Cholesterol-producing yeast strains and use thereof

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to genetically modified yeast which independently produces cholesterol from a simple carbon source. The said yeast expresses 7-dehydrocholesterol reductase and 3β-hydroxysterine Δ24-reductase enzymes, while the sterol 24-C-methyltransferase enzyme is inactive. Cholesterol production of the said yeast is equal to or greater than 20% of all produced sterines. The invention also discloses a method of producing cholesterol and using the disclosed yeast strain to produce labelled and non-labelled cholesterol.

EFFECT: invention enables to obtain large amounts of cholesterol which is safe in terms of sanitation in.

12 cl, 13 dwg, 18 ex

 

The present invention relates to the production of cholesterol in organisms of the Kingdom Fungi.

Cholesterol (see figure 1) is an important animal Sterol. It is a fundamental component of cellular membrane fluidity which it regulates, and is present in all animal tissues and especially in nervous tissue.

Cholesterol is a product which is of great industrial interest. So, it is normally used in the cosmetic industry. It is also used in the pharmaceutical industry, for example, for administering drugs ("Drug delivery"), as well as in cell culture.

Cholesterol is also used in the industrial synthesis of vitamin D3. This vitamin is then used to Supplement the human diet (e.g., dairy products) and animals. Cholesterol is also preferably used as an additive to food animals, in particular to food intended for farmed shrimp.

Currently, the majority produced for sale cholesterol extracted from animal tissue (negligible receive chemical synthesis). Two large source used for extraction of cholesterol: the spinal cord of cattle and lanolin which is a natural fatty material of wool.

Using animal the tissue as the source of the product is associated with certain problems. Thus, the recent problems associated with the transmission of the prion responsible for sheep shaking, cattle (disease called ESB (spongiform encephalopathy of cattle) cattle), reminded about the need for caution in the use of animal tissue as raw materials. Meanwhile, despite the measures taken, the risk of transmission of pathogenic factor cannot be completely excluded, and it would be highly desirable, therefore, to have a source of cholesterol, not originating from animal tissue.

The present invention aims to provide a source of cholesterol, abundant and safe from the sanitary point of view. The inventors have unexpectedly demonstrated that it is possible to change the natural production of ergosterol inFungiso that was producyrovtsa cholesterol.

General description of the invention

The first aspect of the invention relates to an organism of the Kingdom ofFungiproducing Autonomous cholesterol.

The second aspect of the invention relates to an organism of the Kingdom ofFungisuch as defined above, characterized in that the latter is genetically modified.

The third aspect of the invention relates to an organism of the Kingdom ofFungisuch as defined above, characterized in that the latter produces cholesterol onbased on simple carbon source.

The invention also concerns an organism of the Kingdom ofFungisuch as defined above, expressing the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase. In particular, the invention concerns a body, such as defined above, in which inactivated the enzyme Sterol 24-C-methyltransferase and/or inactivated the enzyme C-22 Sterol desaturase.

Another aspect of the invention relates to an organism of the Kingdom ofFungisuch as defined above, characterized in that the expression of the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase carried out due to the transformation of the body.

The invention also concerns an organism of the Kingdom ofFungisuch as defined above, characterized in that the inactivation of the enzyme Sterol 24-C-methyltransferase exercise due to genetic inactivation, and/or inactivation of the enzyme C-22 Sterol of desaturase exercise due to genetic inactivation.

Another aspect of the invention relates to an organism of the Kingdom ofFungisuch as defined above, characterized in that it is chosen from the typeAscomycetein particular subtype ofSaccharomycotinapreferably from the classSaccharomycetesorSchizosaccharomycetesmore preferably, of the orderSaccharomycetalesorSchizosaccharomycetaleseven more preferably, of the familySaccharomycetaceaeorSchizosaccaromycetaceae even more preferably, of the genusSaccharomycesorSchizosaccharomyces.

Another aspect of the invention relates to an organism of the Kingdom ofFungisuch as defined above, characterized in that it is a yeast of the speciesSaccharomyces cerevisiaeorSchizosaccharomyces pombe.

The invention concerns also a method of obtaining cholesterol non-animal origin, including cultivation of the organism, such as defined above.

In particular, this method differs in that after the stage of culturing the organism should phase extraction of cholesterol. Preferably, the extraction of cholesterol carried out using a solvent not miscible with water.

In particular, the method such as defined above, characterized in that before the extraction of cholesterol exercise stage saponification. Preferably, the method such as defined above, characterized in that prior to saponification or by extraction of cholesterol exercise stage mechanical crushing of cells.

Another aspect of the invention concerns the application of an organism of the Kingdom ofFungisuch as defined above, to obtain cholesterol or one of the intermediate products of its metabolism, or a mixture of sterols, labeled13C or14C.

The invention also relates to a method of obtaining cholesterol or one of the intermediate is of Reducto its metabolism, or a mixture of sterols, labeled13C or14C, comprising the following stages:

- cultivation of the organism of the Kingdom ofFungisuch as defined above, on the substrate, labeled13C or14C, and

extraction of the specified cholesterol or one of its metabolic intermediates, or from a mixture of sterols.

The invention concerns also a method of obtaining isotopic mixture of cholesterol, intermediates or metabolites of cholesterol, labeled in different positions by means of isotopic markers, comprising culturing an organism of the Kingdom ofFungisuch as defined above, labeled on the substrate, then the unlabeled substrate, and the duration of cultivation on each of these substrates is chosen so to get a specific isotope profile. The invention also concerns the sample of molecules of cholesterol, intermediates or metabolites of cholesterol, labeled in different positions by means of isotopic markers with a specific isotope profile, and which can be obtained by this method.

The invention also concerns compositions containing as a marker to trace the origin of the isotopic mixture of cholesterol, intermediates or metabolites of cholesterol, labeled in different positions by means of isotope marker is in having a certain isotope profile. In particular, this composition is intended for nutrition or therapy of the human or animal.

Detailed description of the invention

The present invention relates to the production of cholesterol in organisms of the Kingdom ofFungi. TheFungicholesterol is not found in the natural state because it is an animal Sterol. The main Sterol in the cell membranes of these organisms is ergosterol.

The present invention allows the synthesis of cholesterol by multiplicationFungiin the presence of a simple carbon source. The method proposed in the present invention thus allows to obtain a large amount of cholesterol, low-cost since the method is carried out cultivation of organisms of the Kingdom ofFungiand add a simple carbon source, easily available.

Under a simple carbon source according to the present invention understand the carbon sources used by the specialist for normal growthfungusand in particular yeast. In particular, under such sources understand different digestible sugars such as glucose, galactose or sucrose or molasses, or byproducts of these sugars. Especially preferred simple carbon source is ethanol and glycerin.

The fact that the production is carried out offline means, that is not necessary to add the substrates to obtain cholesterol, but that the body can produce from the initial simple carbon source. It is also clear that the strain can produce cholesterol by use of the substrate located above the path of metabolism, provided that the strain of the organism according to the present invention contains all the genes necessary for the full implementation of the metabolic pathway of obtaining cholesterol.

The invention concerns, in particular, genetically modified organism of the Kingdom ofFungi (Fungus), offline producing cholesterol, on the basis of a simple carbon source.

A number of genetic changes infunguscan be done to change the natural metabolic pathway of obtaining ergosterol so that was producyrovtsa cholesterol. The present invention relates thus genetically modified organism of the Kingdom ofFungiexpressing the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase. So amended the strain of the organism of the Kingdom ofFungiproduces cholesterol. The applicant was able to make the model due to the obtained results (see experimental part of this application), the path of metabolism, resulting in ergosterol is to some of its derivatives (see, 2). The expression of the enzyme 7-dehydrocholesterol reductase inhibitor and 3β-hydroxysteroid Δ24-reductase infungus S. cerevisiaecan provide products of cholesterol, partially modifying the path of the biosynthesis of ergosterol.

The enzyme 7-dehydrocholesterol reductase bears the number of the EC 1.3.1.21 in the international classification of enzymes (Enzyme Classification). It is also called Delta 5,7-Sterol-Delta 7-reductase, 7-DHC - reductase or Sterol-Delta 7-reductase, as well as Delta 7-Sterol-reductase, the Delta-7Red, Delta 7-reductase or Δ7-reductase in the next part of this document. This enzyme catalyzes the natural state in plants, such as the NADPH-dependent recovery of 5.7-cholestadiene to Delta-5-cholestanol or restore Sterol intermediate products having a double bond at position 7-8 (Taton and Rahier, 1991). The gene encoding the enzyme 7-dehydrocholesterol-reductase, was first isolated from plantsArabidopsis thalianathe selection of the corresponding gene and expression of this enzyme in yeastSaccharomyces cerevisiaedescribed in the patent EP 727489. The sequence of this gene and protein available under the following access number in GenBank: U49398 (Lecain et al., 1996).

A number of homologues of this gene have been described in other species. This homologue is, for example, homologous gene in humans (the nucleotide sequence is available under GenBank AF04544, protein sequence under GenBank: AAC05086) (Moebius et al., 1998). Homologous gene in ratRattus norvegicus(the nucleotide sequence is available under GenBank: AB016800, protein sequence under GenBank: BAA34306). Genes homologues have also been identified in chickenGallus gallusnumber in Genbank BM490402, or toadXenopus laevisnumber in Genbank B1315007, or fish-ZebraDanio rerionumber in Genbank BQ132664. The gene encoding the activity of Delta 7-Sterol reductase, is also found in plants, such as rice,Oryza sativanumber in Genbank CA753545, potatoesSolanum tuberosumnumber in Genbank BF342071. This gene, encoding the activity of Delta 7-Sterol reductase, can also be detected in a simpleMastigomoeba balamuthinumber in Genbank BE636562.

The specialist can easily identify other homologous genes encoding the enzyme 7-dehydrocholesterol in other organisms. He may apply, in particular, to a method for cloning as described in example 1 of patent EP 727489, which describes the cloning method that allows to distinguish cDNA encoding a protein having the activity of Delta 5,7-Sterol Delta-7-reductase. The specialist can also easily determine the activity of 7-dehydrocholesterol corresponding proteins, in particular using the test activity, as described in example 1 of patent EP 727489.

The expression of the enzyme is 7-dehydrocholesterol reductase in the body of the Kingdom of Fungiaccording to the invention can be obtained by any method known to the expert. This can be, in particular, the transformation of the body through the design, including the expression cassette consisting of a promoter transcription, mainly homologous open reading frames, encoding the enzyme 7-dehydrocholesterol reductase, and a transcription terminator, adapted according to the usual rules known to the specialist. As a homologous promoter typically use a promoter that is suitable to provide sufficient and functional expression of heterologous protein. The promoter can be, for example, the PGK promoter, the ADH promoter, the CYCl promoter, the promoter GALIO/CYCI, TDH3 promoter or promoter TPI. The terminator may be, for example, the terminator gene phosphoglycerate kinase (PGK). This expression cassette can be incorporated in the form of one or some of the copies in the nuclear or mitochondrial genome of the host, or be in the composition of the artificial structure artificial yeast chromosome (YAC) or episomal genetic element, such as a plasmid. To implement this type of expression can be used, for example, yeast typeYarrowia lipolitica, Kluyveromyces lactisorPichia pastoris.

Preferably, the expressed enzyme 7-dehydrocholesterol reductase farm is the t plants Arabidopsis thaliana(an example of how the expression of this enzyme in yeastSaccharomyces cerevisiaedescribed in the patent EP 727489). However, this may be either homologous or not, natural or artificial enzyme having the same enzymatic activity.

The enzyme 3β-hydroxysteroid Δ24-reductase, also known DHCR24 24-dehydrocholesterol, catalyzes the natural state of recovery desmosterol (cholesta 5, 24 gianola) or derivative lanosterol having a double bond at position 24 and 25 on the side chain (for example, 14 desmethyltramadol, zymosterol or cholesta 7,24 of gianola), required for the biosynthesis of cholesterol, in particular in humans (Waterham HR.et al, 2001). This enzyme in the following parts of this document referred to as the Delta 24-(25) Sterol reductase, Delta 24 Sterol reductase or Δ24-reductase.

The gene encoding the enzyme 3β-hydroxysteroid Δ24-reductase, was first isolated in humans, the selection of the corresponding gene and expression of this enzyme in yeastSaccharomyces cerevisiaedescribed in the publication Waterham HR. et al., 2001. The sequence of this gene and the protein are available under the following access numbers GenBank: NM_014762.et NP_055577.

A number of homologues of this gene have been described in other species. For example, such a homologue is the homologous mouse gene (Mus musculus) (nucleotide sequence of which is available under GenBank: NM_053272, the protein sequence is GenBank: NP_444502). Homologues have been described in wormCaenorhabditis elegansin particular complementary DNA with the number in Genbank AF026214. Homologous sequences were also described in plants, such as cottonGossypium hirsutumnumber in Gehbank AAM 47602.1, riceOrysa sativanumber in Genbank AAP53615, peasPisuni satinumnumber in Genbank AAK15493.

The specialist can easily identify other homologous genes encoding the enzyme 3β-hydroxysteroid Δ24-reductase in other organisms. He may, in particular, to refer to a method of cloning that is described in the publication Waterham HR. et al., 2001. The specialist can also easily determine the activity of 3β-hydroxysteroid Δ24-reductase corresponding proteins, in particular, using the test activity, as described in this publication (Waterham et al., 2001).

The expression of the enzyme 3β-hydroxysteroid Δ24-reductase in the body of the Kingdom ofFungiaccording to the invention can be obtained by any method known to the expert. This can be, in particular, the means described above in relation to the expression of the enzyme 7-dehydrocholesterol reductase.

Preferably, the expressed enzyme 3β-hydroxysteroid Δ24-reductase is a human enzyme. An example of detecting the corresponding gene and the expression of this enzyme in yeastSaccharomyces cerevisiaedescribed in the publication Waterham HR. et al 2001. However, it can be any homologous or natural or artificial enzyme having the same enzymatic activity.

Preferably, the organisms of the Kingdom ofFungiaccording to the present invention Express the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase, and, in addition, carry out the inactivation of the enzyme Sterol 24-C-methyltransferase.

The enzyme Sterol 24-C-methyltransferase bears the number of the EC 2.1.1.41 in the international classification of enzymes (Enzyme Classification). It is also called ERG6p, Delta(24)-methyltransferase, Delta(24)-Sterol-methyltransferase, zymosterol-24-methyltransferase, S-adenosyl-4-methionine:Sterol Delta(24)-methyltransferase, SMT1, 24-Sterol C-methyltransferase, S-adenosyl-L-methionine:Delta(24(23)-the Sterol methyltransferase or phytosterols-methyltransferase.

This enzyme catalyzes the natural state of methylation at position C-24 zymosterol, which leads to the formation of fecosterol.

The gene encoding the enzyme Sterol 24-C-methyltransferase, was namedErg6in yeastSaccharomyces cerevisiae. The sequence of this gene is available under the following GenBank access number: NC_001145. The sequence of the corresponding protein is available under the following GenBank access number: NP_013706 (Bowman et al., 1997), (Goffeau et al., 1996).

A number of homologues of this gene have been described in other . This homologue is, for example, homologous gene fromSchizosaccharomyces pombe(the nucleotide sequence is available under GenBank Z99759, the protein sequence is GenBank: CABl 6897) (Wood et al., 2002). Homologous gene fromNeurospora crassa(the nucleotide sequence is available under GenBank: NCB24P7, protein sequence under GenBank: CAB97289). Homologous gene fromCandida albicans(the nucleotide sequence is available under GenBank: AF031941, protein sequence under GenBank: AAC26626) (Jensen-Pergakes et al., 1998). Genes encoded by the enzyme homologous ERG6, were also described inCandida lusitaniaenumber Genbank AA021936.1, as well as fromPneumocystis carinii(Kanesbiro et al., 2002) orKluveromyces lactis(Ozier-Kalogeropoulos et al., 1998).

The specialist can easily identify other genes homologous geneERG6,in organisms of the Kingdom ofFungi. The specialist can also easily determine the activity of Sterol 24-C-methyltransferase corresponding proteins, in particular, using as a test on the activity of functional complementation strain of yeast, which lack these genes. About complementaly shows the formation of sterols included in regulation 24, in particular sterols type ergosta-bearing methylene group in position 24-28. The presence of biological activity of the Sterol 24-C-methyltransferase typeERG6 definein vitrothanks to techniques developed (McCammon et al., 1984) or Taylor and Parks (Taylor and pax, 1978). On the other hand, derived sterols and the substrate of the enzyme ERG6 separated by Chromatography in gaseous phase according to the technology developed Nes (Methods in Enzymology Steroids and Isoprenoids Volume 111, part B, 1985, "A comparison of Methods for the Identification of Sterols" pp3-37).

The strain of the organism of the Kingdom ofFungiaccording to the present invention, expressing the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase, and in which, in addition, inactivated the enzyme Sterol 24-C-methyltransferase, produces cholesterol. The applicant has unexpectedly been able to determine that the inactivation of the enzyme Sterol 24-C-methyltransferase blocks the path of the biosynthesis of ergosterol in the earlier stages and allows the strain offungusto produce increased amounts of cholesterol (see experimental part of this application).

The expression of the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase is carried out, as described above.

Inactivation of the enzyme Sterol 24-C-methyltransferase may be carried out by any method known to the expert. This can be, in particular, introduction by mutagenesis nonsense mutations, insertions or deletions leading to change of the reading frame in the gene encoding this protein.

This may also be the expression and Tomislava RNA, complementary to the messenger RNA that encodes this protein, or system of gene extinction known to the specialist under the name of siRNAs (small interfering RNA), and associated enzyme systems, if they are not found in natural conditions in the host. Mutagenesis can be carried out in the coding sequence or non-coding sequence in such a way as to make the encoded protein inactive or impede the expression or broadcast. Mutagenesis can be carried outin vitroorin situby suppression, substitution, deletion and/or addition of one or more bases in the corresponding gene, or the inactivation of a gene.

In particular, it can be the introduction of exogenous DNA in the coding or promoter sequence (for example, the expression cassettes with the homologous promoter and/or terminator and heterologous coding part). The expression cassette preferably provides the expression of the selective marker. It is also possible to modify the promoter of the gene for lowering the level of expression. Forfungiinactivation can also occur due to the interruption of the coding sequence, a sequence that encodes a heterologous or homologous marker gene. The main methods of interrupting genefungidescribed in the article by Johnston et al (2002) (Methods in Enzyology Volume 350 Edited by Christine Guthrie and Gerry Fink ; "Gene Disruption"; M. Johnston,L. Riles, J. Hegemann pp 290-315).

Preferably, the organisms of the Kingdom ofFungiaccording to the present invention Express the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase and inactivated the enzyme C-22 Sterol desaturase.

The enzyme C-22 Sterol desaturase also called ERG5p, Cyp61, cytochrome p-45061, Sterol Delta-desaturase. This enzyme catalyzes the natural state of the conversion ergosta-5,7,24(28)-trienol in ergosta-5,7,22,24(28)-tetraena, adding a double bond in position C22 (see figure 2).

The gene encoding the enzyme C-22 Sterol desaturase, was named Erg5 in yeastSaccharomyces cerevisiae. The sequence of this gene is available under the following GenBank access number: U34636. The sequence of the corresponding protein are available under the following access numbers GenBank: AAB06217 (Skaggs et al., 1996) or P54781 (Bowman et al., 1997).

A number of homologues of this gene have been described in otherFungi. This homologue is, for example, homologous gene fromSchizosaccharomyces pombe(the nucleotide sequence is available under GenBank Z98974, the protein sequence is GenBank: CAB11640) (Wood et al., 2002). Homologous gene fromSymbiotphrina buchneri(the nucleotide sequence is available under GenBank: AB086896, the protein sequence is GenBank: BACOl 142) (Noda and Koizumi, 2003). Homologous gene fromSymbiotphrina kochii (the nucleotide sequence of which is available under GenBank: AB086890, the protein sequence is GenBank: BAC01139) (Noda and Koizumi, 2003). Homologous gene fromCandida albicans(the nucleotide sequence is available under GenBank: AL033396, the protein sequence is GenBank: CAA21953) (Tait et al., 1997). Gene ERG5 was also described byCandida lusitaniaenumber Genbank AAO48601.

The specialist can easily identify other genes homologous gene Erg5, in organisms of the Kingdom ofFungi. The specialist can also easily determine the activity of C-22 Sterol of desaturase corresponding proteins, in particular, using the test activity described Skaggs, B.A., et al, 1996. This activity can also be identified by functional complementation of the yeastS. Cerevisiae, which was previously carried out a gap in the level of the geneerg5. About this complementaly will testify to the presence in complementarianism strain ergosta 5,7,22 of trienol. Activity C-22 Sterol of desaturase can be measuredin vitrousing the method described by Kelly and Baldwin et al JBC (1997) after lysis of yeast (Kelly et al., 1997).

The strain of the organism of the Kingdom ofFungiaccording to the present invention, expressing the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase, and in which, in addition, inactivated the enzyme C-22 Sterol desaturase, producer is no cholesterol. The applicant was able to determine that the inactivation of the enzyme C-22 Sterol of desaturase preferably blocks the conversion of cholesterol into cholesta 5,22 dienal and provides stabilization of the production of cholesterol (see experimental part of this application). This lock is also on the level of transformation of cholesta 5.7 gianola, the precursor of cholesterol in cholesta 5,7,22 trienol, the predecessor of cholesta 5,22 gianola. Unexpectedly, the enzyme C-22 Sterol desaturase uses as substrate cholesterol, which he turns into cholesta 5,22 dienal. This parasitic reaction can be eliminated by inactivation of the enzyme-22 Sterol-desaturase, how did you determine the applicant.

The expression of the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase is carried out, as described above. Inactivation of the enzyme C-22 Sterol of desaturase can be carried out by any known specialist way. This can be, in particular, the methods described above relative to the inactivation of the enzyme Sterol 24-C-methyltransferase.

Preferably, the organisms of the Kingdom ofFungiaccording to the present invention Express the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase, and, in addition, they inactivated the enzyme C-22 Sterol desaturase and enzyme Sterol 24-C-methyltransferase. These strains are indeed the possession is t cumulated benefits associated with inactivation of both enzymes, and are strains-producers of cholesterol.

The expression of the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase and inactivation of enzymes (C-22 Sterol of desaturase and Sterol 24-C-methyltransferase carried out, as described above.

In the method of implementation of the cholesterol present in the strain of the organism according to the present invention in quantities of more than 20%, mainly 35%, most preferably 50% or more of total sterols produced by strain according to the invention (in particular, intermediates of synthesis).

Preferably, the organisms of the Kingdom ofFungiaccording to the present invention are selected from the typeAscomycetesmore preferably, they are chosen from a subtype ofSaccharomycotinaeven more preferably, they are chosen from the classSaccharomycetesorSchizosaccharmyceteseven more preferably, they are chosen of the orderSaccharomycetalesorSchizosaccharomycetaleseven more preferably, they are chosen from the family ofSaccharomycetaceaeorSchizasaccharomycetaceaeeven more preferably, they are chosen from the genusSaccharomycesorSchizosaccharomycesmost preferably, the organisms of the Kingdom ofFungiaccording to the invention are of the formSaccharomyces cerevisiaeorSchizosaccharomyces pombe.

The present invention also concerns the method of obtaining cholesterin is and non-animal origin, includes the following stages:

- cultivate the organism of the Kingdom ofFungias described above,

- extracted cholesterol produced by this organism.

Extraction based on the processing offungussolvent cholesterol, preferably not miscible with water. This processing may preferably be combined with any method of mechanical crushing of cells. More preferably,fungusprocess to solvent extraction amylase mixture designed to release cholesterol, possibly associated with other cellular components, such as, in particular, fatty acids. This malaysa mixture may consist of a base, for example, ammonium hydroxide, sodium hydroxide, potassium hydroxide, dissolved in water or, more preferably, in an organic solvent that can be mixed with water, such as, for example, methanol or ethanol, or in a solvent-water mixture. The saponification can be carried out without or preferably with heating at a temperature of 60-120°C, at atmospheric pressure or under reduced pressure. The extraction solvent is not miscible with water, may be replaced by extraction in solid phase in the hydrophobic resin. The method of extraction of sterols described L. Parks and co-workers (1985) (Methods in Enzymology 111 Edited by L Rilling, L. Parks, C. Bottema, R. Rodriguez and Thomas Lewispp333-339).

Thus obtained crude cholesterol can be purified by any means known to the expert, in particular, as described Boselli E, Velazco V, Caboni Mf and Lercker G J Chromatogr A. 2001 May 1 1; 917(1-2):239-44.

Other methods may also be used, for example, the described method of extraction of cholesterol from wool. The specialist may, in particular, to refer to the methods described in U.S. patent 2688623 or 2650929, or in the English patents GB690879, GB646227 or GB613778.

Another aspect of the invention concerns the application of the strains according to the present invention for obtaining cholesterol or one of the intermediate products of its metabolism, or labeled mixture of sterols. Under the intermediate product of the metabolism of cholesterol see, in particular, sterols, indicated in figure 2. This may, in particular, to be cholesta 8,24(25) dienal, cholesta 7,24(25) dienal, cholesta 5,7,24(25)trienol, cholesta 5,24(25) dienal, cholesta 5,22 dienal.

The principle of obtaining labeled cholesterol is described in figure 10. This manipulation is to first grow a strain offungusin the fully labeled substrate. The cells are then cultivated on a non-labeled substrate. Thus there is a change in the isotopic label carbon source, followed by the synthesis ofde novointermediate products of metabolism, then Sterol, including cholesterol containing the gradual change of the label. River which goes, therefore, complicated, but it is amenable to experimental determination of the profile, which is unique isotopic signature, which depends simultaneously:

1) from the tagging Protocol and, in particular, the terms and conditions of cultivation on labeled and not labeled substrate;

2) from the exact genetic structure of the used strain;

3) exact stop time of cultivation.

After stopping cultivation (for example, by lysis of the cells or by stopping the cultivation in the presence of sub-lethal concentrations of the cytotoxic or cytostatic anti-fungal products) labeled cholesterol or one of the intermediate products of its metabolism, or labeled mixture of sterols extracted and purified as described above.

The isotopic profile of labeled cholesterol or one of the intermediate products of its metabolism, or labeled mixture of sterols has several unique properties:

1) it can if necessary be changed due to changes in cultivation conditions used strain and selected Sterol, thus can be obtained a unique register marks;

2) he is "combinable", namely some isotopic signatures corresponding to several unique sterols, labeled isotope profiles, which are themselves modulated, mo the ut to be combined with obtaining molecular alphabet";

3) it is reproducible and easily determinable experimentally;

4) it corresponds to the molecular tracer mixture, easy selection, stable, colorless and non-smell, non-volatile, non-toxic and may be applied in food, medicine, supplements, or other products for human consumption;

5) it is not amenable to falsification, if you do not know the specific recombinant strains and very precise conditions tagging, cultivation and extraction. Moreover, the knowledge of the isotopic signature is not possible to identify the parameters that could allow its receipt.

Thus, not amenable to falsification "isotope alphabet" General purpose and which may be included in any kind of food, including food, can be easily obtained thanks to the present invention. The number of isotopic words"that can be built on the basis of this alphabet is virtually unlimited due to the use of profiles simultaneously tagging and different types of sterols. The inclusion of such signatures in the composition of the various products is, therefore, a unique method is not amenable to falsification marking, unlike, for example, from DNA signatures which, if once known, can be reproduced. CCT is camping can be besides a few ways, without damage, for example by laser ionization with subsequent analysis by a mass spectometry (MALDI-TOF etc).

The use of the substrate, labeled13C, instead of unlabeled carbon sources for the cultivation of strains offungusaccording to the invention allows the synthesis of sterols and, in particular, strongly labeled cholesterol (containing at least 95% carbon13C). Obtaining sterols and radioactive cholesterol14C is also possible using the same approach. The method can also be used against strains of yeast, producing steroids, in particular, hydrocortisone (see patent application WO 02/061109) to obtain steroids, labeled13C or14C, for example, RIA tests.

Description of the drawings

1. Chemical formula of cholesterol, as well as the item, typically used for numbering different carbon atoms and the names of the various cycles. Four cycles of molecules of cholesterol are called respectively A, B, C and D, and the carbons are numbered from 1 to 27.

2. The simplified scheme of the later part of the pathway of biosynthesis of sterols type ergosta and cholest - natural or modified yeast. The diagram is not exhaustive, but allows you to define the stage involving enzymes cited in this document. Proteins ERG2p, ERG3p, ERG5p and ERGp are proteins fungusor yeast, while the protein Delta-7Red (Delta 7 Sterol reductase), Delta 24-(25)Red (Delta 24-(25) Sterol reductase) are heterologous proteins derived from mammals or plants.

3. Profile, compared to HPLC with UV detection at 206 nm, free sterols strains derived from strain BMA64, and identification of these sterols. Were studied the following strains: WGIF01 (strain BMA64 with the destroyed geneerg6(see example 1)), WGIF02 (strain BMA64 with the destroyed geneerg6and expressing Δ24-reductase, example 12), WGIF03 (strain BMA64 with the destroyed geneerg6and expressing Δ7-reductase, example 13), WGIF04 (strain BMA64 with the destroyed geneerg6and expressing Δ7-reductase and Δ24-reductase, example 14). C5: cholesta 5 enol (cholesterol); C5,22: cholesta 5,22 dienal; C5,24: cholesta 5,24 dienal (desmosterol); C8,24: cholesta 8,24 dienal (zymosterol); C5,7,22: cholesta 5,7,22 trienol; C5,7,24: cholesta 5,7,24 trienol; C5,22,24: cholesta 5,22,24 trienol; C5,7,22,24: cholesta 5,7,22,24 tetraena; lan: lanosterol.

4. Profile, compared to HPLC with UV detection at 206 nm, free sterols strain WGIF04 (strain BMA64 with the destroyed geneerg6and expressing Δ7-reductase and Δ24-reductase, example 14) after 0,2,4,8,24 hours of induction by galactose. Δ:the strain WGIF01 (example 1). For strain WGIF04 sampling was carried out after 0, 2, 4, 8 and 24 h after replacing the carbon source galactose. To depict allendy profile strain BMA64, with the destruction in the geneerg6(WGIF01), corresponds to the profile obtained immediately after replacing to galactose. This profile remains almost unchanged during induction (0-24 h). Signal absorption at 206 nm corresponds to the absorption coefficients, changing from one Sterol to another. C5:10 cholesta 5 enol (cholesterol); C5,22: cholesta 5,22 dienal; C5,24: cholesta 5,24 dienal (desmosterol); C8,24: cholesta 8,24 dienal (zymosterol); C5,7,22: cholesta 5,7,22 trienol; C5,7,24: cholesta 5,7,24 trienol; C5,22,24: cholesta 5,22,24 trienol; C5,7,22,24: cholesta 5,7,22,24 tetraena; lan: lanosterol.

5. Profile, compared to HPLC with detection by elektrorazpredelenie and positive ionization (mass spectometry) free sterols strain WGIF04 (example 14) after 0, 2, 4, 8, 24 hours of induction with galactose. Δ:the strain WGIF01. C5:cholesta 5 enol (cholesterol); C5,22: cholesta 5,22 dienal; C5,24: cholesta 5,24 dienal (desmosterol); C8,24: cholesta 8,24 dienal (zymosterol). The HPLC profiles obtained in the same test as in the case of figure 4.

Figa(left): detection at m/z=367,FIGU(right) m/z=3 69.

Ordinate: number of counted ions/second. Abscissa: duration of elution in minutes.

6. Detail profile at m/z=369 in HPLC for the three strains: WGIF01, CA10 carrying a plasmid for the expression of the Delta-24 Sterol reductase and WGIF04, cholesterol is introduced as an internal standard. The total number with arenov, entered for all three strains, corresponds to the extraction carried out on the basis of identical quantities of culture, as measured by the absorption at 600 nm.

Fig.7. Compare the profiles of total sterols (free and in the form of esters) in chromatography in gas phase strains WGIF01 (deletion of erg6), WGIF02 (deletion of erg6 with expression Δ24:reductase); WGIF03 (deletion of erg6 with the expression of Δ7-reductase), WGIF04 (deletion of erg6 with expression Δ24:reductase and Δ7-reductase) and CA10 pYES_Delta24 (genetic basis of FY1679, deletion erg5 with expression Δ24:reductase, Δ-7-reductase, erg5). The magnitude of the response (current flame ionization) are arbitrary. Profiles of different strains should be compared only qualitatively. The time scale of deduction is, however, one and the same for all strains (hold times are expressed in minutes). Identification of sterols carried out according to the criteria described in this application.

Fig. Quantitative distribution of major free sterols in yeast strains CBMA64 (figa), WGIF01 (pigv), WGIF02 (figs) and WGIF03 (fig.8D)), estimated on the basis of the UV spectra. The distribution is given in per cent of all the species represented in the drawing, and which are only detectable in significant quantities. In the absence of a standard for the more intermediate Sterol determination of the number of exercise-based UV spectra, associated with each of the peaks in the chromatogram HPLC using absorption coefficients below (see table 1, the absorption coefficient is expressed in mm per 1 liter and 1 cm). To this end, the absorption coefficients, the corresponding unsaturated structural units present in the structure of this Sterol, is found in table 1 and, if necessary, stack (if multiple links are present in the same molecule), to obtain an estimate of the coefficient of maturity of each type of Sterol. Evaluation do, using the values at 280 nm, if there is at least one link, absorbing at this wavelength, otherwise use a wavelength of 235 nm, and in the absence of absorption at this last use a wavelength of 206 nm to estimate the concentration of each of the sterols from the corresponding signals of absorption in HPLC.

Fig.9. Quantitative distribution of major free sterols in the strain of yeast WGIF4 defined on the basis of the UV spectra. Determine the number carried out in the same manner as in the case of Fig.

Figure 10. The principle of isotope labeling of sterols with the replacement of carbon sources.

11. Assessment profiles isotope labeling of cholesterol produced in the strain WGIF04 after 4, 8, and 24 hours of induction. Free sterols are extracted and share ASH, as described. The mass range between m/z 300 to m/z=450 receive every 0.2 seconds during elution. These spectra are then average over the Windows of 1.8 seconds, then subjected multilinear regression, using as the basis of regression 24 vector representing theoretical mass distribution of labeled cholesterol, for arbitrary inclusion of independent copies of carbon 13 in each of the 27 provisions of molecules with a probability of tagging each alternating carbon from 0 to 1, depending on the considered vector. The probability of tagging the various vectors used as the basis is chosen so that the coefficient of cross-correlation of the distributions of two consecutive vectors of the Foundation amounted to 0.92, begins basis vector corresponding to 100% probability of presence in all positions of carbon 12. Multilinear settlement carried out according to a statistical criterion of least squares, cancelling non-diagonal terms of the matrix products of the partial derivatives method Gauss (maximum digital filtering). After analysis are reconstructed mass spectra on an optimized basis. The curves shown in the figures, represent, therefore, the optimum filtered reconstruction after normalizing the maximum amplitude at a value of 100.

For each time the induction of both curves represent two independent profile corresponding to the elution times than 1.8 seconds, and the corresponding spectra, located in the Central area of the peak elution of cholesterol. The figure shows the high reproducibility of the analysis.

Fig. An example of the different isotopic signatures at the level of different sterols or different induction times. The same calculation and representation, as for 11, but for different sterols and different induction times.

The value of RT indicates the range of retention time used to calculate (in minutes). Values of this range are as follows:

Figa: RT=12,25-12,42,

figw: RT=12,2-12,7,

figs: RT=12,25-12,35,

fig.12D: RT=a 13.3-13,6,

induction time 8 or 24 hours.

The values of m/z indicate the left and right border m/z. The lowest value of m/z for each frame corresponds to m/z for Sterol, is entirely made of carbon 12.

Fig. Compare the profiles of total sterols (free and in the form of esters) in chromatography in gas phase strains YIM59/pIM303 (part a of the figure) and strain YIM59/pIM331 (part B of figure) (see example 18). The scale of the response is arbitrary. The scale of the retention time is the same for both strains (the retention time is expressed in minutes). Identification of sterols carried out according to the criteria op the toboggan in this application.

The present invention is illustrated by the following examples which should be considered as illustrative and non-restrictive.

Used techniques in molecular biology described by Ausubel et al, some manipulations of the yeast described Adamset al(Adams and Holm, 1996).

EXAMPLE 1

The design strain of the yeastS. cerevisiaewith the interrupted geneERG6(strain WGIF01)

The strain of the yeastS. cerevisiaeWGIF01, ERG6 gene which interrupted geneTRPJ,was obtained by transformation of strain BM64 PCR product bearing a functional geneTRP1, flanked edges homologous geneERG6.

Strain BM64 (genotypeMATa; strip-52; TRP1AZ; leu2-3_112; his3-ll; ade2-1; canl-100) is obtained from a strain of the yeastS. cerevisiae, W303 α by complete deletion of the geneTRP1. Strain BMA64 and strain W303 α described in the publication Baudin-Baillieu et al (Baudin - Baillieu et al., 1997).

To select geneTRP1, geneTRP1plasmids pFL44 (Bonneaud et al., 1991) amplified usingZ-TaqI(DNA-dependent DNA polymerase), provided by the company Takara (Pan Vera LLC 501 Charmany Drive Madison, W1 53719 USA).

Used primer pair allows DNA polymerase to amplify the gene ofTRP1, flanked by sequences corresponding to a gene ofERG6.

The sequence of these primers is as follows:

OERG6trp1: 5' (CCTAGCGACGAAAAGCATCATTGGAGTGAATAacttggacttaccattcttag cattttgacg) 3' (SEQ ID No. 1).

p> OERG6trp2: 5' (GCATAAGAGTGAAACAGAATTGAGAAAAAGACaggcccaattcaaattcggg tcgaaaaaagaaaagg) 3' (SEQ ID No. 2).

The product of PCR (Polymerase Chain Reaction), thus obtained, purified by elektrobudowa fragment corresponding to the expected size, and used for transformation of strain BM64 technique of lithium chloride as described (Gietz et al., 1995).

After transformation of processed yeast placed on minimal medium containing tryptophan (Gietz et al., 1995). Get so 41 colony transformed BM64, prototron in respect of tryptophan. This 41 colony then tested with respect to three properties: sensitivity to nystatin, genomic structure of the gene insertionTRP1profile in chromatography in gas phase total sterols, which they produce.

For this 41 this colony is transferred to minimal medium containing respectively 10, 20 or 50 μg/ml of nystatin, with dozens of colonies able to grow on a medium containing a dose of 50 µg/ml nystatin. These resistant colonies are selected to test their genetic structure, and composition of sterols.

The inclusion of geneTRP1in the ERG6 gene test by PCR, using a pair of oligonucleotides that overlap the connection between the functional geneTRP1and brokenERG6. This pair of oligonucleotides is as follows: OERG6trp3: AGGGCCGAACAAAGCCCCGATCTTC (SEQ ID No. 3) and OERG6trp4: GGCAAACCGAGGAACTCTTGG (SEQ ID No. 4).

Some strains represents the t of the expected PCR profile, that is a fragment of 800 base pairs, corresponding to the size expected for the inclusion ofTRP1inERG6.

To ensure that the gene ERG6 really inactivated in these strains, carried out the analysis of the composition of sterols these strains chromatography in gas phase and high-performance liquid chromatography (Duport et al., 2003; Szczebara et al., 2003).

These analyses confirm the absence of synthesis of ergosterol and accumulation of compatible abnormal sterols with the expected violations biosynthesis pathway in the strain with a broken gene.

One strain was, in particular, selected and named WGIF01.

EXAMPLE 2

Construction of strains CA10, CA14 and SA

StrainsCA10(genotype:α, rho+, GAL2, ura3-52, trp1-Δ63, his3-Δ200, erg5::HYGROR, ade2::GAL10/CYC1::Δ::PGK1, LEU2::GAL10/CYC1:: matADR:.PGK1),CA14(genotype:α, rho+, GAL2, ura3-52, trp1-Δ63, his3-Δ200, erg5::HYGROR, atf2::G418R, ade2::GAL10/CYC1::Δ::PGK1, LEU2::GAL10/CYC1::matADR::PGK1), andCA23(genotype:α, rho+, GAL2, ura3-52, trp1-Δ63, his3-Δ200, erg5::HYGROR, are1::G418R,are2::HIS3, ade2::GAL10/CYC1::Δ::PGK1, LEU2::GAL10/CYC1::matADR::PGK1), and their structure is described in the link Duportet al., technical content regarding the design of these strains included in the present application by reference.

These strains produce and contain in their membranes unnatural degree the ins (as described in the application for the European patent EP 0727489) and in particular, ergosta-5-enol (campesterol).

These three strains do not Express the gene productERG5that is not functional due to the inclusion in its coding sequence of a gene of resistance to hygromycin. In addition, these strains Express a cDNA encoding a Δ7 reductase plants (in the application for the European patent EP 0727489 described, in particular, cloning Δ7 reductase plantsArabidopsis thalianathis application is incorporated into the present application by reference, the access number in this sequence GenBank - ATU49398).

Strain SA get from strain CA10 due to the gap geneATF2. The product of this gene leads to acetylation of pregnenolone in position 3 (as described in the patent application WO 99/40203). Strain CA23 is a strain derived from strain CA10 due to the deletion of genesARE1andARE2both protein Are1p and Are2p are responsible for the esterification of ergosterol (Sturley, 2000) and, possibly, cholesterol, because they are homologous enzyme responsible for the esterification of cholesterol in mammals (ACAT).

EXAMPLE 3

Construction of plasmids the expression of Δ24-25 reductase of human origin (plasmid pYES_Delta24)

The construction of this plasmid was described Waterhamet al. 2001. The design is to place a cDNA encoding a Delta 24 Sterol-reductase under the control of pGAL1 promoter and term is the General tCYCl in the vector pYES2 (Invitrogen SARL, Cergy Pontoise, France). This plasmid is a Shuttle plasmidE. coli/S. cerevisiaeand contains the website start replication 2 microns and geneURA3that provides its replication in yeast and facilitates the selection of yeast transformed with this plasmid.

The GAL1 promoter, in addition, is induced by galactose.

EXAMPLE 4

Construction of the plasmid pAG1 expressing Δ7-reductaseA. thaliana

Was constructed plasmid for specific expression of the Delta-7 ReductaseA. thalianaon adenocarinoma vector. This used the plasmid pAM1. This plasmid, the construction of which is described in the PCT application WO 02/061109 (see example 9.b said application, which is incorporated into the present application by reference), is a Shuttle plasmidE.coli./S cerevisiaebased on the sequence of Autonomous replication and centromere (ARS CEN). The selection marker is a gene ADE2. This plasmid is compatible and can thus be replicated simultaneously with a plasmid-based website start replication 2 microns. This plasmid has, in particular, a unique websiteNotI, allowing cloning of expression cassettes as described in the application PCT.

This site was used to clone the cassette expression Delta-reductaseA. thalianaoriginating from strain CA10. Indeed, this expression cassette is the tsya very effective and allows the strain CA10, which also brokenERG5to produce campesterol (ergosta-5-enol), the major Sterol (Duport et al., 1998). A fragment of genomic DNA of strain CA10, containing the gene Delta-reductase, amplified using the following primers:

OSA72 5' (TATATAGCGGCCGCTTTCGCTGATTAATTACCCCAG) 3' (SEQ ID No. 5)

OSA77 5' (TATATAGCGGCCGCGAGAAGTGACGCAAGCATCA) 3' (SEQ ID NO. 6).

Amplification was performed on genomic DNA of strain SA obtained by the method of rapid extraction in a mixture of phenol/chloroform as described Adamset al. (Adams and Holm, 1996).

Fifty nanograms of genomic DNA SA used as template for amplification using primers OSA72 and OSA77. Taq DNA polymerase and enzymatic conditions were obtained from Stratagene. The conditions of amplification were as follows. Initial denaturation of 5 min at 95°C followed by thirty cycles consisting of 30 s denaturation at 95°C, hybridization for 30 s at 50°C, then the elongation for 1 min at 72°C. the Reaction is finished the final stretch for 10 min at 72°C.

The PCR fragment is then cleaved by the enzymeNotI and purified on agarose gel, and then clone the usual manner at the level of unique customersNotI plasmid pAM1. The plasmids thus obtained, called pAG1.

It is odnokorennye vector providing the expression Delta ReductaseA. thalianain yeast, in which the gene Delta Reductase in the human ashen under the control of a promoter GALl0/CYCl (Lecain et al., 1996).

EXAMPLE 5

Extraction of free and esterified sterols in yeast for analysis

1)Conditions for extraction of free and esterified sterols in yeast (procedure 1).

a) the Condition for the extraction of free sterols

The cell sediment was washed twice with 500 ál of deionized water and filtered water in a glass test tube.

Cells then resuspended in 500 μl of water containing glass beads with a diameter of 0.5 mm, which corresponds to 150 μl of a liquid in a test tube.

The extraction was carried out twice with 2 ml of 1,2-dichloroethane under strong agitation on a vortex for 10 minutes. After the first extraction, the mixture of cells, glass beads, solvent, centrifuged for 5 minutes at 1500g for separation of two phases.

Both organic fraction originating from both sequential extraction, combined and dried in a stream of nitrogen for several hours. Sterol extract suspended in 100 μl of acetonitrile for analysis by high-performance liquid chromatography (HPLC) (Szczebara et al., 2003) or in 100 μl of hexane for analysis by chromatography in gas phase (GC) (Duport et al., 2003).

b) conditions for extraction of total sterols: Saponification and extraction esterified sterols, qualitative analysis, procedure 1

Cellular precipitate resuspended in 500 μl of purified water. To this suspen the AI add 2 ml of potassium hydroxide KOH, 10% in methanol. The mixture is heated for one hour at 60°C in closed tubes. Then incubation and immediately upon reaching the tubes at ambient temperature the mixture is extracted three times with 2 ml of hexane. Between each extraction the two phases are separated by centrifugation for 5 min at 1500g. After each extraction the organic phase is transferred into a new tube, then three the combined organic phases are then dried in a stream of nitrogen.

Sterol balance resuspended in 100 μl of acetonitrile (100%) for analysis by high-performance liquid chromatography (HPLC) (Szczebara et al., 2003) or in 100 μl of hexane for analysis by chromatography in gas phase (GC) (Duport et al., 2003).

2)Conditions for extraction of free and esterified sterols in yeast for qualitative analysis (procedure 2).

Strains grown in rich medium (10 g bactopeptone 1 l and 10 g of yeast extracts on 1 l) with 2% glucose as carbon source, receiving 500 mg liofilizovannyh cells. These dried cells are placed in 3 ml methanol (100%)containing 1 g of KOH, and trace amounts of pyragollole, then the mixture is incubated for 45 minutes at 90°C. After returning to ambient temperature sterols extracted with 5 ml of hexane. The organic phase is divided into three samples of the same size and dried in a current of air. Two of the samples extragere is the R sterols placed in 100 μl of hexane for analysis by chromatography in gas phase (GC) and by chromatography in gas phase, combined with mass-spectometry GC/MS, and the third sample is placed in 150 μl of methanol for research high-performance liquid chromatography (HPLC).

EXAMPLE 6

Analysis of free and esterified sterols in yeast chromatography in gas phase (GC)

1)Chromatography in gas phase (GC) with FID detection (flame ionization)

Sterol extract (free or total)suspended in hexane, receive according to procedure 1 (see example 5 1) a) and b)). Control injections added to a mixture of Sterol is cholesterol, in a concentration of from 10 to 50 ng/µl.

Then is injected from 1 to 3 μl of the sample in the apparatus for chromatography in gas phase under the following conditions. From 1 to 3 ál injected on the column Alltech type SE30 (Data column: 30 m×0.32 mm IDX 0.25 μm). Used gas is helium. The ratio of the split ranges from 50 to 80. The pressure in the top of the column is 30 psi. The injector is adjusted to 280°C. the Initial column temperature is 130°C for 0.5 minutes. It increased to 230°C at a rate of 40°C/min, then to 230°C to 280°C at a rate of 3°C/min Column support then at 290°C. the detector Temperature is 310°C.

2)Chromatography in gas phase (GC) with FID detection (flame ionization), combined with mass-spectometry (GC/MS)

Extract total Sterol, suspended in hexane, get with the public hearing procedure 2. Used GC equipped with a classic injector split split less" classic DB5 column, 30 m long and with a diameter of 0.25 mm

The injection is carried out at 230°C with helium as the carrier gas with a flow rate of 2 ml/min column Temperature increase from 130 to 290°C in 4 stages. Column support at 130°C before injection, then increased to 230°C at 40°C/min, then to 230°C up to 280°C at 3°C/min, then to 280°C to 290°C at 30°C/min Column is maintained for 5 minutes at 290°C.

Upon exit from the column for chromatography in gas phase molecules analyze mass spectometry with evaporation in the ionization chamber, such as chamber type Turbo Mass from Perkin Elmer. Molecule fragment electron beam of high energy. The different fragments are then divided into four pole filter, and then detects the ion detector. Each mass localized on the graph of ion current corresponds to the mass spectrum, which unites the masses of all the products of fragmentation ion M+. This mass spectrum obtained for a given retention time on the column, compared with libraries of fragmented products, as well as with libraries described for sterols Quail and Kelly. (Methods in Molecular Biology Vol53 Yeast Protocols Edited by Evans; M, Quail and S, Kelly "The Extraction and Analysis of Sterols from Yeast" pp 123-131 (1996)).

Thus, we detected the deletion of ERG6 gene in strain WGIF01 in particular the absence of ergosta 8, 24(28) gianola and the presence of Sterol type cholesta having a double bond in 24(25).

EXAMPLE 7

Analysis of free and esterified sterols in yeast high-performance liquid chromatography (HPLC) with UV detection or detection of mass spectometry

1)Analysis of HPLC with UV detection

Ten to 30 μl of Sterol extract (suspended in acetonitrile or methanol and obtained according to procedure 1 or 2 (see example 5)) injected on the column type X-terra RP18, a 4.6×100 mm (Waters, Milford, MA01757 USA).

The separation is performed on the gradient consisting of water, containing 0,02% TFA (triperoxonane acid) (buffer A) and pure acetonitrile (buffer B). Column support at 60°C for analysis.

Used HPLC apparatus type "Waters 600 E System Controller (Waters, Milford, MA01757 USA). UV detection was carried out on the detector diode bars covering the wavelength from 206 to 350 nm. The column was equilibrated with buffer containing 20% (vol./about.) buffer A (acetonitrile) and 80% buffer B (water, containing 0,02% TFA (triperoxonane acid)). A linear gradient carried out on the basis of a solution containing 50% buffer A and 50% buffer B. after 10 min, the composition of the elution buffer comprises 25% buffer A to 75% buffer B. the New linear gradient applied to a 30 min gradient achieved a 100% buffer B. This value is supported in t the value of 5 minutes, to clear the column.

2)Analysis of HPLC with detection by a mass spectometry (HPLC/MS)

In the case of the analysis of mass-spectometry sample support at 30°C, and the column support at 60°C during analysis. Used apparatus for HPLC apparatus is of the type "Alliance HT Waters 2790", coupled with a mass detector "Waters MicroMass ZQ". Unlike previous detection method, the elution buffer does not contain A TFA, but both buffer A and B contain at 0.01% (vol./about.) formic acid.

The column was equilibrated with buffer containing 80% buffer A (water containing 0,01% (vol./about.) formic acid) and 20% buffer B (acetonitrile containing 0,01% (vol./about.) formic acid).

Injection starts with a buffer containing 50% of these two buffers. A linear gradient with two speeds growth effected on the basis of solution containing 50% buffer A and 50% buffer B.

After 10 minutes, the composition of the elution buffer comprises 25% buffer A to 75% buffer B. the growth Rate of the gradient then change to receive 12.5% buffer A and 87.5% buffer B after 25 minutes of analysis, then 100% buffer B for 30 minutes. This value is maintained for 5 minutes to regenerate the column.

Mass detector, Waters MicroMass ZQ" set to scan in the positive ionization elektrorazpredelenie. The values of the m/z range from 295 to 450. To scan select mode “continum”. In addition, extracts the th signal in the mode of "SIR" is carried out in parallel to all the masses, expected in natural isotopic abundance, analyzed for sterols. Detector set at full resolution without interference molecules, differing by 1 unit on m/z. The set of commits parametrize so that the total duration of fixation, corresponding to the scan, and the total time fixing all SIR was less than 2 seconds.

EXAMPLE 8

Cultivation of yeast strains for analysis of Sterol content with or without tagging13C

The analyzed strains were cultured in a volume of 50 ml of medium Kappeli (Kappeli et al., 1985)containing 2% normal D-glucose or D-glucose-U-13With6(regarding labeling, see figure 10).

The optical density of the original culture is 0.1 at 600 nm. This culture is incubated for 72 hours at 30°C with shaking at 200 rpm

Cells are then obtained by centrifugation of the medium at 600 g for 10 minutes. Cellular precipitate then analyze directly the methods of analysis presented in example 5 (for tests that do not require induction in galactose).

However, to test the kinetics of induction of the expression of Delta 7-reductase and Delta 24-reductase (strains transformed with plasmid pYES_Delta24 and/or pAG1), sediment resuspended in 50 ml of fresh medium Kappeli, containing 2% galactose (not labeled carbon13C).

This crop is incubated at 30°C under stirring speed of 200 rpm Ten ml of the culture taken after 0 hours, 2 hours, 4 hours, 8 hours and 24 hours of cultivation.

These samples culture centrifuged at 800 g for 10 minutes, the cell sediment is frozen and maintained at -20°C until extraction of sterols methods described in example 5.

EXAMPLE 9

Identification of sterols present in the analyzed strains

Identification of sterols based on a combination of the following principles.

- Comparison of behavior in GC, HPLC, GC/MS and HPLC/MS with authentic standards in the case of campesterol (ergosta 5-enol), ergosterol (ergosta 5,7,22 trienol), cholesterol (cholest 5-enol), desmosterol (cholesta 5, 24 dienos), cholesta 5,22 gianola and zymosterol (cholesta 8,24 dienal).

Analysis of the absorption spectrum in HPLC and UV detection with a diode array (see example 7-1)).

This method allows to clearly identify on the basis of the spectra of the five classes of sterols: 1) class SA1: no conjugate gantovoy system, 2) the class SA2: the presence of 5,7-diene system; 3) the class SA3: the presence 22,24(25) diene system; (4) class SA4: the presence 8,14 diene system; 5) class SA5: the presence of 22, 24 (28) diene system. Classes SA3 and SA5 cannot coexist for structural reasons. Classes SA2 and SA4 cannot coexist for reasons biosynthesis, class SA2 can be combined with structural units of classes SA1, SA3, SA5, clicks the Zuya additional total spectra.

- Analysis of retention times in GC and HPLC on the basis of the approximate additivity of the movements of the retention time associated with each type of unsaturation in the presence of the skeleton type ergosta or cholesta. Because this criterion is not absolute, it is used as an auxiliary to identify and to resolve the ambiguity, but it is the risk of error for individual use. It is used thus only in combination with other criteria.

Analysis in GC/MS (see example 6-2)), which gives the mass of the molecule and the profile of fragmentation, which can be compared with library spectra.

Analysis in HPLC/MS (see example 7-2)) elektrorazpredelenie, which gives, in the case of 3-hydroxystyrene, the main signal in the molecular mass -17 (protonation (+1) and the loss of a molecule of water (-18)).

Analysis all of the above systems the composition of sterols different reference strains of yeast at different points biosynthesis.

- Analysis of changes in the composition of sterols within complementaly various enzymes of biosynthesis and kinetics of this complementaly for induction this complementaly.

Analysis of the profile tagging of various sterols-13 isotope of carbon.

Analysis of the UV-spectrum of sterols separated by HPLC at a given retention time. Two conjugated double bonds 5,7, not only is jut a typical spectrum with two absorption peaks between 265 and 280 nm, while two conjugated double bonds 22,24 are peak absorption at 235 nm. Last conjugated double bond 8,14 detected by peak absorption 245 nm.

EXAMPLE 10

Identification of sterols present in the strain BMA64

Strain BMA64 cultured in a volume of 50 ml of medium Kappeli, containing 2% D-glucose, quantitative and comparative analysis of sterols.

The optical density of the original culture is 0.1 at 600 nm. This culture is incubated for 72 hours at 30°C with shaking at 200 rpm

Cells are then obtained by centrifugation of the medium at 600 g for 10 minutes, the cell sediment analyze the methods presented in example 5. Various described analyses enabled the identification of sterols produced by this strain.

Defined in such a way that this strain accumulates more than 80% of their free sterols in the form of ergosterol (ergosta 5,7,22 trienol) (see Fig). Two other detectable minority Sterol produced by this strain, we are talking about ergosta 5.7 dienone (substrate gene product ERG5) (12%) and sitosterol (ergosta 8,24 dienal) (5%). Cholesterol is not detected at all (the threshold of detection of this method is approximately 0.5% of the detected sterols). Small quantities of lanosterol also detected (only on the level of analysis General the sterols).

EXAMPLE 11

Identification of sterols present in the strain WGEFOL

Strain WGIFOL (see example 1) were cultured in a volume of 50 ml of medium Kappeli (Kappeli et al., 1985)containing 2% D-glucose, quantitative and comparative analysis of sterols.

The optical density of the original culture is 0.1 at 600 nm. This culture is incubated for 72 hours at 30°C with shaking at 200 rpm Cells are then obtained by centrifugation of the medium at 600 g for 10 minutes, the cell sediment analyze the methods presented in example 5. Various described analyses enabled the identification of sterols produced by this strain.

Search in the chromatogram of ergosta 5,7,22 of trienol (ergosterol) or ergosta 5.7 gianola gives a negative result (less than 0.5% of the value obtained from BMA64) in HPLC connected with mass-spectometry. On the level of free sterols strain accumulates 50% of the total number of zymosterol (cholesta 8,24 dienal), substrate product of the gene ERG6 and 30, and 20%, respectively, cholesta 5,7,24 of trienol and cholesta 5,7,22,24 of tetraene, originating probably from the mechanism of synthesis are identical leading to ergosta 5,7 dianala and ergosta 5,7,22 trienale the parent strain (see figure 3 and 8). This clearly shows that the path biosynthesis is blocked at the level of theerg6because the enzyme ERG6 (S-adenosylmethionine Delta 24 Sterol C-ethyl transferase) turns cholesta 8,24(25) dienal in ergosta 8,24(28) dienal (see 2). This accumulation clearly indicates that the strain WGIF01 contains no functional copies of the geneerg6. The results also indicate that the normal way of ergosterol biosynthesis in yeast and, in particular, 8,7 Sterol-isomerase, Sterol 5-desaturase and Sterol Delta 22-desaturase, capable of converting the substrate type cholesta activity, which remains high.

EXAMPLE 12

Construction of strain WGIF02 and identification of sterols present in this strain

Strain WGIF02 was obtained by transformation of strain WGIF01 the plasmid pYES2 carrying the expression cassette Δ24 Reductase (pYES_Delta24, see example 3). Clones were selected on medium containing no uracil, and the presence and expression of cDNA Δ24 reductase was examined by analyzing the sterols of these transformants using procedure 1 (see example 5-1)).

The clone, named WGIF02 was selected because it had the Sterol profile other than strain WGIF01, moreover, additional Sterol had a retention time close to that of cholesterol (see Fig.7). Strain WGIF02 were cultured in a volume of 50 ml of medium Kappeli (Kappeli et al., 1985)containing 2% D-glucose, quantitative and comparative analysis of sterols.

The optical density of the original culture was 0.1 at 600 nm. This culture is incubated for 72 hours at 30°C with shaking at 200 rpm

Cells then receive centrif is the response of the environment at 600 g for 10 minutes, cellular precipitate analyze the methods presented in example 5. Various described analyses enabled the identification of sterols produced by this strain.

Both Sterol profile of extracts of strain WGIF01 and strain WGIF02 similar, with the exception of a new peak, identified on the basis of its mass, its retention time and its conjugated double bonds as cholesta 5,7,22 trienol (figure 2, 3 and 7). The presence of this compound indicates the expected presence of activity 24-25 Sterol reductase on the double bond at position 24(25) holista 5, 7, 25 22, 24 (25) tetraene. In addition, the number of cholesta 5, 7 24 trienol reduced with the advent of cholesta 5,7,22 of trienale in strain WGIF02 (Fig.7 and 8). The activity of the enzyme reveal the transformation of cholesta 5,7,24 of trienol, representing 30% strain WGIF01, and only 12% in WGIF02, i.e. the difference is 18% and occurs entirely in the form of cholesta 5,7,22 of trienale in strain WGIF02. We are talking about an unexpected result, since the product of the transformation of cholesta 5,7,24 Delta 24-reductase is cholesta of 5.7, which is absent in WGIF02, so it is quantitatively converted into cholesta 5,7,22. This reveals another unexpected result, namely that cholesta is 5,7-Sterol substrate 22 desaturase, while cholesta 5,7,24, according to the profile of sterols strain WGIP01, is a poor substrate.

EXAMPLE 13

To strairway strain WGIF03 and identification of sterols, present in this strain

Strain WGIF03 was obtained by transformation of strain WGIF01 the plasmid pAG1. This Shuttle plasmid betweenE. coliandS. cerevisiaecarrying the expression cassette Δ7 reductase, the corresponding cDNA, which is under the control of the promoter GAL10/CYC1. Strain WGIF01 was transformed by the technique of lithium chloride, and transformants were selected on medium containing adenine. The expression of Delta 7-reductase was examined on the basis of appearance in the Sterol profile of clones of cholesta 5,24(25) gianola. One clone that meet these criteria, was specifically selected and named WGIF03.

Strain WGIP03 were cultured in a volume of 50 ml of medium Kappeli (Kappeli et al., 1985)containing 2% D-glucose, quantitative and comparative analysis of sterols.

The optical density of the original culture was 0.1 at 600 nm. This culture is incubated for 72 hours at 30°C with shaking at 200 rpm

Cells are then obtained by centrifugation of the medium at 600 g for 10 minutes, the cell sediment analyze the methods presented in example 5. Various described analyses enabled the identification of sterols produced by this strain.

Expression of Delta 7 Sterol reductase in strain WGIF01 (for strain WGIF03), in contrast to the expression of the Delta-24 Sterol reductase, leads to a profound change in the Sterol profile of the strain is almost complete disappearance of cholesta 5,7,22,24 of tetraene, cholesta 7,24 of gianola and cholesta 8,24 of gianola.

This activity is also marked by the appearance of the majority of the peak identified as described earlier, as cholesta 5,24 dienal or desmosterol. The number of cholesta 8,24 of gianola ranges from 12 to 48%. Found cholesta 5,7,24 trienol is from 30 to 3%, and the detected cholesta 5,7,22,24 tetraena - from 23% to 4% respectively for strains WGTF01 and WGIF03. These observations indicate an unexpected way that the Sterol Delta 7-reductase restores cholesta 5.7 dienal almost regardless of the nature of nancysinatra located on the side chain of sterols. This result is opposite to the observed with the Sterol Delta 24-reductase. Unexpectedly, expression of the Sterol Delta 7-reductase also leads to accumulation (12%) molecules, co-migrating with cholesta 5.7 gianola. It seems, however, unlikely, although not impossible that this molecule was the molecule cholesta 5.7 gianola, whose theoretical level would decrease, not increase under these conditions. The emergence of a small number of cholesta 5,22,24 of trienol (8%) is also of interest. This last Sterol is the expected product of the action of the Sterol 22-desaturase on cholesta 5,24 dienal, the major Sterol (60%) in the strain WGIF03 (originating from recovery cholesta 5,7,24 trienol the Sterol Delta-7 " reducta is Oh). A small accumulation of cholesta 5,22,24 of trienol indicates an unexpected way that cholesta 5,24 dienal is not a good substrate for the Sterol 22-desaturase. Thanks to the results obtained with strain WGIF02 (see example 12), it can be concluded that the presence of unsaturation in position 24 (cholesta 5,24 dienal or cholesta 5,7,24 trienol) makes sterols hardly metabolisable Sterol 22-desaturase. The action of the enzyme ERG6, transforming unsaturated in position 24 cholesta in ergosta leads thus to transform poor substrates gene ERG5 (22-desaturase) in good substrates.

EXAMPLE 14

Construction of strain WGIF04 and identification of sterols present in this strain

Strain WGIF04 was obtained by transformation of strain WGIP02 the plasmid pAG1 technique of lithium chloride, and transformants were selected on media containing neither adenine or uracil. Transformants were confirmed on the basis of detection of the accumulation of cholesterol. The clone that meet these criteria, was specifically selected and named WGIF04. The sample strain WGTP04 was deposited at the National Collection of Microorganism Cultures (CNCM) of the Institut Pasteur), 25 rue du Docteur Roux, 75724 Paris Cedex 15, France, on April 22, 2004 under registration number 1-3203.

Indistinguishable strains WGIF04 can be obtained by transformation of strain WGIF03 the plasmid pYES_Delta24 and using the receiving of the same selection.

Strain WGTP04 were cultured in a volume of 50 ml of medium Kappeli, containing 2% D-glucose, quantitative and comparative analysis of sterols.

The optical density of the original culture was 0.1 at 600 nm. This culture is incubated for 72 hours at 30°C with shaking at 200 rpm

Cells are then obtained by centrifugation of the medium at 600 g for 10 minutes, the cell sediment analyze the methods presented in example 5. Various described analyses enabled the identification of sterols produced by this strain.

Cholesterol is 25% of free sterols strain WGIF04 (see Fig.9). The formation of cholesterol in this strain prove yourself in GC and HPLC co-migration with authentic standard and confirm at the same time in GC/MC and HPLC/MS. Cholesterol is not detected (<0.5% of total sterols) in all strains that do not Express at the same time Delta 7-reductase and Delta 24-reductase.

Strains in which the gene oferg6is not broken, can produce cholesterol, but it is less than 5% of the total free sterols. Thus, the designed strain BMA64-PYES_DELTA24-PAGL, derived from BMA64 joint transformation pYES_Delta24 and pAG1. This strain produces cholesterol, the latter is several % of the total sterols.

Strain SA was transformed PLA is Midol pYES_Delta24. This strain also produces cholesterol, the latter is several % of the total sterols.

In addition, were able to show that the formation of cholesterol requires induction of promoters Delta 7-reductase and Delta 24-reductase (see figure 4 and 5). Containing these genes, the strains do not produce cholesterol in the absence of induction, figure 5 shows that the highest cholesterol levels reach approximately after 24 h of induction. Parallel to the formation of cholesterol (cholest 5-enol) also observe the formation of cholesta 5,22 gianola. Analysis of figure 4 and 5 shows that the formation of this last connection is faster after induction than the formation of cholesterol, and begins even before induction (see figa: m/z=367). However, this connection is missing completely, if the strain is not responsible or two plasmid pAG1 and pYES_Delta24. Education 22-dehydrocholesterol represents the process so much faster than the formation of cholesterol, but is also involved predecessor, which quickly disappears after induction, leaving room for the formation of cholesterol. Cholesterol can be formed on the basis of cholesta 5,24 through the action of Δ24-reductase, or on the basis of cholesta 5,7 through action Δ7~reductase. Thus, it was shown that cholesta 5.7 dienal cannot accumulate due to their immediate conversion is cholesta 5,7,22 trienol. Source of cholesterol is thus cholesta 5,24 dienal, which is absent during induction and builds up to 4-8 hours of induction, after which the quantity is reduced to 24 h (figure 5). This explains the belated appearance of cholesterol, as it requires prior synthesis of cholesta 5,24 of gianola. On the contrary, both possible predecessor of cholesta 5,22 gianola are cholesta 5,7,22 trienol and cholesta 5,22,24 trienol. This last is missing at the beginning of induction (figure 4), while the first is present, then the number is declining rapidly in parallel with the stabilization of education cholesta 5,22 gianola. On this basis, it is possible to conclude that the source of cholesterol is the restoration of 5.24 dienal Δ24-reductase, while education cholesta 5,22 dienal occurs as a result of recovery 5,7,22 of trienol Δ7-reductase. Education cholesta 5,22 gianola under the action of Δ22-desaturase on the cholesterol cannot be completely ruled out, but seems to be a minority process on the basis of the preferred accumulation of cholesterol in relation to cholesta 5,22 to dianala in long-term (24 h) kinetics (figure 4 and 5).

EXAMPLE 15

Optimization of the pathway of biosynthesis of cholesterol, the role of Δ22-desaturase

The duration of the induction 24 h strain WGIF04 accumulation of cholesta 5,22 gianola sostav the em approximately 50% of the accumulation of cholesterol on the level of free sterols (figure 4). Gene destruction Δ22-desaturase is an additional option to optimize the production of cholesterol. You can construct a strain with a double break at the level of Δ22-desaturase (geneerg5and geneerg6and expressing Δ7-reductase and Δ24-reductase. Got a strain carrying a subset: the gap Δ22-desaturase, expression of Δ7-reductase and expression of Δ24-reductase.

This strain was obtained by transformation of strain SA the plasmid pYES_Delta24 technique of lithium chloride and selection on the basis of prototrophic in relation to uracil. The resulting strain was named CA10/Δ24.

Strain SA expressing Sterol Δ24 reductase, produces a relatively small amount of cholesterol (see Fig.6 and 7) and accumulates mainly ergosta 5-enol and the average number of ergosta 5.7 dienal. The accumulation of cholesta 5.7 gianola is very weak in this strain, which indicates the necessity of gap geneerg6for significant savings derived series cholesta. Activity Δ24-reductase is thus surprisingly little competitive compared with the activity of a gene producterg6.Thus, on the basis of these results we can conclude that simultaneous disruption of geneserg5anderg6it is important to optimize the production of cholesterol.

Gene destructionerg5in the strain WGIP04 would allow the specialist is to increase significantly the production of cholesterol. The possibility of obtaining such a strain established by constructing strains WGIF04 and CAl0/Δ24 and the fact that this strain is only obvious genetic combination of the previous two strains. Data obtained with WGIF04 show the rapid disappearance of cholesta 5,24 during the expression of Δ24-reductase (by comparing the results obtained with WGIF03, and the results obtained with WGIF04). This allows you to predict a very efficient synthesis of cholesterol in the strain in which both destroyed geneserg5anderg6and which together expresses Δ7-reductase and Δ24-reductase; in this case, the cholesterol is the only end Sterol.

In conclusion, the minimum needed for the production of cholesterol in the amount of greater than or equal to 20% of the total sterols, is to destroy geneerg6the expression of Δ7-reductase and Δ24-reductase. Additional destruction Δ22-desaturase, apparently, can result in improved performance in relation to cholesterol and eliminate spurious education cholesta 5,22 gianola as the final Sterol.

EXAMPLE 16

Isotopic labeling of cholesterol and determination of isotopic signatures

The principle of obtaining labeled cholesterol is described in figure 10. This manipulation is that first grow yeast on glucose, fully labeled13C, within 72 cha is s at 30°C.

Cells are then obtained by centrifugation of the medium at 600 g for 10 minutes. The precipitated cells are then suspended in 50 ml of fresh medium Kappeli, containing 2% galactose, not labeled carbon13C. the Culture is stopped after 2 hours, 4 hours, 8 hours or 24 hours after transfer to galactose, sterols extracted, then analyzed (see example 7). The transition from glucose to galactose triggers the induction of the promoter GAL10/CYC1, simultaneously controlling gene Δ7-reductase gene and Δ24-reductase. At the same time there is a change in the isotopic label carbon source. The synthesis ofde novointermediate products of metabolism, then Sterol, including cholesterol, which is accompanied by the replacement of the label. This change marks can be characterized on the basis of the profile of the masses of each intermediate Sterol. Indeed, the inclusion of each atom13To change the mass of one atomic mass unit (AMU). So, for example, cholesterol is manifested with a mass ranging from 386 to 413 daltons, depending on the level tagging. In the analysis by HPLC-mass using elektrorazpredelenie with positive ionization, this corresponds to values of m/z (mass/charge), ranging from 369 to 396 (ion M+N+- N2Oh, i.e. M+1-18=385-17=369). The retention time of sterols in HPLC is not affected in detectable extent on the level of tagging, the spectrum of the ACC peak HPLC, corresponding to a single Sterol "X"corresponds to the mass distribution, which is thus the superposition (sum) of the mass distributions of Sterol "X", synthesized at different points in time after tagging. We are talking, therefore, about the complex profile (11), but it is experimentally determinable, which is the only isotope signature, which depends simultaneously:

1) from the tagging Protocol and, in particular, the terms and conditions of cultivation in12C glucose and13C galactose;

2) fine genetic structure of the used strain;

3) exact stop time culture.

This isotope profile has some unique properties:

1) it can if necessary be changed due to changes in cultivation conditions used strain and selected Sterol. Thus, there may be obtained a unique register marks;

2) he is "combinable", namely some isotopic signatures corresponding to several unique sterols, labeled isotope profiles, which are themselves modulated, can be combined with obtaining molecular alphabet";

3) it is reproducible and easily determinable experimentally (see 11 and 12), double and triple lines, which indicate the reproducibility of the profile is th;

4) it corresponds to the molecular tracer mixture, easy selection, stable, colorless and non-smell, non-volatile, non-toxic, and may be applied in food, medicine, supplements, or other products for human consumption;

5) it is not amenable to falsification, if not known specific recombinant strains and very precise conditions tagging, cultivation and extraction. Moreover, the knowledge of the isotopic signature is not possible to identify the parameters that could allow its receipt.

Thus, the invented anti-fraud "isotope alphabet" utility, which can be included in any kind of food, including edible. The number of isotopic words"that can be built on the basis of the alphabet, is virtually unlimited due to the use of profiles simultaneously tagging and different types of sterols. The inclusion of such signatures in the composition of the various products is, therefore, a unique method is not amenable to falsification marking, unlike, for example, from DNA signatures which, if once known, can be reproduced. The signature can be besides a few ways, without damage, for example by laser ionization with subsequent analysis of the ACC-spectometry (MALDI-TOF etc).

EXAMPLE 17

Products not of animal cholesterol, high degree of labelled13C

The use of13C galactose or13C glucose and ethanol instead of labeled carbon sources for the culture of strain WGIP04 in the conditions described above in relation to analyses of sterols, allows the synthesis of sterols, and, in particular, strongly labeled cholesterol (containing at least 95% carbon13C). Obtaining sterols and radioactive cholesterol14C it is also possible using the same approach. The method can also be used against strains of yeast, producing steroids, in particular hydrocortisone (see patent application WO 02/061109) to obtain steroids, labeled13C or14C, for example, RIA tests.

EXAMPLE 18

Construction of strains producing mainly cholesterol

Strain CDR07 ata described in the patent application published under number WO 02061109, and deposited in the National Collection of Microorganism Cultures (CNCM), 25 rue du Docteur Roux, 75724 Paris Cedex 15, France, under the provisions of the Budapest Agreement on January 24, 2001 under the number 1-2616.

Strain CDR07 Mata (relevant markers:ade2::GAL10/CYClp::Δ7; erg5::PGKlp::hygroR; ERG6) was crossed with strain WGIF01 described in example 1 (relevant markers:EG5; erg6::TRP1).

After the diploid sporoobrazovanie determined Sterol composition of the dispute to find disputes producing desmosterol, which is a precursor of cholesterol, as described in example 6. Identified thus dispute producing desmosterol and having a functional geneTRP1and carrying cDNA Δ7 reductaseArabidopsis thalianaas the analysis shows PCR. In addition, this strain, named YIM59 sensitive hygromycin that shows that geneERG5is functional.

Obtaining sterols carried out as described in examples 6 and 9, showed that this strain YTM59 produces sterols that have the same retention time as zymosterol and desmosterol. Strain YTM59 also showed auxotroph in respect of adenine, leucine, uracil and histidine. The presence of desmosterol proves that this strain expresses the Sterol Δ7-reductase, and that it is not functional alleleerg6.

To improve the level of expression of human DHCR24 nucleotide sequence of the cDNA DHCR24 was modified; to improve broadcast at the level of the initiator ATG, the promoter controlling the expression of DHCR24, was also modified. New selected promoter is a promoter CYC1 cytochrome c1 instead of the inducible GAL1 promoter plasmid pYES_Delta24 (see example 3).

The sequence thus is estoya NH 2-end of DHCR24 reductase, merged with CYC1, was modified as follows:

tagcgtggatggccaggcaactttagtgctgacacatacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctdgfatgtatataaaactttgttttcttctwctctaaatattcttttacttctatagacacgcaaacacaaaggaattgacaagtttgtacaaaaaagcaggctaaaaaatggaacctgcc GTGTCGCTGGCCGTGTGCG (SEQ ID No. 7).

Small symbols indicate partial nucleotide sequence of the promoter CYC1, then the sequence AttB1 recombination, then the sequence AAAA, which precedes the initiator ATG. The sequence of the first two codons was also modified (sequence GAA-CCT after the initiator codon ATG).

The final plasmid carrying cDNA DHCR24 under the control of the CYC1 promoter and is also the site of the beginning of the replication 2µS. cerevisiaeand selective marker URA3-d, was named pIM331. Its equivalent without cDNA DHCR24 was named RM.

Strain YIM59 was independently transformed with plasmids pIM303 and pIM331 and specifically selected two transformant carrying plasmid pIM303 (strain YIM59/pIM303) or RSS 1 (strain YIM59/pIM331).

These strains were cultured in rich reconstructed environment type Kappeli within 72 hours at 28°C to achieve absorption 40 at 600 nm. Extracts of total sterols (esterified sterols and free sterols) strain YIM59/pIM303 (not carrying cDNA DHCR24) and strain YTM59/pIM331 (carrying cDNA DHCR24) was obtained in the presence of methanolic potassium hydroxide (see examples 5 and 6). These two strains were tested in classified and their ability to produce cholesterol. Part of the results (GC) presented on Fig. Presents the retention times are given in minutes on both chromatograms.

Thus, were able to show that a strain that does not bear the DHCR24 expression vector (strain YIM59/pIM303), does not produce cholesterol (part a), but mainly desmosterol (part a). On the contrary, a strain that carries the cDNA DHCR24 (strain YTM59/pIM331), produces a Sterol having a retention time characteristic of cholesterol (part B). Using chromatography in gas phase, coupled with mass-spectrometry with electron impact (as described in example 6), was able to show that the Sterol is cholesterol. Using the area of each peak Sterol it was shown that 57% of the sterols produced by strain YTM59/pIM331 is cholesterol.

The Deposit of biological material

The following organisms were deposited on April 22, 2004 in the National Collection of Microorganism Cultures (CNCM), 25 rue du Docteur Roux, 75724 Paris Cedex 15, France, under the provisions of the Budapest Treaty.

Strain WGIF04 deposited under registration number 1-3203.

All cited publications and patents is incorporated into the present application by reference.

Table 1
Evaluation of spectral contributions not what sidenote sterols
(extinction coefficients, mm-1cm-1)
UnsaturationWavelength (nm)
206235280
5a 3.90,00,0
the 5.74,01,711,5
5,7,224,81,711,5
5,224,40,00,0
5,246,90,00,0
5,22,248,727,00,0
5,7,247,51,711,5
5,7,22,249,229,811,5
8,246,9 0,00,0

References

1. Adams, A.K., and C. Holm. 1996.Mol Cell Biol.16:4614-20.

2. Ausubel, Fred M., Roger Brent, Robert E. Kingston, David Moore, D., Seidman J.G., Smith, John A., Kevin Struhl (Editeurs). Current Protocols in Molecular Biology, publie par John Wiley & Sons Inc. Current Protocols Customer Service, 605 Third Avenue, 9th Floor New York, NY 10158 USA USA edition mise a jour de Mars 2002).

3. Baudin-Baillieu, A., E. Guillemet, C. Cullin, and F. Lacroute. 1997.Yeast.13:353-6.

4. Bonneaud, N., O. Ozier-Kalogeropoulos, G.Y. Li, M. Labouesse, L. Minvielle-Sebastia, andF. Lacroute. 1991.Yeast.7:609-15.

5. Bowman, S.et al.1997.Nature.387:90-3.

6. Duport, C, B. Schoepp, E. Chatelain, R. Spagnoli, B. Dumas, and D. Pompon. 2003.Eur J Biochem.270:1502-14.

7. Gietz, R.D., R.H. Schiestl, A.R. Willems, and R. A. Woods. 1995.Yeast.11:355-60.

8. Goffeau, A.,et al.1996.Science.274:546, 563-7.

9. Jensen-Pergakes, K.L., M.A. Kennedy, N.D. Lees, R. Barbuch, C. Koegel, and M. Bard. 1998.Antimicrob Agents Chemother.42:1160-7.

10. Kaneshiro, E.S., J.A. Rosenfeld, M. Basselin-Eiweida, J. R. Stringer, Keely SP, A.G. Smulian, and J.L. Giner. 2002.Environ Mol.44:989-99.

11. Kappeli, O., M. Arreguin, and M. Rieger. 1985. JGen Environ.131:1411-6.

12. Kelly, S.L., D.C. Lamb, B.C. Baldwin, A.J. Corran, and D.E. Kelly. 1997.J Biol Chem.272:9986-8.

13. Lecain, E., X. Chenivesse, R. Spagnoli, and D. Pompon. 1996.J Biol Chem.271:10866-73.

14. McCammon, M.T., M.A. Hartmann, CD. Bottema, and L.W. Parks. 1984.JBacteriol.157:475-83.

15. Moebius, F.F., B.U. Fitzky, J.N. Lee, Y.K. Paik, and H. Glossmann. 1998.Proc Natl Acad Sci USA.95:1899-902.

16. Noda, EL, and Y. Koizumi. 2003.Insect Biochem Mol Biol.33:649-58.

17. Ozier-Kalogeropoulos, O., A. Malpertuy, J. Boyer, F. Tekaia, and B. Dujon. 1998.Nucleic Acids Res.26:5511-24.

18. Skaggs, B.A., J.F., Alexander, C.A. Pierson, for K.S. Schweitzer, K.T. Chun, C. Koegel, R. Barbuch, ad M. Bard. 1996.Gene.169:105-9.

19. Sturley, S.L. 2000.Biochim Biophys Acta.1529:155-63.

20. Szczebara, F.M.,et al.2003.Nat Biotechnol21:143-9.

21. Tait, E., M.C. Simon, S. King, A.J. Brown, N.A. Gow, and D.J. Shaw. 1997.Fungal Genet Biol.21:308-14.

22. Taton, M., and A. Rahier. 1991.Biochem Biophys Res Commun.181:465-73. Taylor, F.R., and T.W. Parks. 1978.J Bacteriol.136:531-7.

23. Waterham, H.R., J. Koster, G.J. Romeijn, R.C. Hennekam, P. Vreken, H.C. Andersson, D.R. FitzPatrick, R.I. Kelley, and R.J. Wanders. 2001.Am J Hum Genet.69:685-94.

24. Wood, V.,et al.2002.Nature.415:871-80.

1. Genetically modified strain of yeast, producing Autonomous cholesterol, on the basis of a simple carbon source such as glucose, galactose, sucrose, ethanol, glycerin or syrup, or by-products of these sugars, characterized in that it expresses the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase and the fact that the enzyme Sterol 24-C-methyltransferase inactivated, and the fact that the products of the cholesterol equal to or greater than 20% of all produced sterols.

2. The strain of yeast according to claim 1, characterized in that the expression of the enzyme 7-dehydrocholesterol reductase and 3β-hydroxysteroid Δ24-reductase is produced by transformation of the body.

3. The strain of yeast according to claim 1, characterized in that the inactivation of the enzyme Sterol 24-C-methyltransferase implemented genetic inactivation.

4. The strain of yeast according to claim 1, characterized in that its choice is up from the genus Saccharomyces or Schizosaccharomyces.

5. The strain of the yeast Saccharomyces cerevisiae according to claim 4, characterized in that it is a strain WGIF04 deposited in the National Collection of Microorganism Cultures (CNCM) on April 22, 2004 under the registration number I-3203.

6. The method of obtaining cholesterol non-animal origin, including cultivation of a strain of yeast according to one of claims 1 to 5 and the extraction of cholesterol.

7. The method according to claim 6, characterized in that the extraction of cholesterol is carried out using a solvent not miscible with water.

8. The method according to claim 6, characterized in that before the extraction of cholesterol exercise stage saponification.

9. The method according to claim 6 or 8, characterized in that prior to saponification or by extraction of cholesterol exercise stage mechanical crushing of cells.

10. Application of the strain of yeast according to one of claims 1 to 5 to obtain cholesterol or one of the intermediate products of its metabolism, or a mixture of sterols, labeled13With or14C.

11. The method of obtaining cholesterol or one of the intermediate products of its metabolism, or a mixture of sterols, labeled13With or14With, including the following stages:
cultivation of a strain of yeast according to one of claims 1 to 5 in galactose or glucose, labeled or not13With or14With, and
extraction of the specified cholesterol or one of the intermediate products of its metabolism, or the art of sterols.

12. The method of obtaining the isotopic mixture of cholesterol, intermediates or metabolites of cholesterol, labeled in different positions by means of isotope labels13With or14With, including the cultivation of a strain of yeast according to one of claims 1 to 5 labeled galactose or glucose, then at the unlabeled galactose or glucose, and duration of cultivation on each of these substrates is chosen so to get a specific isotope profile, and extraction of the isotopic mixture of cholesterol, intermediates or metabolites of cholesterol.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: method of selective preparation of 7α-hydroxyandrostens with the help of floccus, includes transformation of Δ5 -androstenes with the help of mycelium Curvularia lunata VKPM F-981 separated and washed from medium. At the same time substrate is used in the form of microchips, or in the complex with cyclodextrins.

EFFECT: yield of end 7-hydroxyproducts - 60-90%.

2 cl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: method of selective preparation of 7α-hydroxyandrostens with the help of floccus, includes transformation of Δ5 -androstenes with the help of mycelium Curvularia lunata VKPM F-981 separated and washed from medium. At the same time substrate is used in the form of microchips, or in the complex with cyclodextrins.

EFFECT: yield of end 7-hydroxyproducts - 60-90%.

2 cl, 5 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: invention refers to biotechnology and to be used in pharmaceutical industry. Strain Rhodococcus erythropolis "ВКПМ" Ac-1740 resulted from actinobacteria selection, is able to introduce 9α-hydroxygroup into steroid line of hydrosterone, pregnane, estrane and does not produce 1,2-dehydrogenase. Utilisation of the invention allows for high 9α-hydroxylase activity both on common mediums, and high dimethyl formamide content mediums.

EFFECT: ensured high 9α- hydroxylase activity both on common mediums, and high dimethyl formamide content mediums.

2 tbl, 9 ex

FIELD: chemistry.

SUBSTANCE: 6α-methylhydrocortisone and its 11β-alkanoyloxy-derivatives are obtained by method that includes preliminary protection of 11β,- 17α- and 21-hydroxy groups of hydrocortisone or its 21-acyloxy-derivative in step-by-step way with formation of 17α,20;20,21-bismethylenedioxy-derivative (BMDO-protection of dioxyacetone side chain) and further etherification of 11β-hydroxy group, methylenisation of C6 position, reduction of 6-methylene group into 6α-methyl one. By reaction of 1,2-dehydration of 6α- methylhydrocortisone and its 11β-alkanoyloxy-derivatives by microbiological transformation by means of microbial cells 6α-methylprednisolone or its 11β-alkanoyloxy-derivatives are obtained.

EFFECT: obtaining of the above listed derivatives.

17 cl, 23 ex.

FIELD: pharmaceutical chemistry and biotechnology.

SUBSTANCE: invention, which can be used for synthesis of pharmacologically active 19-norsteroides, uses fungus genus Nigrospora capable of oxidizing carbon in position 19 of 6-substituted Δ-6-pregnane, 6-Substituted Δ-6-pregnanes perform oxidation in a biotransformation medium containing 0.2 to 4 mL/L nonionic detergent and 5 to 60 g/L carbon source.

EFFECT: enabled preparation of 19-nor-10β-carboxylic acids with high yield.

8 cl, 3 ex

FIELD: biotechnology, microbiology, chemistry, pharmaceutical industry.

SUBSTANCE: invention relates to microbial production of androsta-1,4-diene-3,17-dione (ADD). Claimed method is based on ability of specific Mycobacterium neoaurum bacteria strain to selectively eliminate side chain of abovementioned sterols and to accumulate ADD in presence of transformation product sorbent. As sorbents synthetic polymer resins obtained by copolymerization of divinylbenzene and ethylstyrene are used. Sorbents are added in broth in end of lag-phase. ADD is formed with yield of 66-76 % depending on side chain structure of transformed substrates.

EFFECT: improved method of ADD production.

5 ex

FIELD: organic chemistry, steroids, chemical technology.

SUBSTANCE: invention describes a method for preparing 3-keto-7α-alkoxycarbonyl-substituted ▵4,5-steroid of the formula (I): wherein is taken among or R3 means hydrogen atom (H), lower alkyl, lower alkoxy-group or cyano-group (CN); R21 means hydrogen atom (H) or alkyl; R26 means (C1-C4)-alkyl; R8 and R9 form in common heterocyclic ring system. Method involves interaction of an alkylating agent with 4,5-dihydro-5,7-lactone steroid of the formula (II): wherein R18 means (C1-C4)-alkyl or R18O-group taken in common form O,O-oxyalkylene bridge or keto-group and R3, R8 and R9 have above given values in the presence of a base. Compounds of the formula (I) are used as intermediate compounds in improved methods for synthesis of epoxymexerone.

EFFECT: improved preparing method.

56 cl, 42 tbl, 30 sch, 5 dwg, 89 ex

FIELD: organic chemistry, steroids, chemical technology.

SUBSTANCE: invention describes a method for preparing 3-keto-7α-alkoxycarbonyl-substituted ▵4,5-steroid of the formula (I): wherein is taken among or R3 means hydrogen atom (H), lower alkyl, lower alkoxy-group or cyano-group (CN); R21 means hydrogen atom (H) or alkyl; R26 means (C1-C4)-alkyl; R8 and R9 form in common heterocyclic ring system. Method involves interaction of an alkylating agent with 4,5-dihydro-5,7-lactone steroid of the formula (II): wherein R18 means (C1-C4)-alkyl or R18O-group taken in common form O,O-oxyalkylene bridge or keto-group and R3, R8 and R9 have above given values in the presence of a base. Compounds of the formula (I) are used as intermediate compounds in improved methods for synthesis of epoxymexerone.

EFFECT: improved preparing method.

56 cl, 42 tbl, 30 sch, 5 dwg, 89 ex

FIELD: microbiology.

SUBSTANCE: method for enzymatic conversion of phytosterol compositions to androstenedion (androst-4-ene-3,17-lion, AD) and androstadienedion (androsta-1,4-diene-3,17-dion, ADD) includes heating of phytosterol composition in presence of one or more solubilizers up to 100-130°C to form paste-like solution. Solubilizers are selected from polypropylene glycol, silicone or vegetable oil. Prepared paste-like mass is charged into bioreactor containing microorganism Mycobacterium MB 3683 and inorganic salt medium followed byfermentation. Method of present invention makes it possible to sufficiently increase of phytosterol composition concentration (30 g or more for 1 l of broth) and to increase produced product yield up to 80-90 %.

EFFECT: method of improved efficiency and yield.

6 cl, 1 dwg, 2 tbl, 5 ex

FIELD: biotechnology, biochemistry, natural compounds.

SUBSTANCE: invention relates to a method for preparing derivatives of steroid glycosides from the plant Ruscus aculeatus (ruscosaponins). Method for preparing desglucodesrhamnoruscin involves hydrolysis of steroid glycosides from Ruscus aculeatus (ruscosaponins) by fermentation of substrate containing indicated glycosides using fungus of species Aspergillus niger. Method provides preparing desglucodesrhamnoruscin with the high degree of effectiveness.

EFFECT: improved preparing method.

2 ex

FIELD: chemistry, brewing.

SUBSTANCE: invention relates to technology of processing yeast biomass in order to remove bitterness. The method involves dilution of yeast from beer brewing process with water, addition of sodium bicarbonate, passing the obtained suspension through a reactor with a hydroacoustic transducer at 5-35°C.

EFFECT: invention provides efficient removal of specific substances from surface structures of brewing yeast cells which move from hops to beer.

4 ex

FIELD: biotechnologies.

SUBSTANCE: integrative plasmid vector contains selective marker for selection of transformants in cells E.coli, site of replication start, site of integration and expression cassette, which consists of promotor, transcription terminator and selective marker, and integration site is represented by sequence of DNA that codes area 18S of messenger RNA.

EFFECT: improved productivity of strain.

3 cl, 4 dwg, 10 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents polypeptide, having α-L-arabinofuranosidase activity selected from the following polypeptides: polypeptide with SEQ ID No. 2, polypeptide, amino-acid sequence of which is located between positions 28 and 400 SEQ ID No. 2, fragment of polypeptide with SEQ ID No. 2, having activity of α-L-arabinofuranosidase, polypeptide having activity of α-L-arabinofuranosidase B and expressing 80% identity with polypeptide SEQ ID No. 2. Invention also relates to polynucleotide, which codes this polypeptide, expression cassette and vector, containing polynucleotide, and master organism that contains this polypeptide.

EFFECT: expanded arsenal of mediums for hydrolysis of α-L-arabinofuranosyl links in arabinofuranosyl-oligosaccharide compounds.

9 cl, 6 dwg, 2 tbl, 1 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and is a Pachia pastoris PS 108 (pChIG) yeast strain, which is a producer of chicken interferon-gamma transformed by plasmid pChIG. Such plasmid pChIG, which facilitates biosynthesis of chicken interferon-gamma, has size of 8.19 thousand base pairs and consists of the following elements: - EcoRI-BamHI - a fragment of plasmid DNA of bifunctional bacterial-yeast vector pPIC9 with size of 7.75 thousand base pairs, - Bglll-EcoRI - a fragment with size of 0.44 thousand base pairs, which contains the coding part of the chicken interferon-gamma gene except the signal peptide coding region. The chicken interferon-gamma gene is obtained through a reverse polymerase chain reaction, whose matrix is RNA obtained from chicken peripheral blood mononuclear cells, induced by human recombinant interleukin-2 Roncoleikin ®.

EFFECT: invention enables obtaining chicken interferon-gamma with high efficiency.

3 cl, 2 dwg, 3 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, specifically to a method of producing recombinant protein human albumin-interleukin-2 or recombinant protein human albumin-alpha 16-interferon, modified by attachment of human albumin. The method involves technology of culturing yeast strain Pichia pastoris PS106/pPIC9HAbIL-2 or yeast strain Pichia pastoris PS106/pPIC9HAbIFNa-16 in modified culture medium BMGY, after which induction synthesis of target proteins is carried out at low temperature. Further, cells are removed and the medium is concentrated. Target proteins are then precipitated using ammonium sulphate or polyethyleneglycol 3350. Target proteins are then separated by gel filtration on Sephacryl HR 200 or BioRad P-300 sorbents. Finally, affinity chromatography is then done on Cibacron F3GA sorbent.

EFFECT: invention simplifies and increases efficiency of the technology of purifying target proteins, and also allows for obtaining biologically active hybrid proteins, suitable for making medicinal agents.

3 cl, 1 tbl, 5 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, specifically to a method of identifying γ-secretase and its inhibitors and can be used in medicine when searching for active compounds for treating Alzheimer's disease. A genetic structure is formed, which codes fused protein, which contains a signal peptide and amino acid sequence GAIIGLMVGGVVIATVIVITLVML. In the obtained fused protein, except the GAIIGLMVGGVVIATVIVITLVML sequence, all sites acting as a signal for endo- or exocytosis, and/or protease splitting site are excluded.

EFFECT: invention allows for highly effective identification of γ-secretase or substances which inhibit its activity by reducing background signal and increasing specificity of the signal.

41 cl, 4 dwg, 17 ex

FIELD: medicine.

SUBSTANCE: vitamin K dependent protein is made by separating a cultivated eukaryotic cell that contains an expressing vector that contains a nucleic acid molecule coding vitamin K dependent protein and associated sequences regulating expression. The associated sequences contain the first promoter and the nucleic acid molecule coding gamma-glutamylcarboxylase, and the second promoter. The first promoter represents a pre-early promoter of human cytomegalovirus (hCMV), and the second promoter is a pre-early promoter SV40. Herewith the expressing relation of vitamin K dependent protein and gamma-glutamylcarboxylase is 10:1 to 250:1.

EFFECT: invention allows for making gamma-carboxylated vitamin K dependent protein in production quantities.

29 cl, 5 dwg, 6 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: there is offered method for identification and/or verification of inhibitors of receptor tyrosine kinases that involves application of a new test system which represents a yeast host cell containing an expression vector including a nucleic acid sequence that encodes fused protein essentially consisting of a complete cytoplasmic part of analysed receptor tyrosine kinase and the dimerisation domain and, if necessary, in addition including anchoring sequence for fused protein in a membrane wherein expression of fused protein conduces to termination of cell proliferation. The method provides production of specified host cells being in contact with a candidate compound and identification of inhibitors of tested tyrosine kinase activity as a result of cultivation on the assumption that inhibition of tyrosine kinase activity with a candidate compound causes restoration of proliferation process.

EFFECT: prospected application of the invention is related to development of selective therapeutic, including anticancer, agents.

13 cl, 5 dwg, 2 ex

FIELD: biology.

SUBSTANCE: present invention relates to microbiology and biotechnology. Obtained is a recombinant strain of Yarrowia lipolytica which produces lipase, developed through transformation of the Yarrowia lipolytica Polf strain using integrative plasmid pZ-ura3d4-hp4d-LIP2.

EFFECT: obtained Yarrowia tipolytica strain can be used in obtaining lipase on an industrial scale.

2 dwg, 4 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: invention refers to genetic engineering and bioengineering and can be used for production of recombinant human mechanodependent growth factor (MGF). Recombinant human mechanodependent growth factor is produced by cultivation of yeast cells containing plasmid which provides expression of protein secretor, and liberation of end product from culture fluid. Plasmid providing expression of human mechanodependent growth factor secretor contains expression cartridge including GAL1 gene promotor and termination region of yeast CYC1 gene transcription, pre- MFα1 gene region and DNA sequence, coding end protein. This plasmid is composed on the basis of plasmid pKX. Besides for production of human mechanodependent growth factor, strain Saccharomyces cerevisiae YBS618/pKX-MGF - producer of specified produced is also used.

EFFECT: expression of human mechanodependent growth factor secretor in yeast.

6 cl, 2 dwg, 1 tbl, 7 ex

FIELD: food industry.

SUBSTANCE: invention refers to food industry, in particular to manufacture of bakery products intended for protective diet. The method includes preparing a medium for activation, placement of fragmented compressed yeast into the nutrient medium with obtaining the mixture and ageing the mixture. The nutrient medium is prepared by mixing flour, water and powder of debranned red rice obtained by its fragmentation and subsequent crushing in a thin rotating spiral film with thickness of 0.1-1.0 mm at a pulsating pressure gradient of 10-30 MPa and a temperature of 25-30°C. The powder is added in amount of 1-3% of flour weight in terms of finished bakery products.

EFFECT: compressed yeast obtains high dough fermentation property, the process technology duration is reduced and bakery products quality is improved.

1 tbl, 3 ex

Up!