kinases. The function of Pim-1 is associated with proliferation, differentiation, apoptosis, formation of tumors, hypoxia, angiogenesis and mitosis (Wanget al.,Biochim Biophys Acta1593:45, 2002). These microscopic studies, combined with data on hypophosphorylation AKT and measurements of the enhanced activity of caspase-3 show that inhibition of Pim-1 was increased caused by docetaxel apoptosis through inactivation signal AKT, which mediates the survival of cells. Pim-1 and p21 have very similar characteristics in the absence of HCT116 cells to docetaxel in accordance with reports showing that p21 is a substrate for phosphorylation of Pim-1 (Wanget al.,Biochim Biophys Acta1593:45, 2002). Inhibition of Pim-1 induces specific apoptosis in the absence of docetaxel, however, was more effective in the presence of the drug, whereas suppression of transforming acidic bierling protein TACC3 did not cause cell death in the absence of docetaxel, indicating that in itself is Rnci had no effect on cell proliferation. The obtained results show that the reduction in the levels of different proteins can identify different mechanisms of sensitization of cells to docetaxel.

Accordingly, in one aspect from which retene activation of one or more genes, described in table I and II, and level of proteins for these genes can be used to select the strategy of therapeutic treatment and monitor the effectiveness of the chosen treatment strategy.

In a particular application of the method, which allows you to monitor the level of activation of one or more genes listed in table I and II, in the course of chemotherapy to assess and predict the efficacy of chemotherapy for the patient. Biopsy of tumors (e.g. breast cancer, colon cancer, non-small cell lung cancer and tumors of the stomach) or quickly prepared culture of tumor biopsies of patients with undelivered diagnosis of cancer or patients currently undergoing treatment, are processed for DNA extraction (Hafneret al.,Arch Pathol Lab Med127:1221, 2003; Rodriguezet al.,Clin Cancer Res10:5785, 2004), the messenger RNA (Chang et al., Lancet. 362:340, 2003) and/or proteins (Espinaet al.,J Immunol Methods290:121, 2004), to assess levels of gene activation or protein levels for the genes listed in table I and II, or their subpopulations. Characterization of gene transcription and protein expression is used for diagnosis, prediction of therapeutic response to potential treatment strategies and can be a useful tool for monitoring the patient's response to therapy.

According to the present from which briteney RNA can be released from tumor samples using any of the available methods, which are widely used in this field (Ullmannet al., J Biomol Screen9:95, 2004;Badiee et al., BMC Biotechnol3:23, 2003). The examinee selects one or more cells, and these cells produce RNA. As examples, the patient may be selected cells of peripheral blood leukocytes (PBL), or it is possible to obtain a sample of cells and to saturate the sample in a desired cell type. Cells can be isolated from a cell mixture by various methods, for example the selection of cells using antibodies that bind to a specific epitope on the cell type. If the cells are in a solid tissue, individual cells can be removed by dissection, such as microdiscectomy or microdissecting with laser capture (LCM) (Bonneret al.,Science278:1481, 1997; Fendet al.,Am J Path154:61, 1999). RNA may be extracted from tissue or cell sample using different methods, for example by lysis in the presence of guanidine thiocyanate followed by centrifugation in CsCl (Chirgwinet al.,Biochemistry18:5294, 1979). RNA from single cells can be obtained as described in methods preparation of cDNA libraries from single cells (Dulac, Curr Top Dev Biol. 36:245, 1998). For specific types of sample RNA can be further enriched. For example, in one of the applications of sample RNA can be allocated poly(A)+RNA. In particular, poly-T-oligosol tidy can be immobilized on a solid substrate, to serve as affinity ligands for mRNA. The industry produces kits for this purpose, for example the MessageMaker kit (Life Technologies, Grand Island, N.Y.). Enrichment can be carried out, for example, through the synthesis of primer-specific cDNA or more stages linear amplification based on cDNA synthesis and directed the matrix transcription in vitro (Wanget al.,Proc Natl Acad. SciUSA 86:9717, 1989; Dulacet al.above).

In the methods of the present invention is suitable for use in a variety of amplification techniques, including, for example, PCR; ligase chain reaction (LCR) (Wu and Wallace,Genomics4:560, 1989); self-sustained replication sequence (SSR) (Guatelliet al.,Proc Natl Acad Sci USA87:1874, 1990); amplification-based nucleic acid sequences (first NASBA) and transcription amplification (Kwohet al.,Proc Natl Acad Sci USA86:1173, 1989). Methods of PCR technology is well known to specialists in this field (see, for example, PCR Technology: Principles and Applications for DNA Amplification (ed. H. A. Erlich, Freeman Press, N.Y., N.Y., 1992); PCR Protocols: A Guide to Methods and Applications (eds. Innis, et al., Academic Press, San Diego, Calif., 1990).

In RNA may be a label for detection using any of the methods known to experts in this field. For example, using microarrays, such as those manufactured by Affymetrix. In RNA paid label, and it is detected by hybridization with any widely used which has been created methods for example, a direct label RNA such dyes as Cyanine-3 or Cyanine-5 (Perkin Elmer MPS544001KT). Additional methods include direct-label cDNA that is reverse transcription using nucleotides labeled with Cyanine-3 or Cyanine-5 (Badiee A, 2003), fluorescein or Alexa dyes (Molecular Probes), or other fluorophores. In addition, there may be used an indirect label cDNA, for example FairPlay™/aminoaniline label (cat. No. Stratagene: 252002), dendrimers label 3DNA (Genisphere Inc) or the enzymatic amplification of the signal (MICROMAX TSA, Perkin Elmer). Alternatively, RNA can be quantitatively determined using RNA samples that are detected using an enzymatic, fluorescent, radioactive, or light-emitting methods.

In one aspect of the present invention RNA derived from a tumour sample, and the detection of genetic markers using Taqman technology. Is the generation of primers for detection of specific RNAS listed in table I and II, or their podmnozhestva, and amplification is carried out using a reverse transcriptase. Detection of specific fragment, amplified using reverse transcriptase, is performed by gel electrophoresis, polymer electrophoresis, direct DNA sequencing, detection of the light, the decline of the fluorescence signal, the farm is consultative reaction or detection by hybridization with complementary RNA. In another aspect of the present invention for the detection of oligonucleotides used real-time PCR. mRNA obtained from a tumour sample, subjected to reverse-transcribed into cDNA. Is the generation of primers for amplification of specific RNA shown in table I and II, or their podmnozhestva, using the technology of polymerase chain reaction. Detecting the level of mRNA produced by using gel electrophoresis and staining of the ethidium bromide or CYBR Green, or by measuring the intensity of fluorescence from labeled fluorophore samples specific to sequences that are allocated polymerase.

In another aspect of the present invention uses the technology of Northern-blotting. RNA derived from a tumour sample and then separated by gel-electrophoresis and transferred to a membrane. The content of RNA is determined by hybridization using probes labeled with a radioactive isotope, for example P32or chromogenic or fluorescent-based analysis of the enzymatic reaction.

In another aspect of the present invention as a surrogate indicator of the transcript may be used dose of the gene. The dose of the gene for transcripts from tables I and II or their subpopulations can be determined quantitatively and evaluated as to whether the tumor of Raag is encoded to treatment with docetaxel (Rodriguez et al.,Clin Cancer Res10:5785, 2004). Since such an assessment can be made prior to neoadjuvant treatment before surgery) therapy, patients may receive treatment with docetaxel, if they are classified as reactive, or it may be treatment with another chemotherapeutic agent, if they are classified as areagirls.

DNA extracted from the biopsy of the tumor patients and cleaned in order to remove impurities, using methods in accordance with the procedures performed by professionals in this area. Methods used for determining the dose of the gene in the tumor DNA, among other things, include quantitative PCR, genomic DNA-chip hybridization in the formation, or southern blotting (Hafneret al.,Arch Pathol Lab Med127:1221, 2003; Rodriguezet al.,Clin Cancer Res10:5785, 2004). Accordingly, these methods can be used to determine the copy number of one or more genes from tables I and II and compared to a control sample or a control token.

In another aspect of the present invention as a surrogate indicator of the transcript can be used the protein level. It is shown that the protein levels correlate with suppression or increased levels of transcripts. Therefore, the present invention includes methods for measuring levels of proteins that match peptidyl products, encoded by transcripts from tables I and II. Proteins are detected and used as markers predictable response to docetaxel. Methods for the determination of proteins is well known to specialists in this field. For example, relates to immunoassay methods that use antibodies to detect expression of the target protein. In particular the application of immunoassay used for the detection of the protein products of one or more genes listed in table I and II. In addition, antibodies to any of the proteins listed in table I and II, can be used in a number of other methods of detection. Such methods of detection, among others, include the following: Western blot, analysis, ELISA, sandwich ELISA. Alternatively, discusses other methods of analysis that do not use antibodies, and these include approaches that use DNA oligonucleotides or polypeptides that recognize the proteins encoded by transcripts from tables I and II (e.g., aptamers). Can also be used for mass spectrometric analysis of biological samples, which determines the composition of the polypeptides on the exact molecular weight of the peptide fragments after proteolytic decay.

The present invention also includes appropriate labels, which include enzymes, fluorophores (e.g., among p is ocih, fluorescein isothiocyanate (FITC), phycoerythrin (PE), Texas red (TR), rhodamine, free or chelated salts of lanthanides), chromophores, radioisotope, chelating agents, dyes, colloidal gold, latex particles, ligands (e.g., Biotin), and chemiluminescent agents.

In one aspect of the present invention used radioactive label can be isotopes, for example,3H,14C,32P,35S36Cl51Cr57Co.,58Co.,59Fe90Y125I131I and186Re. Quantitative determination of the levels of radioactivity may be currently known and available methods of counting. Can, on the contrary, to apply a radio-opaque substance. In carrying out the invention, in which the label is an enzyme, detection may be performed using any method, currently used in this field: colorimetric, spectrophotometric, fluorospectrometer, amperometric or gasometrical method.

Another aspect of the present invention is the use of binding peptides agents such as antibodies or fragments of antibodies. The antibodies include polyclonal and monoclonal antibodies prepared in accordance with standard methodology. Only a small the art of antibody molecules, Pratap, is involved in the binding of an antibody to its epitope (see, in General, Clark, W. R. (1986) The Experimental Foundations of Modem Immunology Wiley & Sons, Inc., New York; Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications, Oxford). For example, the field of pFc' and Fc are the effectors Complementos cascade, but do not participate in binding to the antigen. The antibody from which the enzymatic method has been removed region pFc' or which producirovanie no scope pFc', referred to as the fragment F(ab')2retains both the binding site of the antigen, which are available with the intact antibody. Thus, in applying the present invention uses the detected labeled fragment of the antibody, for example a fragment F(ab')2. Similarly, the antibody from which the enzymatic method has been removed, the Fc region or which producirovanie without the Fc region, referred to as Fab fragment, retains one of the binding sites of the antigen, which are available with the intact antibody. The Fab fragments contain covalently bound light chain antibodies and part of the heavy chain of the antibody denoted by Fd. The Fd fragments are a major determinant of specificity antibodies (make-Fd fragment can bind up to ten different light chains without changing the specificity of the antibody), and the selected Fd fragments retain the ability to bind epitopes.

As is well known to specialists in this area and, in antigennegative part of the antibody, there are areas complementarity determining (CDR), which directly interact with the epitope of the antigen, and framework regions (FR), which maintain the tertiary structure of paratope (see generally Clark, 1986; Roitt, 1991). In the heavy chain Fd fragment and the light chain of immunoglobulins IgG marked four frame region (FR1 through FR4), respectively, divided in three areas that define complementarity (with CDR1 through CDR3). Region CDRs and in particular CDR3, or rather a heavy chain CDR3, largely responsible for antibody specificity. At the present time guaranteed that not related to the CDR region of the antibody mammals can be replaced by similar areas conspecific or heterospecific antibodies while retaining the specificity of the epitopes of the original antibody. This is most obviously manifested in the development and use of "humanized" antibodies in which neumanniana CDR covalently associated with human FR and/or Fc/pFc' areas to get a functional antibody (see U.S. patent No. 4816567, 5225539, 5585089, 5693762 and 5859205).

A fully humanized monoclonal antibodies can also be prepared by immunization of transgenic mice significant cuts loci heavy and light chain of a human is the first immunoglobulin. After immunization of these mice (e.g., XenoMouse (Abgenix) and HuMAb mouse (Medarex/GenPharm)) using standard hybridoma technology it is possible to prepare monoclonal antibodies. Such monoclonal antibody will have an amino acid sequence of a human immunoglobulin, and therefore will not cause a reaction of the human artemisinin antibodies (HAMA) with the introduction of the man.

Therefore, experts in this field will be obvious that the present invention also includes fragments F(ab')2, Fab, Fv and Fd; chimeric antibodies in which the Fc and/or FR and/or CDR1 and/or CDR2 and/or light chain CDR3 was replaced by homologous humanitarianism or regularizovanim sequences; chimeric antibody fragment F(ab')2in which the FR and/or CDR1 and/or CDR2 and/ or light chain CDR3 was replaced by homologous humanitarianism or regularizovanim sequences; chimeric antibodies with the Fab fragment in which the FR and/or CDR1 and/or CDR2 and/or light chain CDR3 was replaced by homologous humanitarianism or regularizovanim sequences and chimeric antibodies with Fd fragment, in which the FR and/or CDR1 and/or CDR2 region have been replaced by homologous humanitarianism or regularizovanim sequences. The present invention also includes so-called the single-stranded antibodies is A.

For a more thorough understanding of the present invention can be referenced by the following preferred but not the only examples, which are given as illustrations of the invention. The following examples are provided to more fully illustrate the preferred implementation of the present invention. However, it in no case should not be construed as limiting the broad scope of the present invention.

EXAMPLES

EXAMPLE 1: Screening of miRNAs

In order to identify genes that provide a higher resistance or sensitivity to docetaxel, organized the screening of miRNAs in relation to the 101 genes in HCT116 cells using the set of concentrations of docetaxel to get the curve of dose-response relationships. The cancer cell line human colon HCT116 were obtained from ATCC and were cultured in McCoy 5A with the addition of 100 u/ml penicillin, 100 μg/ml streptomycin, 4 mm L-glutamine and 10% fetal bovine serum at 37°C in the presence of 95% CO2and 5% O2. The list of miRNAs included cancer-related genes, including those for which there is increased expression in resistant to docetaxel breast cancer tumors according to experiments characterization of gene expression (Changet al.,Lancet362:362, 2003). An additional criterion is the susceptibility Misha is her drug. The General scheme is as follows. On the first day of HCT116 cells were sown at 5000 cells per cell in the plate of 96 cells and the next day was transfusional with a pool of 3-4 miRNAs on gene. Used a representative sample of the miRNAs listed in table I and II. Lipofectamine 2000 (Invitrogen) was used for transfection siRNA (Dharmacon) in cells HCT 116 in tablets of 96 cells. On the third day miRNAs were removed and added to docetaxel in concentrations from 0 to 40 nm. On the sixth day through analysis of WST-1 quantify cell viability. Using this analysis tracks the activity of mitochondrial dehydrogenases present in viable cells, which lead to the collapse of tetrazole salt WST-1 to form formazan. On the day of analysis from the plate of 96 cells were selected environment. Reagent WST-1 (Roche) was diluted 10-fold in the environment McCoy 5A and each cell was added 100 ul. Then the plates were incubated for 40 to 80 minutes at 37°C prior to measurement on a SpectroMax (Molecular Devices) at a wavelength of 450 nm. The values of WST-1 was built hierarchically by calculating the ratio of the experimental to the control siRNA and were characterized by 15 genes as providing sensitivity and 9 genes that confer resistance below in table III. Sensitive and resistant population can be further p is tasdelen on additional groups: 1), where the effect of miRNAs was observed at lower concentrations of docetaxel (1-6 nm) shear IC50or 2), where the main effect was observed at higher concentrations (>6 nm) at less noticeable shift in the IC50.

Compared to miRNAs Mad2, BubR1 and Mps1 miRNAs aimed at Grb2, CDK6, separate and calcium/calmoduline the protein kinase II Delta (CamKIID), showed more pronounced effects at lower concentrations of docetaxel (1-6 nm) with a characteristic shift in the IC50. In General, this group demonstrated a weaker resistance than mitotic checkpoint genes and miRNAs CamKIID have provided the highest level of protection, which was twice as much as control cells. The obtained data show that the loss of four mitotic checkpoint genes along with several other genes may in varying degrees, to increase the resistance to docetaxel.

The data in figure 1 show several characteristic curves dose-response relationships for cells transfected miRNAs, with subsequent exposure to several concentrations of docetaxel. miRNAs to the four mitotic checkpoint genes, including BubR1, Bub1, Mad2 and Mps1 (Bub1 not shown), and the exchange factor guanine nucleotide (GEFT) for Rac/Cdc42 showed significant resistance to docetaxel with more pronounced EF the project at higher concentrations of docetaxel (> 6 nm). A higher level of resistance was observed for Mad2, where cell viability was increased five-fold compared with control cells, transfitsirovannykh miRNAs. Most miRNAs failed screening, and as a representative example is the human retinoblastoma 1 (RB1).

In General, the results show that screening for miRNAs able to provide an idea of how the suppression of gene expression sencibilisiruet or protects cells from treatment with docetaxel, and depending on the concentrations of lead in the action of various mechanisms of modulation mediated docetaxel cell death.

Table I
Sequences of miRNAs that determine sensitivity to docetaxel
The name of the geneThe sequence of miRNAsIdent. number sequenceSequence
miRNAs
Ident.
number sequence
P21(Waf1)GCGAUGGAACUUCGACUUU1AGACCAUGUGGACCUGUCA 3
UGGAACUUCGACUUUGUCA2
Pim-1CCUUCGAAGAAAUCCAGAA*4UAUUCCUUUCGAGCAUGAC6
UGGUGUGUGGAGAUAUUCC5
GBP-1CGAAAGGCAUGUACCAUAA7GAACAGGAGCAACUACUAA9
GAUACAGGCUGAAGAGAUU8
RXRAGCAAGGACCUGACCUACAC10GACCCUGUCACCAACAUUU12
GCAAGGACCGGAACGAGAA11
SPF45CAAAUCCGCUGACUGAAAU13GACCCUAUGUUUCCUAAUG15
GAACAAGACAGACCGAGAU14
Hec1GUGUAUUCGACAACUCUGU16GUACUCAGUUGCAGACAUU18
GAUUGCAAGAUUGGAACAA17GUAUCACAAAUUGGCUAGA19
Raf1GCACGGAGAUGUUGCAGUA20GACAUGAAAUCCAACAAUA22
GCAAAGAACAUCAUCCAUA21GGAAUGAGCUUGCAUGACU23
Aurora AGAGAACUGCUACUUAUAUA24GAAGGUCGGAUGCAUGAUG26
GAAUAUGCACCACUUGGAA25GUAAAGGAAAGUUUGGUAA27
TACC3GCACCUCGCUUCCCACAAG28GAACGAAGAGUCACUGAAG30
GAGCGGACCUGUAAAACUA29
RelBGCAGAAAGAGGACAUAUCA31GCCCGUCUAUGACAAGAAA33
GCAGCGAGCCAUUGCCUUU32
PRKCDGGACGUGGAUUGCAAACAA34GAAAGAACGCUUCAACAUC36
GCAUGAAUGUGCACCAUAA35
BRAF35GGGCGUACCAGCAGUCUGA37GUCUGAAGCCUAUAAGAUG39
GCUCUGGGCUCAUGAACAC38
HSPA1LGAGAUCGACUCCCUGUUUG40GAUCAACGACGGAGACAAG42
UGGAGGAGUUCAAGAGAAA41
STK11GAAGAAGGAAAUUCAACUA43GAAACAUCCUCCGGCUGAA45
GAGAAGCGUUUCCCAGUGU44
MKK3GGUGGAGGCUGAUGACUUG46GGAGGGCCAUGUGAAGAUG48
GGAGAUUGCUGUGUCUAUC47GAUGUGAAGCCCUCCAAUG49
*Separate sequence, demonstrating effective knockdown

Table III
Genes that affect the response to docetaxel
Sequences of miRNAs that determine sensitivity to docetaxel:
The name of the gene Ident. number sequenceCat. No.Rel. IC50p(Rel. IC50)Min. Rel.p(Min. Rel.)
P21(Waf1)90NM_0003890,700,00040,250,0000
Pim-191NM_0026480,800,00110,300,0000
GBP-192NM_0020530,590,00000,250,0000
RXRA93NM_0029570,640,00110,360,3098
SPF4594NM_032905 0,720,00000,470,0000
Hec195NM_0061010,640,00000,310,0121
Raf196X034840,900,00590,300,0000
Aurora A97AF0085510,730,00001,370,0018
TACC398NM_0063420,290,00000,850,0077
RelB99NM_0065090,560,00000,770,0052
PRKCD10 NM_0062540,460,06830,591,0000
BRAF35101NM_0063390,440,00001,290,1361
HSPA1L102NM_0053450,600,04041,081,0000
STK11103NM_0004550,940,45440,270,0000
MKK3104L367190,510,00000,820,0553
Sequences of miRNAs that determine increased resistance to docetaxel:
Naim is the identification of the gene Ident. number sequenceCatalog numberRel. IC50p(Rel. IC50)Min. Rel.p(Min. Rel.)
BubR1105AF0460791,880,22073,010,5663^
Mad2106AJ0001863,220,0076of 5.061,0000^
Mps1107NM_0033183,550,00082,921,0000^
GEFT for Rac1/CDC42108NM_1334833,501,00002,421,0000^
Bub1109 NM_0043361,380,00072,450,0000
hSeparase110NM_0122911,990,00000,881,0000
CamKIID111NM_0012212,030,00161,291,0000
CDK6112NM_0012591,990,00001,141,0000
GRB2113NM_0020861,970,00001,161,0000
miRNAs, does not impact the response to docetaxel:
The name of the geneIdent. number sequenceCatalog numberRel. IC50p(Rel. IC50)Min. Rel.p(Min. Rel.)
RB1114NM_0003210,870,00611,030,4863
GAPDH115NM_002046ndndndnd
RPS9116BC071941ndndndnd
Notes:
Min. Rel.: The ratio of miRNAs to control at the highest dose of docetaxel
The smaller the p value, the more significant differences between obrazcami control
The values of p, denoted by ^, is high due to the poor approximation of the curve in the curves dose-response relationships, even in spite of the significance and reproducibility of the differences
nd = not determined

EXAMPLE 2: Cross-validation for the subpopulation of miRNAs in increased resistance to docetaxel

A potential disadvantage of the methods of screening for miRNAs comes from the fact that there was a possibility renaturation of miRNAs with transcripts with partial identity or translational initiation blocks micro-RNA (MCMC), which complicates the distinction between specific and non-specific to the target effects (outside customers) (Jacksonet al.,Nat Biotechnol21:635, 2003). To confirm the resistance using an independent approach of the second sequence, BubR1 and Mps1 were obtained stable cell lines after knockdown by infection of HCT116 cells retroviral vector carrying the DNA oligonucleotides encoding short RNA hairpin. Short RNA hairpin contains a different sequence compared with siRNA targeted to a different region of the open reading frame. Retroviral cell line with a defect packaging GP2-293 was obtained from Clontech. The cells were kept in DMEM with the addition of 100 u/ml penicillin, 100 μg/ml streptomycin, 4 mm L-glutamine and 10% fetal bovine serum. Virus g who was narrowly transient transfection of cells GP2-293. Only 3.6×106cells were sown in 10 cm Cup for 24 hours before transfection. The medium was replaced 4 hours before transfection in DMEM containing 10% FBS without antibiotics. The cells were transfusional 6 μg of vector DNA, 6 μg of envelope plasmid VSV-G (Clontech) and 72 μl lipofectamine-2000. The medium was replaced after 14-16 hours; viral supernatant was collected after 24 hours, filtered through 0.45 μm filter and used for infection of HCT116 cells at multiplicity of infection of 5 in the presence of 8 μg/ml polybrene. Forty-eight hours after infection, cells were selected in 0.5 μg/ml puromycin for 7 days or until the death of the background cells. Curves dose-response relationships obtained for BubR1 and Mps1 cell lines after knockdown, again showed increased resistance, which was more pronounced at higher concentrations of docetaxel (figure 2), similar to results obtained at intermediate transfected miRNAs. To check, reduce whether miRNAs levels of mRNA, used real-time PCR for detection of endogenous transcripts and confirmed that the RNA levels decreased in BubR1 and Mps1 stable cell lines after knockdown compared with vector control stable line (figure 3).

Cells were literally and RNA was extracted using RNAqueous-96 (Ambion). Samples Taqman™ and forward and reverse primers were designed using the m software Primer Express™ (PE Applied Biosystems, UK). A BLAST search of the sequences of samples and primers did not reveal identity to other sequences, in addition to specific testable genes. For real-time PCR in each cell was placed 20 ál of master mix TaqMan™: 4,825 ál water without RNase, and 12.5 μl of 2× universal master mix for PCR and of 0.625 μl of 40× mixture MultiscribeTM and RNase inhibitor (Applied BioSystems), and 0.9 µl forward and reverse primers (100 μm), 0,ml sample (100 μm). In each cell was added 5 ál of sample RNA (approximately 1ng/µl). The tablets were analyzed by TaqMan™ ABI Prism 7700 Sequence Detector™ (Perkin-Elmer, UK). The cycle parameters were 48°C for 30 minutes, 95°C for 10 minutes, 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. Values for the test gene mRNA extrapolated from the standard curve and are presented in the residual percentage.

EXAMPLE 3: Suppression of Mad2, BubR1 and Mps1 protects cells from death induced by docetaxel, due to the departure from the stop mitosis in combination with the formation of aneuploidy

As determined by analysis of WST-1, loss of mitotic checkpoint genes in the presence of docetaxel correlated with increased cell viability, emphasizing resistance (figure 1). For additional validation of measurements of WST-1 was conducted cytological experiments to study the morphology and viability of cells (Phi is .4). The cells were monitored using confocal microscopy and Calcein-AM, a vital dye, which provides the green fluorescence in the reaction with intracellular esterase, performing the function of an indicator of metabolically active cells. Figure 4 shows that after 16 hours after the addition of docetaxel cells, transfetsirovannyh miRNAs Mad2, BubR1 and less Mps1 prematurely exited from mitosis in obvious interphase state, which was combined with a flattened morphology of the cells, whereas the majority of cells transfected with control siRNA stayed in mitosis with a round cell morphology. The phenotype of flat cells was previously described for other inhibitors of microcannulas and refers to the ability of cells to exit stop mitosis in, obviously, interphase condition without the actual completion of mitosis (Kunget al., Proc Natl Acad Sci87:9553, 1990; Lanni and Jacks,Mol Cell Biol18:1055, 1998). 72 hours after treatment, the most striking observation for cells with suppression of miRNAs Mad2, BubR1 or Mps1 was the much larger number of cells and their very large size compared to cells transfitsirovannykh control RNA, which were almost destroyed when processed by docetaxel. In the absence of docetaxel cells with suppressed mitotic checkpoint genes looked like control the number of cells in two different time point, and increased number of cells after 72 hours indicates that the cells were actively growing in the presence of miRNAs.

Cells with suppressed mitotic checkpoint genes can avoid stopping mitosis and pre-emerge after treatment with the inhibitors microcannulas, such as colcemid, nocodazole and paclitaxel (Taylor and McKeon,Cell89:727, 1997; Shinet al.,Cancer Cell4:483, 2003; Masudaet al.,Am J Pathol163:1109, 2003; Sudoet al.,Cancer Res64:2502, 2004). To install, how is premature exit from mitosis in HCT116 cells after suppression of three specific checkpoint gene Mad2, BubR1 or Mps1, we measured the mitotic index of transfected cells. Accordingly, cells, transfetsirovannyh miRNAs Mad2, BubR1 or Mps1, selected without treatment (0) or after 8, 16, 24, 36, 48, and 72 hours after treatment with docetaxel, then fixed and incubated with polyclonal antibodies that detect phosphorylation of histone H3 as a sign of mitosis (Mitotic Index Kit, Cellomics). A graphical representation of all points in time is given in figure 5. Mitotic index reached its peak between 16 and 24 hours, indicating that all cases are reported stop mitosis. Mitotic index reached the highest values for cells transfected with control siRNA, while cells transfetsirovannyh peaceful the Mad2 and BubR1, demonstrated a significant reduction in mitotic index. The effects of miRNAs Mps1 were not so serious in comparison with Mad2 and BubR1. The obtained results clearly show that cells with suppression of mitotic checkpoint genes can leave the state stop mitosis induced by docetaxel, and that miRNAs BubR1 was the most effective compared with Mad2 and Mps1.

To exclude the possibility that changes in mitotic index coincided with significant differences in the efficiency of knockdown, to measure levels of mitotic control transcript used real-time PCR. The experiment shown in Fig.6, shows that the levels of mRNA were decreased to comparable levels in cells transfected with Mad2, BubR1 and Mps1 miRNAs, indicating that the difference in mitotic index largely reflects the function of genes.

From microscopy data it was evident that a very large cells may contain abnormal amounts of DNA. In order to further investigate whether these cells with damaged mitotic control genes to overcome the cell cycle arrest induced by docetaxel, and again go in S-phase for the generation of aneuploid cells, the authors conducted a FACS analysis to measure DNA content. Cells transfetsirovannyh Mps1, BubR1, Mad2 and controlengineering, were cultured in the absence and in the presence of docetaxel were fixed and stained propedy-iodide and analyzed using FACS. Data were collected at multiple points in time after the addition of docetaxel (data not shown), and figure 7 shows histograms for points 72 hours. 72 hours after the addition of docetaxel transfection of Mps1, BubR1, Mad2 and miRNAs caused the accumulation of cells with DNA content 8N, 16N, and in the case of BubR1 - 32N. When using only the control siRNA in the presence of docetaxel were recorded population of cells 8N), but the values 8N were much greater for cells with suppressed mitotic control genes. At an earlier point in time after the addition of docetaxel (data not shown) most of the control cells was stopped with 4N, while cells transfetsirovannyh miRNAs Mps1, BubR1 and Mad2, continued growth from 4N to 8N. The results show that knockdown of mitotic checkpoint genes allows cells accumulate faster abnormal levels of DNA and to cross a higher threshold ploidy compared to nematandani cells. These results demonstrate the role of Mad2, BubR1 and Mps1 in the regulation of mitotic index and flow cell cycle in the presence of previously non-characterized inhibitor of microanalyses of docetaxel.

EXAMPLE 4: generation of the colon is th, resistant to docetaxel, in cells with suppression of BubR1

Apoptotic function of BubR1 is important for regulatory compliance chromosomes considering the fact that the lack of expression of BubR1 in combination with agents counteracting microcanonical, was linked to aneuploidy, as the restoration of BubR1 was associated with an activated checkpoint and apoptosis of aneuploid cells (Shinet al.,Cancer Cell4:483, 2003). To determine whether continuous suppression of mitotic checkpoint genes allow cells to grow with a higher proliferative capacity, stable cell lines BubR1 and Mps1 after knockdown (figure 4) were tested with respect to their ability to proliferation and formation of colonies in the constant presence of docetaxel. It was not possible to generate stable cell lines Mad2 after knockdown, because the suppression of Mad2 was deadly to cells (Michelet al.,Proc Natl Acad Sci101:4459, 2004). Stable cell lines after knockdown BubR1, Mps1 and control short RNA hairpin was treated with 5 nm docetaxel for 10 days and then were stained with crystal violet. On Fig shown that cell line after knockdown BubR1 was produced bigger colonies than the control cell line. Cell line after Mps1 knockdown was not in the situation of the Institute to form colonies in the presence of 5 nm of docetaxel. After the plates were incubated for 17 days, was observed colonies on the control tablets, but they were still smaller in number than compared to the line after the knockdown BubR1. The results associated low levels of BubR1, but not

Mps1, with active cell growth in the presence of chemotherapeutic drug docetaxel.

EXAMPLE 5: Cross-validation of miRNAs, which determines an increased sensitivity to docetaxel

In addition to the identification of miRNAs that protect cells from induced by docetaxel death, the screening has identified miRNAs that sensibiliser the cells to die. In table III, Pim-1, p21waf1/Cip1GBP-1, RXRA, Hec1, SPF45, Raf1 are a group of miRNAs that lead to pronounced death at higher concentrations of docetaxel (>6 nm) with a very small shift of the IC50. Curves dose dependence of miRNAs for oncogenic serine/trionychinae Pim-1 and inhibitor p21 cell cyclewaf1/Cip1were very similar (figure 9), which may reflect overlapping or shared role for the signal channel; and previously published reports have shown that p21waf1/Cip1a substrate of Pim-1 (Wanget al.,Biochim Biophys Acta1593:45, 2002). Of additional interest are the data on increased expression of Pim-1 in the epithelial cells of the prostate, which leads to interference mitotic stake is control of genes and genetic instability (Roh et al.,Cancer Res63:8079, 2003). The obtained results are in accordance with data on the lack of expression of Mad2, BubR1 and

Mps1, indicating comparable phenotype with opposite levels of expression (see figure 1). Other miRNAs, which provided a sensitivity to docetaxel was Hec1.

In table III TACC3, RELB, Aurora-A, PRKCD (PKC), HSPA1A and BRAF35 represent miRNAs that increase the sensitivity at lower concentrations of docetaxel (1-6 nm) with a characteristic shift in the IC50. Aurora-A is A serine/trionychinae, which operates at the beginning of mitosis and is involved in the maturation of centrosomes and spindle formation (review Meraldiet al.,Curr Opin GenetDev 14:29, 2004). Of particular interest published data showing that increased expression of Aurora-A in HeLa cells, protected from docetaxel, is in accordance with our results, where the lack of expression of Aurora-A was increased mortality when exposed to docetaxel (Anandet al.,Cancer Cell3:51, 2003). Although this was a slight decrease IC50for Aurora-A, which represented a 25% decrease in survival; however, the results were accurately reproduced using retroviral delivery of a short RNA hairpin, causing stable knockdown of Aurora-A in HCT116 cells (compare figure 9 with figure 10 and 11).

EXAMPLE 6: Pim1 inhibits proliferation clearnet in the absence of docetaxel

For further evaluation of positive screening results, it was important to distinguish miRNAs that affect cell viability in the absence of docetaxel, as well as those that operate together with docetaxel, increasing the death. To distinguish between these possibilities, we investigated the effects of transfection on the proliferation of using exclusion analysis with staining Trifanova blue count the cells to determine the number of viable cells in 6-cell tablets after 24, 48 and 72 hours after transfection. Our results show that miRNAs Pim-1 inhibited the growth of HCT116 cells, whereas miRNAs TACC3 not affect growth (Fig; quantitative data knockdown is shown in Fig), although both miRNAs enhance cell death induced by docetaxel (Fig.9).

EXAMPLE 7: Check subpopulations of resistant and sensitive genes by analysis of the relationship of the survivor to the lost

For visual mapping miRNAs, which determine the sensitivity and resistance to docetaxel, used microscopy to determine the ratio of surviving cells to the lost, while for the painting of the living cells in the green color used Calcein-AM, and for staining the nucleus of dead cells in red color used propedy-iodide (PI). After adding docetaxel is (72 hours) cells BubR1, transfetsirovannyh miRNAs showed the greatest number of viable cells, whereas Pim-1 and TACC3, transfetsirovannyh miRNAs resulted in the greatest number of dead cells and control cells were in an intermediate position (data not shown). Although only some miRNAs BubR1 showed increased cell death after 72 hours, ultimately, the cells became more resistant to docetaxel. One miRNAs Pim-1 caused cell death within 24 hours, whereas TACC3 siRNA did not lead to death. The results show that the suppression of BubR1 was associated with increased cell viability and resistance to drugs, whereas inhibition of Pim-1 and TACC3 was associated with increased cell death and sensitivity to drugs. And Pim-1, and TACC3 showed higher rates of death in the presence of docetaxel, but this analysis was not possible to differentiate between additive and synergistic effects death.

EXAMPLE 8: Induced by docetaxel activity of caspase-3 was decreased by suppressing BubR1 and is enhanced by inhibition of Pim-1

Docetaxel can cause cell death through induction of apoptosis (Kimet al.,Int J Mol Med11:799, 2003). To determine whether miRNAs Pim-1 and BubR1 to modulate canonical apoptotic path in the absence and in presets the following docetaxel, we studied the levels of activated caspase-3 in HCT116 cells (using analysis biocomplex) (Fig). At 48 hours after administration of 40 nm of docetaxel in the control cells were induced activity of caspase-3, and this induction was further confirmed by the inhibition of Pim-1 and decreased by suppression of BubR1 (middle and lower panels). In the absence of docetaxel inhibition of Pim-1 caused a slight decrease in the activity of caspase-3 in the time 24 hours, but after 48 and 72 hours (top panel) was observed returning to the control level, indicating the activation of another mechanism of apoptosis to maintain the increased destruction of cells observed at time 72 hours according to the WST-1 and analysis of the relationship of the SURVIVORS/VICTIMS. Suppression of BubR1 in the absence of docetaxel caused very little increase in the activity of caspase-3, which is consistent with the observation made in the analysis of SURVIVORS/VICTIMS within 72 hours of initial cell death caused by knockdown BubR1. The results additionally indicate that Pim-1 and BubR1 as effectors of death when exposed to docetaxel through the modulation of the activity of caspase-3.

EXAMPLE 9: a transmission Path of a signal involved in caused by docetaxel sensitivity associated with Pim-1, and the resistance associated with BubR1

The functions attributed to the Pim-1, this is positive indicates, she plays a Central role in blocking the transmission of the signal that leads to cell death, while encouraging signals that promote the survival of cells. To try to determine the molecular basis for the increased cell death associated with knockout Pim-1, examined the activation state of key cellular pathway involved in the survival of cells, AKT. HCT116 was sown on 4×105cells/cell 6-cell tablets, and the next day was transicionales miRNAs at a concentration of 16 nm using lipofectamine 2000 (Invitrogen). After 24 hours, cells were left untreated or were treated with 5 and 40 nm of docetaxel. Cells were literally after 24, 48 and 72 hours after addition of docetaxel ice Lisinym buffer (50 mm HEPES buffer (PH7,4), 1% NP40, 2.5 mm EDTA, 100 mm sodium fluoride, 10 mm sodium-PPI, tablet mixture of protease inhibitors (Roche), 2 mm orthovanadate sodium) and centrifuged at 12000g for 10 minutes. Then, lysates quantify the level of total protein using the DC protein analysis (BioRad). The levels of active caspase-3 was determined using a kit for the analysis of active caspase-3 column with beads (Upstate) and system Luminex 100TMwith the protocols suggested by the manufacturer. The levels of total and phosphorylated AKT were determined using a set of printed degranula total antibodies ACT and set deposited on the granules antibodies phosphospecific AKT S473(Biosource) and system Luminex 100TMwith the protocols suggested by the manufacturer.

The experiment shown in Fig shows that inhibition of Pim-1 reduces the basal phosphorylation of the ACT compared with the control, and the effect was significantly increased with increasing concentrations of docetaxel. When comparing the suppression of BubR1 increased basal phosphorylation of the ACT, and the effect was stronger at lower, but not higher concentrations of docetaxel, pointing to the possibility of activation of alternative signaling at higher doses.

The applicants have carried out Western blotting using antibodies against Pim-1 and BubR1 to measure protein levels in a time of 48 hours. Equal amounts of proteins were loaded into the gels NuPAGE Novex Bis-Tris (Invitrogen). Antibodies to Pim-1 (Santa Cruz biotechnology), BubR1 (BD bioscience) and α-tubulin (Sigma) was used according to the manufacturer's instructions. Secondary antibodies conjugatively with HRP (BioRad) and were detected using ECL Western Blot Detection System (Amhersham Biosciences) followed by exposure to Hyperfilm ECL (Amhersham Biosciences). The experiment shown in Fig showed that the protein levels of Pim-1 and BubR1 was reduced in comparison with the control, indicating compliance with low levels of protein functional changes (Fig). The obtained data show that suppression of protein levels of Pim-1 can block the phosphorylation and is ctively AKT, so to condemn cells to apoptosis. Pim-1, obviously, mediates cell survival through activation of the channels, contributing to survival.

The present invention is not limited in scope to those specific implementations, which are described in this document. Indeed, various modifications of the invention, besides the already described herein, will be apparent from the above description and attached drawings. It is assumed that such modifications fall within the scope of the attached claims.

All references cited herein are fully incorporated in this document.

Anand S, Penrhyn-Lowe S, Venkitaraman AR. (2003) AURORA-A amplification overrides the mitotic spindle assembly checkpoint, inducing resistance to Taxol. Cancer Cell. 3:51-62.

Aza-Blanc P, Cooper CL, Wagner K, Batalov S, Deveraux QL, Cooke MP. (2003) Identification of modulators of TRAIL-induced apoptosis via RNAi-based phenotypic screening. Mol Cell. 12:627-37.

Chang JC, Wooten EC, Tsimelzon A, Hilsenbeck SG, Gutierrez MC, Elledge R, Mohsin S, Osborne CK, Chamness GC, Allred DC, O'connell P. (2003) Gene expression profiling for the prediction of therapeutic response to docetaxel in patients with breast cancer. Lancet. 362:362-9.

Hong, WK (2002) The current status of docetaxel in solid tumors. Oncology 16:9-15.

Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J, Mao M, Li B, Cavet G, Linsley PS. (2003) Expression profiling reveals off-target gene regulation by RNAi. Nat Biotechnol. 21:635-7.

Katsumata N. (2003) Docetaxel: an alternative taxane in ovarian cancer. Br J Cancer. 89 Suppl 3:S9-S15.

Kim R, Tanabe K, Uchida Y, Emi M, Toge T. (2003) Effect of Bcl-2 antisense oligonucleotide on drug-sensitivity in association with apoptosis in undifferentiated thyroi carcinoma. Int J Mol Med. 11:799-804.

Kolfschoten GM, Hulscher TM, Duyndam MC, Pinedo HM, Boven E. (2002) Variation in the kinetics of caspase-3 activation, Bcl-2 phosphorylation and apoptotic morphology in unselected human ovarian cancer cell lines as a response to docetaxel. Biochem Pharmacol. 63:733-43.

Kung AL, Sherwood SW, Schimke RT. (1990) Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87:9553-7.

Lanni JS, Jacks T. (1998) Characterization of the p53-dependent postmitotic checkpoint following spindle disruption. Mol Cell Biol. 18:1055-64.

Lee LF, Li G, Templeton DJ, Ting JP. (1998) Paclitaxel (Taxol)-induced gene expression and cell death are both mediated by the activation of c-Jun NH2-terminal kinase (JNK/SAPK). J Biol Chem. 273:28253-60.

Li Y, Dowbenko D, Lasky LA. (2002) AKT/PKB phosphorylation of p21Cip/WAF1 enhances protein stability of p21Cip/WAF1 and promotes cell survival. J Biol Chem. 277:11352-61.

Lum L, Yao S, Mozer B, Rovescalli A, Von Kessler D, Nirenberg M, Beachy PA. (2003) Identification of Hedgehog pathway components by RNAi in Drosophila cultured cells. Science. 299:2039-45.

Masuda A, Maeno K, Nakagawa T, Saito H, Takahashi T. (2003) Association between mitotic spindle checkpoint and his or her susceptibility to the induction of apoptosis by anti-microtubule agents in human lung cancers. Am J Pathol. 163:1109-16.

McManus MT, Sharp PA. (2002) Gene silencing in mammals by small interfering RNAs. Nat Rev Genet. 3:737-47.

Meraldi P, Honda R, Nigg EA. (2004) Aurora kinases link chromosome segregation and cell division to cancer susceptibility. Curr Opin Genet Dev. 14:29-36.

Michel L, Diaz-Rodriguez E, Narayan G, Hernando E, Murty VV, Benezra R. (2004) Complete loss of the tumor suppressor MAD2 causes premature cyclin B degradation and mitotic failure in human somatic cells. Proc Natl Acad Sci U S A. 101:4459-64.

Ojima, I. and Geney, R. 109881 Aventis (2004) Curr Opin Investig Drugs 4:737-40.

Ringel I, Horwitz SB. (1991) Studies with RP 56976 (taxotere): a semisynthetic analogue of taxol. J Natl Cancer Inst. 83:288-91.

Roh M, Gary B, Song C, Said-Al-Naief N, Tousson A, Kraft A, Eltoum IE, Abdulkadir SA. (2003) Overexpression of the oncogenic kinase Pim-1 leads to genomic nstability. Cancer Res. 63:8079-84.

Shin HJ, Baek KH, Jeon AH, Park MT, Lee SJ, Kang CM, Lee HS, Yoo SH, Chung DH, Sung YC, McKeon F, Lee CW. (2003) Dual roles of human BubR1, a mitotic checkpoint kinase, in the monitoring of chromosomal instability. Cancer Cell. 4:483-97.

Simmer F, Moorman C, Van Der Linden AM, Kuijk E, Van Den Berghe PV, Kamath R, Fraser AG, Ahringer J, Plasterk RH. (2003) Genome-Wide RNAi of C. elegans Using the Hypersensitive TTF-3 Strain Reveals Novel Gene Functions. PLoS Biol. 1:E12.

Sudo T, Nitta M, Saya H, Ueno NT. (2004) Dependence of paclitaxel sensitivity on a functional spindle assembly checkpoint. Cancer Res. 64:2502-8.

Tanabe K, Kim R, Inoue H, Emi M, Uchida Y, Toge T. (2003) Antisense Bcl-2 and HER-2 oligonucleotide treatment of breast cancer cells enhances their sensitivity to anticancer drugs. Int J Oncol. 22:875-81.

Taylor SS, McKeon F. (1997) Kinetochore localization of murine Bub1 is required for normal mitotic timing and checkpoint response to spindle damage.Cell. 89:727-35.

Wang TH, Wang HS, Soong YK (2000) Paclitaxel-induced cell death: where the cell cycle and apoptosis come together. Cancer. 88:2619-28.

Wang Z, Bhattacharya N, Mixter PF, Wei W, Sedivy J, Magnuson NS. (2002) Phosphorylation of the cell cycle inhibitor p21Cip1/WAF1 by Pim-1 kinase. Biochim Biophys Acta. 1593:45-55.

Zhou J, Yao J, Joshi HC. (2002) Attachment and tension in the spindle assembly checkpoint. J Cell Sci. 115:3547-55.

1. A method for predicting or monitoring the response of a cancer patient suffering from colon cancer, docetaxel, comprising the following stages:
a) selection of sample for testing from the field of malignant lesions in this patient;
b) selection of the control sample;
c) measuring the level of one or more genetic markers; and
(d) comparison of the measured levels of the specified one or more genetic markers in the sample to test and pin the Aulnay sample;
thus reducing the specified one or more genetic markers measured in the sample for testing in comparison with the control sample indicates an increased resistance to docetaxel, where
specified one or more genetic markers selected from the group including
BubR1, mRNA Homo sapiens similar to protein kinase (BUBR1), full code (catalog number GenBank: AF046079);
Mad2, mRNA Homo sapiens protein MAD2 (catalog number GenBank: AJ000186); Mps1, mRNA Homo sapiens protein kinase TTK (TTK) (catalog number GenBank: NM_003318);
GEFT for Rac1/CDC42, the exchange factor Homo sapiens RAC/CDC42 (GEFT), transcript variant 2, mRNA (catalog number GenBank: NM_133483);
Bub1, homolog 1 (yeast) [Homo sapiens BUB1 budding, eingeborenen-benzimidazole (BUB1), mRNA (catalog number GenBank: NM_004336);
hSepharase, extra spindle poles like 1 Homo sapiens (S. cerevisiae) (ESPL1), mRNA (catalog number GenBank: NM_012291);
CamKIId, calcium/calmodulin-dependent protein kinase (Cam kinase) II Delta (CAMK2D), transcript variant 3, mRNA (catalog number GenBank: NM_001221);
CDK6, cyclin-dependent kinase 6 (CDK6), mRNA (catalog number GenBank: NM_001259); and
GRB2, growth factor Homo sapiens protein 2 associated with the receptor (GRB2), transcript variant 1, mRNA (catalog number GenBank: NM_002086).

2. The method according to claim 1, wherein said level of one or more genetic markers measured by mRNA, DNA or protein.

3. SPO is about according to claim 2, where indicated mRNA is measured using a method selected from the group comprising hybridization at the time of formation, polymerase chain reaction reverse transcriptase, the hybridization of nucleic acids, electrophoresis, Northern-blotting and mass spectrometry.

4. The method according to claim 2, in which the specified DNA is measured using a method selected from the group including quantitative polymerase chain reaction genomic DNA-chip hybridization in the formation, electrophoresis, southern blotting and mass spectrometry.

5. The method according to claim 2, wherein said protein is measured using a method selected from the group including immunoassay, Western blotting, ELISA and mass spectrometry.

6. A kit for predicting or monitoring the response of suffering from colon cancer patients on docetaxel in accordance with the method according to claim 1, where the kit includes antibodies labeled detectable label, antibody fragments labeled with detectable label, or oligonucleotides labeled with detectable label comprising a nucleic acid capable of hybridizing in stringent conditions with the formation of specified or selected genetic markers selected from the group which consists of
BubR1, mRNA Homo sapiens similar to protein kinase (BUBR1), full code (catalog number GenBank: AF046079);
Mad2, mRNA Hom sapiens protein MAD2 (catalog number GenBank: AJ000186);
Mps1, mRNA Homo sapiens protein kinase TTK (TTK) (catalog number GenBank: NM_003318);
GEFT for Rac1/CDC42, the exchange factor Homo sapiens RAC/CDC42 (GEFT), transcript variant 2, mRNA (catalog number GenBank: NM_133483);
Bub1, homolog 1 (yeast) [Homo sapiens BUB1 budding, eingeborenen-benzimidazole (BUB1), mRNA (catalog number GenBank: NM_004336);
hSepharase, extra spindle poles like 1 Homo sapiens (S.cerevisiae) (ESPL1), mRNA (catalog number GenBank: NM_012291);
CamKIId, calcium/calmodulin-dependent protein kinase (Cam kinase) II Delta (CAMK2D), transcript variant 3, mRNA (catalog number GenBank: NM_001221);
CDK6, cyclin-dependent kinase 6 (CDK6), mRNA (catalog number GenBank: NM_001259); GRB2, growth factor Homo sapiens protein 2 associated with the receptor (GRB2), transcript variant 1, mRNA (catalog number GenBank: NM_002086).

7. The kit according to claim 6, where the detected label is selected from the group comprising an enzyme, a radioactive isotope or chemical compound which is fluorescent, chemiluminescent molecule, radiopaque substances, liposomes and heptanone molecule.

8. A kit for predicting or monitoring the response of suffering from rectal cancer patients on docetaxel in accordance with the method according to claim 1, where the kit includes tools
a) obtaining total RNA from taken from the body of the sample for testing;
b) reverse transcription of total RNA to obtain cDNA; and
c) conducting polymerase the th chain reaction with cDNA using primer sets
one or both primers have detektiruya label, and both primers are retrieved from the nucleotide sequence of one or more genetic markers selected from the group consisting of
BubR1, mRNA Homo sapiens similar to protein kinase (BUBR1), full code (catalog number GenBank: AF046079);
Mad2, mRNA Homo sapiens protein MAD2 (catalog number GenBank: AJ000186);
Mps1, mRNA Homo sapiens protein kinase TTK (TTK) (catalog number GenBank: NM_003318);
GEFT for Rac1/CDC42, the exchange factor Homo sapiens RAC/CDC42 (GEFT), transcript variant 2, mRNA (catalog number GenBank: NM_133483);
Bub1, homolog 1 (yeast) [Homo sapiens BUB1 budding, eingeborenen-benzimidazole (BUB1), mRNA (catalog number GenBank: NM_004336); hSepharase, extra spindle poles like 1 Homo sapiens (S.cerevisiae) (ESPL1), mRNA (catalog number GenBank: NM_012291);
CamKIId, calcium/calmodulin-dependent protein kinase (Cam kinase) II Delta (CAMK2D), transcript variant 3, mRNA (catalog number GenBank: NM_001221);
CDK.6, cyclin-dependent kinase 6 (CDK6), mRNA (catalog number GenBank: NM_001259); and
GRB2, growth factor Homo sapiens protein 2 associated with the receptor (GRB2), transcript variant 1, mRNA (catalog number GenBank: NM_002086).

9. The set of claim 8, where the detected label is selected from the group comprising an enzyme, a radioactive isotope or chemical compound which is fluorescent, chemiluminescent molecule, radiopaque substances, liposomes and heptanone say coli.

10. A method for predicting or monitoring the response of a cancer patient suffering from colon cancer, docetaxel, comprising the following stages:
a) selection of sample for testing from the field of malignant lesions in this patient;
b) measuring the level of one or more genetic markers of the group, including
BubR1, mRNA Homo sapiens similar to protein kinase (BUBR1), full code (catalog number GenBank: AF046079);
Mad2, mRNA Homo sapiens protein MAD2 (catalog number GenBank: AJ000186);
Mps1, mRNA Homo sapiens protein kinase TTK (TTK) (catalog number GenBank: NM_003318);
GEFT for Rac1/CDC42, the exchange factor Homo sapiens RAC/CDC42 (GEFT), transcript variant 2, mRNA (catalog number GenBank: NM_133483); Bub1, homolog 1 (yeast) [Homo sapiens BUB1 budding, eingeborenen-benzimidazole (BUB1), mRNA (catalog number GenBank: NM_004336);
hSepharase, extra spindle poles like 1 Homo sapiens (S.cerevisiae) (ESPL1), mRNA (catalog number GenBank: NM_012291);
CamKIId, calcium/calmodulin-dependent protein kinase (Cam kinase) II Delta (CAMK2D), transcript variant 3, mRNA (catalog number GenBank: NM_001221);
CDK6, cyclin-dependent kinase 6 (CDK6), mRNA (catalog number GenBank: NM_001259); and
GRB2, growth factor Homo sapiens protein 2 associated with the receptor (GRB2), transcript variant 1, mRNA (catalog number GenBank: NM_002086);
c) measuring the level of one or more of the control of genetic markers selected from the group, with the standing of
GAPDH, glyceraldehyde-3-phosphatedehydrogenase Homo sapiens (this causes), mRNA (catalog number GenBank: NM__002046); and RPS9, the cDNA clone Homo sapiens IMAGE: 6647283, partial code (catalog number: WS);
(d) comparison of the measured levels of the specified one or more genetic markers and the specified one or more of the control of genetic markers in the sample for testing,
thus reducing the specified one or more genetic markers in comparison with the level of one or more control genetic markers indicates an increased resistance to docetaxel.

11. The method according to claim 10, wherein said level of one or more genetic markers measured by mRNA, DNA or protein.

12. The method according to claim 11, in which the indicated mRNA is measured using a method selected from the group comprising hybridization at the time of formation, polymerase chain reaction reverse transcriptase, the hybridization of nucleic acids, electrophoresis, Northern-blotting and mass spectrometry.

13. The method according to claim 11, in which the specified DNA is measured using a method selected from the group including quantitative polymerase chain reaction genomic DNA-chip hybridization in the formation, electrophoresis, southern blotting and mass spectrometry.

14. The method according to claim 11, wherein said protein ISM is con siderably widening using the method selected from the group including immunoassay, Western blotting, ELISA and mass spectrometry.

15. A kit for predicting or monitoring the response of suffering from rectal cancer patients on docetaxel in accordance with the method of claim 10, where the kit includes antibodies labeled detectable label, antibody fragments labeled with detectable label, or oligonucleotides labeled with detectable label comprising a nucleic acid capable of hybridizing in stringent conditions with the formation of specified or selected genetic markers and the specified or indicated control of genetic markers selected from the group which consists of
BubR1, mRNA Homo sapiens similar to protein kinase (BUBR1), full code (catalog number GenBank: AF046079);
Mad2, mRNA Homo sapiens protein MAD2 (catalog number GenBank: AJ000186);
Mpsi, mRNA Homo sapiens protein kinase TTK (TTK) (catalog number GenBank: NM_003318);
GEFT for Rac1/CDC42, the exchange factor Homo sapiens RAC/CDC42 (GEFT), transcript variant 2, mRNA (catalog number GenBank: NM_133483); Bub1, homolog 1 (yeast) [Homo sapiens BUB1 budding, not inhibited by benzimidazole (BUB1), mRNA (catalog number GenBank: NM_004336);
hSepharase, extra spindle poles like 1 Homo sapiens (S. cerevisiae) (ESPL1), mRNA (catalog number GenBank: NM_012291);
CamKIId, calcium/calmodulin-dependent protein kinase (Cam kinase) II Delta (CAMK2D), transcript variant 3, mRNA (number in to the taloga GenBank: NM_001221);
CDK6, cyclin-dependent kinase 6 (CDK6), mRNA (catalog number GenBank: NM_001259); and
GRB2, growth factor Homo sapiens protein 2 is associated with the receptor (GRB2), transcript variant 1, mRNA (catalog number GenBank: NM_002086);
GAPDH, glyceraldehyde-3-phosphatedehydrogenase Homo sapiens (this causes), mRNA (catalog number GenBank: NM_002046); and
RPS9, the cDNA clone Homo sapiens IMAGE:6647283, partial code (catalog number: WS).

16. Set on 15, where the detected label comprises an enzyme, a radioactive isotope or chemical compound, which is fluorescent, chemiluminescent molecules, radiopaque substances, liposomes and Gapanovich molecules.

17. A kit for predicting or monitoring the response of suffering from rectal cancer patients on docetaxel in accordance with the method of claim 10, where the kit includes tools
a) obtaining total RNA from taken from the body of the sample for testing;
b) reverse transcription of total RNA to obtain cDNA; and
(c) polymerase chain reaction with cDNA using a set of primers, one or both primers have detektiruya label, and both primers are retrieved from the nucleotide sequence of one or more genetic markers selected from the group consisting of
BubR1, mRNA Homo sapiens similar to protein kinase (BUBR1), full code (catalog number GenBank: AF046079);
Mad2, mRNA Homo sapiens protein MAD2 (room b directory GenBank: AJ000186);
Mps1, mRNA Homo sapiens protein kinase TTK (TTK) (catalog number GenBank: NM_003318);
GEFT for Rac1/CDC42, the exchange factor Homo sapiens RAC/CDC42 (GEFT), transcript variant 2, mRNA (catalog number GenBank: NM_133483);
Bub1, homolog 1 (yeast) [Homo sapiens BUB1 budding, not inhibited by benzimidazole (BUB1), mRNA (catalog number GenBank: NM_004336);
hSepharase, extra spindle poles like 1 Homo sapiens (S.cerevisiae) (ESPL1), mRNA (catalog number GenBank: NM_012291);
CamKIId, calcium/calmodulin-dependent protein kinase (Cam kinase) II Delta (CAMK2D), transcript variant 3, mRNA (catalog number GenBank: NM_001221);
CDK6, cyclin-dependent kinase 6 (CDK6), mRNA (catalog number GenBank: NM_001259);
GRB2, growth factor Homo sapiens protein 2 associated with the receptor (GRB2), transcript variant 1, mRNA (catalog number GenBank: NM_002086);
GAPDH, glyceraldehyde-3-phosphatedehydrogenase Homo sapiens (this causes),
mRNA (catalog number GenBank: NM_002046); and
RPS9, the cDNA clone Homo sapiens IMAGE:6647283, partial code (catalog number: WS).

18. Set on 17, where the detected label comprises an enzyme, a radioactive isotope or chemical compound, which is fluorescent, chemiluminescent molecules, radiopaque substances, liposomes and Gapanovich molecules.



 

Same patents:

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to molecular biology and can be used in designing agent and methods of modulating body functions associated with HGF/c-met signalling pathway. The invention discloses HGF/c-met polypeptide-antagonists which are mutant forms of HGF which contain a mutation in the N-terminal part of the β-chain and/or in its dimerisation part. The disclosed polypeptides have lower biological activity compared to wild type HGG and can be used in modulating activity of c-met, cell proliferation, cell migration and angiogenic cell activity.

EFFECT: invention describes a method of obtaining HGF muteins using DNA recombinant technology and agents which are necessary for its existence.

22 cl, 8 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: in order to predict insufficiency of saturation with oxygen of peripheral blood of pregnant women who have herpes-virus infection, content of glucose-6-phosphat-dehydrogenase and TNFα in peripheral blood is determined. Discriminant equation D=-0.589·G-6-PDG+{+1.23·TNFα} is solved. If value of discriminant function is equal or greater than 89.95, predicted is development of oxygen insufficiency, accompanied with reduction in peripheral blood of pregnant women of pO2 with titre of antibodies to Herpes simplex virus 1:12800 to 27.63±0.7 mm Hg, and of HbO2 to 90.2±0.47% (control: pO2 - 39.22±0.5 mm Hg; HbO2 - 95.3±0.27%).

EFFECT: increased accuracy of determining possibility of development of oxygen insufficiency in pregnant woman with herpes-virus infection.

3 tbl

FIELD: medicine.

SUBSTANCE: in estimation of local inflammation activity in case of background diseases of neck of uterus sampling of analysed biomaterial is performed by bringing of device for native material removal to external neck of uterus fauces. Said device has elongated holder in form of rod with length, exceeding length of vagina. From distal side of rod, at angle to it, located is operation element in form of roller. Proximal end of rod serves as manipulator-handle. Sampled material is placed until complete submergence into tightly closable test tube, filled with 1.0 ml of 0.155 M solution of sodium chloride. Mixture is centrifuged for 10 minutes. Obtained materials are analysed by method of solid phase ELISA analysis on boards by means of set of reagents "Vector-Best". Concentration of cytokine of interleukin-6 in analysed samples is determined spectrophotometrically. If value is higher than 50 pg/ml to 92 pg/ml, conclusion about presence of chronic inflammation process is made. If value is higher than 92 pg/ml, conclusion about active course of inflammatory process and expressed immune response is made.

EFFECT: application of method allows to increase quality of analysed native material and accuracy of obtained result without complicating analysis process.

2 cl, 3 ex

FIELD: medicine.

SUBSTANCE: invention can be used for diagnostics of presence of destructive process in uterine appendages in case of localised peritonitis if gynecological genesis, and for selection of optimal treatment tactics. In order to realise the method content of C-reactive protein (CRP) in blood serum is determined by turbodimetric method, if values of C-reactive protein content are 130 mg/l and higher, purulent-destructive process in uterine appendages in case of localised peritonitis is diagnosed, if values of C-reactive protein content are lower than 130 mg/l diagnosed is purulent salpingitis in case of pelvioperitonitis.

EFFECT: application of method allows to detect presence of purulent-destructive process in uterine appendages in case of pelvioperitonitis in urgent way, which determines tactics of further treatment.

2 ex

FIELD: medicine.

SUBSTANCE: invention can be used for obtaining diagnostic and/or therapeutic agents, in particular antibodies, which specifically interact with proteins of cell surface of target cells. Claimed is method of screening phage display library and including it method of isolation of library element, which is specific partner of binding of target cell surface protein, and method of isolation of unknown cell surface protein, specifically interacting with library element. Method of screening phage display library according to invention includes contact of said library with cells of interest with further separation of cells, which bound with one or several elements of expression library, from non-bound elements by separation through organic phase, and differs by introduction of additional stage, which consists in carrying out before said separation of at least one stage of material washing, and ensures essential increase of method efficiency.

EFFECT: higher efficiency.

30 cl, 7 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, particularly to ophthalmology, can be used for prediction of progression of myopia acquired in schools in 10-14 and 15-17 year old children. Blood serum is analysed for cartilage glycoprotein-39 with the use of sandwich-type enzyme immunoassay. If its concentration is within 34.7-53.4 ng/ml in 10-14-year-old children and 22-56.3 ng/ml in 15-17-year-old children, a permanent course of myopia is predicted. The concentration 18.5-33.9 ng/ml in 10-14-year-old children and 53.7-69 ng/ml in 15-17-year-old children enables to predict a progressive course of myopia.

EFFECT: use of the invention improves accuracy of the prediction of clinical course.

4 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to diagnostic techniques and concerns a diagnostic techniques technique for respiratory function of peripheral blood erythrocytes in pregnant women in herpes virus infection episode in the third trimester. The technique consists in determination of glutathione reductase and herpes virus antibody titre concentration by the enzyme immunoassay in peripheral blood in pregnant women suffered from a herpes virus infection episode. If glutathione reductase concentration is 8.36±0.137 E/g Hb (ref. - 7.82±0.185 E/g Hb), herpes virus antibody titre is 1:6400. If herpes virus antibody titre is increased to 1:12800, erythrocyte glutathione reductase concentration is decreased 4.48±0.22 E/g Hb.

EFFECT: technique is characterised by high sensitivity and allows predicting the development of impaired respiratory activity of erythrocytes in the pregnant women with the herpes virus infection episode.

FIELD: medicine.

SUBSTANCE: simultaneously two parametres are determined: for men - in ejaculate, and for women - in discharge of cervical canal, namely, slgA and lactoferrin. If level of secretory immunoglobulin A is 3.01±0.50 mcg/ml and lower and simultaneous level of lactoferrin is 6876±89 ng/ml and higher, gonococcus infection with systemic manifestations is diagnosed, if said condition is absent, localised gonorrhea is diagnosed.

EFFECT: application of claimed method allows carrying out differential diagnostics of various forms of gonococcus infection in case of its oligosymptomatic course.

3 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: before and after treating chronic heart disease, modified LP(a) are determined as follows. Blood serum 0.6 ml is treated with 0.1% Triton X-100 0. 2 ml, incubated for 15 minutes at 20°C. Then 7% polyethylene glycol 6000 is added, incubated with the Sudan Black stain at 40°C for 1 h; it is followed with electrophoretic separation of LP in agarose gel in a cavity 4×20 mm. The decreasing level of modified LP(a) by 40% and more in comparison with the primitive level, treating chronic heart disease treatment is considered as effective.

EFFECT: higher accuracy of estimating clinical effectiveness of chronic heart disease.

1 tbl, 6 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: there is offered a method to assess of enzyme's ability to the level of phosphorylation of polypeptide that implies a reaction of the analysed enzyme and a substratum presented with a biotin-conjugated fragment of 516 to 777 residues of a human insulin 1 receptor substratum (hIRS-1-p30), binding of the reaction product and immobilised streptavidin and detection of the level of phosphorylation by antibodies specific to the phosphorylated polypeptide residues.

EFFECT: according to the invention, the method allows identifying tyrosine and serine proteinases and can be taken as a basis of a test system for new modulators of their activity.

9 cl, 8 dwg, 4 ex

FIELD: veterinary science.

SUBSTANCE: method for assessment of kidney function in felines includes determination of observed level of ghrelin in tissue or biofluid of feline and establishment of direct dependence of observed level of ghrelin on kidney function by comparison of observed level of ghrelin with reference level of ghrelin that characterises normal kidney function. Method for diagnostics of kidney disease in felines includes detection of observed level of ghrelin in tissue or biofluid of feline and comparison of observed ghrelin level with referent level of ghrelin, which characterises normal kidney function, where observed level lower than reference level indicates kidney disease or predisposition to it. Method for detection of kidney disease beginning in felines includes monitoring level of ghrelin in tissue or biofluid of feline for a certain period of time; where beginning is identified, if at any moment of time level of ghrelin decreases compared to initial level that characterises healthy kidney function. Diagnostics set includes (a) one or more test materials to detect observed levels of ghrelin in tissue or biofluid of feline; and (b) one or more user-available mediums bearing the following information: (i) reference level of ghrelin that corresponds to a specific feline; and (ii) algorithm of direct dependence of observed ghrelin level relative to reference level on kidney function or reverse dependence of observed ghrelin level relative to reference level on availability of kidney disease or predisposition to kidney disease.

EFFECT: early diagnostics of kidney function abnormalities in felines.

20 cl, 1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: particles of covering tissues, which are applied for virus isolation, after preliminary washing in medium with increased content of antibiotics, are placed in bottles with nutrient medium - medium EMEM or medium 199 with 2% of cow foetus blood serum and 200 U/ml of penicillin, 200 mcg/ml of streptomycin and 25 mcg/ml of nystatin. Incubation is carried out during 3-5 days at optimal temperature for virus reproduction and constant swing on shaker (50 swings per min.). After that virus separation from tissue is carried out.

EFFECT: application of method allows to increase virus separation efficiency, allows to separate virus in research of clinical material of fishes which had disease at late stage of epizooty, material of fish-virus carriers in inter-epizooty period and in monitoring of sturgeon and carp fish population for presence of herpes-viral disease stimulant and spring viremia, when probability of virus separation by known method is low.

2 ex, 4 tbl, 1 cl

FIELD: medicine.

SUBSTANCE: bacteriological analysis of prostate secretion and post massage urine with parallel determination of patient's immunological characteristics (subpopulation composition of lymphocytes) is carried out. In case if clinical picture of prostatitis is present, uropathogenic bacteria in prostate secretion or in post massage urine are absent, and change of immunological blood characteristics: content of T-lymphocytes (CD3+)>64.0%, NK-cells (CD16+/CD56+)<12.6%> T-suppressors (CD3+/CD8+)>29.0%, T-NK cells (CD3+/CD16+/CD56+)>8.8%, immunoregulatory index <1.29 take place, abacterial prostatitis is diagnosed.

EFFECT: application of method allows to increase reliability of abacterial prostatitis diagnostics.

1 ex

FIELD: medicine.

SUBSTANCE: on the basis of amino acid sequence of domain 10 of type III human fibronectin (10Fn3) obtained is group of mutant polypeptides, able to compete with natural vessel endothelium growth factor (VEGF-A) for binding with receptor VEGFR-2 (KDR), as well as pegylated forms of said polypeptides with improved pharmacokinetic characteristics. It is proposed to use novel polypeptodes and their pegylated derivatives for inhibition of VEGF-mediated biological activities, in particular in therapy of cancer diseases.

EFFECT: increase of medication efficiency.

18 cl, 31 dwg, 11 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: device for collecting data about sample for volumetric calculation of platelets in blood sample contains measuring cavity for reception of blood sample. Measuring cavity has preliminarily fixed thickness. Device for collecting data about sample additionally contains reagent placed in dry form on surface, setting ranges of measuring cavity. Reagent contains hemolysing means for lysing of red blood cells in blood sample and optionally dye for selective staining of platelets in blood sample. System contains device for collecting data about sample and measuring equipment. Measuring equipment contains holder of device for collection of data about sample, light source and system of image formation for obtaining magnified digital image of sample. Measuring device additionally contains image analyser, made with possibility to analyse obtained digital image in order to determine quantity of platelets in blood sample.

EFFECT: accelerated volumetric calculation of platelets.

29 cl, 4 dwg

FIELD: medicine.

SUBSTANCE: there is involved revealing differences between measurement of the analysed substance level in blood samples and measurement of the analysed substance level in reference solutions used for testing of optical devices used to perform these measurements. The reference solution contains: a marking substance revealed by the optical device to distinguish measurements, e.g., of glucose level received for the reference solutions from measurements of glucose level received for biological fluid sample, e.g., blood.

EFFECT: use of the invention allows revealing differences between measurements of the analysed substance level in blood and reference solutions.

2 ex, 2 dwg

FIELD: medicine.

SUBSTANCE: in biopsy samples of lung tissue evaluated is proliferative activity of cells of connective tissue by immunohystochemical method determining proliferation index by means of regulatory protein Ki-67. If in analysed sample proliferation index does not exceed 1%, first stage of pleural empyema is diagnosed. If proliferation index of analysed sample in zone of inflammatory changes is higher than 17% and in zone of lung with visually preserved structure it is from 5% to 12%, II stage of pleural empyema is diagnosed, if proliferation index in zone of inflammatory changes is higher than 17% and in zone of lung with visually preserved structure it is higher than 12%, III stage of pleural empyema is diagnosed.

EFFECT: increased accuracy of pleural empyema stage diagnostics.

3 ex

FIELD: chemistry.

SUBSTANCE: present invention relates to compounds of formula

, in which A is a counter ion, a=1-3, b=0-3, X=1-6C alkyl, R1=1-6C alkyl, one or R2 and R3 is 1-6C alkyl and the other is XN+Hb(R1)3-b, or R2 and R3 form a methylenedioxy group, one or R4 and R5 is a halogen and the other is a halogen-substituted 1-6C alkyl, or R4 and R5 are bonded to form a 6-10C aromatic ring or a substituted 6-10C aromatic ring in which the substitute is selected from 1-6C alkoxy, halogen and halogen-substituted 1-6C alkyl. The invention also relates to a method of measuring content of analysed substance capable of ensuring proportional colour change as a result of a reaction in a biological fluid, involving the following steps: ensuring availability of the disclosed tetrazolium salt as an indicator and determination of concentration of the said analysed substance in the biological fluid using the said tetrazolium salt which is used as an indicator.

EFFECT: agents are highly effective.

24 cl, 7 dwg, 1 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: cell material containing marrow stem cells in a liquid culture medium is placed over a prepared agar medium containing marrow cells producing homing factors. After incubation of the prepared two-layer culture, inadherent cells are transferred to a semi-viscous culture medium and incubated in a mode required for colony-formation. Then by recording the difference of stem cell count in the cell material in the reference, and after placing on the agar medium containing homing factors, stem cells migrated by stem cell homing factor are counted.

EFFECT: invention allows simplifying the method for determination of production of stem cell homing factors due to the use of the agar medium as a semipermeable membrane and the introduction of colony-forming ability change of the cell material as an evaluation criterion of production of stem cell homing factors.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to traumatology and orthopedics. In order to predict development of endoprosthesis instability after total endoprosthetics in connection with osteoarthrosis of hip joint, patient's blood serum is tested. Level of primary, secondary and final isopropanol-soluble products of lipid peroxidation (ISPP, ISSP, ISFP) and ascorbate-induced lipid peroxidation (AOA-1, AOA-2) is determined. ISPP, ISSP, ISFP levels are analysed on 10-14 day after operation, as well as 3 and more months after operation. AOA-1 and AOA-2 levels are analyzed only on 10-14 day after operation. Level of primary, secondary and final isopropanol-soluble products of lipid peroxidation and ascorbate-induced lipid peroxidation relative to norm on 10-14 day after operation and 3 and more months after operation is used to predict development of endoprosthesis instability after endoprosthetics of hip joint.

EFFECT: method is simple, available, efficient for long-term prediction of instability development.

4 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology. The invention describes a yeast cell which contains an interference DNA construct. The construct comprises: a reporter gene under control of a first promoter; one or more in induced promoters called interference promoters selected and fixed in such a way that their activation induces transcriptional interference of the first promoter leading to a detectable decrease in expression of the reporter gene. The cell expresses: a first chimeric protein (Y-AD) formed by a transcription activation domain (AD) fused with a protein Y capable of interacting with at least a partner protein X; a second chimeric protein (X-DBD) formed by a first DNA-binding domain (DBD) fused with a second domain formed by protein X capable of interacting with protein Y, wherein the interaction of the two chimeric proteins X-DBD and Y-AD leads to formation of a functional transcription factor which activates the interference promoter(s). The invention discloses a method of intensifying a compound which inhibits interaction of the first protein X with the second protein Y.

EFFECT: invention enables detection of interruption of protein-protein interaction, as well as identification of alleles lacking on the level of interaction of proteins involved in the protein-protein interactions.

27 cl, 11 dwg, 4 tbl, 11 ex

Up!