Mutant photoprotein (versions) for determining intracellular calcium simultaneously in different cell organelles

FIELD: medicine.

SUBSTANCE: invention represents mutant photoprotein for determining intracellular calcium simultaneously in different cell organelles, which possesses light0emitting function and is characterised by amino acid sequence of wild type calcium-regulated photoprotein, in which natural residues of phenylalanine, related to conservative regions of said sequence and corresponding to residue 119 of photoprotein obelin Obelia longissima, as well as to residue 88 of obelin Obelia longissima, are substituted with other residues, different from phenylalanine, substitution of which results in the reduction of sensitivity of calcium-regulated photoprotein to calcium ions in comparison with wild type photoprotein and change of emitted light wavelength in comparison with wild type photoprotein. Invention also relates to one more mutant protein, which has substitution in position 144 of photoprotein obelin Obelia longissima. Invention also relates to DNA, which codes said proteins, as well as to vectors for expression of proteins.

EFFECT: invention allows to obtain novel forms of photoprotein with changed sensitivity to calcium and changes wavelength of emitted light.

13 cl, 5 dwg, 4 ex

 

The invention relates to the field of genetic and protein engineering, namely to new proteins, mutant CA2+-regulated photoproteins that exhibit distinctive properties compared to fetoprotein wild-type cDNA encoding the protein data, and can be used in in vivo studies, in particular, for measuring the flow of calcium into the cells. The main use of the Sa2+frequency photoproteins because of the nature of the reaction - emission of light occurs in response to calcium ions, therefore, the greatest use of the Sa2+-adjustable fetoprotein found as bioluminescent indicators of intracellular calcium in various cell types. Bioluminescence is triggered by calcium ions and is caused by oxidative decarboxylation associated with the protein substrate - coelenterazine. The result is the formation of the reaction product, calendered in the excited state and CO2. The transition calendered from the excited state to the ground accompanied by the emission of light. Obelin wild type generates a "blue" bioluminescence. For monitoring the content of intracellular calcium at once in different parts of the cell would be useful to change the wavelength of emission, so that it was possible to separate signals coming from different organelles. Fetoprotein dick is x types allow to measure the concentration of CA 2+in the concentration range 10-7-10-4M Different content of free calcium in different organelles (EPR, which is the CA2+depot, and in the mitochondria, the maximum concentration of free calcium is very high and reaches 0.1-1 mm, and in the cytosol, on the contrary, low 10-8-10-7M) requires the application of photoproteins with decreased and increased sensitivity to calcium.

Known mutants aquarina and obelin the luminescent protein with shifted emission spectrum [US 7345160, C12Q 1/66, publ. March 18, 2008], where the shift, in addition, was achieved by using as a substrate modified analogues coelenterazine that led to radiation in the longwave part of the spectrum.

A known number of mutants aquarina low [Kendall J.M. et al, Biochem. Biophys. Res. Commun., 1992] and increased sensitivity to calcium [L. Tricoire et al, PNAS, 2006, (prototype)].

The disadvantage of the mutants aquarina and aquarina wild type is the effect of magnesium ions on the sensitivity towards calcium ions. This is significant because magnesium ions are able to bind to the binding sites of calcium and modify sensitivity to calcium in the cell magnesium content was quite large (1-3 mm).

The technical result of the invention to provide on the basis of photoprotein reporter of intracellular calcium that has both reduced feelings is lacking calcium or "blue bioluminescence", and reporter with increased sensitivity to calcium and green bioluminescence.

The technical result is achieved by the fact that in the mutant photoprotein to determine intracellular calcium at the same time in different organelles of the cell, having a light emitting function and characterized by the amino acid sequence of the calcium-regulated photoprotein wild-type, in which the natural phenylalanine residues belonging to the conservative regions of the named sequence and the corresponding residue 119 photoprotein obelin the luminescent protein Obelia longissima (or residue 120 fetoprotein aquarina Aequorea victoria, or residue 122 fetoprotein litina Clytia gregaria), and the residue 88 obelin the luminescent protein Obelia longissima (or residue 89 fetoprotein aquarina Aequorea victoria, or residue 91 of photoprotein litina Clytia gregaria), replaced by other residues, other than phenylalanine, substitutions which lead to the fact that the sensitivity of the calcium-regulated photoprotein towards calcium ions is reduced in comparison with fetoprotein wild-type and changes the wavelength of the emitted light compared to fetoprotein wild type. Amino acid residue corresponding to residue 119 in abeline Obelia longissima, is tryptophan, and the amino acid residue corresponding to residue 88 obelin the luminescent protein Obelia longissima, is a tyrosine.

The technical result to thetsa the that mutant photoprotein to determine intracellular calcium at the same time in different organelles of the cell, having a light emitting function and characterized by the amino acid sequence of the calcium-regulated photoprotein wild-type, in which the natural balance of isoleucine, which is conservative and the corresponding amino acid residue 144 photoprotein obelin the luminescent protein Obelia longissima (or residue 145 fetoprotein aquarina Aequorea victoria, or residue 147 fetoprotein litina Clytia gregaria), replaced by another amino acid residue other than isoleucine, thus, it increases the sensitivity of the calcium-regulated photoprotein towards calcium ions and changes the wavelength of the radiation in comparison with fetoprotein wild type. In the mutant fetoprotein hydrophobic amino acid residue at position 144 photoprotein obelin the luminescent protein Obelia longissima replaced by a hydrophilic amino acid residue. Hydrophilic amino acid, which increases the sensitivity of the calcium-regulated photoprotein towards calcium ions and change the wavelength of the emitted light, is a histidine.

The technical result is also provided DNA, in which the codons corresponding to amino acid residues at positions 119 and 88, replaced by codons that determine amino acid other than phenylalanine, so about the time, the sensitivity of the calcium-regulated photoprotein towards calcium ions decreases and changes the wavelength of the emitted light compared to fetoprotein wild type. DNA has the nucleotide sequence described in Seq. No. 1, where the nucleotides at positions 262 to 264 form a codon encoding amino acid, providing the shift of the maximum radiation in the shorter wavelength region of the spectrum, and the nucleotides at positions 355-357 form a codon encoding an amino acid that reduce the sensitivity of photoprotein towards calcium ions. DNA, in which the nucleotides at positions 262 to 264 encode tyrosine and the nucleotides at positions 355-357 encode tryptophan.

The technical result is also provided DNA, in which the codon corresponding to amino acid residue at position 144 is replaced by codon determining amino acid other than isoleucine, so that the sensitivity of the calcium-regulated photoprotein towards calcium ions increases and changes the wavelength of the emitted light compared to fetoprotein wild type. DNA has the nucleotide sequence described in Seq. No. 3, where the nucleotides in positions 430 to 432 form a codon encoding amino acid, providing the shift of the maximum radiation in the longwave region of the spectrum and increase the sensitivity of photoprotein Kinam calcium. DNA, in which the nucleotides in positions 430 to 432 encode histidine.

Vector for protein expression in mammalian cells, is a plasmid pCMV/myc/mito (Invitrogene), which Legerova DNA, characterized by the sequence Seq. No. 1, the expression product of which is localized in mitochondria and emit blue light.

Vector for protein expression in mammalian cells, representing the plasmid pcDNA3.1, which Legerova DNA, characterized by Seq. No. 3, the expression product of which is localized in the cytoplasm of the cells and the appearance of calcium ions (with incentive) to emit green light. Plasmids containing the genes for mutant photoproteins in such forms, which are able to Express the proteins of the invention constitutive, when introduced into a cell of the host.

According to the invention provides mammalian cells lines SNO able to Express the mutant photoprotein of the invention, and the method of analysis in which the intracellular calcium concentration is measured simultaneously in two parts of the cell.

In the invention by site-directed mutagenesis derived proteins, one molecule of which contains at the same time replacement, leading to change two properties of photoprotein: sensitivity towards calcium ions and bioluminescence spectrum. It does not require additional is sustained fashion the use of substrate analogues. And, unlike the prototype, except for a change in the sensitivity to calcium, mutant photoprotein of the present invention have altered spectral characteristics of the radiation so that the maximum bioluminescence two mutant photoproteins are separated from each other at the spectral wavelength of 50 nm. Also unlike the prototype photoprotein according to the invention are calcium sensitivity, which does not depend on the presence of magnesium ions.

Purchased a mutant fetoprotein new properties can effectively use them as a reporter agents in the study of flow of calcium in the cells, because having different sensitivity to CA2+allow to measure the concentration of ions in the compartments of the cells with various concentrations of calcium, and the different maxima of the radiation makes it possible to measure at the same time.

The above distinctive features of the prototype characteristics allow to draw a conclusion on the conformity of the proposed technical solutions to the criterion "novelty".

The features distinguishing the claimed technical solution from the prototype, have been identified in other technical solutions and, therefore, provide the claimed solution according to the criterion of "inventive step".

Description of the drawings

The figure 1 presents the sequence of oligonucleotide is, used as primers for the implementation of the mutation site-directed mutagenesis.

The figure 2 presents a graph illustrating spectra of bioluminescence obelin the luminescent protein wild type WT and mutants obelin the luminescent protein with a double replacement: phenylalanine in the 88th position on tyrosine and in the 119th position in tryptophan (F88Y&F119W) and with the substitution of the isoleucine at position 144 the amino acid sequence of obelin the luminescent protein to histidine (I144H).

The figure 3 shows graphs of the dependence of luminescence intensity on the concentration of CA2+(A) mutant obelin the luminescent protein OL I144H, (C) mutant obelin the luminescent protein OL F88Y&F119W. Notation: Δ - luminescence mutants, ○ - luminescence obelin the luminescent protein WT. Filled symbols - calcium concentration was specified with the help of CA2+- EGTA buffers. Open symbols - calcium concentration was asked by farming solution of CaCl2. The light intensity signal (L) is expressed in units of L/Lintwhere Lint- the total number of quanta emitted during the reaction, determined from kinetic measurements under the same conditions in the same protein sample. Measure temperature of 20°C. In the lower right corner of the graphs shows bioluminescence spectra of the corresponding mutant proteins, the intensity of luminescence is expressed in relative units, obtained by normalization of the spectra at the Lmax. Next to the curve numbers is denoted by wavelength, at which there is maximum bioluminescence (λmax).

The figure 4 shows the graphs of the dependence of luminescence intensity obelin the luminescent protein mutant OL F88Y (a) and aquarina Aeq N33D () from the concentration of CA2+. Symbols: ○ - luminescence mutants in the absence of Mg2+; □ - luminescence mutants in the presence of 1 mm Mg2+. The other designations similar to figure 3.

The figure 5 presents a table that outlines the key features of bioluminescence obelin the luminescent protein WT and its mutant variants: OL I144H and OL F88Y&F119W. The characteristics of bioluminescence in solution at pH 7.0. Bioluminescent activity expressed as a percentage relative to the specific activity of obelin the luminescent protein wild-type (recombinant). The parameter Lmin/Int denotes the intensity of the CA2+-independent luminescence normalized by the total light output. CA2+-independent luminescence (spontaneous emission) is a measure of the stability of photoproteins. krecessioncharacterizes the speed of recession of the bioluminescent signal.

The sequence presented in the end of the description, describe the DNA sequence and amino acids as follows:

Sequence No. 1: represents the DNA sequence encoding a mutant photoprotein of the present invented the I, in which the codons of the wild type Obelia longissima at positions 262 to 264 and 355-357 suffered mutations to tyrosine base 263 mutation And presents, for tryptophan base 356 and 357 in mutation presents So

Sequence No. 2: is the amino acid sequence of photoprotein of the present invention, in which the amino acid phenylalanine at positions 88 and 119 Obelia longissima replaced with tyrosine and tryptophan, respectively.

Sequence No. 3: represents the DNA sequence encoding another mutant photoprotein of the present invention, in which the mutated codon wild-type Obelia longissima in position 430 to 432 so that the base at position 430 and 431 are presented With, and A.

Sequence No. 4: is the amino acid sequence of another photoprotein of the present invention, in which the amino acid isolamin replaced by histidine.

Example 1

Obtaining mutant photoproteins with altered sensitivity to calcium and spectra of radiation.

All genetic engineering manipulations, unless otherwise stated, were performed using methods well known to specialists in this field.

Site-directed mutagenesis to obtain mutant forms of obelin the luminescent protein was carried out by PCR using a kit aimed at customers QuikChange® Site-Directed Mutagenesis Kit (Stratagene, USA), following the manual to the set. As the matrix used a plasmid containing the gene of obelin the luminescent protein wild-type pET19-OL8. The primers for the introduction of single amino acid substitutions were synthesized in LLC "Synthol" (Russia). Sequences of oligonucleotide primers and their complementary partners are presented in figure 1. All the mutations were confirmed by sequencing the DNA. The DNA nucleotide sequence was determined on a system for sequencing Amerlight (Amersham, UK) using Themo Sequenase™ Cy™5 Dye Terminator Kit (Amersham, UK). For each set of 4 reactions (one sample) was prepared by the reaction mixture is a combination of the following components in a single vial: 1 μg DNA template (0.5 ág/ál), 4 pmol sequencewas primer (20 μm), reaction buffer, thermosequenase (10 U/µ1), 2 μl of A, G, C or T-mixture. The amplification program consisted of 31 cycle with the following parameters: 95°C 30 sec, following 30 cycles (95°C 30 sec, 56°C 30 sec, 72°C 1 min 20 sec). The obtained samples were perioadele ethanol with ammonium acetate and glycerol, the precipitate was obtained by centrifugation for 15 min at 16000 g, dried in air and dissolved in 8 μl of stop solution to each. Then DNA was denaturiruet by heating for 3 minutes at 72°C and placed in ice before application to the gel. As an electrophoretic buffer used is VE×0.5. The gel was applied at 1/2 volume reactions. The separation was carried out according to the standard program ALFWin Control (Amerlight, UK) under the following conditions: 1500 V, 25 mA, 750 minutes Data were processed using the program ALF Express.

Proteins expressed in cells .li and obtained in highly purified form by the method developed for obelin the luminescent protein wild-type (WT). The cell paste is suspended in five volumes of 0.02 M Tris-HCl, pH 7.0, and was destroyed by sound using ultrasonic disintegrator UD-20 (Techpan, Poland) 5-fold to 20 seconds while cooling with ice. The resulting mixture was centrifuged (14000 g, 2.9 min). The residue, consisting mainly of Taurus include, washed, resuspended sequentially with solutions of 0.02 M Tris-HCl, pH 7.0 containing 0.9% NaCl, 0.1% Triton X-100, 5 mm CaCl2. Taurus inclusion was dissolved in a 2.5-fold volume of 6 M urea containing 20 mm Tris-HCl and 5 mm CaCl2(40°C, over night), then centrifuged. The supernatant was chromatographically on a column filled with DEAE-Sepharose FF (2×3.5 cm) (chromatography FPLC system, Pharmacia, Sweden). The elution of substances from the column was performed with buffer containing 6 M urea, 5 mm CaCl20.02 M Tris-HCl pH 7.0 NaOAc concentration gradient from 0 to 0.5 M. the Rate of elution was 2 ml/min

The purity of the final preparations of recombinant Atabekov obtained after selection was estimated using the of electrophorese 12.5%SDS page under denaturing conditions (in the presence of 0.1%SDS) according to the method of laemmli's method.

Active photoprotein was obtained by incubation Atabekov with a 10-fold molar excess of substrate - coelenterazine in buffer containing 20 mm Tris-HCl, pH 7.0, 5 mm EDTA, 5 mm dithiothreitol at 4°C for at least 4 hours.

The activated protein was separated from Alibekov ion exchange chromatography on a column of Mono Q 5/5 by chromatographic system FPLC, Pharmacia, Sweden. The elution of protein from the column was performed in 20 mm Tris-HCl, pH 7, 5 mm EDTA gradient of NaCl (0-0,35 M).

Example 2

Determination of the sensitivity of photoproteins towards calcium ions

Determination of the sensitivity of photoproteins to the Ca2+based on the fact that low concentrations of Ca2+defined using a calcium buffer solutions (Ca2+-EGTA buffers), and high - simple dilution of a solution of CaCl2. Calcium buffer solutions were prepared from two stock solutions by reciprocal dilution: one of them contained equimolar amount of Ca2+and chelator - EGTA, the other the same amount of chelator, but without Ca2+. To determine the concentration of calcium in the finished solutions used equilibrium dissociation constant chelator, which depends on pH, ionic strength and temperature of the solution. All the used solutions and utensils require careful processing of traces of ions of Ca2+and EGTA. To this end, all used solutions passed the through the column with sorbent Chelex-100, connecting trace amounts of calcium ions (Sigma). For the preparation of solutions used deionized water (18.2 Mω). During the measurements the temperature of both solutions, and measuring cuvette block was maintained at a constant level (20°C).

Protein solutions were also purified from traces of ions of Ca2+and EGTA by gel filtration on a column: 1.5×6.5 cm D-Salt Dextran Desalting column (Pierce) in a buffer containing 150 mm KCl, 5 mm PIPES, pH 7.0. Fractions containing protein were identified by bioluminescent activity, while avoiding contamination EGTA whether bioluminescent activity on the concentration of Ca2+collected only the first coming from a speaker protein fractions. The measurement light signal was performed by injection of 10 μl of the thus prepared solution fetoprotein in 1 ml of Ca2+-solution. The intensity of the signal light (L) was expressed in units of L/Lintwhere Lint- the total number of quanta emitted during the reaction, determined from kinetic measurements under the same conditions in the same protein sample. The luminometer had three filters of different optical density, resistant to radiation, which allowed to record signals that differ in size by 8 orders of magnitude.

To determine the sensitivity of photoproteins to Sa2+in the presence of 1 mm Mg 2+, desalted protein sample was kept for 1 hour with 1 mm MgCl2. All Sa2+the solutions also contained 1 mm Mg2+.

A study of the dependence of luminescence intensity on the concentration of CA2+identified the following indicators:

a) the range of sensitivity of CA2+;

b) Lmin/Lmax- the ratio of the lower and upper bounds of the range of fluorescent response, characterizing the width of the range of fluorescent response;

in) Lmin/Int - intensity of CA2+-independent luminescence normalized by the total light output.

The dependence of luminescence intensity mutant photoproteins from the concentration of CA2+presented as function of the logarithm of the normalized luminescence (log(L/Lint)) from the logarithm of the concentration of CA2+(log[Ca2+]). The range of sensitivity of CA2+in the mutant fetoprotein I144H is located in the interval-7.6 - -4.7 and is shifted towards lower concentrations of CA2+compared with fetoprotein wild type, which means increasing the sensitivity of the mutants to the CA2+. In contrast, replacement F88Y&F119W lead to a shift of the range of sensitivity of CA2+towards higher concentrations of the ion, and the range is-6.5 - -3.6 (on the order of less than abelina wild type). Data Mut is ntie fetoprotein selected as the most promising of a series of planned and researched point substitutions in the sequence of obelin the luminescent protein, includes: SA, F72V, V118F, E41G, D133E&I132V, F119W, L160D, F88W, F88Y, F88H, F88R, W92F, W92H, W92E, W92K, W92R, W92F&H22E, NE, H22N, M25F, M25Y, MN, MC, M25R, I144W, I144H, I144Q, Y138F, Y138W. For mutant fetoprotein F88Y&F119W the value of Lmin/Lmaxis almost 10-7for mutant I144H - 10-6. Narrowing the width of the range of fluorescent response in the case of the latter is explained by the increase of the luminescence intensity in the absence of CA2+(increasing the lower end of the range) Lmin/Int.

Magnesium ions (Mg2+) have lower affinity to the calcium-binding sites of photoproteins than calcium ions (CA2+). But their presence may affect the sensitivity of CA2+. The presence of Mg2+in physiological concentrations (1 mm) does not affect the sensitivity of mutant photoprotein of the present invention to Sa2+. This is reflected in the fact that the CA2+curves in the absence of magnesium ions and in the presence of 1 mm Mg2+identical. The lack of influence of magnesium ions on the sensitivity towards calcium ions characteristic of the original protein - obelin the luminescent protein wild-type (WT). On this basis obelin differs from other fetoprotein - aquarina, despite the fact that both proteins are closely related and structural differences between them are minimal. We have designed 2 mutant aquarina: first with the replacement of the 33rd asparagine aspartic acid-Ohm Sa 2+-binding site aquarina (N33D), the second - with the replacement of phenylalanine in the 156-m position on serine located in the hydrophobic region of the protein globule (F156S). Determined the sensitivity of obtained mutants aquarina to calcium. It turned out that both photoprotein have a heightened sensitivity to CA2+compared with aquarium wild type, which is characterized by a shift of the range of sensitivity of CA2+towards lower concentrations of CA2+. Adding 1 mm Mg2+all used in the experiment solutions radically shifts of CA2+curves towards higher concentrations of the ion. The figure 4 presents examples of the influence of the presence of magnesium ions for their sensitivity to calcium onlinepogo mutant and aquarianage mutant.

Example 3

The main bioluminescent properties fetoprotein

Relative specific bioluminescent activity (relative obelin the luminescent protein wild type) mutants was determined using the tablet Luminoskan luminometer vl.30 (Labsystems, Finland). To do this, in the wells of an opaque tablet made 50 ál of solution fetoprotein in 20 mm Tris-HCl-buffer, pH 7.0, containing 5 mm EDTA and 0.2 M NaCl. The reaction was started by injection of 50 μl of 100 mm Tris-HCl buffer, pH 8.8, containing 100 mm CaCl2in each well of the plate. The scan signal from 5 sec to 1 min depending on the t speed luminescent reaction of each of the proteins.

Bioluminescent activity of mutant fetoprotein F88Y&F119W identical activity fetoprotein wild-type (WT), the activity of mutant fetoprotein I144H below 40% (figure 5).

Calcium-independent luminescence was measured in protein samples (0.5 to 2.0 mg/ml)containing 2 mm EDTA, placed in a luminometer cuvette.

The level of calcium-independent luminescence characterizing the stability of photoprotein as complex protein-substrate, the double mutant is the same as the obelin the luminescent protein wild-type and single in 10 times above, but when using this protein for in vivo studies, it is not essential, since the complex protein-substrate is formed by the penetration of hydrophobic substrate in the cell and does not require long-term storage.

Bioluminescence spectra were measured on an AMINCO (Thermo breakers, USA). All radiation spectra were corrected for the sensitivity of the PMT to different wavelengths by using the software of the device. Bioluminescence spectra were measured in protein solutions containing 1 mm EDTA, 50 mm Bis-Tris propane, pH 7.0, in the injection solution of CaCl2in the same buffer. The concentration of free calcium in the reaction mixture was about 0.5 µM (the concentration was calculated using a computer program Maxichelator) in order to ensure a constant level when ecene during the recording of the spectrum of radiation. The measurements were performed at room temperature.

Obelin wild type generates blue bioluminescence with a maximum of 482 nm and a shoulder around 400 nm. Maximum bioluminescence mutant fetoprotein F88Y&F119W is located in the "blue" part of the spectrum and is equal to 455 nm. Maximum bioluminescence mutant fetoprotein I144H is located in the green part of the spectrum and is equal to 505 nm. The spectra of both photoproteins invention of monomodal and do not contain other peaks.

The constant decline bioluminescent signal was calculated from the curve of decline, which was recorded during injection of saturating concentrations of Ca2+in the sample, placed in a luminometer cuvette, according to the formula krecession=ln(I1/I2)/Δt (sec).

The kinetics of the bioluminescent reaction mutants characterized by a slower decrease in the intensity compared to abelina wild type. The constant decline bioluminescent signal for F88Y&F119W is 1.6 sec-1that is 4 times less than that of obelin the luminescent protein WT, for I144H constant is 6.1, which is also less than the value of the constant obelin the luminescent protein wild type. Slow glow - another advantage of fetoprotein as an intracellular reporter protein, because it simplifies the registration of the light flux.

Example 4

Obtaining plasmids containing the DNA of the present invention

The plasmid pCMV/myc/mito and pcDNA3.1(+) receiving the s from hwtrogene Corporation, USA. Oligonucleotide primers were synthesized CJSC "Biosan", Russia.

Primer containing the restriction site for the nuclease kpni restriction sites to construct a vector containing the gene of mutant fetoprotein OL I144H, based on the pcDNA3.1(+) by PCR is characterized by the sequence:

olig No. 1 - 5'-TAACTTTAAGAAGGAGAGGTACCATGGCT-3'.

Primer containing the restriction site for the nuclease > PST, to construct a vector containing the gene of mutant fetoprotein OL F88Y&F119W, on the basis of pCMV/myc/mito by PCR, has the following sequence:

olig # 2 is 5'-CTTTAAGAAGGAGATATCTGCAGGCTTCAAAATACGCA-3'.

Primer for synthesis of the restriction site for the nuclease XhoI, complementary to the end portion of the sequence of obelin the luminescent protein presents:

olig No. 3 - 5'-TACTCGAGATTAGGGAACTCCGTTGC-3'.

To obtain pCMV-OL88/119 insert containing the coding sequence of the mutant fetoprotein OL F88Y&F119W (Seq. 1) with concavity restriction sites > PST and XhoI, were obtained on the basis of pET19b-OL88/119 by PCR with primers olig # 2 and olig No. 3. The restriction fragment and vector were performed using a > PST and XhoI (SibEnzyme, Russia), then preparative were purified using agarose gel electrophoresis and ligated.

To obtain pcDNA3.1(+)-OL144 insert containing the coding sequence of the mutant fetoprotein OL I144H (Seq. 3) with terminal restriction sites kpni restriction sites and XhoI, were obtained on the basis of pET19b-OL144 by PCR with primers lig # 1 and olig No. 3. The restriction fragment and vector were performed using Cloned and XhoI (SibEnzyme, Russia), then preparative were purified using agarose gel electrophoresis and ligated.

The obtained constructs were verified by DNA sequencing. Transformation of plasmids into cells Cho cells Chinese hamster ovary) was performed using transfairusa agent FreeStyle MAX (Invitrogene). Selective screening of clones containing plasmids was carried out on the medium with neomycin.

Received new mutant form of photoprotein obelin the luminescent protein, characterized by altered sensitivity to calcium and simultaneously changed the wavelength of the emitted light. New fetoprotein differ from the initial version of point substitutions in amino acid sequence. Received two reporter that can be used as intracellular calcium indicators. Blue and green bioluminescence, as well as high and low sensitivity to calcium, it allows to study the changes in the concentration of calcium at the same time (using two-wavelength detection) in the two cell compartments with different content of CA2+for example, in the cytosol, where [CA2+] rest is 0.05-0.1 μm, rising to 10 μm for various incentives, and the mitochondria, where [CA2+] hundreds of microns. This method of determining the content of nutrilett the CSOs calcium is applicable for studying processes in the cell, the indirect effect of calcium ions, to determine the function of receptors, ligands, ion channels, to study the effects on cells of various substances: drugs, toxins and other

Seq 1.

Seq 2.

Seq 3.

Seq 4.

1. Mutant photoprotein to determine intracellular calcium at the same time in different organelles of the cell, having a light emitting function, and characterized by the amino acid sequence of the calcium-regulated photoprotein wild-type, in which the natural phenylalanine residues belonging to the conservative regions of the named sequence and the corresponding residue 119 photoprotein obelin the luminescent protein Obelia longissima (or residue 120 fetoprotein aquarina Aequorea victoria, or residue 122 fetoprotein litina Clytia gregaria), and the residue 88 obelin the luminescent protein Obelia longissima (or residue 89 fetoprotein aquarina Aequorea victoria, or residue 91 of photoprotein litina Clytia gregaria) substituted by other residues other than phenylalanine, which lead replacement to the fact that the sensitivity of the calcium-regulated photoprotein towards calcium ions is reduced in comparison with fetoprotein wild-type and changes the wavelength of the emitted light compared fot the protein of the wild type.

2. Mutant photoprotein according to claim 1, characterized by the amino acid sequence described in Seq. No. 2, characterized in that the amino acid residue corresponding to residue 119 in abeline Obelia longissima, is tryptophan, and the amino acid residue corresponding to residue 88 obelin the luminescent protein Obelia longissima, is a tyrosine.

3. Mutant photoprotein to determine intracellular calcium at the same time in different organelles of the cell, having a light emitting function and characterized by the amino acid sequence of the calcium-regulated photoprotein wild-type, in which the natural balance of isoleucine, which is conservative and the corresponding amino acid residue 144 photoprotein obelin the luminescent protein Obelia longissima (or residue 145 fetoprotein aquarina Aequorea victoria, or residue 147 fetoprotein litina Clytia gregaria) replaced by another amino acid residue other than isoleucine, thus, it increases the sensitivity of the calcium-regulated photoprotein towards calcium ions and changes the wavelength of the radiation in comparison with fetoprotein wild-type.

4. Mutant photoprotein according to claim 3, characterized in that the hydrophobic amino acid residue at position 144 photoprotein obelin the luminescent protein Obelia longissima replaced by a hydrophilic amino acid residue.

5. Mutant photoprotein according to claim 4, characterized AMI is kislotno sequence, described in Seq. No. 4, where the hydrophilic amino acid, which increases the sensitivity of the calcium-regulated photoprotein towards calcium ions and change the wavelength of the emitted light, is a histidine.

6. DNA encoding a mutant photoprotein according to claim 2, characterized in that it polynucleotide sequence is a sequence of photoprotein obelin the luminescent protein wild-type, in which the codons corresponding to amino acid residues at positions 119 and 88, replaced by codons that determine amino acid other than phenylalanine, so that the sensitivity of the calcium-regulated photoprotein towards calcium ions decreases and changes the wavelength of the emitted light compared to fetoprotein wild-type.

7. The DNA according to claim 6, characterized in that has a nucleotide sequence described in Seq. No. 1, where the nucleotides at positions 262 to 264 form a codon encoding amino acid, providing the shift of the maximum radiation in the shorter wavelength region of the spectrum, and the nucleotides at positions 355-357 form a codon encoding an amino acid that reduce the sensitivity of photoprotein towards calcium ions.

8. The DNA according to claim 7, where the nucleotides at positions 262 to 264 encode tyrosine and the nucleotides at positions 355-357 encode tryptophan.

9. DNA encoding a mutant is oncoprotein according to claim 5, characterized in that it polynucleotide sequence is a sequence of photoprotein obelin the luminescent protein wild-type, in which the codon corresponding to amino acid residue at position 144 is replaced by codon determining amino acid other than isoleucine, so that the sensitivity of the calcium-regulated photoprotein towards calcium ions increases and changes the wavelength of the emitted light compared to fetoprotein wild-type.

10. The DNA according to claim 9, characterized in that has a nucleotide sequence described in Seq. No. 3, where the nucleotides in positions 430 to 432 form a codon encoding amino acid, providing the shift of the maximum radiation in the longwave region of the spectrum and increase the sensitivity of photoprotein towards calcium ions.

11. DNA of claim 10, where the nucleotides in positions 430 to 432 encode histidine.

12. The vector for expression of the protein described in any one of claims 1 and 2, in mammalian cells, representing the plasmid pCMV/myc/mito, which Legerova DNA described in any of PP-8.

13. The vector for expression of the protein described in any of PP-5, in mammalian cells, representing the plasmid pcDNA3.1, which Legerova DNA described in any of PP-11.



 

Same patents:

FIELD: medicine.

SUBSTANCE: degree of pathogenicity of enterovirus strains of Coxsackie B virus is determined basing on research of neuropathogenicity of Coxsackie B virus field strain in conditions of one nest of linear mice. Mice are divided on two groups. One is subjected to artificial infection with field strain. Expressed signs of central nervous system affection in mice infected in natural way are fixed. They are compared with characteristic of control strains of Coxsackie B virus prototype and epidemic ones. In case if character of expressed signs of nervous system affection coincides, correspondence of degree of pathogenicity of field strain to interepidemic one is stated.

EFFECT: invention allows to simplify determination of degree of pathogenecity of Coxsackie B virus strain.

3 ex

FIELD: chemistry.

SUBSTANCE: without grinding, a sample of freshly collected pathological material is put into an accumulation medium - guanosine monophosphate broth with addition of 1% glucose and then cultured in a temperature-controlled cabinet at 37°C for 24 hours. Seeding is then carried out on a Petri dish with agar medium with addition of 5% erythrocytes and on enterococcus agar. The inoculations are kept in a temperature-controlled cabinet for 24-48 hours at 37°C. Samples which failed to grow in aerobic conditions are further inoculated on a Petri dish with agar medium with addition of 5% erythrocytes and then put into an anaerobic jar for 24 hours at 37°C. The inoculations are examined under a microscope and microorganisms are identified from the results using traditional methods.

EFFECT: higher isolation rate of enterococcus in anaerobic conditions at 31,2-36% and possibility of detecting presence of microorganisms in clinical material which do not grow in aerobic conditions.

1 tbl

FIELD: medicine.

SUBSTANCE: cultivated microbiological objects count is ensured by the measurements of their morphological compositions by determining the size distribution of microorganism cells in a nutrient fluid by variation of scattered light intensity. The fluid flow is sounded with monochromatic coherent light; interaction signal of probe radiation and analysed microbiological objects are recorded by the measurement of amplitude and duration of scattered light pulses by analysed particles; and functions derived from the measurements are plotted in the form of two-dimensional distribution of specified amplitudes and durations expressing statistic parameters of light scattering intensity by particles. After said functions, the size distribution of analysed cultivated microbiological objects and decay products of the nutrient fluid is derived.

EFFECT: higher measurement accuracy due to eliminated error caused by foreign particles that are decay products of the nutrient fluid in cultivation of the analysed microbiological objects.

9 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: cultivated microbiological objects count is ensured by the measurements of their morphological compositions by determining the size distribution of microorganism cells in a nutrient fluid by variation of scattered light intensity. The fluid flow is sounded with monochromatic coherent light; interaction signal of probe radiation and analysed microbiological objects are recorded by the measurement of amplitude and duration of scattered light pulses by analysed particles; and functions derived from the measurements are plotted in the form of two-dimensional distribution of specified amplitudes and durations expressing statistic parameters of light scattering intensity by particles. After said functions, the size distribution of analysed cultivated microbiological objects and decay products of the nutrient fluid is derived.

EFFECT: higher measurement accuracy due to eliminated error caused by foreign particles that are decay products of the nutrient fluid in cultivation of the analysed microbiological objects.

9 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: oligonucleotide with double specificity for synthesis of nucleic acid molecule in elongation reaction on matrix has the following general formula: 5'-Xp-Yq-Zr-3'. Method of obtaining oligonucleotide with double specificity includes selection of sequence of target nucleic acid. After that constructing of sequence of oligonucleotide, which contains hybridisation sequence and separating section, containing at least three universal bases, so that hybridisation section penetrates enters hybridisation sequence, producing in said oligonucleotide three sections. After that location of separating section in said nucleotide is determined.

EFFECT: claimed invention allows to carry out matrix-depending reactions with much higher specificity.

28 cl, 13 dwg, 1 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: cell material containing marrow stem cells in a liquid culture medium is placed over a prepared agar medium containing marrow cells producing homing factors. After incubation of the prepared two-layer culture, inadherent cells are transferred to a semi-viscous culture medium and incubated in a mode required for colony-formation. Then by recording the difference of stem cell count in the cell material in the reference, and after placing on the agar medium containing homing factors, stem cells migrated by stem cell homing factor are counted.

EFFECT: invention allows simplifying the method for determination of production of stem cell homing factors due to the use of the agar medium as a semipermeable membrane and the introduction of colony-forming ability change of the cell material as an evaluation criterion of production of stem cell homing factors.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: nutrient medium contains salmon milt broth, sodium chloride, yeastrel, glucose, microbiological agar and distilled water.

EFFECT: extended range of nutrient mediums and simplified method for preparing a nutrient medium.

2 cl, 3 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: kit includes polyclonal antibodies against protein of said viral envelope and a pair of primers: upstream 5'-primer with ID 1: CTGCAGATGGTTTGCCGAATTTGCAA sequence and downstream 3'-primer with ID 2: GCTCTAGACTAGATCTCAAGCAGGTC sequence.

EFFECT: kit allows detecting Prunus necrotic ring spot virus in plants.

17 cl, 4 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: DNA is recovered from each germ in a parental and hybrid soya seed group. The recovered DNA is amplified by the polymerase chain reaction. The amplification is enabled by microsatellite SATT1, SATT9 and SOYPR 1 loci with using primers flanking these loci. The amplification products are electrophoretically separated in the coloured agarose gel.

EFFECT: comparison of electrophoretic spectra of each germ and spectra of its parental forms in ultraviolet rays allows recovering hybrid germs by observing two fractions on an electrophoregram matched with the fractions of parental forms.

2 cl, 3 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: molecular typing of genes of family of main complex of histocompatibility in blood is carried out by method of polymerase chain reaction. In case if in genes isolated from DNA detected are HLA-DR B1*04 or HLA-DR B1*16 alleles, high degree of risk of tuberculosis infection is determined.

EFFECT: increased efficiency of predicting tuberculosis of respiratory organs in children.

1 tbl, 2 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to immunology and biotechnology. The invention discloses versions of a cytotoxically active CD3-specific binding structure. The structure comprises a first domain specifically binding to human CD3 and an Ig-derived second binding domain which is specific to molecules on the cell surface. The invention describes a coding nucleic acid, a vector for expressing the structure and an eukaryotic cell transformed by the vector. The invention discloses versions of compositions based on the structure for treating, preventing or alleviating various diseases and corresponding methods of treating the diseases. A method of obtaining the structure is disclosed.

EFFECT: use of the invention provides a structure with low immunological potency, which has cytotoxicity comparable to the initial structure, which may find further use in medicine.

60 cl, 18 dwg, 15 tbl, 8 ex

FIELD: chemistry.

SUBSTANCE: invention relates to anti-M-CSF-specific antibodies based on RX1 or originating from RX1, and which more than 785% compete with monoclonal antibodies RX1, MC1 and/or MC3 for bonding with M-CSF (macrophagal colony-stimulating factor). The non-mouse antibody is two-stranded, contains a certain amino acid sequence (given in the formula of invention and list of sequences) and retains high affinity towards M-CSF. The invention discloses an isolated nucleic acid which codes the said antibody, an expression vector, a host cell and a method of producing the anti-M-CSF-antibody using a host cell or hybridome, particularly ATCC PTA-6263 or ATCC PTA-6264 hybridome. The invention describes a pharmaceutical composition containing said antibodies, sets containing pharmaceutical compositions and methods of preventing and treating osteoporosis in a person suffering from an osteolytic disease.

EFFECT: disclosed antibodies can inhibit osteoclast differentiation, which facilitates their use as highly effective preparations for treating osteolysis, cancer with metastases and osteoporosis associated with cancer metastases.

131 cl, 44 dwg, 12 tbl, 16 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to genetic engineering and can be used to optimise expression of the antigen protein of the human epidermal growth factor-2 (HER2/neu). To obtain the HER2/neu protein, a nucleic acid synthetic molecule is used, which is codon-optimised for high level of expression of the said protein in a human cell.

EFFECT: invention increases production of the recombinant HER2/neu protein during expression in human cells.

8 cl, 10 dwg, 14 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to a novel fluorescent protein from Entacmaea quadricolor and its functional mutants. The invention discloses nucleic acids which code the said protein, a vector which contains the said nucleic acids, a transgenic cell which carries the vector and a method of obtaining the said fluorescent proteins from transgenic cells. The composition of the said proteins and nucleic acids can be used in various applications and methods, particularly for labelling biomolecules, cells or cell organelles. The disclosed protein and nucleotide sequences can be used for testing activity of promoters under various conditions.

EFFECT: obtaining proteins with primarily red or far-red fluorescence.

7 cl, 7 dwg, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to immunology and biotechnology. The invention discloses a monomer single-strand V93 nanoantibody which can bind and inhibit the human vascular endothelial growth factor. The invention describes a nucleotide sequence which codes the V93 nanoantibody and its expression vector with extra epitope(s) on the C-end for detection and extraction and a signal peptide on the N-end. The invention discloses a method of obtaining the V93 nanoantibody, a method of inhibiting proliferation of endothelial cells using the V93 nanoantibody, as well as use of the V93 nanoantibody for qualitative and quantitative determination of VEGF in a sample.

EFFECT: use of the invention provides high-affinity neutralising monovalent single-strand nanoantibodies which are more resistant to external factors (temperature, pH) and cheaper to produce compared to conventional VEGF antibodies, which can be useful in medicine for treating and diagnosing diseases associated with regulation of the activity of the vascular endothelial growth factor (VEGF).

7 cl, 7 dwg, 6 ex

FIELD: chemistry.

SUBSTANCE: invention relates to immunology and biotechnology. The invention describes a nucleotide sequence which codes the V9 nanoantibody and its expression vector with extra epitope(s) on the C-end for detection and extraction and a signal peptide on the N-end. The invention discloses a method of obtaining the V9 nanoantibody, a method of inhibiting proliferation of endothelial cells using the V9 nanoantibody, as well as use of the V9 nanoantibody for qualitative and quantitative determination of VEGF in a sample. Use of the invention provides high-affinity neutralising monovalent single-strand nanoantibodies which are more resistant to external factors (temperature, pH) and cheaper to produce compared to conventional VEGF antibodies, which can be useful in medicine for treating and diagnosing diseases associated with regulation of the activity of the vascular endothelial growth factor (VEGF).

EFFECT: invention discloses a monomer single-strand V9 nanoantibody which can bind and inhibit the human vascular endothelial growth factor.

7 cl, 7 dwg, 7 ex

FIELD: medicine.

SUBSTANCE: plasmid contains a DNA fragment encoding laccase C1 of ligninolytic fungus Trametes hirsuta or a DNA fragment hybridised with SEQ ID N0:1 in tough conditions, under control of promoter functioning in this cell. The resulting cell is a producer of laccase C1. The invention also refers to method of laccase obtaining using to the indicated cell.

EFFECT: obtaining laccase with high catalytic activity.

6 cl, 3 dwg, 1 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: present invention relates to biotechnology and immunology. An antibody against angiopoietin-2 is proposed. Versions of the antibody are disclosed, which are produced by hybridome ATCC PTA-7258, ATCC PTA-7259, ATCC PTA-7260. The corresponding coding nucleic acid and expression vector are disclosed. A host cell which produces the antibody based on the said vector is described. The disclosed antibodies have Kd of the order of 10-10-10-12 M, for the antibody 3.19.3 (from ATCC PTA-7260) IC50=99 nM. The said antibody properties can be used in treating human tumours.

EFFECT: design of a method of treating pathological angiogenesis based on an antibody and use of the antibody to prepare a medicinal agent for treating pathological angiogenesis.

33 cl, 18 dwg, 18 tbl, 24 ex

FIELD: medicine.

SUBSTANCE: trans-sialydase enzyme has been recovered from a unicell Trypanosoma congolense. Trans-sialydase is characterised by one of the following amivo acid sequences: SEQ ID NO:2, SEQ ID NO:4 or a sequence being 75% identical with one of said sequences.

EFFECT: extended range of enzymes with trans-sialydase activity.

6 cl, 3 dwg, 1 tbl, 6 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention pertains to biotechnology, animal husbandry and medicine. Proposed is a transgenic animal from the family of bulls which produces in its milk a recombinant human growth hormone in amount of at least 92 ng/ml per month on average. Also disclosed is a method of creating such a transgenic animal which involves cloning the genetic make-up which codes the hGH gene and a beta-casein promoter in an expression vector. Further, there is transfection into fetal somatic cells of cattle, usually fibroblasts, and nuclear transfer into enucleated oocytes of cattle, that way forming transgenic embryos. The invention can be used in animal husbandry and medicine.

EFFECT: invention enables to obtain a large amount of the human growth hormone.

43 cl, 5 dwg, 3 tbl, 9 ex

FIELD: chemistry.

SUBSTANCE: invention discloses a pharmaceutical composition which contains TAT-HOXB4 protein as an effective component. Said composition has stimulating effect on production of hematopoietic stem cells. More specifically, the recombinant protein TAT-HOXB4 enhances acceptance of intramedullary transplants, hematopoietic reconstruction, repopulation and number of circulating stem cells, specifically after chemotherapy or exposure.

EFFECT: higher protein output and stability.

24 cl, 11 dwg, 2 tbl, 9 ex

Up!