Polypeptides, which have antimicrobial action, and polynucleotides coding them

FIELD: medicine, pharmaceutics.

SUBSTANCE: to obtain microbe-resistant plants plant cells are transformed with vector, which contains polynucleotide structure, which codes defensin polypeptide, which has amino-acid sequence C-x (3)-C-x (7, 9)-C-C, C-C-(8)-C-x-C and C-x-C-x (8, 11)- C.

EFFECT: obtaining polypeptide, which can be also applied as drug or veterinary medication, as well as in forage for animals.

23 cl, 4 tbl, 6 ex

 

The technical FIELD

The present invention relates to the selected polypeptides having antimicrobial activity and selected polynucleotide coding for these polypeptides. The invention also relates to the structures of nucleic acids, vectors and cells of the host that contains polynucleotide, as well as to methods of production and use of polypeptides.

BACKGROUND of INVENTION

The present invention is to develop a polypeptide having antimicrobial activity, and coding their polynucleotides.

SUMMARY of the INVENTION

The present invention relates to polypeptides having antimicrobial activity, which contain the amino acid sequence represented: C-x(3)-C-x(7,9)-C-C; C-C-x(8)-C-x-C; or C-x-C-x(8,11)-S.

In the embodiment, polypeptides of the invention are defensively.

In yet another embodiment of the invention the polypeptides selected from the group consisting of:

(a) a polypeptide having the amino acid sequence that has at least 60% identity with:

amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28.

(b) a polypeptide which is encoded by a nucleotide sequence which hybridizes with at least average conditions with (i)

nucleotides 151 to 297 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

nucleotides from 118 to 255 of SEQ ID NO:11, SEQ ID NO:13;

nucleotides from 112 to 255 of SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

nucleotides from 118 to 252 of SEQ ID NO:21;

nucleotides 151 to 297 of SEQ ID NO:23;

nucleotides from 121 to 252 of SEQ ID NO:25; or

nucleotides 145 to 321 of SEQ ID NO:27; or (ii) a complementary circuit (i); and

(C) a variant containing a conservative substitution, a deletion and/or insertion of one or more amino acids of:

amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28.

The present invention also relates to the selected polynucleotide, encoding polypeptides having antimicrobial activity selected from the group consisting of:

(a) polynucleotide encoding the polypeptide having the amino acid sequence, which has the edge is her least 60% identity with:

amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28.

(b) polynucleotide having at least 60% identity with nucleotides 151 to 297 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

nucleotides from 118 to 255 of SEQ ID NO: 11, SEQ ID NO:13;

nucleotides from 112 to 255 of SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

nucleotides from 118 to 252 of SEQ ID NO:21;

nucleotides 151 to 297 of SEQ ID NO:23;

nucleotides from 121 to 252 of SEQ ID NO:25; or

nucleotides 145 to 321 of SEQ ID NO:27; and

(C) polynucleotide that hybridizes when at least Srednerussky conditions with (i):

nucleotides 151 to 297 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

nucleotides from 118 to 255 of SEQ ID NO:11, SEQ ID NO:13;

nucleotides from 112 to 255 of SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19;

nucleotides from 118 to 252 of SEQ ID NO:21;

nucleotides 151 to 297 of SEQ ID NO:23;

nucleotides from 121 to 252 of SEQ ID NO:25; or

nucleotides 145 to 321 of SEQ ID NO:27; or (ii) a complementary circuit (i).

The present invention also relates to the structures of nucleic acids, vectors for recombinant expression and recombinant cells-the household is the s, containing polynucleotide.

The present invention also relates to methods of producing such polypeptides having antimicrobial action, containing (a) culturing recombinant host cells containing the design of nucleic acid containing polynucleotide encoding the polypeptide, under conditions conducive to obtaining a polypeptide; (b) isolation of the polypeptide.

The present invention also relates to methods of using the polypeptides and polynucleotides according to the invention.

DEFINITION

Antimicrobial effects:The term "antimicrobial activity" is defined here as the action, able to lyse cells or to inhibit the cell growth of microbes. For the purposes of this invention, the term "antimicrobial" means that there is bactericidal and/or bacteriostatic and/or fungicidal and/or fungistatic effect, and/or virucidal effect, where the term "bactericidal" should be understood as having the ability to lyse bacterial cells. The term "bacteriostatic" should be understood as having the ability to inhibit the growth of bacteria, i.e. to inhibit the growth of bacterial cells. The term "fungicide" should be understood as having the ability to lyse cells of fungi. The term "fungistatic" should be understood as having the ability to inhibit the growth of fungi, i.e. ingibiruet the growth of fungi cells. The term "viral" should be understood as having the ability to inactivate the virus. The term "microbial cells" means a bacterial or fungal cells (including yeast).

For the purposes of this invention, the term "inhibition of growth of microbial cells" means that the cells are in stationary phase, i.e. they are not capable of reproduction.

For the purposes of the present invention the antimicrobial effect can be determined according to the method described Lehreret al.,Journal of Immunological Methods, Vol. 137 (2) p. 167-174 (1991). Alternatively, the antimicrobial effect can be determined according to NCCLS (National Committee for Clinical Laboratory Standards) from CLSI (Institute of Clinical and Laboratory Standards; formerly known as national Committee for Clinical Laboratory Standards).

Polypeptides having antimicrobial activity may be capable of reducing the number of living cellsEscherichia coli(DSM 1576) to 1/100 after 8 hours (preferably after 4 hours, more preferably after 2 hours, most preferably after 1 hour, and in particular after 30 minutes) incubation at 20°C in 25% (by weight) aqueous solution; preferably, 10% (by weight) aqueous solution; more preferably 5% (by weight) aqueous solution; more preferably, 1% (by weight) aqueous solution; the most is her preferred 0.5% (by weight) aqueous solution; and, in particular, 0.1% (by weight) aqueous solution of the polypeptide having antimicrobial action.

Polypeptides having antimicrobial activity may also be able to inhibit the growth ofEscherichia coli(DSM 1576) for 24 hours at 25°C in the substrate for growth of microorganisms when added to a concentration of 1000 ppm (ppm); preferably when added in a concentration of 500 ppm (ppm); more preferably when added in a concentration of 250 ppm; even more preferably when added in a concentration of 100 ppm; most preferably when added in a concentration of 50 ppm; and, in particular, when added to a concentration of 25 ppm.

Polypeptides having antimicrobial activity may be capable of reducing the number of living cellsBacillus subtilis(ATCC 6633) to 1/100 after 8 hours (preferably after 4 hours, more preferably after 2 hours, most preferably after 1 hour, and in particular after 30 minutes) incubation at 20°C in 25% (by weight) aqueous solution; preferably, 10% (by weight) aqueous solution; more preferably 5% (by weight) aqueous solution; more preferably, 1% (by weight) aqueous solution; most preferably, 0.5% (by weight) aqueous solution; and, in particular, 0.1% (by weight) aqueous solution of the polypeptide possessing the th antimicrobial action.

Polypeptides having antimicrobial activity may also be able to inhibit the growth ofBacillus subtilis(ATCC 6633) for 24 hours at 25°C in the substrate for growth of microorganisms when added to a concentration of 1000 ppm (ppm); preferably when added in a concentration of 500 ppm; more preferably when added in a concentration of 250 ppm; even more preferably when added in a concentration of 100 ppm; most preferably when added in a concentration of 50 ppm; and, in particular, when added to a concentration of 25 ppm.

The polypeptides according to the present invention have at least 20%, preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95%, and even most preferably at least 100% of the antimicrobial activity of the polypeptide consisting of the amino acid sequence represented

amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 po of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28.

Defensin:The term "defensin", as used here, refers to the polypeptides recognized by experts as belonging to the class of defensins antimicrobial peptides. To determine whether the polypeptide by defensins according to the invention, amino acid sequence, preferably, is compared with profile hidden Markov models (hmm profiles) database. PFAM through the use of freely available software package R (see Example 6).

Collection defensins PFAM include Defensin or Defensin mammals" (the access number PF00323), Defensin or Defensin arthropods (access number PF01097), Defensible or "Beta defensin" (the access number PF00711). Defensible or "Defensively propeptide" (the access number PF00879) and Gamma thionin or Gamma-Mininova family" (the access number PF00304).

Defensin may belong to the class of alpha-defensins, class beta-defensins, class theta defensins, classes defensins insects or arthropods or class of plant defensins.

In the embodiment of the invention the amino acid sequence of defensin according to the invention contains 4, 5, 6, 7, 8, 9 or 10 cysteine residues, preferably 6, 7, 8, 9 or 10 cysteine residues, more preferably, 6, 8, and 10 cysteine residues, and, most preferably, 6 or 8 cysteine residues.

Defensin can also be synthetic defensively, combining the characteristic properties of any class of defensins.

Examples of defensins include, but are not limited to, α-Defensin HNP-1 (peptide of human neutrophils), HNP-2 and HNP-3; β-Defensin-12, Josamycin, Klimicin, γ1-purothionins, Defensin And insects and defensive disclosed in PCT applications WO 99/53053, WO 02/06324, WO 02/085934, WO 03/044049, PCT/DK2005/000725 and PCT/DK2005/000735.

The selected polypeptide:The term "isolated polypeptide", as used here, refers to a polypeptide that has at least 20% pure, preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, most preferably at least 90% purity, and even most preferably at least 95% purity, determined by LTOs-PAG.

Almost pure polypeptide:The term "almost pure polypeptide" means here polypeptide preparation which contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, at most 3%, even more preferably at most 2%, most preferably, the bol is the neck 1% and even more preferably at most 0.5% by weight of other polypeptide material with which it is associated untreated. Thus, it is preferable that the almost pure polypeptide has at least 92% pure, preferably at least 94% pure, more preferably at least 95% purity, more preferably at least 96% pure, more preferably at least 97% purity, more preferably at least 98% purity, even more preferably at least 99% pure, most preferably at least 99.5% purity and, even more preferably at least 100% purity by weight of the total polypeptide material present in the preparation.

The polypeptides according to the present invention are, preferably, in almost pure form. In particular, preferably, the polypeptides were mainly in pure form, i.e. that the polypeptide preparation was mostly free of other polypeptide material with which it is associated untreated. This can be achieved, for example, by obtaining the polypeptide is widely known recombinant methods or classical purification methods.

Here, the term "almost pure polypeptide" is synonymous with the terms "isolated polypeptide" or "p is lipacid in the selected form.

Identity:The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "identity".

For the purposes of the present invention, the degree of identity between two amino acid sequences is determined by using the FASTA program, included in version 2,h software package FASTA (see W. R. Pearson and D. J. Lipman (1988), "Improved Tools for Biological Sequence Analysis", PNAS 85:2444-2448; and W. R. Pearson (1990) "Rapid and Sensitive Sequence Comparison with FASTP and FASTA", Methods in Enzymology 183:63-98). Used by the matrix of weights was BLOSUM50, the penalty for skipping was -12 and a fine continuation of the gap was 2.

The degree of identity between two nucleotide sequences is determined using the same algorithm and software package described above. Used by the matrix of weights was the similarity matrix, the penalty for skipping was -16 and fine on the continuation of the gap was-4.

Alternatively, the alignment of two amino acid sequences were determined by using the Needle program from the package EBOSS (http://emboss.org) version 2.8.0. The program Needle performs a General alignment algorithm described in Needleman, S. B. and Wunsch, C. D. (1970) J. MoI. Biol. 48, 443-453. Used the substitution matrix is BLOSUM62, the penalty for the first amino acid gap is equal to 10 and a penalty on the continuation of the gap is equal to 0.5.

The degree of identity m is waiting for the amino acid sequence of the present invention ("sequence of the invention"; for example, amino acids 1 to 49 of SEQ ID NO:2) and a different amino acid sequence ("foreign sequence") is calculated as the number of exact matches in overlapping alignment of the two sequences divided by the length of the sequences of the invention" or the length of the "foreign sequence", any shortest. The result is presented in percent identity.

Full match occurs when the sequence of the invention" or "alien sequence have identical amino acid residues in the same positions overlapping. The sequence length is the number of amino acid residues in the sequence (for example, the length of amino acids 1 to 49 of SEQ ID NO:2 is 49).

Polypeptide fragment:The term "polypeptide fragment" is defined here as a polypeptide having one or more amino acids deleted from the amino and/or carboxy end of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28, or sequences homologous them where the fragment has antimicrobial action.

Suppositionally:The term "suppositionally" is defined here as a nucleotide sequence having one or more nucleotides deleted from the 5' and/or 3' end of SEQ ID NO:1, SEQ ID NO:, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27 or sequences homologous them where suppositionally encodes a polypeptide fragment having antimicrobial action.

Allelic variant:The term "allelic variant" refers to any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic diversity occurs in nature through mutation and can lead to polymorphism within populations. Gene mutations can be silent (no substitutions in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. Allelic variant of a polypeptide is a polypeptide encoded by the allelic variant of a gene.

Almost pure polynucleotide:The term "almost pure polynucleotide", as used here, refers to the drug polynucleotide free from other external or unwanted nucleotides and in a form suitable for use in systems producing created by methods of genetic engineering of proteins. Therefore, almost pure nucleotide contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more is preferable, at most 3%, even more preferably at most 2%, most preferably at most 1%, more preferably at most 0.5% by weight of other polynucleotide material with which it is associated untreated. Almost pure polynucleotide may, however, include natural 5' and 3' untranslated region, such as promoters and terminators. It is preferable that practically pure polynucleotide has at least 90% purity, preferably at least 92% pure, more preferably at least 94% pure, more preferably at least 95% purity, more preferably at least 96% pure, more preferably at least 97% purity, even more preferably at least 98% pure, most preferably at least 99% pure, and even most preferably at least 99.5% purity by weight. Polynucleotide according to the present invention are preferably in almost pure form. In particular, it is preferable that polynucleotide disclosed here were mostly pure", i.e. to a polynucleotide preparation was mostly free of other polynucleotide material with which it is associated untreated. Here, the term "almost pure polynucleotide is sin is Nimes terms "isolated polynucleotide" or "polynucleotide in the selected form. Polynucleotide may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combination thereof.

cDNA:The term "cDNA" is defined here as a DNA molecule, which can be obtained by reverse transcription from a Mature splanirovannaya mRNA molecule obtained from a eukaryotic cell. In cDNA lacks intron sequences that are usually present in the corresponding genomic DNA. The initial primary RNA transcript is the precursor mRNA, which is processed through a series of stages before emergence as a Mature splanirovannaya mRNA. These steps include the removal of intron sequences through a process called splicing. cDNA derived from mRNA, is not, therefore, any intron sequences.

Structure of nucleic acids:The term "design nucleic acid", as used here, refers to a molecule of nucleic acid, one - or two-chain, which is isolated from a naturally occurring gene or which is modified for content segments of nucleic acids so that otherwise would not exist in nature. The term structure of nucleic acids is synonymous with the term "expression cassette"when the design of the nucleic acid with the contains regulatory sequences, required for expression of the coding sequence according to the present invention.

Controlling the sequence:The term "regulatory sequence" is defined here as including all components that are necessary or advantageous for the expression of polynucleotide encoding the polypeptide according to the present invention. Each control sequence may be his or foreign to the nucleotide sequence that encodes a polypeptide. Such regulatory sequences include, but are not limited to, a leader, polyadenylation sequence, a sequence propeptide, promoter, signal peptide sequence, and transcription terminator. At the very least control sequences include a promoter, and transcriptional and translational stop signals. Control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleotide sequence that encodes a polypeptide.

Functionally attached:The term "functionally connected" here means a configuration in which a control sequence is placed at an appropriate position, Rel is relatively coding sequence of the polypeptide sequence so what control sequence controls expression of the coding sequence of the polypeptide.

The coding sequence:When used herein, the term "coding sequence" means a nucleotide sequence, which directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence is usually defined open reading frame, which usually begins with the ATG start codon or alternative start codons, such as GTG or TTG. The coding sequence may be DNA, cDNA or recombinant nucleotide sequence.

Expression:The term "expression" includes any step involved in obtaining a polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification and secretion.

Expression vector:The term "expression vector" is defined here as a linear or circular DNA molecule that contains polynucleotide encoding the polypeptide of the invention, and which is functionally attached to additional nucleotides that provide for its expression.

A host cell:The term "a host cell", as used here, includes any cell type which is susceptible to transformation is, transfection, transduction and similar design of nucleic acid containing polynucleotide of the present invention.

Modification:The term "modification" means any chemical modification of the polypeptide consisting of

amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28; as well as genetic manipulation of the DNA encoding the polypeptide. Modification(s) may(may) be a substitution(s), deletion(s) and/or insertion(s) of amino acid(s), and substitution(s) in the side(s) chain(s) of amino acids; or the use of unnatural amino acids with similar characteristics in amino acid sequence. In particular, the modification(s) may(may) be the formation of amide linkages, such as the formation of the amide bond on the C-end.

Artificial variant:When used herein, the term "artificial variant" means a polypeptide having antimicrobial activity, obtained with the help of an organism expressing a modified nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ I NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27. The modified nucleotide sequence get through human intervention by modification of the nucleotide sequence disclosed in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27.

DETAILED description of the INVENTION

POLYPEPTIDES HAVING ANTIMICROBIAL ACTION

In the first aspect, the invention relates to polypeptides having antimicrobial activity, which contain the amino acid sequence represented: C-x(3)-C-x(7,9)-C-C; C-C-x(8)-C-x-C; or C-x-C-x(8,11)-S.

In the embodiment of the invention the polypeptides contain amino acid sequence represented:

C-x(3)-C-x(7,9)-C-C and C-C-x(8)-C-x-C; or

C-C-x(8)-C-x-C and C-x-C-x(8,11)-C; or

C-x(3)-C-x(7,9)-C-C and C-x-C-x(8,11)-C; or

C-x(3)-C-x(7,9)-C-C and C-C-x(8)-C-x-C and C-x-C-x(8,11).

The consensus C-x(3)-C-x(7,9)-C-C; C-C-x(8)-C-x-C and C-x-C-x(8,11)-C should be interpreted using PROSITE (www.expasy.org/prosite/) format definition of consensus:

for amino acids used standard IUPAC one-letter code;

the symbol "x" is used for the position, permit any amino acid;

- each element in the sample is separated from the next by "-"; and

- repeat element in the consensus is specified by following the item number of the military value or a numerical range in parentheses. For example: x(3) corresponds to x-x-x, x(2,4) corresponds to x-x or x-x-x or x-x-x-X.

For more information on the application of the principle of PROSITE contact Sigrist et al. PROSITE: a documented database using patterns and profiles as motif descriptors.Brief Bioinform.3:265-274 (2002).

In the second aspect, which may be the embodiment of the first aspect, the invention relates to polypeptides containing the amino acid sequence which has a degree of identity with amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28 (i.e. the Mature polypeptide) of at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, and even most preferably at least 97%, which have antimicrobial activity (below "homologous polypeptides"). In a preferred aspect, the homologous polypeptides have an amino acid placentas is required, which differs by ten amino acids, preferably by five amino acids, more preferably by four amino acids, even more preferably by three amino acids, most preferably by two amino acids, and even more preferably one amino acid from amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28.

The polypeptide of the present invention preferably contains the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28, or allelic variant; or a fragment that has antimicrobial activity. In a preferred aspect, the polypeptide contains the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28. In another preferred aspect, the polypeptide contains amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

Amin is acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28, or allelic variant; or a fragment, which has antimicrobial activity. In another preferred aspect, the polypeptide contains amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28.

In another preferred aspect, the polypeptide consists of the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28, or their allelic variants; or a fragment, which has antimicrobial activity. In another preferred aspect, the polypeptide consists of the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28. In another preferred aspect, the polypeptide consists of amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

linakis is from 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28 or allelic variant, or a fragment, which has antimicrobial activity. In another preferred aspect, the polypeptide consists of amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28.

In a second aspect the present invention relates to the selected polypeptides having antimicrobial activity, which is encoded by polynucleotide, hybridization under very mild conditions, preferably mild conditions, more preferably medium conditions, more preferably medium-hard conditions, even more preferably stringent conditions, and most preferably very stringent conditions with (i) nucleotides 151 to 297 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

nucleotides from 118 to 255 of SEQ ID NO:11, SEQ ID NO:13;

nucleotides from 112 to 255 of SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

nucleotides from 118 to 252 of SEQ ID NO:21;

nucleotides 151 to 297 of SEQ ID NO:23;

nucleotides from 121 to 252 of SEQ ID NO:25; or

nucleotides 145 to 321 of SEQ ID NO:27;

(ii) the cDNA sequence contained in nucleotides 1 to 297 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

nucleotides 1 to 255 of SEQ ID NO:11, SEQ ID NO:13;

nucleotides 1 to 255 of SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

nucleotides 1 to 252 of SEQ ID NO:21;

nucleotides 1 to 297 of SEQ ID NO:23;

nucleotides 1 to 252 of SEQ ID NO:25; or

nucleotides 1 to 321 of SEQ ID NO:27;

(iii) suppositionally of (i) or (ii), or (iv) a complementary chain (i), (ii) or (iii) (J. Sambrook, E.F. Fritsch, and T. Maniatus, 1989,Molecular Cloning, A Laboratory Manual,2d edition, Cold Spring Harbor, New York). Suppositionally of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27 contains at least 100 of paired nucleotides, or preferably 200 paired nucleotides. In addition, suppositionally may encode a polypeptide fragment which has antimicrobial activity.

The nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27 or suppositionally, as well as the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28, or their fragments can be used to create a probe nucleic acid for detection and Clonie the Finance DNA encoding polypeptides having antimicrobial activity from strains of different genera or species according to methods well known in the field. In particular, such samples can be used for hybridization with the genomic or cDNA of interest to genus or species, following the standard technique of southern blotting for the detection or selection of the corresponding gene in it. Such probes can be considerably shorter than the entire sequence, but should be at least 14, preferably at least 25, more preferably at least 35, and most preferably at least 75 nucleotides in length. However, it is preferable that the probe nucleic acid has at least 100 nucleotides in length. For example, the probe nucleic acid can have at least 200 nucleotides, preferably at least 250 nucleotides. Can be used as DNA and RNA probes. Probes usually mark for detecting the corresponding gene (for example,32R3H,35S, Biotin or Avidya). Such probes are covered by the present invention.

Library of genomic DNA or cDNA prepared from such organisms may, therefore, be skanirovaniya on DNA hybridized with the samples described above and which encodes a polypeptide having proteomic is one action. Genomic or other DNA from such other organisms may be separated by electrophoresis in agarose or polyacrylamide gel, or other methods of separation. DNA from the libraries or selected DNA can be transferred and immobilized on a nitrocellulose or other suitable material. To detect a clone or DNA which is homologous with SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27, or their suppositionally carrier material is used in the southern band.

For the purposes of the present invention, hybridization indicates that the nucleotide sequence hybridized with labeled probe nucleic acids corresponding to the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27, its complementary sequence, or its suppositionally very soft to very stringent conditions of hybridization. Molecules that hybridized probe nucleic acid can be detected using x-ray film.

In a preferred aspect, the probe nucleic acid is a polynucleotide sequence which encodes the polypeptide of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28, or suppositionally. In another preferred aspect, the probe nucleic acid is SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27. In another preferred aspect, the probe nucleic acid is a region that encodes a Mature polypeptide of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27.

For long probes of length of at least 100 nucleotides defined hybridization conditions from very soft to very hard as prehybridization and hybridization at 42°C in 5X SSPE, 0.3% of SDS, 200 μg/ml destroyed and denatured DNA from salmon sperm, and in 25% formamide for very soft or soft conditions, or 35% formamide for medium or Srednerussky conditions, or 50% formamide for hard or very hard conditions, following the standard technique of southern blotting, optimally, within 12 to 24 hours.

For long probes of length of at least 100 nucleotides carrier material at the end washed three times each for 15 minutes using 2X SSC, and 0.2% SDS preferably at least at 45°C. (very soft shaded relief), more preferably at least at 50°C (soft money), more preferably at least at 55°C (medium shaded), bol is E. preferably, at least at 60°C (Srednerussky shaded relief), even more preferably at least at 65°C (hard money) and most preferably at least at 70°C. (very hard hillshade).

For short probes which are about 15 nucleotides to about 70 nucleotides in length, stiffness terms are defined as prehybridization, hybridization and washing after hybridization at about 5°to about 10°C below the calculated Tm(the melting temperature), using the calculation according to Bolton and McCarthy (1962,Proceedings of the National Academy of Sciences USA48:1390) in 0.9 M NaCI, and 0.09 M Tris-HCI pH of 7.6, 6 mm EDTA, 0,5% NP-40, 1X solution of Denhart, 1 mm sodium pyrophosphate, 1 mm of sodium phosphate monobasic, 0.1 mm ATP, and 0.2 mg of RNA from yeast per ml following standard technique of southern blotting.

For short probes which are about 15 nucleotides to about 70 nucleotides in length, the carrier material is washed once in 6X SSC plus 0.1% of SDS for 15 minutes and twice for 15 minutes using 6X SSC at 5°C to 10°C below the calculated Tm.

In the third aspect of the present invention relates to artificial variants comprising conservative substitution, a deletion and/or insertion of one or more amino acids in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28, or the Mature polypeptide is H. Preferably, amino acid substitutions were insignificant, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of one to about 30 amino acids; small movements amino - or carboxy-ends, such as methionine base; a small linker peptide of up to about 20-25 bases; or a small extension that facilitates purification by changing the total charge or another function, such as polyhistidine plot, antigenic epitope or binding domain.

Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that usually do not alter the specific activity are known in this field and are described, for example, H. Neurath and R.L. Hill, 1979,In, The Proteins,Academic Press, New York. The most common substitutions are Ala/Ser, Val/lle, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/lle, Leu/Val, Ala/Glu is Asp/Gly.

In addition to the 20 standard amino acids, non-standard amino acids (such as 4-hydroxy-Proline, 6-N-methyl-lysine, 2-aminoisobutyric acid, isovaline and alpha-methyl serine) may be a substitute for the amino acid residues of the wild-type polypeptide. A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids can be used instead of the amino acid residues. "Unnatural amino acids" have been modified after synthesis of the protein and/or have a chemical structure in its side chains that differ from it in the usual amino acids. Unnatural amino acids can be chemically synthesized and, preferably, commercially available, and include pipecolinic acid, thiazolidinediones acid, digitopolis, 3 - and 4-methylpropan and 3.3-dimethylpropyl.

Alternatively, amino acid substitutions are substances with modified physicochemical properties. For example, amino acid substitutions can improve thermal stability of the polypeptide, change substrate specificity, to change the pH optimum and the like.

Essential amino acids in the parent polypeptide can be identified by methods known in science, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cuningham and Wells, 1989,Science244: 1081-1085). In the latter technique, single alanine mutations are inserted at every residue in the molecule, and the resultant mutant molecules are tested for biological activity (i.e., the antimicrobial effect), to detect amino acid residues that are critical for activity of the molecule. Cm. also Hiltonet al.,1996,J. Biol. Chem.271: 4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, which is determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity tagging in combination with mutation of amino acids possible site of contact. See, for example, de Voset al., 1992,Science255: 306-312; Smithet al.,1992,J. MoI. Biol.224: 899-904; Wlodaveret al.,1992,FEBS Lett.309:59-64. Conclusion on identification of essential amino acids can also be made from the analysis of identity with the polypeptides that are associated with the polypeptides according to the invention.

Single or multiple amino acid substitutions can be made and tested using known methods of mutagenesis, recombination, and/or rearrangement and subsequent procedure of the corresponding screening, such as those disclosed in Reidhaar-Olson and Sauer, 1988,Science241: 53-57; Bowie and Sauer, 1989,Proc. Natl. Acd. Sci. USA86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that may be used include the wrongly-directed error-PCR, phage display (e.g., Lowmanet al.,1991,Biochem.30:10832-10837; U.S. patent No. 5223409; WO 92/06204) and region-directed mutagenesis (Derbyshireet al.,1986,Gene46:145; Neret al.,1988,DNA7:127).

Methods of mutagenesis/shuffling can be combined with the methods of high-performance automated screening to detect activity of cloned mutant polypeptides expressed in cells of the host. Mutated DNA molecules that encode active polypeptides can be isolated from the host cells and rapidly sequenced using standard methods in the field. These methods allow you to quickly determine the importance of individual amino acid residues in the polypeptide of interest and can be applied to polypeptides of unknown structure.

The total number of amino acid substitutions, deletions and/or insertions

in amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28 is 10, preferably 9, more pre is respectfully, 8, more preferably 7, more preferably at most 6, more preferably at most 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.

In a preferred embodiment of the invention the polypeptides according to the invention are polypeptides of defensins.

N-terminal extension

N-terminal extension of the polypeptides according to the invention can accordingly be from 1 to 50 amino acids, preferably from 2 to 20 amino acids, especially from 3 to 15 amino acids. In one embodiment of the invention N-terminal peptide continuation does not contain Arg (R). In another embodiment of the invention the N-terminal extension contains a kex2 or kex2-like cleavage sites defined further below. In a preferred embodiment of the invention the N-terminal extension is a peptide containing at least two of Glu (E) and/or Asp (D) amino acid residues, such as N-terminal extension that contains one of the following sequences: EAE, IT, DE and DD.

The kex2 sites

The kex2 sites (see, for example, Methods in Enzymology VoI 185, ed. D. Goeddel, Academic Press Inc. (1990), San Diego, CA, "Gene Expression Technology") and kex2-like site is a dibasic recognition sites (i.e., sites of cleavage), found between the coding propeptide region is a region of the Mature peptide in some proteins.

In some cases it has been shown that inserting a kex2 or kex2-like site improves the correct processing by the endopeptidase site Rosaline propeptide, leading to increased levels of secretion of the protein.

In the context of the invention to insert a kex2 or kex2-like site leads to the possibility to obtain cleavage at a certain position in the N-terminal extension, leading to the following antimicrobial peptide compared to the Mature polypeptide shown as amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28.

Fused polypeptides

The polypeptides according to the present invention also include fused polypeptides or split fused polypeptides in which another polypeptide is linked to the N-end or the end of a polypeptide of the invention or its fragment. Fused polypeptide get by merging the nucleotide sequence (or portion thereof), encoding another polypeptide to a nucleotide sequence (or part thereof) of the present invention. Methods for obtaining the fused polypeptides are known in the science and in luchot ligation of coding sequences, encoding the polypeptides so that they are in the frame, and that the expression of the fused polypeptide is under the control of the same promoter(s) and terminator.

Sources of polypeptides having antimicrobial action

The polypeptides according to the present invention can be obtained from microorganisms of any genus. For the purposes of the present invention, the term "obtained from"as used herein, in connection with a given source shall mean that the polypeptide encoded by the nucleotide sequence produced by this source or strain, in which was embedded the nucleotide sequence of the source. In a preferred aspect, the polypeptide obtained from this source, is secreted outside the cell.

The polypeptide according to the present invention may be a bacterial polypeptide. For example, the polypeptide may be from gram-positive bacteria, such as the polypeptide of theBacillusfor example, the polypeptide of theBacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus B. megaterium, Bacillus stearothermophilus, Bacillus subtilisorBacillus thuringiensis; or the polypeptide of theStreptomycesfor example, the polypeptide of theStreptomyces lividansorStreptomyces murinus; or the polypeptide of gram-negative bacteria, for example, the polypeptide of theE. coliorPseudomonas sp..

The polypeptide according to the SNO present invention may be a fungal polypeptide, and, more preferably, yeast polypeptide such as a polypeptide of theCandida, Kluyveromyces, Pichia, Saccharomyces, SchizosaccharomycesorYarrowia; or, more preferably, a polypeptide of the filament fungi, such as the polypeptide of theAcremonium, Aspergillus, Aureobasidium, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, TolypocladiumorTrichoderma.

In a preferred aspect, the polypeptide is a polypeptide fromSaccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensisorSaccharomyces oviformis,having antimicrobial action.

In another preferred aspect, the polypeptide is a polypeptide fromAspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium frost, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reeseiorTrichoderma viride.

In another preferred aspect, the polypeptide is a polypeptide fromArenicola marinafor example, the polypeptide of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:2, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28.

It will be understood that for the aforementioned species of the invention covers both perfect and imperfect stages, and other taxonomic equivalents, for example, anamorphic, regardless of the form under which they are known. Experts can easily recognize the identity of the relevant equivalents.

Strains of these species are easily available to the public in a number of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).

Further, such polypeptides can be detected and obtained from other sources including microorganisms isolated from nature (e.g., soil, compost, water and the like), using the above sample. Methods for isolation of microorganisms from natural habitats is well known in science. Polynucleotide can then be obtained by simple screening of genomic or cDNA library of another microorganism. As soon as the polynucleotide sequence encoding the polypeptide is detected by the probe (s), polynucleotide you can select or clone, using techniques that are well known to the person skilled in the art (see, for example, Sambrooket al.,1989,supra).

The polypeptides according to the present invention also include the cast polypeptides or cleaved polypeptide furni, in which another polypeptide is fused to the N-end or the end of the polypeptide or its fragment. Fused polypeptide is produced by merging the nucleotide sequence (or portion thereof), encoding another polypeptide to a nucleotide sequence (or its fragment) according to the present invention. Methods for obtaining a polypeptide furnow are known in science and include ligation of coding sequences that encode polypeptides so that they were in the frame and to the expression of the fused polypeptide under control of the same promoter(s) and terminator.

Polynucleotide

The present invention also relates to the selected polynucleotide having a nucleotide sequence that encodes a polypeptide according to the present invention. In a preferred aspect, the nucleotide sequence set in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27. In another preferred aspect, the nucleotide sequence is a region that encodes a Mature polypeptide of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27. The present invention also encompasses nucleotide sequences that encode the polyp is ptid, having the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28, or their Mature peptides, which differ from SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27 due to the degeneracy of the genetic code. The present invention also relates to suppositionally of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27, which encode fragments of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28 having antimicrobial action.

The present invention also relates to mutant polynucleotides containing at least one mutation in the sequence encoding the Mature polypeptide of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27, in which the mutant nucleotide sequence encodes a polypeptide consisting of

amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28.

Techniques used for selection or cloning polynucleotide encoding the polypeptide, are known in the prior art and include isolation from genomic DNA, from cDNA, or a combination of both. Cloning polynucleotides according to the present invention from such genomic DNA can be performed, for example, through the use of polymerase chain reaction (PCR) or by screening antibody expression libraries to detect DNA fragments with shared structural properties. See, for example, Inniset al.,1990, PCR:A Guide to Methods and Application, Academic Press, New York. Other methods of nucleic acid amplification, such as ligase chain reaction (LCR), legirovannye activated transcription (LAT) and based on the nucleotide sequence amplification (CCNSO), can be used. Polynucleotide can be cloned from a strain ofAspergillus,or another or related organism and thus, for example, may be an allelic or species variant encodes a polypeptide region of the nucleotide sequence.

The present invention also relates to polynucleotides having nucleotide sequences which have a degree of identity to the sequence that encodes a Mature polypeptide of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27 (i.e. the nucleotides 151 to 297 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9; nucleotides from 118 to 255 of SEQ ID NO:11, SEQ ID NO:13; nucleotides from 112 to 255 of SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19; the nucleotides from 118 to 252 of SEQ ID NO:21; the nucleotides 151 to 297 of SEQ ID NO:23; the nucleotides from 121 to 252 of SEQ ID NO:25; or nucleotides 145 to 321 of SEQ ID NO:27) at least 60%, preferably at least 65%, more preferably at at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95% and most preferably at least 97% identity, which encode an active polypeptide.

Modification of a nucleotide sequence that encodes a polypeptide according to the present invention, it may be necessary for the synthesis of polypeptides that are substantially similar to the polypeptide. The term "substantially similar" to the polypeptide is not naturally occurring form of the polypeptide. These polypeptides may differ in some engineered way from the polypeptide isolated from its natural source, for example, artificial variants that differ in specific activity, thermostability, the optimum R is or the like. The variant sequence may be constructed on the basis of the nucleic acid sequence presented as encoding a polypeptide region of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27, for example, it suppositionally and/or by introduction of nucleotide substitutions that are not source another amino acid sequence of the polypeptide encoded by the nucleotide sequence, but which correspond to the triplets of the host body, intended for the production of the enzyme, or by incorporation of nucleotide substitutions that may be the source excellent amino acid sequence. For a General description of nucleotide substitutions, see, for example, Fordet al.,1991,Protein Expression and Purification2: 95-107.

Specialists will be obvious that such substitutions can be made outside the regions critical to the functioning of the molecule and still result in an active polypeptide. Amino acid residues required for activity of the polypeptide encoded by the selected polynucleotide according to the invention and, thus, preferably, not objects to replace, can be identified by methods known in science, such as site-directed mutagenesis or alanine-scanning mutage the ez (see, for example, Cunningham and Wells, 1989,Science244: 1081-1085). In the latter technique mutations are introduced at every positively charged residue in the molecule, and the resultant mutant molecules are tested for antimicrobial action for detection of amino acid residues that are critical for activity of the molecule. The sites of interaction of substrate-enzyme can be determined by analyzing the three-dimensional structure, which is determined by such techniques as nuclear magnetic resonance, crystallography or photoaffinity tagging (see, for example, de Voset al.,1992,Science255: 306-312; Smithet al.,1992,Journal of Molecular Biology224: 899-904; Wlodaveret al.,1992,FEBS Letters309: 59-64).

The present invention also relates to the selected polynucleotide coding for the polypeptide according to the present invention, which hybridize under mild conditions, preferably medium conditions, more preferably medium-hard conditions, even more preferably stringent conditions, and most preferably very stringent conditions with (i) nucleotides 151 to 297 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

nucleotides from 118 to 255 of SEQ ID NO:11, SEQ ID NO:13;

nucleotides from 112 to 255 of SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

nucleotides from 118 to 252 of SEQ ID NO:21;

nucleotides 151 to 297 of SEQ ID NO:23;

nucleotides from 121 to 252 of SEQ ID NO:25; or

the nucleotides is from 145 to 321 of SEQ ID NO:27;

(ii) the cDNA sequence contained in nucleotides 1 to 297 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

nucleotides 1 to 255 of SEQ ID NO:11, SEQ ID NO:13;

nucleotides 1 to 255 of SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

nucleotides 1 to 252 of SEQ ID NO:21;

nucleotides 1 to 297 of SEQ ID NO:23;

nucleotides 1 to 252 of SEQ ID NO:25; or

nucleotides 1 to 321 of SEQ ID NO:27; or

(iii) a complementary circuit (i) or (ii); or allelic variants or suppositionally (Sambrooket al.,1989,supra), which are defined here.

The present invention also relates to the selected polynucleotides obtained by (a) hybridizing a population of DNA in soft, medium, medium-hard, hard, or very hard conditions with (i) nucleotides 151 to 297 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

nucleotides from 118 to 255 of SEQ ID NO:11, SEQ ID NO:13;

nucleotides from 112 to 255 of SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

nucleotides from 118 to 252 of SEQ ID NO:21;

nucleotides 151 to 297 of SEQ ID NO:23;

nucleotides from 121 to 252 of SEQ ID NO:25; or

nucleotides 145 to 321 of SEQ ID NO:27;

(ii) the cDNA sequence contained in nucleotides 1 to 297 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

nucleotides 1 to 255 of SEQ ID NO:11, SEQ ID NO:13;

nucleotides 1 to 255 of SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

nucleotides 1 to 252 of SEQ ID NO:21;

nucleotides 1 to 297 of SEQ ID NO:23;

n is cleotide from 1 to 252 of SEQ ID NO:25; or

nucleotides 1 to 321 of SEQ ID NO:27; or

(iii) a complementary circuit (i) or (ii); and (b) allocation hybridities of polynucleotide, which encodes a polypeptide having antimicrobial action.

Structure of nucleic acids

The present invention also relates to the structures of nucleic acids containing the selected polynucleotide according to the present invention, functionally attached to one or more control sequences that direct the expression of the coding sequence in a suitable cell host under conditions compatible with the control sequences.

With a dedicated polynucleotide coding for the polypeptide according to the present invention, can be manipulated in various ways to provide for expression of the polypeptide. Manipulation sequence polynucleotide before embedding it into a vector may be desirable or necessary depending on expressing vector. Methods for modification of the polynucleotide sequences using methods of recombinant DNA, widely known in science.

The control sequence may be an appropriate promoter sequence, a nucleotide sequence that is recognized by the host-cell for expression Poliny is eotide, encoding the polypeptide of the present invention. The promoter sequence contains sequences control transcription, which mediate the expression of the polypeptide. The promoter may be any nucleotide sequence which shows transcriptional activity in the selected cell host, including mutant, reduced or hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides, or homologous or heterologous to the host cell.

Examples of suitable promoters for directing the transcription of the structures of nucleic acids according to the present invention, especially in a bacterial cell host, are the promoters obtained fromlacoperonE. coliGena , and agarases (dagAfromStreptomyces coelicolor, gene Lavansaari (sacBfromBacillus subtilis, gene alpha-amylase (amyLfromBacillus licheniformis, gene maltogenic amylase (amyM) fromBacillus stearothermophilus(amyM), the gene alpha-amylase (amyQ) fromBacillus amyloliquefaciens, gene penitsillinazy (penPfromBacillus licheniformisgenesxylAandxylBfromBacillus subtilisand prokaryotic gene beta-lactamase (Villa-Kamaroffet al.,1978,Proceedings of the National Academy of Sciences USA75: 3727-3731), as well astacthe promoter (DeBoeret al.,1983,Proceedings of the National Academy of Sciences USA80: 21-25). Additional promoters are described in "Useful poteins from recombinant bacteria" in Scientific American, 1980, 242: 74-94; and in Sambrooket al.,1989,supra.

Examples of suitable promoters for directing the transcription of the structures of nucleic acids according to the present invention in the cells-the owners of the filament fungi are the promoters obtained from the genes TAKA amylase fromAspergillus oryzae, aspartate protease fromRhizomucor mieheineutral alpha-amylase fromAspergillus niger, acid-stable alpha-amylase fromAspergillus niger, glucoamylase (glaAfromAspergillus nigerorAspergillus awamori, lipase fromRhizomucor mieheialkaline protease fromAspergillus oryzae, triose-phosphate isomerase fromAspergillus oryzae, acetamidate fromAspergillus nidulans, amyloglucosidase fromFusarium venenatum(WO 00/56900), Daria fromFusarium venenatum(WO 00/56900), Quinn fromFusarium venenatum(WO 00/56900), trypsin-like protease fromFusarium oxysporum(WO 96/00787), beta-glucosidase fromTrichoderma reesei, cellobiohydrolase I ofTrichoderma reeseiendoglucanase I ofTrichoderma reeseiendoglucanase II fromTrichoderma reeseiendoglucanase III of theTrichoderma reeseiendoglucanase IV of theTrichoderma reeseiendoglucanase V fromTrichoderma reesei, xylanase I fromTrichoderma reesei, xylanase II fromTrichoderma reeseibeta-xyloside fromTrichoderma reesei, as well as the NA2-tpi promoter (a hybrid of the promoters from the genes of neutral alpha-amylase fromAspergillus nigerand triose-phosphate isomerase fromAspergillus oryzae); and mutant, truncated, or hybrid promoters E. the CSOs.

The owners of the yeast used by promoters obtained from the genes enolase (ENO-1)Saccharomyces cerevisiae, galactokinase (GAL1) fromSaccharomyces cerevisiae, alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP) fromSaccharomyces cerevisiaetriose-phosphate isomerase (TPI) of theSaccharomyces cerevisiae, metallothionein (CUP1) fromSaccharomyces cerevisiaeand 3-phosphoglycerate kinase fromSaccharomyces cerevisiae. Other passing promoters for yeast host cells are described Romanoset al.,1992,Yeast8: 423-488.

The regulatory sequence may also be an appropriate sequence terminator of transcription, a sequence recognized by the cell-master to stop transcription. Termination sequence is functionally attached to the 3'-end a nucleotide sequence that encodes a polypeptide. Any terminator which is functional in the selected cell as the host, can be used in the present invention.

Preferred terminators for host cells of the filament fungi are derived from genes TAKA amylase fromAspergillus oryzae, glucoamylase fromAspergillus nigeranthranilate synthetase fromAspergillus nidulansalpha-glucosidase fromAspergillus nigerand the trypsin-like protease fromFusarium oxysporum.

Preferred terminators for yeast host cells are obtained from genomanalyse from Saccharomyces cerevisiae, cytochrome C (CYC1) fromSaccharomyces cerevisiaeand glyceraldehyde-3-phosphate dehydrogenase fromSaccharomyces cerevisiae. Other applicable terminators for yeast host cells are described Romanoset al.,1992,supra.

The regulatory sequence can also be a leader sequence, untranslated region of mRNA that is important for translation of the host-cell. A leader sequence is functionally attached to the 5'-end a nucleotide sequence that encodes a polypeptide. Any leader sequence that is functional in the selected cell as the host, can be used in the present invention.

Preferred leaders for host cells of the filament fungi are derived from genes TAKA amylase fromAspergillus oryzaeand triose-phosphate isomerase fromAspergillus nidulans.

Suitable leaders for yeast host cells are obtained from the genes enolase fromSaccharomyces cerevisiae3-phosphoglycerate kinase fromSaccharomyces cerevisiaethe alpha-factor ofSaccharomyces cerevisiaeand alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP) fromSaccharomyces cerevisiae.

The regulatory sequence may also be a polyadenylation sequence, a sequence operatively linked to the 3'-end nucleotide of th is of the sequences, and that when transcription recognized by the host-cell as a signal to add residues polyadenine transcribed to RNA. Any polyadenylation sequence which is functional in the selected cell as the host, can be used in the present invention.

Preferred polyadenylation sequences for host cells of the filament fungi are derived from genes TAKA amylase fromAspergillus oryzae, glucoamylase fromAspergillus nigeranthranilate synthetase fromAspergillus nidulansthe trypsin-like protease fromFusarium oxysporumand alpha-glucosidase fromAspergillus niger.

Suitable polyadenylation sequence for yeast host cells described by Guo and Sherman, 1995,Molecular Cellular Biology15: 5983-5990.

The regulatory sequence may also be encoding the signal peptide region, which encodes the amino acid sequence associated with aminocom.com polypeptide and directs the encoded polypeptide in the cell secretory pathway. the 5'-end coding sequence of the nucleotide sequence may inherently contain encoding the signal peptide region naturally linked in reading frame broadcast to the segment of the coding region which encodes a secretory polypeptide. Alternatively, 5'-who once coding sequence can include encoding the signal peptide region, which is alien to the coding region. Alien encoding a signal peptide region may be required when the coding sequence does not contain inherently encoding the signal peptide region. Alternatively alien encoding a signal peptide region may simply replace the natural encoding the signal peptide region to enhance secretion of the polypeptide. However, any encoding a signal peptide region, which directs the expressed polypeptide in the secretory path selected host cell may be used in the present invention.

Current encoding the signal peptide regions for bacterial host cells are encoding the signal peptide region derived from genes maltogenic amylase fromBacillusNCIB 11837, alpha-amylase fromBacillus stearothermophilus, subtilisin fromBacillus licheniformisbeta-lactamase fromBacillus licheniformisneutral proteases (nprT, nprS, nprMfromBacillus stearothermophilusandprsAfromBacillus subtilis. Signal peptides are described Simonen and Palva, 1993,Microbiological Reviews57: 109-137.

Current encoding signal peptides areas for host cells of the filament fungi are encoding the signal peptide region derived from genes TAKA amylase fromAspergillus oryzaeneutral amylase fromAspegillus niger , glucoamylase fromAspergillus niger, aspartate protease fromRhizomucor miehei, cellulase fromHumicola insolensand lipase fromHumicola lanuginose.

In a preferred aspect, the coding of the signal peptide region is nucleotides 1 to 57 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO:9, which encode amino acids from -50 to -32 from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10; nucleotides 1 to 63 of SEQ ID NO:11 or SEQ ID NO:13, which encode amino acids from -39 to -19 from SEQ ID NO:12 or SEQ ID NO:14; nucleotides 1 to 63 of SEQ ID NO:15, SEQ ID NO:17 or SEQ ID NO:19, which encode amino acids from -37 to -17 from SEQ ID NO: 16, SEQ ID NO: 18 or SEQ ID NO:20; nucleotides 1 to 63 of SEQ ID NO:21, which encode amino acids from -39 to -19 from SEQ ID NO:22; nucleotides 1 to 57 of SEQ ID NO:23, which encode amino acids from -50 to -32 from SEQ ID NO:24; nucleotides 1 to 63 of SEQ ID NO:25, which encode amino acids from -40 to -20 of SEQ ID NO:26; or nucleotides 1 to 66 of SEQ ID NO:27, which encode amino acids from -48 to-27 of SEQ ID NO:28.

Suitable signal peptides for yeast host cells are obtained from the genes for alpha-factor ofSaccharomyces cerevisiaeand invertase fromSaccharomyces cerevisiae. Other applicable region encoding signal peptides described Romanoset al.,1992,supra.

The regulatory sequence may also be coding propeptide region, which encodes the amino acid sequence, located on Aminogen the e polypeptide. The resulting polypeptide is called proferment or propolypeptide (or simagena in some cases). Propolypeptide is generally inactive and can be converted into the Mature active polypeptide by catalytic or autocatalytic cleavage of propeptide from propolypeptide. The coding propeptide region can be obtained from the genes for alkaline protease (aprEfromBacillus subtilisneutral protease (nprTfromBacillus subtilisthe alpha-factor ofSaccharomyces cerevisiae, aspartate protease fromRhizomucor mieheiand laccase fromMyceliophthora thermophila(WO 95/33836).

In a preferred aspect, the coding propeptide region is nucleotides 58 to 150 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO:9, which encode amino acids from -31 to -1 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10; nucleotides 64 to 117 of SEQ ID NO:11 or SEQ ID NO:13, which encode amino acids -18 to -1 of SEQ ID NO:12 or SEQ ID NO:14; nucleotides 64 to 111 of SEQ ID NO:15, SEQ ID NO:17 or SEQ ID NO:19, which encode amino acids -16 to -1 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20; nucleotides 64 to 117 of SEQ ID NO:21, which encode amino acids -18 to -1 of SEQ ID NO:22; nucleotides 58 150 of SEQ ID NO:23, which encode amino acids from -31 to -1 of SEQ ID NO:24; nucleotides 64 to 120 of SEQ ID NO:25, which encode amino acids -19 to -1 of SEQ ID NO:26; or nucleotides 67 to 144 of SEQ ID NO:27, which encode amino acids is t -26 to -1 of SEQ ID NO:28.

Where region and signal peptide and propeptide attend aminocore polypeptide, the area propeptide is located in front of aminocom.com polypeptide, and the region of the signal peptide is located in front of aminocom.com area propeptide.

Also, it may be desirable to add regulatory sequences which allow to regulate the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those that cause the activation and deactivation of gene expression in response to chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include the operator of the systemlac,tacandtrp. In yeast can be used system ADH2 or system GAL1. In filament mushrooms as regulatory sequences can be used promoter TAKA alpha-amylase promoter of glucoamylase fromAspergillus nigerand the promoter glucoamylase fromAspergillus oryzae. Other examples of regulatory sequences are those that allow amplification of the gene. In eukaryotic systems, these include gene dihydrotetrazolo that amplificates in the presence of methotrexate, and genes metallothionein that it provided amplification with heavy metals. In these cases, encoding a polypeptide NUS is eathena sequence would be functionally attached to a regulatory sequence.

The expression vectors

The present invention also relates to recombinant expression vectors containing polynucleotide according to the present invention, the promoter and stop signals of transcription and translation. Different sequences of nucleic acids and control sequences described above may be joined together with obtaining a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the nucleotide sequence that encodes a polypeptide at such sites. Alternatively, the nucleotide sequence according to the present invention can be expressed by embedding the nucleotide sequence or structure of the nucleic acid containing the sequence into an appropriate vector for expression. When creating the expression vector the coding sequence is located in the vector so that the coding sequence is functionally connected to the appropriate control sequences for expression.

The recombinant expression vector may be any vector (e.g., plasmid or virus), which can be conveniently subjected to the techniques of recombinant DNA and mo is et to carry out the expression of the nucleotide sequence. The choice of the vector will typically depend on the compatibility of the vector with the host-cell into which the vector. The vectors may be linear or closed circular plasmid.

The vector may be a stand-alone can replicate vector, i.e. a vector which exists as an extrachromosomal unit, the replication of which is independent of chromosomal replication, e.g. a plasmid, an extrachromosomal element, minichromosomes or artificial chromosome. The vector can contain any mechanisms to ensure or infect other programs. Alternatively, the vector may be one which, when introduced into the cell host is integrated into the genome and replicated together with the chromosome(s)into which it was integrated. Additionally, there may be used a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to integrate into the genome of the host cell, or a transposon.

The vectors according to the present invention preferably contain one or more selection markers, which permit easy selection of transformed cells. Marker selection is the gene, the product of which provides for biocide or viral resistance, resistance to heavy metals, the properties of prototroph auxotrophs and the like.

Examples of bacterial Mar the development of selection are dalgenes fromBacillus subtilisorBacillus licheniformisor markers that confer antibiotic resistance, such as resistance to ampicillin, kanamycin, chloramphenicol or tetracycline. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. The marker selection for use in the cells of the host filament fungi include, but are not limited to this,amdS(acetamides),argB(ornithine carbarnoyl the transferase),bar(phosphinotricin acetyltransferase),hph(hygromycin phosphotransferase),niaD(nitrate reductase),pyrG(orotidine-5'-phosphate the decarboxylase),sC(sulfate adinistrator) andtrpC(anthranilate synthase), and their equivalents. Preferred for use in the cells ofAspergillusareamdSandpyrGgenes fromAspergillus nidulansorAspergillus oryzaeandbarthe gene ofStreptomyces hygroscopicus.

The vectors according to the present invention preferably contain an element(s)that allows the integration of the vector into the genome of the host cell or Autonomous replication of the vector in the cell independent of the genome.

For integration into the genome of the host cell, the vector may be based on sequence polynucleotide encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. The quality is solid fuel alternatives, the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell in the exact position(I) in the chromosome(s). To increase the likelihood of integration at a precise location, the elements of integration should preferably contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, and most preferably from 800 to 10,000 base pairs, which have a high degree of identity with the corresponding sequence of the target to enhance the probability of homologous recombination. Integration element can be any sequence that is homologous to the target sequence in the genome of the host cell. In addition, the integration elements can be non-coding or coding nucleotide sequences. On the other hand, the vector can be integrated into the genome of the host cell by homologous recombination.

For Autonomous replication, the vector may further contain a replication origin, enabling the vector to replicate autonomously in the cell host. The replication origin may be any plasmid Replicator, mediating Autonomous replication that functions in the cell. The term "replication origin" or "plasmid Replicator" is defined here as the nucleotide sequence, enabling the plasmid or vector to replicatein vivo.

Por the measures of bacterial start points of replication are the starting point of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication inE. coliand pUB110, pE194, pTA1060, and pAMβ1, allowing replication inBacillus.

Examples of start points of replication for use in yeast cells, the owners are 2-micron position to start replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.

Examples of start points of replication for use in the cells-the owners of the filament fungi are AMA1 and ANS1 (Gemset al.,1991,Gene98:61-67; Cullenet al., 1987,Nucleic Acids Research15: 9163 - 9175; WO 00/24883). The allocation of the AMA1 gene and construction of plasmids or vectors containing the gene can be performed according to the methods disclosed in WO 00/24883.

More than one copy of polynucleotide according to the present invention can be inserted into the cell host to increase production of the gene product. The increase in the number of copies of polynucleotide can be obtained by embedding at least one additional copy of the sequence into the genome of the host cell or by including amplifierarava gene marker assisted breeding polynucleotides, where cells containing amplificatoare copy of a gene marker selection, and, therefore, additional copies of polynucleotide, can be selected by culturing cells in the presence of an appropriate agent selection.

Techniques used for ligating elements, opican the x above, to construct the recombinant expression vectors of the present invention are well known to the expert (see, for example, Sambrooket al.,1989,supra).

Cell host

The present invention also relates to a recombinant cell host containing polynucleotide according to the present invention, which are mainly used in recombinant obtaining polypeptides. A vector containing polynucleotide according to the present invention, introduced into the cell host such that the vector is maintained as a chromosomal insert or as a self-replicating extrachromosomal vector, as described earlier. The term "a host cell" includes any progeny of the parent cell, which is not identical to the parent cell due to mutations that occur during replication. The choice of host cell will to a greater extent depend upon the gene encoding the polypeptide, and its source.

A host cell may be a unicellular microorganism, e.g., prokaryotes, or not a single-celled microorganism, for example, eukaryotes.

Suitable single-celled microorganisms are bacterial cells such as gram positive bacteria including, but not limited to, cells ofBacillusfor example,Bacillusalkalophilus,Bacillus amyloliquefaciens,Bacillus brevis,Bacillus circulans Bacillus clausii,Bacillus coagulans,Bacillus lautus,Bacillus lentus,Bacilluslicheniformis,B. megaterium Bacillus,Bacillus stearothermophilus,BacillussubtilisandBacillus thuringiensis; or cellsStreptomycesfor example,Streptomyces lividansandStreptomyces murinusor gram-negative bacteria such asE. coliandPseudomonassp. In a preferred aspect, the bacterial cell, the host cell isBacillus lentus, Bacillus licheniformis, Bacillus stearothermophilusorBacillus subtilis. In another preferred aspect, the cellBacillusthe cells are a alcaliphilicBacillus.

Introduction of the vector into a bacterial cell host may, for example, be achieved by transformation of protoplasts (see, e.g., Chang and Cohen, 1979,Molecular General Genetics168: 111-115), by using competent cells (see, for example, Young and Spizizin, 1961,Journal of Bacteriology81: 823-829, or Dubnau and Davidoff-Abelson, 1971,Journal of Molecular Biology56: 209-221), by electroporation (see, e.g., Shigekawa and Dower, 1988,Biotechniques6: 742-751), or by conjugacies (see, for example,Koehler and Thone, 1987,Journal of Bacteriology169: 5771-5278).

A host cell may be eukaryotic, such as mammalian cells, insects, plants, or fungi.

In a preferred aspect, a host cell is a cell of fungi. "Fungi"as used here include the types of records of Ascomycetes,The basidiomycetes,Chytrids and Zygomycetes (defined Hawksworthet al.,In, Ainsworth nd Bisby''s Dictionary of The Fungi , 8th edition, 1995, CAB International, University Press, Cambridge, UK)and Oomycetes (cited in Hawksworthet al., 1995,supra, page 171) and all the generators mitosporic fungi (Hawksworthet al., 1995,supra).

In a more preferred aspect mushroom a host cell is a yeast cell. "Yeast"as used here, include ascospores yeast (order Endemicity), basidiospores yeast, and yeast belonging to the imperfect fungi (Blastomyces). Because the classification of fungi may change in the future, for the purposes of this invention, yeast shall be defined as described inBiology and Activities of Yeast(Skinner, F.A., Passmore, S.M., and Davenport, R.R., eds,Soc. App. Bacteriol. Symposium SeriesNo. 9, 1980).

In another more preferred aspect, the yeast cell, the host cell isCandida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, SchizosaccharomycesorYarrowia.

In the most preferred aspect, the yeast cell, the host cell isSaccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensisorSaccharomyces oviformis. In another most preferred aspect, the yeast cell, the host cell isKluyveromyces lactis. In another most preferred aspect, the yeast cell is a host cell isYarrowia lipolytica.

In another more preferred aspect mushroom a host cell is a filamentous fungi cell.

"Filamentous g is iby" include all filamentous forms of the subdivision Eumycets and Oomycetes (defined Hawksworth et al.,1995,supra). Filamentous fungi are usually wall mycelium composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is the lengthening of the hypha, and carbon catabolism is obligatorily aerobic. In contrast, vegetative growth of yeast, such asSaccharomyces cerevisiaeoccurs by budding unicellular thallus, and catabolism of carbon may be enzymatic.

In another more preferred aspect, a host cell of a filamentous fungi cell isAcremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, TrametesorTrichoderma.

In the most preferred aspect is a host cell of a filamentous fungi cell isAspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae. In another most preferred aspect, a host cell of a filamentous fungi cell isFusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium frost, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioidesorFusarium venenatum. In another most preferred aspect, a host cell of filamentous what the present moment is the cell strains of Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufaorCeriporiopsis subvermispora, Coprinus cinereus, Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reeseiorTrichoderma viride.

The cells of fungi can be transformed through a process that includes the formation of protoplasts, transformation protoplasts and regeneration of the cell wall by way of well-knownper se. Suitable methods for transforming host cells ofAspergillusandTrichodermadescribed in EP 238 023 and Yelton et al., 1984,Proceedings of the National Academy of Sciences USA81: 1470-1474. Suitable methods for transformation of the formFusariumdescribed by Malardieret al., 1989,Gene78: 147-156 and WO 96/00787. Yeast may be transformed using the methods described by Becker and Guarente,InAbelson, J.N. and Simon, M.I., editors,Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology,Volume 194, pp 182-187, Academic Press, Inc., New York; Itoet al.,1983,Journal of Bacteriology153: 163; and Hinnenet al.,1978,Proceedings of the National Academy of Sciences USA75: 1920.

Ways to get

The present invention also relates to methods of producing the polypeptide according to the present invention, comprising (a) cultivating a cell, which is in the form of wild type capable of producing the floor of the peptide under conditions contributing to the production of the polypeptide; and (b) isolation of the polypeptide. Preferably the cells belong to the genusArenicolaand, even more preferably, areArenicola marina.

The present invention also relates to methods of producing the polypeptide according to the present invention, comprising (a) culturing cells under conditions conducive to the production of the polypeptide; and (b) isolation of the polypeptide.

The present invention also relates to methods of producing the polypeptide according to the present invention, comprising (a) culturing cells under conditions conducive to the production of the polypeptide, where a host cell contains a mutant nucleotide sequence having at least one mutation in the coding of the Mature polypeptide region of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27, where the mutant nucleotide sequence encodes a polypeptide which consists of amino acids 1 to 49 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10;

amino acids 1 to 46 of SEQ ID NO:12 or SEQ ID NO:14;

amino acids 1 to 48 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20;

amino acids 1 to 45 of SEQ ID NO:22;

amino acids 1 to 49 of SEQ ID NO:24;

amino acids 1 to 44 of SEQ ID NO:26; or

amino acids 1 to 59 of SEQ ID NO:28, and (b) isolation of the polypeptide.

the methods of production according to the present invention, the cells are cultivated in a nutrient medium, suitable for receipt of the polypeptide using methods well known in the field. For example, cells can be grown in flasks with shaking and fermentation on a small scale or large scale (including continuous, batch, fed or solid state fermentation) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing to Express and/or to isolate the polypeptide. The cultivation takes place in a suitable nutrient medium containing sources of carbon and nitrogen and inorganic salts, using methods known in this field. A suitable environment is available from private providers and can be prepared according to published compositions (e.g., in catalogues of the American type culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be directly isolated from the environment. If the polypeptide is not secreted, it can be isolated from cell lysates.

The polypeptides can be detected using methods known in this field, which are selective for polypeptides. These detection methods may include use of specific antibodies. For example, the detection method of antimicrobial action can be used to determine the activity of the polypeptide described herein.

The resulting polypeptide can be identified, using methods known in this field. For example, the polypeptide may be isolated from the culture medium by well-known techniques, including, but not limited to, centrifugation, filtration, extraction, convection drying, evaporation, or precipitation.

The polypeptides according to the present invention can be cleaned using a variety of methods known in this field, including, but not limited to, chromatography (e.g. ion exchange, affinity, hydrophobic, chromatofocusing and gel filtration), electrophoretic procedures (e.g., preparative, isoelectrofocusing), differential solubility (e.g., precipitation with ammonium sulfate), LTO-page, or extraction (see, for example,Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Plants

The present invention also relates to a transgenic plant, plant part or plant cell that is transformed with a nucleotide sequence that encodes a polypeptide having antimicrobial activity, of the present invention, in order to Express and get the polypeptide in the allocated quantities. The polypeptide can be isolated from plants or parts of plants. Alternatively, the plant or plant part containing Ryoko is pinentry polypeptide, can be used as such for improving the quality of food or feed, e.g., improving nutritional value, taste attractiveness and rheological properties, or to destroy anti-nutritional factor.

The transgenic plant may be a dicotyledonous (dicotyledonous plant or a monocotyledonous (monocot plant). Examples of monocotyledonous plants are grasses, such as meadow grass, forage grass such as fescue, ryegrass, grass temperate climate, such as bent grass, and grains, such as wheat, oats, rye, barley, rice, sorghum and maize (corn).

Examples of dicotyledonous plants include tobacco, legumes, such as lupins, potato, sugar beet, pea, bean and soybean, and cruciferous plants (family Brassicaceae), such as cauliflower, rape and the closely related model organismArabidopsis thaliana.

Examples of parts of the plant are the stem, callus, leaves, roots, fruits, seeds and tubers, as well as individual tissue components of these parts, for example, epidermis, mesophyll, parenchyma, vascular tissue, meristem. Separate compartments of plant cells, such as chloroplasts, apoplast, mitochondria, vacuoles, peroxisomes and cytoplasm, are also considered part of the plant. In addition, any plant cell, from any source tissue, is considered part of the plant. Similar to the way, parts of plants, as specific tissues and cells allocated to facilitate the use of the invention, are also considered parts of a plant, for example, the germ, the endosperm, the aleurone and seed coat.

Also included in the scope of the present invention is progeny of such plants, plant parts and plant cells.

The transgenic plant or plant cell expressing the polypeptide according to the present invention can be interpreted in accordance with methods known in this field. Briefly, the plant or plant cell is interpreted as the inclusion of one or more expression constructs encoding a polypeptide of the present invention, the genome of the host plant and multiplication of the resulting modified plant or plant cell into a transgenic plant or plant cell.

Expression design is usually the design of nucleic acid that contains polynucleotide encoding the polypeptide of the present invention, functionally attached to the appropriate regulatory sequences required for expression of the nucleotide sequence in the selected plant or plant part. In addition, the expression construct may contain a marker selection, suitable for identification of cells Hosea is, in which was embedded expression design, and DNA sequences necessary for the introduction of design in this plant (the latter depends on the method of introducing DNA that will be used).

The choice of regulatory sequences, such as promoter and termination sequences and optionally signal or transit sequences is determined, for example, on the basis of when, where and how it is desirable to Express the polypeptide. For example, expression of the gene encoding the polypeptide of the present invention may be constitutive or induced, or may be associated with the development, specific to the stage (of development) or tissue, and the gene product may be targeted to a specific tissue or plant part such as leaves or seeds. Regulatory sequences are, for example, described Tagueet al.,1988,Plant discrimination86: 506.

For constitutive expression can be used promoter 35S-CaMV, the promoter of ubiquitin 1 from maize and the actin promoter 1 of rice (Francket al., 1980,Cell21: 285-294, Christensenet al., 1992,Plant Mo. Biol.18: 675-689; Zhanget al., 1991,Plant Cell3: 1155-1165). Promoters that are specific to the organs, can be, for example, the promoter of storing tissues, such as seeds, potato tubers, and fruits (Edwards & Coruzzi, 1990,Ann. Rev. Genet.24: 275-303) or from tissue m is tabletochki drains, such as meristem (Itoet al., 1994,Plant MoI. Biol.24: 863-878), a promoter specific to seeds, such as barley glutelin, preliminaly, globulin or albumen promoter from rice (Wuet al., 1998,Plant and Cell discrimination39: 885-889), a promoter fromVicia fabalegumin B4 and the promoter of a gene of unknown protein from the seed ofVicia faba(Conradet al., 1998,Journal of Plant discrimination152: 708-711), a promoter comprising the protein of vegetable oil (Chenet al., 1998,Plant and Cell discrimination39: 935-941), the promoter of the protein reserve napA fromBrassica napusor any other known in the field promoter, specific for seeds, for example as described in WO 91/14772. In addition, the promoter may be a promoter that is specific for the leaves, such asrbcsthe promoter from rice or tomato (Kyozukaet al., 1993,Plant discrimination102: 991-1000), the promoter of the gene alaninovoy methyltransferase from Chlorella virus (Mitra and Higgins, 1994,Plant Molecular Biology26: 85-93), or the promoter of the genealdPfrom rice (Kagayaet al., 1995,Molecular and General Genetics248: 668-674), or induced by wounding promoter such as the potato pin2 (Xuet al., 1993,Plant Molecular Biology22: 573-588). Similarly, the promoter can be induced in non-biological influences, such as temperature, dryness or changes in salinity, or induced by endogenous applied substances that activate the promoter, for example, ethanol, Ostrog the new, plant hormones such as ethylene, abscisic acid and gibberellinovaya acid, and heavy metals.

Promoter enhancer element may also be used to achieve higher expression of the polypeptide of the present invention in the plant. For instance, the promoter enhancer element may be an intron placed between the promoter and the nucleotide sequence that encodes a polypeptide of the present invention. For example, Xuet al., 1993,suprareveal the use of the first intron in the gene actin 1 rice to increase expression.

Gene marker selection and any other part of the expression constructs can be selected from those available in this field.

Design a nucleic acid incorporated into the genome of plants by common methods known in this field, includingAgrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, biolistics transformation, and electroporation (Gasseret al., 1990,Science244: 1293; Potrykus, 1990,Bio/Technology8: 535; Shimamotoet al., 1989,Nature338: 274).

Today,Agrobacterium tumefaciens-mediated gene transfer is the main method of obtaining a transgenic dicotyledonous plants (for a review, see Hooykas and Schilperoort, 1992,Plant Molecular Biology19: 15-38) and can also be used the La transformation of monocotyledonous plants, although these plants are often used other methods of transformation. To date, the primary method of obtaining a transgenic monocotyledonous plants is particle bombardment (microscopic gold or tungsten particles coated with the transforming DNA) of embryonic calli or developing embryos (Christou, 1992,Plant Journal2: 275-281; Shimamoto, 1994,Current Opinion Biotechnology5: 158-162; Vasilet al., 1992,Bio/Technology10: 667-674). An alternative method of transformation of monocotyledonous plants is based on transformation of protoplasts described Omirullehet al.,1993,Plant Molecular Biology21: 415-428.

After the transformation, including expression design transformants are selected and regenerate into whole plants by methods well-known in this field. Often the technique of transformation developed for the selective removal of genes breeding or during regeneration, or in the next generations through the use of, for example, co-transformation of two separate T-DNA structures or site-specific excision of the gene selection by specific recombinase.

The present invention also relates to methods of producing the polypeptide according to the present invention comprises: (a) cultivating a transgenic plant or plant cell containing polynucleotide, codereuse the polypeptide, having antimicrobial action, according to the present invention under conditions conducive to the obtaining of the polypeptide; and (b) isolation of the polypeptide.

Composition

The present invention also relates to compositions, such as pharmaceutical compositions containing the polypeptide of the present invention. Preferably, the compositions are enriched in such a polypeptide. The term "enriched" indicates that the antimicrobial activity of the composition is increased, for example, with an enrichment factor of 1.1.

The composition can optionally contain other pharmaceutically active agent, such as an optional biocide, such as other antimicrobial polypeptide exhibiting antimicrobial action defined above. The biocide can be an antibiotic that is known in this field. Classes of antibiotics include penicillins, such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin and the like; penicillins in combination with inhibitors of beta-lactamase; cephalosporins, for example, cefaclor, Cefazolin, cefuroxime, moxalactam etc.; carbapenems; carbapenems; aminoglycosides; tetracyclines; macrolides; lincomycin; polymyxins; sulfonamides; quinolones; chloramphenicol; metronidazole; spectinomycin; trimethoprim; vancomycin; etc. Biocide may also be against the fungal agent, including the polyene, for example, amphotericin b, nystatin; 5-fluctin; and azoles, e.g., miconazole, ketoconazole, Itraconazole and fluconazole.

In the embodiment of the invention, the biocide is a chemical agent that is not an enzyme. In another embodiment of the invention, the biocide is not a polypeptide, a chemical agent.

The compositions may contain suitable carrier material. The composition may also contain a suitable delivery vehicle capable of delivering the antimicrobial polypeptides of the invention in the desired location, where the compositions are used as medicines.

Polypeptide compositions may be prepared by methods known in this field, and can be in the form of liquid or a dry composition. For example, the polypeptide composition may be in the form of granules or microgranules. The polypeptide to be included in the composition may be stabilized by the methods known in this field.

Below are Examples of the preferred use of the polypeptide compositions according to the invention. The dose of the polypeptide composition of the invention and other conditions under which the composition is used may be determined on the basis of methods known in this field.

Methods and application

The present invention is also directed to methods of use for which peptides, possessing antimicrobial activity. Antimicrobial polypeptides generally applicable in any location subject to contamination by bacteria, fungi, yeast or algae. Usually places are aqueous systems such as cooling water systems, Laundry water, oil system, such as Metalworking fluids, lubricants, oil fields and the like, where the microorganisms need to be killed or where their growth must be controlled. However, the present invention can also be applied to all applications for which the applicable known antimicrobial compounds, such as protection of wood, latex, adhesive, glue, paper, cardboard, textiles, leather, plastic, sealant and food.

Other applications include the safety of food products, beverages, cosmetics such as lotions, creams, gels, ointments, Soaps, shampoos, conditioners, antiperspirants, deodorants were examined, means for rinsing the mouth, products for contact lenses, enzymatic pharmaceutical composition or food ingredients.

Therefore, the antimicrobial polypeptides of the invention can be applied as a disinfectant, for example, in the treatment of infections in the eyes and mouth, skin infections; antiperspirant or deodorants were examined; for cleaning and disinfecting contact lenses and dental care for the oral cavity).

In General podrazumevao the Xia, what antimicrobial polypeptides according to the present invention is applicable to cleaning, disinfecting or inhibiting microbial growth on any surface. Examples of surfaces for which contact with the antimicrobial polypeptides of the invention can be advantageous, are the surfaces of the process equipment used, for example, in the dairy industry, in the chemical or pharmaceutical plants, water disinfection systems, refineries, cellulosimicrobium plants, water treatment plants and cooling towers. Antimicrobial polypeptides according to the invention should be used in an amount that is effective for cleaning, disinfecting or inhibiting microbial growth on the surface.

Antimicrobial polypeptides according to the invention can additionally be used for cleaning surfaces and kitchen utensils in the food industry and in any place where food is prepared or served, such as hospitals, maternity homes and restaurants.

They can also be used as a preservative or disinfectant in Vodootvodny colors.

The invention also relates to antimicrobial polypeptide or composition according to the invention as a drug. the button antimicrobial polypeptide or composition according to the invention can also be used for the production of drugs for the control of microorganisms, such as fungi and bacteria, preferably gram-positive bacteria.

Composition and antimicrobial polypeptide according to the invention can be used as veterinary or medical therapeutic or prophylactic agent. Therefore, the composition and antimicrobial polypeptide according to the invention can be used in obtaining veterinary or medical therapeutic or prophylactic agents for the treatment of microbial infections, such as bacterial or fungal infection, preferably infections caused by gram-positive bacteria. In particular, microbial infection can be associated with pulmonary diseases, including, but not limited to, tuberculosis, pneumonia and cystic fibrosis; and sexually transmitted diseases, including, but not limited to, gonorrhoea and chlamydia.

The composition of the invention contain an effective amount of the antimicrobial polypeptide according to the invention.

The term "effective amount" when used here means the number of antimicrobial polypeptides according to the invention, which is sufficient to inhibit the growth of rassmatrivaemogo microorganism.

The invention also relates to wound healing compositions or products, such as bandages, medical devices such as catheters and forth to the production of dandruff, such as shampoos.

The compositions of the antimicrobial polypeptides of the invention are introduced to a person suffering from or Prednisolonum to microbial infection. The introduction may be local, localized or systemic, depending on the particular microorganism, preferably, it will be localized. The usual dose of antimicrobial polypeptides of the invention would be sufficient to reduce the population of microorganisms by at least 50%, usually by at least 1 order and may be 2 or more orders of magnitude. Compounds according to the present invention is administered at a dosage that reduces the population of micro-organisms, at the same time minimizing any side effects. It is envisaged that the composition will be obtained and used under the guidance of therapist to apply ain vivo. Antimicrobial polypeptides according to the invention is particularly applicable for the destruction of gram-negative bacteria, includingPseudomonas aeruginosaandChlamydia trachomatis; and gram-positive bacteria, including streptococci, such as Streptococcus pneumoniae,S. uberis, S. hyointestinalis, S. pyogenesandS. agalactiae; and staphylococci, such asStaphylococcus aureus, S. epidermidis, S. simulans, S. xylosusthe S. carnosus.

The antimicrobial compositions of polypeptides according to the invention can be administered to the person suffering from or Prednisolonum to microbial lung infections, such as pneumonia; or to microbial wound infections, such as bacterial wound infection.

The antimicrobial compositions of polypeptides according to the invention can be administered to the person suffering from or Prednisolonum to skin infections such as acne, atopic dermatitis or seborrheic dermatitis; preferably, the skin infection is a bacterial infection of the skin, for example, calledStaphylococcus epidermidis, Staphylococcus aureus, Propionibacterium acnes, Pityrosporum ovaleorMalassezia furfur.

Antimicrobial polypeptides according to the invention is also applicable toin vitropharmaceutical compositions for the destruction of microbes, especially where it is undesirable to introduce many conventional antibiotics. For example, the antimicrobial polypeptides of the invention can be added to food products for animals and/or people; or they may be included as an additive to cell culturein vitroto prevent the growth of microbes in cell culture tissue.

The susceptibility of a particular microbe to lysis antimicrobial polypeptides of the invention can be defined bytesting in vitrodescribed in detail in the experimental section. About what a rule the culture of the microorganism connect with antimicrobial polypeptide at various concentrations for a period of time, sufficient for the protein to act, usually between about one hour and one day. Surviving microbes then calculate and determine the level Lissa.

The microbes of interest include, but are not limited to, gram-positive bacteria, e.g.:Citrobacter sp.; Enterobacter sp.; Escherichia sp.,for example,E. coli; Klebsiella sp.; Morganella sp.; Proteus sp.; Providencia sp.; Salmonella sp.,for example,S. typhi, S. typhimurium; Serratia sp.; Shigella sp.; Pseudomonas sp.,for example,P. aeruginosa; Yersinia sp.,for example,Y. pestis, Y. pseudotuberculosis, Y. enterocolitica; Franciscella sp.; Pasturella sp.; Vibrio sp.,for example,V. cholerae, V. parahemolyticus; Campylobacter sp.,for example,C. jejuni; Haemophilus sp.,for example,H. influenzae, H. ducreyi; Bordetella sp.,for example,B. pertussis, B. bronchiseptica, B. parapertussis; Brucella sp., Neisseria sp.,for example,N. gonorrhoeae, N. meningitidisetc. Other bacteria of interest include theLegionella sp.,for example,L pneumophila; Listeria sp.,for example,L. monocytogenes; Mycoplasma sp.,for example,M. hominis, M. pneumoniae; Mycobacterium sp.,for example,M. tuberculosis, M. leprae; Treponema sp.,for example,T. pallidum; Borrelia sp.,for example,B. burgdorferi; Leptospirae sp.; Rickettsia sp.,for example,R. rickettsii, R. typhi; Chlamydia sp.,for example,C. trachomatis, C. pneumoniae, C. psittaci;Helicobacter sp.,for example,H. pylorietc.

Non-bacterial pathogens of interest include fungal and protozoan pathogens, such asPlasmodia sp.,for example,P. falciparum, Trypanosoma sp.,for example,T. brucei;shistosoma;Entaemoeba p., Cryptococcus sp., Candida sp.,for example,C. albicansetc.

Can be used with different methods of administration. The polypeptide composition may be administered orally, or can be entered vnutrisosudisto, subcutaneously, intraperitoneally, in the form of an aerosol, through the eyes, inside the bladder, topically, etc. for Example, methods of administration by inhalation, are widely known in this field. The dose of therapeutic composition will vary widely depending on the specific input antimicrobial polypeptide, the nature of the disease, frequency of administration, method of administration, excretion of the agent from the patient, and the like. The initial dose may be higher, with subsequent smaller dose. The dose may be entered as infrequently as weekly or biweekly, or divided into smaller doses and entered one or more times a day, twice a week, etc. to support the effective dose level. In many cases, oral administration will require a higher dose than intravenous administration. Amide linkages, as well as amino - and carboxylic can be modified for higher stability when administered orally. For example, carboxysomes can be amitirova.

Compounds

Compounds according to the invention can be incorporated into a variety of formulations for Ter the non-therapeutic administration. More specifically, the compounds according to the invention can be introduced into the compositions by combination with appropriate, pharmaceutically acceptable carriers or diluents, and may be introduced in solid, soft, liquid, or gaseous preparations, such as tablets, capsules, powders, granules, ointments, creams, foams, solutions, suppositories, injections, inhalers, gels, microspheres, lotions and aerosols. As such, the introduction of compounds can be achieved in various ways, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal, intracheal etc. introduction. The antimicrobial polypeptides of the invention may be systemic after administration or may be localized through the use of an implant or other prescription form, which is keeping the active dose at the site of implantation.

In one embodiment of the invention, the composition for topical application contains a chelating agent, which reduces the effective concentration of bivalent cations, especially calcium and magnesium. For example, agents such as citrate, EGTA or EDTA may be included, and citrate is preferred. The concentration of citrate is usually from about 1 to 10 mm.

Compounds according to the present invention can be introduced indiv the dual, in combination with each other or they can be used in combination with other known compounds (e.g., perforin, anti-inflammatory agents, antibiotics and the like). In the pharmaceutical dosage forms of the compounds may be introduced in the form of their pharmaceutically acceptable salts. The following methods and excipients are illustrative only and not in any way restrictive.

For oral preparations, the compounds may be used individually or in combination with appropriate additives for the manufacture of tablets, powders, granules or capsules, for example, well-known additives, such as lactose, mannitol, corn or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, gum, corn starch or gelatin; disintegrating agents such as corn starch, potato starch or sodium carboxymethylcellulose; with lubricants, such as talc or magnesium stearate; and if desired, with diluents, buffering agents, moistening agents, preservatives and flavors.

Connections can be put into preparations for injection by dissolving, suspension or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable or other similar oils,synthetic glycerides of saturated acids, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives, such as solvents, isotonic agents, suspendresume agents, emulsifying agents, stabilizers and preservatives.

The compounds may be used in the form of an aerosol composition for administration by inhalation. Compounds of the present invention can be introduced into the formulation under pressure acceptable propellants such as DICHLORODIFLUOROMETHANE, propane, nitrogen and the like.

The compounds can be used as lotions, for example, to prevent infection of burns, by incorporating into the formulation with conventional additives, such as solvents, isotonic agents, suspendresume agents, emulsifying agents, stabilizers and preservatives.

In addition, connections can be made into suppositories by mixing with a variety of bases such as emulsifying bases or videosmovie Foundation. Compounds according to the present invention can be administered rectally via a suppository. The suppository can include carriers such as cocoa butter, carbowax and glycols, which are dissolved under body temperature, staying solid at room temperature.

Can be used with standard drug the forms for oral or rectal administration, such as syrups, elixirs and suspensions, where each unit dose, for example, teaspoonful, tablespoonful, tablet or suppository, contains a predetermined amount of the composition containing one or more compounds according to the present invention. Similarly, the standard dosage forms for injection or intravenous administration may contain the compound according to the present invention in a composition as a solution in sterile water, saline or another pharmaceutically acceptable carrier.

Implants for prescription forms extended release are well known in this field. Implants are prescription form as microspheres, strips, etc. with biodegradable and nonbiodegradable polymers. For example, polymers of lactic acid and/or glycolic acid form entireity polymer, which is well tolerated by the patient. The implant containing the antimicrobial polypeptides of the invention, is placed in close proximity to the site of infection so that the local concentration of active agent is increased compared with the rest of the body.

The term "standard dosage form", as used here, refers to physically discrete units suitable as single dosages for humans and animals, each unit contains away a predetermined amount of the compounds of the present invention, designed in a quantity sufficient to produce a desired effect in combination with a pharmaceutically acceptable diluent, carrier or delivery vehicle. Specifications for standard dosage forms according to the present invention depend on the specific compounds and the effect achieved, and the pharmacodynamics associated with the compound in the patient's body.

Pharmaceutically acceptable excipients, such as a vehicle, an adjuvant, carriers, or diluents, are readily available to all. Moreover, pharmaceutically acceptable excipients, such as agents to bring the pH and buffer agents, agents to summarize the physiological concentrations of salts, stabilizers, moisturizing agents and the like, are readily available to all.

Typical dosages for systemic injections are in the range from 0.1 to 100 milligrams per kg of body weight of the patient. Usual dosage may be one tablet taken two to six times a day, or one capsule or tablet slow-release, taken once a day and containing a proportionally higher content of active ingredient. The effect of slow release can be obtained by using materials of capsules that dissolve in the ranks pH values, using capsules, which release slowly under the action of osmotic pressure or by any other known means of supervised release.

Expert it is clear that dose levels can vary depending on the specific compound, the severity of symptoms and the susceptibility of the patient to side effects. Some of the specific connections are stronger than others. The preferred dose for this connection are easily definable by a specialist using a variety of methods. The preferred method is the measurement of the physiological activity of this compound.

The use of liposomes as delivery vehicles is one way of interest. The liposomes fuse with the cells in the target location and deliver the contents of the liposome into the cell. To merge in sufficient time support contact liposomes with cells using a variety of tools to maintain contact, such as highlighting, binding agents and the like. In one aspect of the invention liposomes developed in aerosol form for insertion through the lungs. Liposomes can be prepared with purified proteins or peptides that mediate the fusion of membranes, such as Sendai virus or influenza virus and other Lipid may be any suitable for minucia known for forming liposomes lipids, including cationic or zwitter-ionic lipids, such as phosphatidylcholine. Other lipids are usually neutral or acidic lipids, such as cholesterol, phosphatidylserine, phosphatidylglycerol and the like.

To obtain liposomes can be used the method described by Katoet al.(1991)J. Biol. Chem.266:3361. Briefly, the lipids and the composition of the lumen of liposomes containing peptides are mixed in an appropriate aqueous medium, usually a physiological environment, where the total dry residue will be in the range of about 1-10 weight percent. After vigorous shaking for short periods of time from about 5-60 C. the test tube is placed in a warm water bath with a temperature of about 25-40°C and the cycle is repeated approximately 5-10 times. The composition is then voiced over a suitable period of time, usually from about 1-10, and can further shake on vortex. Then increase the volume by adding water environment, is usually increasing volume of approximately 1-2 times, followed by shaking and cooling. This method allows you to include into the lumen of liposomes molecules with a large molecular weight.

Formulations with other active agents

For use in the methods of the antimicrobial polypeptides of the invention can be incorporated with other pharmaceutically active and the customers, in particular, with other antimicrobial agents. Other agents of interest include a wide range of antibiotics, known in this area. Classes of antibiotics include penicillins, such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin and the like; penicillins in combination with inhibitors of beta-lactamase; cephalosporins, for example, cefaclor, Cefazolin, cefuroxime, moxalactam etc.; carbapenems; carbapenems; aminoglycosides; tetracyclines; macrolides; lincomycin; polymyxins; sulfonamides; quinolones; chloramphenicol; metronidazole; spectinomycin; trimethoprim; vancomycin; etc.

Antifungal agents are also suitable, including the polyene, for example, amphotericin b, nystatin; 5-fluctin; and azoles, e.g., miconazole, ketoconazole, Itraconazole and fluconazole. Anti-TB drugs include isoniazid, ethambutol, streptomycin, and rifampin. Cytokines may also be included in the antimicrobial polypeptides of the invention, for example, interferon gamma, tumor necrosis factor alpha, interleukin 12, etc.

Synthesisin vitro

The antimicrobial polypeptides of the invention can be obtained by synthesisin vitrousing standard techniques known in science. Available are different sales units for the synthesis of the, for example, automatic synthesizers firms Applied Biosystems Inc., Beckman, etc. When using synths naturally occurring amino acids may be substituted on a non-naturally occurring amino acids, particularly D-isomers (or D-form), for example, D-alanine or D-isoleucine, diastereoisomer, side chains with different length, or other features, and the like. The specific sequence and manner of acquisition will be determined by convenience, economic considerations, desired purity and the like.

Chemical crosslinking can be achieved in peptides or proteins containing functional group for binding, such as amino groups to form amides or substituted amines, for example, by reductive amination, tirinya group for the formation of thioethers or disulfide bonds, carboxyl groups to form amides and the like.

If desired, different groups can be introduced into the peptide during synthesis or during expression, which allow binding with other molecules or with the surface. So, cysteine can be used to create thioesters, histidine to associate with complexes of metal ions, carboxylic groups to form amides or esters, amino groups to form amides and the like.

The polypeptides can be allocated is received and cleared by well-known methods of recombinant synthesis. You can get lysate expressing host cells and clear the lysate by HPLC, gel filtration, electrophoresis gel, affinity chromatography, or other methods of cleaning. For the most part, the composition will contain at least 20% by weight of the desired product, preferably at least about 75% by weight, more preferably at least about 95% by weight and for therapeutic purposes, usually at least approximately 99.5% by weight relative to the impurities associated with the method of obtaining the product and its purification. Usually the percentages are based on total protein.

Pet food

The present invention is also directed to methods of using the polypeptides having antimicrobial action, in animal feed, as well as on the composition of feed and feed additives containing antimicrobial polypeptides of the invention.

The term animal includes all animals, including humans. Examples of animals are not ruminants and ruminants such as cows, sheep and horses. In a specific embodiment of the invention the animal is not the ruminant animal. Not ruminants include animals mono-gastric, such as pigs or boars (including, but not limited to, piglets, fattening pigs and sows); D. the domestic fowl, such as turkeys and chickens (including, but not limited to, broiler chickens, laying hens); young calves; and fish (including, but not limited to, salmon).

The term food or feed composition means any connection, retrieve, mixture or composition suitable for or intended for ingestion by the animal.

In the application according to the invention antimicrobial polypeptides can be fed to an animal before, after or simultaneously with meals. The latter is preferred.

In a specific embodiment of the invention the antimicrobial polypeptide in the form in which it is added to the feed, or when feed additive is strictly defined. Well-defined means that the drug is an antimicrobial polypeptide is at least 50% purity, determined by gel-filtration chromatography (see Example 12 of WO 01/58275). In other separate embodiments for carrying out the invention preparation of antimicrobial polypeptide has 60, 70, 80, 85, 88, 90, 92, 94 or at least 95% purity, determined by this method.

Specific antimicrobial agent is advantageous. For example, it is much easier to dose correctly in food antimicrobial polypeptide, which is practically free from interfering or contaminating other antimicrobial poly is aptidon. The term to dose correctly applies in particular to the problem of getting consistent and uniform results and the ability to optimize the dosage based on the desired effect.

For use in animal feed, however, the antimicrobial polypeptide does not have to be this purity; it may include, for example, other enzymes, in this case it might be called a drug antimicrobial polypeptide.

The drug is an antimicrobial polypeptide may be (a) added directly to the feed (or used directly in the processing of vegetable proteins) or (b) it can be used in obtaining one or more intermediate compositions such as feed additives or pre-prepared mixture, which is subsequently added to feed (or used in the process). The degree of purity described above, refers to the initial preparation of antimicrobial polypeptide or used in (a) or (b).

Drugs antimicrobial polypeptides with purity in that order quantities are in particular produced using recombinant methods of production, whereas they are not easy to obtain and they are also subject to a much higher variations from batch to batch, upon receipt of antimicrobial polypeptide traditional fermentation methods is.

This drug is an antimicrobial polypeptide may be mixed with other enzymes.

The term vegetable proteins used here, refers to any compound, composition, preparation or mixture that include at least one protein derived or originating from plants, including modified proteins and protein derivatives. In specific embodiments of the invention the vegetable protein is at least 10, 20, 30, 40, 50 or 60% (weight).

Plant proteins can be obtained from sources of vegetable proteins such as beans and grains, for example, materials of plant familiesFabaceae(Leguminosae),Cruciferaceae,ChenopodiaceaeandPoaceaesuch as flour of soybean, lupine flour and flour from rape seeds.

In a specific embodiment of the invention the source of vegetable protein is a material from one or more plants of the familyFabaceaefor example, soybean, lupine, peas or beans.

In another specific embodiment of the invention the source of vegetable protein is a material from one or more plants of the familyChenopodiaceaefor example, beet, sugar beet, spinach or quinoa movie.

Other examples of vegetable protein sources are rapeseed and cabbage.

Soy is preferred is sustained fashion source of vegetable protein.

Other examples of vegetable protein sources are cereals, such as barley, wheat, rye, oats, maize (corn), rice, and sorghum.

Antimicrobial polypeptide can be added to food in any form, being as relatively pure antimicrobial polypeptide or in admixture with other components intended for addition to animal feed, i.e. as additives in animal feed, such as the so-called pre-prepared mixes for animal feed.

In a further aspect the present invention relates to compositions for use in animal feed, such as animal feed and additives for animal feed, for example, a pre-prepared mixture.

In addition to the antimicrobial polypeptide of the invention, the additive for animal feed of the invention contain at least one fat-soluble vitamin and/or at least one water-soluble vitamin, and/or at least one trace mineral, and/or at least one macro element.

Further, optional, kormodobyvaniya ingredients are colouring agents, aroma compounds, stabilizers and/or at least one enzyme selected from Fitz EC 3.1.3.8. or 3.1.3.26; the xylanase EC 3.2.1.8.; galactans EC 3.2.1.89; and/or beta-glucanase EC 3.2.1.4.

In a specific embodiment of the invention, these other enzymes are the two who are strictly defined (as defined above for preparations of antimicrobial polypeptides).

Examples of other antimicrobial peptides (AMPs) are SAR, Leucocin And, Traction, Protegrin-1, Tinatin, Defensin, Viperin, such as Novispirin (Robert Lehrer, 2000), and variants or fragments thereof that retain antimicrobial activity.

Examples of other antifungal proteins (AFPs) are peptides ofAspergillus giganteusandAspergillus niger, as well as variants or fragments thereof that retain antifungal activity described in WO 94/01459 and WO 02/090384.

Usually fat and water - soluble vitamins, and trace elements form part of the so-called pre-mixed, intended for adding to food, while macronutrients are usually separately added to feed. Any of these types of compositions during the concentration of the antimicrobial polypeptide of the invention is an additive for animal feed of the invention.

In a specific embodiment, the additive for animal feed of the invention is intended to include (or as prescribed should be included in food animals or food at the level of from 0.01 to 10%; more specifically, from 0.05 to 5.0%; or from 0.2 to 1% (% means the number of grams of additive per 100 g feed). So, in particular, to a pre-prepared mixtures.

The following is a nonexclusive list of examples of these compounds are:

Examples of fat-soluble Vit is Minov are vitamin a, vitamin D3, vitamin E, and vitamin K, such as vitamin K3.

Examples of water-soluble vitamins are vitamin B12, Biotin and choline, vitamin B1, vitamin B2, vitamin B6, Niacin, folic acid and Pantothenate, for example CA-D-Pantothenate.

Examples of minerals are manganese, zinc, iron, copper, iodine, selenium and cobalt.

Examples of macronutrients are calcium, phosphorus and sodium.

The need for these compounds (illustrated in poultry and piglets/pigs) are given in table a of WO 01/58275. The requirement means that these connections should be provided in the diet in the indicated concentrations.

Alternatively, an additive in animal feed according to the invention contains at least one of the individual components specified in table a of WO 01/58275. At least one means or one or more than one, or two, or three, or four, etc. until all thirteen or until all fifteen of the individual components. More specifically, this at least one individual component is included in the additive of the invention in such amount to provide a concentration in the feed is within the limits specified in column four, or column five, or column six of Table A.

The present invention also relates to compositions of feed for animals. The composition of feed for animals or Pete is the have a relatively high protein content. The feeding of poultry or pigs may differ as indicated in the Table In from WO 01/58275, columns 2-3. Fish food can vary as indicated in column 4 of this Table C. in Addition, such a diet of fish usually has a total fat content 200-310 g/kg

The animal feed composition according to the invention has a total protein content of 50-800 g/kg and, in addition, contains at least one antimicrobial polypeptide stated here.

In addition or as an alternative (to the total protein content, above), the animal feed composition of the invention has a content of metabolisable energy of 10-30 MJ/kg; and/or calcium content of 0.1-200 g/kg; and/or the content of available phosphorus of 0.1-200 g/kg; and/or the content of methionine 0.1 to 100 g/kg; and/or the content of methionine plus cysteine 0.1 to 150 g/kg; and/or the lysine content of 0.5-50 g/kg

In specific embodiments of the invention the content of metabolisable energy, total protein, calcium, phosphorus, methionine, methionine plus cysteine and/or lysine is in any one of rows 2, 3, 4 or 5 in the Table In from WO 01/58275 (P. 2-5).

Total protein calculated as nitrogen (N)multiplied by a factor of 6.25, i.e. Total protein (g/kg)=N (g/kg)X6,25. The nitrogen content is determined using the method of kildala (AOAC, 1984, Official Methods of Analysis 14th ed., Association of Official Analytical Chemists, Washington DC).

Metabolisable energy can the be calculated on the basis of the NRC publication Nutrient requirements in swine, ninth revised edition, 1988, subcommittee on swine nutrition, committee on animal nutrition, board of agriculture, national research council. National Academy Press, Washington, D. C, p. 2-6 and the European Table of Energy Values for Poultry Feed-stuffs, Spelderholt centre for poultry research and extension, 7361 DA Beekbergen, The Netherlands. Grafisch bedrijf Ponsen &looijen bv, Wageningen. ISBN 90-71463-12-5.

The content in the diet of calcium, available phosphorus and amino acids in nutrition for animals is calculated on the basis of tables, such as Veevoedertabel 1997, gegevens over chemische samenstelling, verteerbaarheid en voederwaarde van voedermiddelen, Central Veevoederbureau, Runderweg 6, 8219 pk Lelystad. ISBN 90-72839-13-7.

In a specific embodiment of the invention, the animal feed composition of the invention contains at least one vegetable protein or protein source that is defined above.

In still further private embodiments of the invention, the animal feed composition of the invention contains 0-80% maize; and/or 0-80% sorghum; and/or 0-70% wheat; and/or 0-70% barley; and/or 0-30% oats; and/or 0-40% soy flour; and/or 0-10% fish meal; and/or 0-20% whey. Animal rations may, for example, be made as machanka (not granulated or pelleted feed. Usually milled feed products mix and add enough of the necessary vitamins and minerals on the technical conditions for this species. Enzymes can be added as solid or liquid enzyme compositions. For example, the solid enzyme whom is ositio usually added before or during the step of mixing; a liquid enzyme composition is usually added after the stage of granulation. The enzyme may also be included in the feed additive or a pre-prepared mixture.

The final concentration of the enzyme in the diet is in the range from 0.01 to 200 mg of protein enzyme per kg of diet, for example, in the range 5-30 mg protein enzyme per kg of the animal's diet.

Antimicrobial polypeptide can be introduced in one or more of the following quantities (dose ranges): 0.01 to 200; or 0.01-100; or 0.05-100; or 0.05-50; or of 0.10-10 - all these ranges being in mg antimicrobial polypeptide protein per kg feed (ppm).

To determine the mg of the antimicrobial polypeptide per kg of feed antimicrobial polypeptide purified from a lump of the composition, and the specific activity of the purified antimicrobial polypeptide determined using a suitable method of analysis (see antimicrobial activity, substrates and methods of analysis). Antimicrobial activity feed composition as such is also determined using the same method of analysis, and based on these two definitions is calculated dose in mg antimicrobial polypeptide of protein per kg of feed.

The same principles apply to determine the mg of the antimicrobial polypeptide of the protein in feed supplements. Of course, if the available sample antimicrobial polypeptide is, used for the preparation of a feed additive or feed, the specific activity is determined from this sample (no need to clean the antimicrobial polypeptide of the feed composition or additive).

Signal peptide or propeptide

The present invention also relates to the structures of nucleic acids containing the gene encoding a protein functionally attached to one or both of the first nucleotide sequence consisting of nucleotides 1 to 57 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO:9 encoding a signal peptide consisting of amino acids from -50 to -32 from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10; nucleotides 1 to 63 of SEQ ID NO:11 or SEQ ID NO:13 encoding a signal peptide consisting of amino acids from -39 to -19 from SEQ ID NO:12 or SEQ ID NO:14; nucleotides 1 to 63 of SEQ ID NO:15, SEQ ID NO:17 or SEQ ID NO: 19, encoding a signal peptide consisting of amino acids from -37 to -17 from SEQ ID NO: 16, SEQ ID NO: 18 or SEQ ID NO:20; nucleotides 1 to 63 of SEQ ID NO:21 encoding a signal peptide consisting of amino acids from -39 to -19 from SEQ ID NO:22; nucleotides 1 to 57 of SEQ ID NO:23 encoding a signal peptide consisting of amino acids from -50 to -32 from SEQ ID NO:24; nucleotides 1 to 63 of SEQ ID NO:25 encoding a signal peptide consisting of amino acids from -40 to -20 of SEQ ID NO:26; or nucleotides 1 to 66 of SEQ ID NO:27 encoding a signal peptide consisting of aminoxy the lot from -48 to-27 of SEQ ID NO:28;

and a second nucleotide sequence comprising nucleotides 58 to 150 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO:9, encoding propeptide consisting of amino acids from -31 to -1 of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10; nucleotides 64 to 117 of SEQ ID NO:11 or SEQ ID NO:13, the coding propeptide consisting of amino acids -18 to -1 of SEQ ID NO:12 or SEQ ID NO:14; nucleotides 64 to 111 of SEQ ID NO:15, SEQ ID NO:17 or SEQ ID NO:19, encoding propeptide consisting of amino acids -16 to -1 of SEQ ID NO:16, SEQ ID NO:18 or SEQ ID NO:20, nucleotides 64 to 117 of SEQ ID NO:21 encoding propeptide consisting of amino acids -18 to -1 of SEQ ID NO:22; nucleotides 58 to 150 of SEQ ID NO:23 encoding propeptide consisting of amino acids from -31 to -1 of SEQ ID NO:24; nucleotides 64 to 120 of SEQ ID NO:25 encoding propeptide consisting of amino acids -19 to -1 of SEQ ID NO:26; or nucleotides 67 to 144 of SEQ ID NO:27, coding propeptide consisting of amino acids from -26 to -1 of SEQ ID NO:28; where the gene is alien for respect to the first and second nucleotide sequences.

The present invention also relates to recombinant expression vectors and recombinant cell host containing such structures of nucleic acids.

The present invention also relates to methods of producing a protein containing (a) culturing such recombinant host cell under conditions suitable the La receiving protein; and (b) isolation of the protein.

The first and the second nucleotide sequence may be functionally attached to alien genes separately with other control sequences or in combination with other control sequences. Such other control sequences describedsupra. As described above, where the field as a signal peptide, and propeptide are aminocore protein, the area propeptide is located in front of amino end of the protein, and the region of the signal peptide is located in front of amino acid end of propeptide.

Protein may be native or heterologous to the host cell. The term "protein" are not meant to be for a specific length of the encoded product and, thus, encompasses peptides, oligopeptides and proteins. The term "protein" also encompasses two or more polypeptides, combined to form the encoded product. Proteins also include hybrid polypeptides that contain a combination of partial or complete polypeptide sequences obtained from at least two different proteins, where one or more may be heterologous or native to the host cell. Proteins further include naturally occurring allelic or artificially created variations of the above b is lcov and hybrid proteins.

Preferably, the protein is a hormone or a variant, enzyme, receptor, or part of him, the antibody or part thereof, or a reporter. In a more preferred aspect, the protein is an oxidoreductase, transferase, hydrolases, liati, isomerase, or ligase. In another more preferred aspect, the protein is aminopeptidase, amylase, carbohydrate, carboxypeptidase, catalase, cellulase, chitinase, kutinati, cyclodextrin by glycosyltransferases, desoksiribonukleaza, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, athanasou, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase or xylanase.

The gene may be obtained from any prokaryotic, eukaryotic, or other source.

The present invention is further described through the following examples, which should not be construed as limiting the scope of invention.

EXAMPLES

Chemicals used as buffers and substrates were commercial product of at least reagent purity (consistent with our analytical grade).

EXAMPLE 1

Obtaining a cDNA library fromArenicola marina

Bi is litaka cDNA was obtained from intestine A. marina. Was purified enriched in the poly mRNA synthesized cDNA and created the library by standard methods of molecular biology. A detailed Protocol of the entire process can be found in the examples of international patent application WO 01/12794. The vector used for cloning was pMHs7i. Plasmid pMHs7i is derived pMhs5 (see WO 03/044049), in which the SMART Protocol were established sites SfiI cloning compatible adapted SfiI cDNA. Briefly, EcoRI-NotI cDNA fragment dolazi man from lambdaTripIX2 (Clontech) was cloned into the cloning sites Eco RI pMHas5. The resulting plasmid, pMHas7i contains the cDNA dolazi man, flanked relevant SfiI sites required for cloning adapted SMART cDNA.

Getting pMHas7i for cloning cDNA: the Vector was treated with the restriction enzyme SfiI and purified through gel from insertion dolazi by agarose gel electrophoresis. The band containing plasmid, treated with restriction enzyme, purified by GFX processing (GE Healthcare).

EXAMPLE 2

Opening peptide family marinating through the signal capture from cDNA libraries fromA. marina

Plasmid cDNA pool obtained from 20000 total transformants source ligating cDNA into pMHas5 vector and spent a method of signal capture, as described in WO01/77315, deliver 381 of Contigo sequences.

For all 381 of Contigo was produced individual database searches and the results analyzed. One contig (ZY151351) have some homology to amino acids with known antimicrobial polypeptides (similar to defensins polypeptides). The inferred polypeptide was named Marinatin 1A (SEQ ID NO:6).

After re-examination 381 of Contigo by searching for homology with the sequence of the polypeptide Marinatin 1A were found several other "marinating" (SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28).

EXAMPLE 3

The creation expressed inAspergillusvector for marinating

cDNA encoding the predicted Mature plot Marinatin 1 B (amino acids 1 to 49 of SEQ ID NO:8), Marinatin 2A (amino acids 1 to 46 of SEQ ID NO:12), Marinatin 3B (amino acids 1 to 48 of SEQ ID NO:18), Marinatin 4 (amino acids 1 to 45 of SEQ ID NO:22), Marinatin 5 (amino acids 1 to 49 of SEQ ID NO:24), Marinatin 6 (amino acids 1 to 44 of SEQ ID NO:26) and Marinatin 7 (amino acids 1 to 59 of SEQ ID NO:28), amplified from cDNA libraries of intestineA. marinaand connected with the cDNA fragment coding for pre-Pro region plectin, as follows: 10 ng of cDNA was used as template in PCR reactions using oligonu tidy, shown in Table 1.

tr>
Table 1
Marinating-F5' GGATGCGAACCAACTTCAGAAACGTAGCTGGCTATGTAACTGGTTGGGC 3'
Marinating-R5' CCCAAGCTTCACATGGTGTATGGTTGATCTCTCC 3'
Marinina-F5' GGATGCGAACCAACTTCAGAAACGTGGTTGGTGCTGGCAGTGGACATGT 3'
Marinating-R5' CCCAAGCTTGCCCTTCTAGCGTTCAGCTCTT 3'
Marinating-F5' GGATGCGAACCAACTTCAGAAACGTCATTGGTGTTTCGAGTGGTCATGT 3'
Marinating-R5' CCCAAGCTTTCAGTGGAGAACCGTTACAGCA 3'
Marinatin-F5' GGATGCGAACCAACTTCAGAAACGTATCCCCTGTTGGACTCCGACATGT 3'
Marinatin-R5' CCCAAGCTTAGCCCAGTATGCTCTGCACGT 3'
Marinatin-F5' GGATGCGAACCAACTTCAGAAACGTGGGGGCCGGCCCTGTCATAGGCAT 3'
Marinatin-R5' CCCAAGCTTAGTTGTTCGCTCCATTAGCACCT 3'
Marinatin-F5' ACCAACTTCAGAAACGTGGCAGGTCGTGTAATTTCTGGTT 3'
Marinatin-R5' CCCAAGCTTTGGGCGATTCTATCTGCCTCTTA 3'
Marinatin-F5' ACCAACTTCAGAAACGTGGTGGGATGTGTGGTGACGA 3'
Marinatin-R5' CCCAAGCTTGCACATCGTTTCCACCGCAA 3'

5 pmol of each primer F (forward) and R (reverse) (for example, Marinating-F and Marinating-R) was used in a 25 ál volume reaction with Expand High Fidelity PCR System (Roche). After denaturation at 94°C for 2 minutes was performed for 35 cycles of PCR using the following program: 94°C for 15 s and 60°C for 60 S.

Pre-Pro region plectin, including intron length 58 BP (see the Examples of WO 03/044049)was amplified from plasmid matrix, using the oligonucleotides listed in Table 2.

Table 2
PlecBHI-F5' CGCGGATCCCACCATGCAATTTACCACCATCCTCTC 3'
Plec-Mar1B-R5' GCCCAACCAGTTACATAGCCAGCTACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar2A-R5' ACATGTCCACTGCCAGCACCAACCACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar3B-R5'ACATGACCACTCGAAACACCAATGACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar4-R5'TCCAACAGGGGATACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar5-R5' ATGCCTATGACAGGGCCGGCCCCACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar6-R5' AAATTACACGACCTGCCACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar7-R5'CACACATCCCACCACGTTTCTGAAGTTGGTTCGCATCC 3'

5 pmol of each primer F and R (for example, PlecBHI-F and Marinating-R) was used in a 25 ál volume reaction with Expand High Fidelity PCR System (Roche). After denaturation at 94°C for 2 minutes was performed for 35 cycles of PCR using the following program: 94°C for 15 s and 60°C for 60 S.

The PCR reactions were separated in 2% agarose gel. Bands of expected size for cDNA Marinina and pre-Pro section plectin was isolated using the kit for purification of DNA GFX DNA purification kit (Amersham) according to the manufacturer's Protocol. 1/50 purified material was used as template for PCR to connect using direct primer from plectin and reverse primer from Marinina (for example, for Marinatin 1B: Product Marinating-F and Marinating-R, combined with the product PlecBHI-F and Plec-Mar1B-R, as a matrix, using PlecBHI-F and Marinating-R as primers). 5 pmol of each primer F and R (for example, Marinating-F and Marinating-R) was used in a 25 ál volume reaction with Expand High Fidelity PCR System (Roche). After denaturation at 94°C for 2 minutes was performed 25 cycles of PCR using the following program: 94°C for 15 s and 60°C for 60 C. the PCR Reactions were separated in 2% agarose gel. The band expected the CSO size, coding design merged plectin/marinaside, was isolated using the kit for purification of DNA GFX DNA purification kit (Amersham) according to the manufacturer's Protocol. The fragments were digested BamHI and HindIII, which decompose protruding ends, introduced by the PCR primers. Splintered fragments were isolated and cloned in expressing plasmid pDAu109 (see the Examples of WO 2005/042735).

EXAMPLE 4

Expression marinating inAspergillus

Plasmids expressing marinaside based pDAu109, transformed into a strain BECh2Aspergillus orizae(see WO 00/393229). Ten to 20 transformants of each strain were re-allocated twice on selective and pendulous conditions on the plates with minimal medium Cova with sucrose and ndimethylacetamide. To test the expression marinating the transformants were grown for 3 days at 26 ░ C in test tubes with 10 ml Dap2C-1 (see "Environment" in the Examples of WO 2004/032648). Expression was checked by Maldi-TOF and LTO-page of culture supernatants 16% tretinoin LTO-NuPage gels (Invitrogen), as recommended by the manufacturer.

EXAMPLE 5

Determination of antimicrobial activity by radial diffusion

Supernatant described above in Example 4 were analyzed by the method of radial diffusion, following a previously published Protocol for the determination of antimicrobial activity Lehreret al., (1991) Ultra sensitive assays for endogenous antimicrobial polypeptidesJ Immunol Methods137: 167-173). Target bacteria (106colony forming units (CFU)) was added to 10 ml of the lower agarose layer (1% low-melting electroosmotic agarose, 0.03% trypticase-soy medium, 10 mm phosphate, pH of 7.4, 37 degrees Celsius). The suspension was hardened on the INTEGRID Petri dishes Petri Dish (Becton Dickinson Labware, NJ). The device Gel Puncher 3 mm was used for prodelyvanija holes in the bottom agarose (Amersham Pharmacia Biotech, Sweden). The samples were added into the hole, and incubated at 37 degrees Celsius for 3 hours. The upper layer was poured on the surface and the Cup were incubated over night (Wednesday LB, 7.5% agar). The antimicrobial effect was visible as a zone free from bacteria, around the hole. Live cells were stained with 10 ml of 0.2 mm MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide Titlovi blue). All standard protocols have been described elsewhere (Sambrook, Fritsch, and Maniatis, 1989). Were made of electronic pictures. Inhibition of bacterial growth can be seen as a transparent zone, which was measured with an accuracy of 0.1 nm and subtract the diameter of the hole. The results are shown as zones of inhibition of initial samples (table 3) and concentrated samples (table 4) against a number of test strains:

A:Staphylococcus simulans(ATCC11631)

B:Staphylococcus carnosus(ATCC51365)

C:Streptococcus hyointestinalis(ATCC49169)

D:Bacillussubtilis (ATCC23857)

E:Enterococcus saccharolyticus(ATCC43076)

F:Escherichia coli(ATCC10536)

G:Acinetobacter anitratus(ATCC17903)

H:Erwinia chrysanthemi(ATCC11663)

J:Pseudomonas boreopolis(ATCC15452)

The concentration of the samples was performed by precipitation with 45 ml of the culture supernatant with 2.5 ml of 100% THU and resuspending deposited precipitate in 450 µl of buffer for resuspendable (100 mm Tris, pH 8, 100 mm NaCl).

Table 3
The method results in radial diffusion for the source of cultural supernatant recombinant clonesA. oryzaeexpressing marinaside. 10 units in the method of radial diffusion correspond to 1 mm diameter transparent zone around 3 mm holes for sample
The test strain
InWithDE
Marinatin 1B2110109
Marinatin 2A261216Marinatin 460543243
Marinatin 6-453940
Control0000

Table 4
The method results in radial diffusion to the besieged THU cultural supernatant of recombinantA. oryzaeclones expressing marinaside (concentrated 100 times). 10 units in the method of radial diffusion correspond to 1 mm diameter transparent zone around 3 mm holes for a sample.
The test strain
ABCDEFGNMarinatin 1B222522283025262528
Marinatin 2A343535384125394039
Marinatin 414815932680600
Marinatin 5221324252319262622
Control00 0000000

EXAMPLE 6

The use of MMOs files from the PFAM database for the identification of defensin

The sequence analysis using profile hidden Markov models (hmm profiles)may be conducted or online on the Internet or locally on your computer using the widely known software package R freely available. The current version is R 2.3.2, dated October 2003.

MMOs profiles can be obtained from widely known PFAM database. The current version is PFAM 16.0, dated November 2004. As R and PFAM are available for all computer platforms from, for example, the University of Washington in St. Louis (USA), School of Medicine http://pfam.wustl.edu and http://hmmer.wustl.edu).

If the requested amino acid sequence or its fragment belongs to one of the following five PFAM families, the amino acid sequence is defensins according to the invention is:

Defensible or "Beta Defensin"access number: PF00711;

Defensible or Defensin propeptide"access number: PF00879;

Defensin or Defensin mammals", the access number: PF00323;

Defensin or Defensin arthropods", number on the stupa: PF01097;

Gamma thionin or "the Family of gamma mininov"access number: PF00304.

Amino acid sequence belongs to the family PFAM according to the invention, if it forms E-value, which is greater than 0.1, and a score greater than or equal to zero when the database PFAM used online or when hmmpfam program of the HMMER software package) is used locally.

When the sequence analysis is performed locally using the hmmpfam program is required to receive (download) MMO profiles from the PFAM database. Two profiles exist for each family: "xxx_ls.hmm" for General searches and xxx_fs.hmm" for local searches ("xxx" is the family name). It is only 10 profiles for the five families mentioned above.

These ten profiles can be used individually or combined (added) to a profile (using a text editor profiles are ASCII files), which can be named, for example defensin.hmm. The requested amino acid sequence can then be estimated using the following command line:

hmmpfam-E 0.1 defensin.hmm sequence_file

where "sequence_file" is a file with the required amino-acid sequence in any of the formats recognized by the software package HMMER.

If the score is greater than or equal to zero (0,0), and the E-value is bol is more than 0.1, the requested amino acid sequence is defensins according to the invention.

The PFAM database is further described in Bateman et al. (2004) The Pfam Protein Families Database", Nucleic Acids Research, Vol. 32 (Database Issue) p. D138-D141.

1. The defensin polypeptide having antimicrobial activity, which contains the amino acid sequence represented
C-x(3)-C-x(7,9)-C-C and C-C-x(8)-C-x-C and C-x-C-x(8,11)-S.

2. The polypeptide according to claim 1, which is:
(a) a polypeptide containing the amino acid sequence that has at least 60% identity with:
amino acids 1 to 49 of SEQ ID NO:2,
amino acids 1 to 49 of SEQ ID NO:4,
amino acids 1 to 49 of SEQ ID NO:6,
amino acids 1 to 49 of SEQ ID NO:8,
amino acids 1 to 49 of SEQ ID NO:10,
amino acids 1 to 46 of SEQ ID NO:12,
amino acids 1 to 46 of SEQ ID NO:14,
amino acids 1 to 48 of SEQ ID NO:16,
amino acids 1 to 48 of SEQ ID NO:18,
amino acids 1 to 48 of SEQ ID NO:20,
amino acids 1 to 45 of SEQ ID NO:22,
amino acids 1 to 49 of SEQ ID NO:24,
amino acids 1 to 44 of SEQ ID NO:26,
or amino acids 1 to 59 of SEQ ID NO:28; or
(b) a polypeptide which is encoded by a nucleotide sequence which hybridizes with at least average conditions with (i):
nucleotides 151 to 297 of SEQ ID NO:1,
nucleotides 151 to 297 of SEQ ID NO:3,
nucleotides 151 to 297 of SEQ ID NO:5,
nucleotides 151 to 297 of SEQ ID NO:7,
nucleotides 151 to 297 of SEQ ID N:9,
nucleotides from 118 to 255 of SEQ ID NO:11,
nucleotides from 118 to 255 of SEQ ID NO:13,
nucleotides from 112 to 255 of SEQ ID NO:15,
nucleotides from 112 to 255 of SEQ ID NO:17,
nucleotides from 112 to 255 of SEQ ID NO:19,
nucleotides from 118 to 252 of SEQ ID NO:21,
nucleotides 151 to 297 of SEQ ID NO:23,
nucleotides from 121 to 252 of SEQ ID NO:25 or
nucleotides 145 to 321 of SEQ ID NO:27; or (ii) a complementary circuit (i).

3. The polypeptide according to claim 2, containing an amino acid sequence that has at least 70% identity with:
amino acids 1 to 49 of SEQ ID NO:2,
amino acids 1 to 49 of SEQ ID NO:4,
amino acids 1 to 49 of SEQ ID NO:6,
amino acids 1 to 49 of SEQ ID NO:8,
amino acids 1 to 49 of SEQ ID NO:10,
amino acids 1 to 46 of SEQ ID NO:12,
amino acids 1 to 46 of SEQ ID NO:14,
amino acids 1 to 48 of SEQ ID NO:16,
amino acids 1 to 48 of SEQ ID NO:18,
amino acids 1 to 48 of SEQ ID NO:20,
amino acids 1 to 45 of SEQ ID NO:22,
amino acids 1 to 49 of SEQ ID NO:24,
amino acids 1 to 44 of SEQ ID NO:26, or
amino acids 1 to 59 of SEQ ID NO:28.

4. The polypeptide containing the amino acid sequence that has at least 80% identity with:
amino acids 1 to 49 of SEQ ID NO:2,
amino acids 1 to 49 of SEQ ID NO:4,
amino acids 1 to 49 of SEQ ID NO:6,
amino acids 1 to 49 of SEQ ID NO:8,
amino acids 1 to 49 of SEQ ID NO:10,
amino acids 1 to 46 of SEQ D NO:12,
amino acids 1 to 46 of SEQ ID NO:14,
amino acids 1 to 48 of SEQ ID NO:16,
amino acids 1 to 48 of SEQ ID NO:18,
amino acids 1 to 48 of SEQ ID NO:20,
amino acids 1 to 45 of SEQ ID NO:22,
amino acids 1 to 49 of SEQ ID NO:24,
amino acids 1 to 44 of SEQ ID NO:26, or
amino acids 1 to 59 of SEQ ID NO:28.

5. The polypeptide according to claim 2, containing an amino acid sequence that has at least 90% identity with:
amino acids 1 to 49 of SEQ ID NO:2,
amino acids 1 to 49 of SEQ ID NO:4,
amino acids 1 to 49 of SEQ ID NO:6,
amino acids 1 to 49 of SEQ ID NO:8,
amino acids 1 to 49 of SEQ ID NO:10,
amino acids 1 to 46 of SEQ ID NO:12,
amino acids 1 to 46 of SEQ ID NO:14,
amino acids 1 to 48 of SEQ ID NO:16,
amino acids 1 to 48 of SEQ ID NO:18,
amino acids 1 to 48 of SEQ ID NO:20,
amino acids 1 to 45 of SEQ ID NO:22,
amino acids 1 to 49 of SEQ ID NO:24,
amino acids 1 to 44 of SEQ ID NO:26, or
amino acids 1 to 59 of SEQ ID NO:28.

6. The polypeptide according to claim 2, which is encoded by a nucleotide sequence which hybridizes with medium-hard conditions with (i):
nucleotides 151 to 297 of SEQ ID NO:1,
nucleotides 151 to 297 of SEQ ID NO:3,
nucleotides 151 to 297 of SEQ ID NO:5,
nucleotides 151 to 297 of SEQ ID NO:7,
nucleotides 151 to 297 of SEQ ID NO:9,
nucleotides from 118 to 255 of SEQ ID NO:11,
nucleotides from 118 to 255 of SEQ ID NO:13,
nucleotide sequence that is the Chida from 112 to 255 of SEQ ID NO:15,
nucleotides from 112 to 255 of SEQ ID NO:17,
nucleotides from 112 to 255 of SEQ ID NO:19,
nucleotides from 118 to 252 of SEQ ID NO:21,
nucleotides 151 to 297 of SEQ ID NO:23,
nucleotides from 121 to 252 of SEQ ID NO:25,
or nucleotides 145 to 321 of SEQ ID NO:27 or
(ii) a complementary circuit (i).

7. The polypeptide according to claim 2, which is encoded by a nucleotide sequence which hybridizes under stringent conditions with (i):
nucleotides 151 to 297 of SEQ ID NO:1,
nucleotides 151 to 297 of SEQ ID NO:3,
nucleotides 151 to 297 of SEQ ID NO:5,
nucleotides 151 to 297 of SEQ ID NO:7,
nucleotides 151 to 297 of SEQ ID NO:9,
nucleotides from 118 to 255 of SEQ ID NO:11,
nucleotides from 118 to 255 of SEQ ID NO:13,
nucleotides from 112 to 255 of SEQ ID NO:15,
nucleotides from 112 to 255 of SEQ ID NO:17,
nucleotides from 112 to 255 of SEQ ID NO:19,
nucleotides from 118 to 252 of SEQ ID NO:21,
nucleotides 151 to 297 of SEQ ID NO:23,
nucleotides from 121 to 252 of SEQ ID NO:25,
or nucleotides 145 to 321 of SEQ ID NO:27 or
(ii) a complementary circuit (i).

8. The polypeptide according to any one of claims 1 to 7, which consists of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 or SEQ ID NO:28.

9. The polypeptide according to claim 2, which consists of
amino acids 1 to 49 of SEQ ID NO:2,
amino acids 1 to 49 of SEQ ID NO:4,
amino acids 1 to 49 of SEQ ID NO:6,
amino acids 1 to 49 of SEQ ID NO:8,
amino acids 1 to 49 of SEQ ID NO:10,
the amino acid is t 1 to 46 of SEQ ID NO:12,
amino acids 1 to 46 of SEQ ID NO:14,
amino acids 1 to 48 of SEQ ID NO:16,
amino acids 1 to 48 of SEQ ID NO:18,
amino acids 1 to 48 of SEQ ID NO:20,
amino acids 1 to 45 of SEQ ID NO:22,
amino acids 1 to 49 of SEQ ID NO:24,
amino acids 1 to 44 of SEQ ID NO:26, or
amino acids 1 to 59 of SEQ ID NO:28.

10. Polynucleotide containing a nucleotide sequence that encodes a polypeptide according to any one of claims 1 to 9.

11. Polynucleotide of claim 10, having at least one mutation in the coding of the Mature polypeptide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 or SEQ ID NO:27, in which the mutant nucleotide sequence encodes a polypeptide consisting of
amino acids 1 to 49 of SEQ ID NO:2,
amino acids 1 to 49 of SEQ ID NO:4,
amino acids 1 to 49 of SEQ ID NO:6,
amino acids 1 to 49 of SEQ ID NO:8,
amino acids 1 to 49 of SEQ ID NO:10,
amino acids 1 to 46 of SEQ ID NO:12,
amino acids 1 to 46 of SEQ ID NO:14,
amino acids 1 to 48 of SEQ ID NO:16,
amino acids 1 to 48 of SEQ ID NO:18,
amino acids 1 to 48 of SEQ ID NO:20,
amino acids 1 to 45 of SEQ ID NO:22,
amino acids 1 to 49 of SEQ ID NO:24,
amino acids 1 to 44 of SEQ ID NO:26, or
amino acids 1 to 59 of SEQ ID NO:28.

12. The design of nucleic acid containing polynucleotide of claim 10, functionally linked to one or more coding sequences, to the E. direct the production of the polypeptide in an expression host.

13. The recombinant expression vector containing the design nucleic acid according to item 12.

14. Recombinant cell host containing the design nucleic acid according to item 12.

15. The method of producing the polypeptide according to any one of claims 1 to 9, comprising (a) cultivating a cell, which is in the form of wild type capable of producing the polypeptide under conditions conducive for production of the polypeptide; and (b) isolation of the polypeptide.

16. The method of producing the polypeptide according to any one of claims 1 to 9, comprising (a) culturing the host cell containing the design of nucleic acid containing the nucleotide sequence encoding the polypeptide, under conditions conducive to the production of the polypeptide; and (b) isolation of the polypeptide.

17. Selected polynucleotide obtained by (a) hybridizing a population of DNA under average conditions, preferably Srednerussky or stringent conditions with (i)
nucleotides 151 to 297 of SEQ ID NO:1,
nucleotides 151 to 297 of SEQ ID NO:3,
nucleotides 151 to 297 of SEQ ID NO:5,
nucleotides 151 to 297 of SEQ ID NO:7,
nucleotides 151 to 297 of SEQ ID NO:9,
nucleotides from 118 to 255 of SEQ ID NO:11,
nucleotides from 118 to 255 of SEQ ID NO:13,
nucleotides from 112 to 255 of SEQ ID NO:15,
nucleotides from 112 to 255 of SEQ ID NO:17,
nucleotides from 112 to 255 of SEQ ID NO:19,
nucleotides from 118 to 252 of SEQ ID NO:21,
nucleotides 11 to 297 of SEQ ID NO:23,
nucleotides from 121 to 252 of SEQ ID NO:25 or
nucleotides 145 to 321 of SEQ ID NO:27; or (ii) a complementary circuit (i); and (b) distinguishing hybridization of polynucleotide, which encodes a polypeptide having antimicrobial action.

18. The method of producing the polypeptide according to any one of claims 1 to 9, comprising (a) cultivating a transgenic plant or the plant cells containing polynucleotide that encodes a polypeptide having antimicrobial activity, according to the present invention under conditions conducive for production of the polypeptide; and (b) isolation of the polypeptide.

19. The transgenic plant, plant part or plant cell which has been transformed by polynucleotide coding for the polypeptide according to any one of claims 1 to 9.

20. The way of lysis or inhibiting growth of microbial cells, including contact of microbial cells with antimicrobial polypeptide as defined in any one of claims 1 to 9.

21. Antimicrobial polypeptide as defined in any one of claims 1 to 9, for use as a medicinal product or veterinary antimicrobial or therapeutic or prophylactic agent.

22. Antimicrobial polypeptide as defined in any one of claims 1 to 9, in obtaining veterinary or medical therapeutic or prophylactic agent for the treatment of microbial infection or the La prophylactic use.

23. The use of at least one antimicrobial polypeptide as defined in any one of claims 1 to 9, in animal feed.



 

Same patents:

FIELD: medicine.

SUBSTANCE: there is claimed isolated human antibody or its fragment, which binds to human EGFR. Antibody contains corresponding CDR areas of light and heavy chain. Its conjugate with anti-neoplastic means or marker is described. Also described are: coding nucleic acid, expression vector, recombinant cell-host for obtaining antibodies and method of inhibiting growth of tumor, expressing EGFR on the basis of antibody.

EFFECT: application of invention provides antibodies with affinity comparable or higher, than in IMC-C225, which neutralises EGFR activation, what can be applied in medicine for treatment of tumours.

36 cl, 14 dwg, 6 tbl, 13 ex

FIELD: medicine.

SUBSTANCE: invention represents mutant photoprotein for determining intracellular calcium simultaneously in different cell organelles, which possesses light0emitting function and is characterised by amino acid sequence of wild type calcium-regulated photoprotein, in which natural residues of phenylalanine, related to conservative regions of said sequence and corresponding to residue 119 of photoprotein obelin Obelia longissima, as well as to residue 88 of obelin Obelia longissima, are substituted with other residues, different from phenylalanine, substitution of which results in the reduction of sensitivity of calcium-regulated photoprotein to calcium ions in comparison with wild type photoprotein and change of emitted light wavelength in comparison with wild type photoprotein. Invention also relates to one more mutant protein, which has substitution in position 144 of photoprotein obelin Obelia longissima. Invention also relates to DNA, which codes said proteins, as well as to vectors for expression of proteins.

EFFECT: invention allows to obtain novel forms of photoprotein with changed sensitivity to calcium and changes wavelength of emitted light.

13 cl, 5 dwg, 4 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to immunology and biotechnology. The invention discloses versions of a cytotoxically active CD3-specific binding structure. The structure comprises a first domain specifically binding to human CD3 and an Ig-derived second binding domain which is specific to molecules on the cell surface. The invention describes a coding nucleic acid, a vector for expressing the structure and an eukaryotic cell transformed by the vector. The invention discloses versions of compositions based on the structure for treating, preventing or alleviating various diseases and corresponding methods of treating the diseases. A method of obtaining the structure is disclosed.

EFFECT: use of the invention provides a structure with low immunological potency, which has cytotoxicity comparable to the initial structure, which may find further use in medicine.

60 cl, 18 dwg, 15 tbl, 8 ex

FIELD: chemistry.

SUBSTANCE: invention relates to anti-M-CSF-specific antibodies based on RX1 or originating from RX1, and which more than 785% compete with monoclonal antibodies RX1, MC1 and/or MC3 for bonding with M-CSF (macrophagal colony-stimulating factor). The non-mouse antibody is two-stranded, contains a certain amino acid sequence (given in the formula of invention and list of sequences) and retains high affinity towards M-CSF. The invention discloses an isolated nucleic acid which codes the said antibody, an expression vector, a host cell and a method of producing the anti-M-CSF-antibody using a host cell or hybridome, particularly ATCC PTA-6263 or ATCC PTA-6264 hybridome. The invention describes a pharmaceutical composition containing said antibodies, sets containing pharmaceutical compositions and methods of preventing and treating osteoporosis in a person suffering from an osteolytic disease.

EFFECT: disclosed antibodies can inhibit osteoclast differentiation, which facilitates their use as highly effective preparations for treating osteolysis, cancer with metastases and osteoporosis associated with cancer metastases.

131 cl, 44 dwg, 12 tbl, 16 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to genetic engineering and can be used to optimise expression of the antigen protein of the human epidermal growth factor-2 (HER2/neu). To obtain the HER2/neu protein, a nucleic acid synthetic molecule is used, which is codon-optimised for high level of expression of the said protein in a human cell.

EFFECT: invention increases production of the recombinant HER2/neu protein during expression in human cells.

8 cl, 10 dwg, 14 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to a novel fluorescent protein from Entacmaea quadricolor and its functional mutants. The invention discloses nucleic acids which code the said protein, a vector which contains the said nucleic acids, a transgenic cell which carries the vector and a method of obtaining the said fluorescent proteins from transgenic cells. The composition of the said proteins and nucleic acids can be used in various applications and methods, particularly for labelling biomolecules, cells or cell organelles. The disclosed protein and nucleotide sequences can be used for testing activity of promoters under various conditions.

EFFECT: obtaining proteins with primarily red or far-red fluorescence.

7 cl, 7 dwg, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to immunology and biotechnology. The invention discloses a monomer single-strand V93 nanoantibody which can bind and inhibit the human vascular endothelial growth factor. The invention describes a nucleotide sequence which codes the V93 nanoantibody and its expression vector with extra epitope(s) on the C-end for detection and extraction and a signal peptide on the N-end. The invention discloses a method of obtaining the V93 nanoantibody, a method of inhibiting proliferation of endothelial cells using the V93 nanoantibody, as well as use of the V93 nanoantibody for qualitative and quantitative determination of VEGF in a sample.

EFFECT: use of the invention provides high-affinity neutralising monovalent single-strand nanoantibodies which are more resistant to external factors (temperature, pH) and cheaper to produce compared to conventional VEGF antibodies, which can be useful in medicine for treating and diagnosing diseases associated with regulation of the activity of the vascular endothelial growth factor (VEGF).

7 cl, 7 dwg, 6 ex

FIELD: chemistry.

SUBSTANCE: invention relates to immunology and biotechnology. The invention describes a nucleotide sequence which codes the V9 nanoantibody and its expression vector with extra epitope(s) on the C-end for detection and extraction and a signal peptide on the N-end. The invention discloses a method of obtaining the V9 nanoantibody, a method of inhibiting proliferation of endothelial cells using the V9 nanoantibody, as well as use of the V9 nanoantibody for qualitative and quantitative determination of VEGF in a sample. Use of the invention provides high-affinity neutralising monovalent single-strand nanoantibodies which are more resistant to external factors (temperature, pH) and cheaper to produce compared to conventional VEGF antibodies, which can be useful in medicine for treating and diagnosing diseases associated with regulation of the activity of the vascular endothelial growth factor (VEGF).

EFFECT: invention discloses a monomer single-strand V9 nanoantibody which can bind and inhibit the human vascular endothelial growth factor.

7 cl, 7 dwg, 7 ex

FIELD: medicine.

SUBSTANCE: plasmid contains a DNA fragment encoding laccase C1 of ligninolytic fungus Trametes hirsuta or a DNA fragment hybridised with SEQ ID N0:1 in tough conditions, under control of promoter functioning in this cell. The resulting cell is a producer of laccase C1. The invention also refers to method of laccase obtaining using to the indicated cell.

EFFECT: obtaining laccase with high catalytic activity.

6 cl, 3 dwg, 1 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: present invention relates to biotechnology and immunology. An antibody against angiopoietin-2 is proposed. Versions of the antibody are disclosed, which are produced by hybridome ATCC PTA-7258, ATCC PTA-7259, ATCC PTA-7260. The corresponding coding nucleic acid and expression vector are disclosed. A host cell which produces the antibody based on the said vector is described. The disclosed antibodies have Kd of the order of 10-10-10-12 M, for the antibody 3.19.3 (from ATCC PTA-7260) IC50=99 nM. The said antibody properties can be used in treating human tumours.

EFFECT: design of a method of treating pathological angiogenesis based on an antibody and use of the antibody to prepare a medicinal agent for treating pathological angiogenesis.

33 cl, 18 dwg, 18 tbl, 24 ex

FIELD: medicine.

SUBSTANCE: DNA-aptamer specifically and high-affinity get bound with thrombin and is described by general formula: dRGTGACGTANGGTTGGTGTGGTTGGGGCGTCACR (1) where N is any nucleotide of G, A, T, C line or can be absent; R is a chemical radical of 5'-O-methyl-, 5'O-alkyl, 5'-Oallyl; 3'-O-methyl, 3'O-alkil, 3'-O-allyl or can be absent; d is deoxyribose (oligonucleotide contains deoxyribose in all positions).

EFFECT: invention allows producing DNA-aptamer which high-affinity get bound with thrombin, inhibits fibrin-forming activity of purified thrombin, inhibits thrombin activity in human blood plasma, with prolonging activated partial thromboplasmin time, prothrombin and thrombin time, as well as inhibits thrombin stimulated thrombocyte aggregation mediated by thrombin banding with PAR thrombocyte receptors.

2 cl, 13 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: oligonucleotide with double specificity for synthesis of nucleic acid molecule in elongation reaction on matrix has the following general formula: 5'-Xp-Yq-Zr-3'. Method of obtaining oligonucleotide with double specificity includes selection of sequence of target nucleic acid. After that constructing of sequence of oligonucleotide, which contains hybridisation sequence and separating section, containing at least three universal bases, so that hybridisation section penetrates enters hybridisation sequence, producing in said oligonucleotide three sections. After that location of separating section in said nucleotide is determined.

EFFECT: claimed invention allows to carry out matrix-depending reactions with much higher specificity.

28 cl, 13 dwg, 1 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention refers to compounds represented by double-strained RNA mediating RNA interference and including two complementary RNA-strands containing 17-30 nucleotides with at least one blunt end which includes 3'-end of formula I: , where X means O or S, R1 and R2 independently mean OH, NH2, SH, alkyl, aryl, alkylaryl, arylalkyl, where alkyl, aril, alkylaryl, arylalkyl are optionally substituted with additional heteroatoms and functional groups where the specified heteroatom is chosen from the group including N, O and S, and the specified functional group is chosen from the group, including OH, NH2, SH, carboxylic acid and ester, or R1 and R2 can have formula Y-Z wherein Y means O, N, S, and Z means N, alkyl, aryl, alkylaryl, arylalkyl where alkyl, aryl, alkylaryl, arylalkyl are optionally substituted with additional heteroatoms where the specified heteroatom is chosen from the group including N, O and S; provided that both R1 and R2 does not mean OH.

EFFECT: offered invention allows eliminating the disadvantages of synthetic siRNA with 3'-overhanging ends.

8 cl, 4 dwg, 1 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, virology and medicine. The invention concerns methods of prevention and treatment of virus diseases, particularly caused by the strains subtype H5N1 bird influenza virus, a preparation of interferon inducer exhibiting antiviral action, or preparations of interferon inducer and neuraminidase inhibitor. The method involves introduction of said preparation of interferon inducer or interferon inducer and neuraminidase inhibitor Ozeltamivir. Ridostine is used as a preparation of interferon inducer. The invention can be used in medicine.

EFFECT: ensured higher efficacy, lowered toxicity and good tolerance by using a preparation of interferon inducer based on duplex and single RNA recovered from received from Saccharomyces cerevisiae killer yeast together with neuraminidase inhibitor and development of more optimum regimen.

2 cl, 4 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: plasmid contains a DNA fragment encoding laccase C1 of ligninolytic fungus Trametes hirsuta or a DNA fragment hybridised with SEQ ID N0:1 in tough conditions, under control of promoter functioning in this cell. The resulting cell is a producer of laccase C1. The invention also refers to method of laccase obtaining using to the indicated cell.

EFFECT: obtaining laccase with high catalytic activity.

6 cl, 3 dwg, 1 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention is a DNA molecule encoding an enzyme having glucoamylase activity, possessing at least 80% sequence identity with glucoamylase from Trichoderma, possessing the sequence of SEQ ID NO: 4. The invention also refers to vectors and host cells with integrated DNA sequences, enzyme compositions and methods of use of glucoamylase in various applications.

EFFECT: expansion of arsenal of glucoamylases.

45 cl, 20 dwg, 10 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: DNA sequences tightly bound with cell surface proteins are recovered. The prepared DNA fragments are divided lengthwise to recover the fragments 6-16 nucleotides long to be sequenced. Among the prepared DNA fragments, motives 5-8 n long are identified. It is followed with searching genomic DNA sequences in databases in silico containing the specified motives at frequency 50% and more. Oligonucleotides of the identified sequence are synthesised and analysed for their immunomodulatory activity.

EFFECT: invention allows improving effectiveness of immunomodulatory DNA fragments selection that is ensured by using natural DNA fragments tightly bound with cell surface proteins as a starting material for searching the sequence-specific sequences.

3 cl, 4 tbl, 2 ex

FIELD: agriculture.

SUBSTANCE: plasmid pC27RNS contains DNA of coding part of gene of extracell ribonuclease Zinnia elegans ZRNasell under control of inducible MAS2' -promotor. Plasmid pBiRNS contains DNA of coding part of gene of extracell ribonuclease Zinnia elegans ZRNasell under control of inducible 35S-promotor. Plasmid pC27RNS or pBiRNS is transferred into strain Agrobacterium tumefaciens. Produced agrobacteria are used to transform plant material by cocultivation with Agrobacteria and further selection of transgentic plants at selective medium.

EFFECT: expression of gene of extracell ribonuclease Zinnia elegans ZRNasell in plants gives them imprived resistance to virus infections.

3 cl, 3 dwg, 3 tbl, 5 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to molecular biology and biotechnology. Proposed are fragments of double-chain RNA with length of 22 nucleotides which contain trinucleotide projecting 3'-ends consisting of nucleotide chains of the following sequence: 5'-AAAN1N2N3N4N5N6N7GCCUGACACUUU/A-3' 5'-GUGUCAGGCN14N13N12N11N10N9N8UUUUUU/A-3', where N1-N7 are complementary to N8-N14, respectively, having antiproliferative and interferon-inducing activity.

EFFECT: obtaining compounds which can be used for making dosage forms of preparations used for treating viral diseases.

5 dwg 2 tbl, 6 ex

FIELD: chemistry.

SUBSTANCE: invention relates to oligonucleotide probes and their compositions which can be used to analyse the representative sample of a genome. An algorithm is proposed, which employs genome transformation and an auxiliary data structure for fast and accurate calculation of the quantity of a specific nucleotide motive in a genome. Such an algorithm can be used to identify oligonucleotide probes according to this invention. Provided also are systems and methods of analysing differences in the number of copies nucleotide sequences and comparing the level of methylation between two genomes.

EFFECT: invention proposes a simple genome analysis method owing to virtual presentation with minimum risk of cross hybridisation and possibility of avoiding oversized or undersized presentation of certain sequences during genome analysis.

71 cl, 12 dwg, 2 tbl, 12 ex

FIELD: biotechnology.

SUBSTANCE: DNA is constructed encoding protein, advancing fungus resistance to certain group of compounds. Alternatively DNA is constructed having defect in function and encoding protein, which advances lowering of GPI-anchored protein amount in fungus cell wall. Encoded protein is useful in production of antibody thereto which may by applied as active ingredient of antifungal agent.

EFFECT: new method for production of antifungal agent.

11 cl, 8 dwg, 1 tbl, 2 ex

Up!