Method of obtaining population of neural differentiation induced stromal cells of fat tissue

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, specifically to obtaining cell population and can be used in cell transplantology and tissue engineering in order to obtain cell material for restoring nerve tissue damaged due to injury, stroke or neurodegenerative diseases. The method involves isolating a population of stromal cells from fat tissue, immunosorting based on using antibodies against the brain-derived neurotropic factor (BDNF) receptor (TrkB) to obtain an essentially homogeneous sub-population of TrkB-expressing cells for their culturing in a standard medium for mammal cells and differentiation induction through transfer into a medium which contains a neural differentiation inducing substance - BDNF combined with 5-azacytidine or retinoic acid combined with 5-azacytidine.

EFFECT: invention enables to obtain a population of neural differentiation induced stromal cells of fat tissue.

7 cl, 5 dwg, 4 tbl, 6 ex

 

The present invention relates to the field of cell biology and can be used in cell transplantation and tissue engineering with the aim of obtaining cellular material to restore nerve tissue damaged by trauma, stroke or neurodegenerative diseases, and for testing drugs that affect the functional activity of cells of the nervous tissue and neural precursors. We propose a method that allows using immunosensing with antibodies against the receptor for the neurotrophic factor brain BDNF (TrkB) to allocate from the total population of stromal cells of adipose tissue a subpopulation of progenitor cells that are prone to neural differentiation, for subsequent efficient induction of neural differentiation of these cells using relevant factors.

Introduction

Disability as a result of damage to the Central nervous system and peripheral nerve fibers due to trauma, stroke or neurodegenerative diseases associated with the impossibility of full regeneration of the nervous tissue. Like other somatic human tissues, nervous tissue contains small amounts of so-called stem cells, which in the case of local damage is able to be activated to undergo TKA is spetsificheskoi differentiation and to restore structural and functional integrity of the tissue. However, severe injuries, and patients of older age, the number of such cells is insufficient for full reparation, therefore, the most promising approach for the treatment of such patients is the transplantation of stem and progenitor cells. These cells can be obtained from the patient's tissue, accrued in vitro and introduced into the damage site. Unlike embryonic stem cells, which when used therapeutically, there ethical and religious problems, the risk of transmission of infectious diseases and tumor development (teracom), and the rejection of foreign material, use your own (autologous) cells does not involve such difficulties. Transplantation of autologous stem cells and tissue fragments grown in vitro on the basis of them, already successfully applied for the recovery of the skin after burns, for replacement of bone and cartilage defects, as well as for tissue repair after removal of cancers.

In recent years more and more attention of researchers attracted by the possibility of use as a source of autologous cells stromal cells from adipose tissue, the availability of which is sufficient for almost any is about patient today allows us to consider it as the best resource for cell therapy, including for the regeneration of nervous tissue.

The level of technology

It is known that the stroma of adipose tissue contains undifferentiated precursor cells, which by their phenotype and expression profile similar to mesenchymal stem cells from bone marrow [6]. Stromal precursor cells from adipose tissue (ADSC) under the action of various inductors are able to differentiate in vitro into various cell types: osteoblasts, chondroblasts, adipocytes [1], hepatocytes, endothelial cells [16], cultured myoblasts [10], cardiomyocytes [12], epithelial cells [3], and neural precursors [4].

Neural differentiation of stem cells of different origin is usually accompanied by increased expression of specific genes and, consequently, the advent of the cell of cytoskeletal proteins such as nestin (early marker of neural precursors), the neuronal form of tubulin-β3, glial fibrillar acidic protein GFAP (astrocytic marker glial), a protein that interacts with microtubules MAR specific to neurons Eno2 enolase and some other markers of neural differentiation. It is known that to induce neural differentiation of mesenchymal stem cells, such as cells derived from sources such as bone marrow, using retinoic acid[7] and neurotrophic factors [8, 15]. As for ADSC, despite the increased interest in this source of progenitor cells studies related to their ability to differentiate into neural direction in response to the stimulation is known inducers of neural differentiation, anecdotal and not yet allow us to draw any certain conclusions about the mechanisms of neural differentiation and optimal conditions for obtaining a population of cells, differentiated in this direction. In U.S. patent No. 7,078,230 [18] proposed a multistage method of obtaining intended for transplantation of a population of stromal cells from adipose tissue induced to neural differentiation under the action of retinoic acid, as in [19] as an inducer of neural differentiation of ADSC, along with retinoic acid, it is proposed to use neurotrophic factor (BDNF). This method requires the selection of a population of stromal cells from adipose tissue of a person, their cultivation under standard conditions within 3-5 weeks and the induction of neural differentiation is carried out in two stages: cultivation for 3 days in serum-free medium containing bFGF (20ng/ml) and hEGF (20ng/ml), which is accompanied by the formation of neurosphere, and the subsequent 30-day cultivation in the presence of 10 ng/BDNF and 0.75 mm retinoic acid (RA). The obvious disadvantages of this method are its duration and lack of effectiveness. According to the authors, after a 30-day induction of BDNF and RA pronounced morphological and immunocytochemical characteristics of neural differentiation occur in approximately half of the cells.

Since the known methods of producing induced to neural differentiation of ADSC culture, including the above, closest to the proposed method [19], seem to be of little use for practical purposes because of their low efficiency, the present invention aims to solve the General problem of the increase of this index.

Disclosure of inventions

One of the most probable reasons for the low efficiency of the induction ADSC under the action of neurotrophic factors may be insufficient level of "sensitivity" of the total cell population to the inductor, so the basis for the development of a new method of obtaining induced to neural differentiation of ADSC population was supposed to identify the total population of ADSC TrkB-positive cells, sensitive to the action selected for the induction of neural differentiation of neurotrophic factors, in particular neurotrophic factor brain (BDNF), and homogeneous cell culture enriched in TrkB-positive cells, is capable of being the mi efficiently differentiate into neural direction.

It is known that on the readiness of cells to perceive signals of neurotrophic factors can be judged by the expression on their surface receptors to these factors, in particular, to the action of BDNF sensitive cells expressing tyrosinekinase receptor of BDNF, TrkB. This receptor is expressed on the surface of neurons, and akanah and dendrites in many brain structures [17], and in embryogenesis TrkB detected in cells of the monocytic dendritic faction during the formation of the innervation of the organ [5]. It is through interaction with the receptor of BDNF supports the differentiation and survival of neurons.

With this in mind, the task was to try to identify the total population of ADSC cells carry on their surface a receptor-derived neurotrophic factor brain (BDNF) and TrkB, to assess their levels in the population and to offer a suitable method for the maximum enrichment culture TrkB-containing cells in order to increase the "sensitivity" of culture ADSC to subsequent induction using this factor, and if the establishment of such opportunities and other known inducers of neural differentiation.

When carrying out the invention was first experimentally established presence in the total population of ADSC cells, bearing on its surface of prescriptions is the PR-derived neurotrophic factor brain. In particular, using PCR analysis, it was found the presence of cells expressing mRNA of BDNF receptor (example 2A, figure 1), and a method of immunofluorescent staining revealed cells containing the antigen TrkB (example 2B). The results cytometrical analysis the percentage of cells bearing TrkB receptor in the total population was estimated as equal to about 6%.

To enrich the population of ADSC TkrB-expressing cells used two methods: the method immunomagnetic selection and the method of flow cytofluorimetry; in both cases was able to get essentially homogeneous population of cells (>90%) TrkB-containing ADSC.

Analysis of the fractions obtained TrkB-positive cells on the expression of relevant markers, indicating the potential ability of these cells to neural differentiation, comprising the determination of the concentration cell mRNA-specific marker proteins revealed the presence of mRNA nestin and tubulin-β3, as well as neurotrophic growth factors HGF and BDNF; the content of all these mRNA in these cells was several times higher than in TrkB-negative ADSC (example 4, Fig 3).

The resulting subpopulation of TrkB-containing cells induced to neural differentiation by placing cells in differencirovany the DMEM/10% FBS containing BDNF (comparative experiment retinue the th acid in combination with 5-azacitidine). Assessment of the effectiveness of induction, which determine the expression level of transcription of the marker genes of neural differentiation (nestin, tubulin-β3 and neurospecific Eno2 enolase) showed that in cells induced by BDNF, after 3 days the amount of mRNA nestin, tubulin and Eno2 increases of 3-6 times. 7 days after induction in these cells was also increased in the corresponding protein (Example 5). After induction of TrkB-expressing ADSC retinoic acid experienced a similar, though less pronounced, changes. As a result of direct experiment to transplant a homogeneous population Trk-expressing ADSC derived and induced according to the proposed method, in the brain of a mouse, it was found that during the 10 days of observation, the transplanted cells remained viable and showed migration from the injection zone into the parenchyma of the brain of the recipient, whereas the control cells, the total population of ADSC remained in the area of track and did not contact with the tissue of the patient.

Thus, the essence of the invention is to obtain a total population of ADSC, the identification and allocation of the total population of a subpopulation of TrkB-positive cells using immunomagnetic breeding or immunosensing using antibodies PR is against TrkB receptor, and induction of neural differentiation neurotrophic factor (BDNF) or retinoic acid in combination with 5-azacitidine. Advantage (effect) of the proposed method before the previously known methods is to increase the efficiency of induction of neural differentiation and reduce the total time for preparing cultures for transplantation, the possibility of which unequivocally shows in a direct experiment high viability induced TrkB-positive ADSC and their ability to integrate into the fabric of the recipient.

Brief description of drawings

Figure 1. The content of TrkB mRNA in the total population of ADSC. The product of amplification of a fragment of the transcript TrkB (83 mo) is indicated by the arrow.

Figure 2. The content analysis of cells expressing TrkB, in the total population of ADSC using flow cytometry. Oblique shading corresponds to cells incubated with control immunoglobulins, vertical shading cells stained with antibodies against TrkB). R5 - area counting positively stained cells.

Figure 3. A comparative content analysis of mRNA marker genes neural differentiation and neurotrophic factors in subpopulations ADSC expressing and not expressing TrkB. The abscissa axis is the abbreviation of the tested genes, the y - axis the level of the mRNA analyzer is controlled genes normalized mRNA content of the two genes household (GAPDH, β-actin). Black bars, cells expressing TrkB, white columns of cells, not expressing TrkB.

Figure 4. The content of marker proteins neural differentiation in subpopulations ADSC expressing and not expressing TrkB before and after induction. The left column panels - detection nestin; right column panels - detection of β3-tubulin. A, B - subpopulations ADSC, not expressing TrkB, before induction; In, G - subpopulations ADSC expressing TrkB, before induction; D, E - subpopulations ADSC expressing TrkB, after exposure to BDNF in combination with 5-azacitidine.

Figure 5. The distribution of GFP-labeled cells in the striatum of the brain within 10 days after transplantation. Top panel - induced (BDNF) subpopulation of ADSC, not expressing TrkB; bottom panel - induced (BDNF) subpopulation ADSC expressing TrkB.

The implementation of the invention

When carrying out the invention, in addition to the methods disclosed in detail in the following examples, were used well known in the art methods for cell cultivation, also described in the cited sources.

Example 1

The selection of stromal cells from adipose tissue

For used ADSC human and mouse. ADSC were isolated according to the Protocol Separation et al. [19]. Subcutaneous fats which tissue was obtained during abdominal surgery in oncological patients whose average age was 40 to 60 years. Rat ADSC were isolated from subcutaneous fat groin area male line Black6. Adipose tissue was crushed with scissors, then treated with enzymes and collagenase ("Invitrogen", USA, 30 units per ml tissue) and protease ("Gibco, USA, 200 units per ml of tissue) for 40 min at 37°C with constant stirring. After this time the suspension was added an equal volume of DMEM medium ("Gibco, USA) with 10% fetal bovine serum (FBS, "Gibco, USA) and centrifuged for 5-10 min at 900 rpm. The precipitate, which was a fraction of stromal-vascular cells, resuspendable in DMEM with 10% FBS and filtered through a 100-mm cell filter (BD Biosciences, Bedford, MA), the cells were planted on culture Petri dishes ("Corning Costar, USA) and placed in CO2-incubator at 37°C and 5%. The next day in the cups changed environment. Thus, in the culture remained only adherent cells. Upon reaching the monolayer cells were removed with trypsin and were seated at a ratio of 1:2.

Example 2

Study the total population of ADSC for the presence of cells expressing the receptor TrkB

a) Determining the content of TrkB mRNA

Total RNA from cells was isolated using the kit for RNA extraction ("RNeasy Mini Kit", "QIAGEN, USA) according to the Protocol of the manufacturer. All procedures for the isolation of RNA and synthesis of cDNA was performed on ice seminarrom Boxing. The concentration of total RNA was determined by spectrophotometer Bio Photometer (Eppendorf). The quality of the selected RNA was controlled by electrophoresis in 1% agarose gel. Then the matrix synthesized by the DNA according to standard Protocol of the firm "Fermentas", using oligo-dT primers. For this purpose, RNA was mixed with Oligo (dT)18primer (Fermentas, 0.5 ág/ál) (for every 10 ál of RNA it is necessary to add 1 ál of Oligo (dT)18 primer). The mixture is incubated for 5 minutes at 70°C. After incubation the mixture was added to 4 ál of 5x reaction buffer (Fermentas) and 2 μl of 10 mM dNTP mix (Fermentas) (for every 10 ál of RNA). The mixture was incubated 5 min at 37°C. After incubation the mixture was added 2 μl of M-Mul V reverse transcriptase (Fermentas, 20 u/μl) (for every 10 ál of RNA). The resulting mixture was incubated 60 min at 37°C. reaction was Stopped by heating the mixture to 70°C for 10 minutes. Synthesized cDNA was frozen and kept at - 20°C.

Analysis of gene expression of TrkB was performed CRL in real-time using Sybr Green ("Synthol", Russia). Used primers and annealing temperature are presented in table 1.

The results of electrophoretic analysis of the PCR product (Figure 1) unequivocally testified that ADSC second passage containing TrkB mRNA.

b) Cytofluorimetry

Received ADSC were analyzed for the presence of expression of the TrkB receptor on the surface of the analyzed cells. For this purpose a suspension of one is cnyh cells (0.5 to 1 X 10 6cells) zero passage in 500 μl of PBS buffer (phosphate buffered saline) were incubated with the primary antibodies against TrkB (Abeam, # ab51190) for 40 minutes at room temperature. After three times washing in PBS were incubated cells with secondary antibodies against rabbit antibodies (Jacson Immunoresearch, # 111-175-144), labeled So, for 40 minutes. Fluorescence of cells after staining was evaluated by flow cytometry on the device MoFlo (Dako Cytomation) and analyzed using Summit 4.1. In each experiment to confirm the specificity of the staining was used izotopicheskii immunoglobulin control: cells incubated with non-specific antibodies, and then with secondary antibodies. The analysis of more than 300,000 cells was confirmed by the presence among them of cells expressing the receptor TrkB. According to flow cytometry, the percentage of such cells in the total population of ADSC was 6±2,5%.

b) assess the capacity allocated to ADSC neural differentiation method immunofluorescent staining

To assess the ability of selected cells to neural differentiation was determined the content of the main marker proteins after induction in vitro. In the experiment used ADSC 2nd passage. Cells in the medium described in example 1, were planted on 8-hole glass plates (Lab-Tek Chamber have slid, Nalge Nunc Int.) and the next day added BDNF (20 ng/ml) or retinoic acid (1mM) in combination with 5-azacitidine (1mM). After 3 days inducing medium was changed for fresh, also containing the appropriate inducers, were cultured for 4 more days and recorded for analysis immunofluorescent staining. Fixation of cells was performed in 4% formalin solution (Sigma, USA) for 2 min at room temperature with a subsequent 3-fold with PBS washing. After washing the cells were covered with 1% solution of BSA (bovine serum albumin) with 10% goat serum for 30 min, and incubated at room temperature with rabbit antibodies against nestin (Chemicon, 1:100), Eno2 (Chemicon, 1:50) and mouse anti tubulin (Abcam, 1:100) for 1 hour. As a negative control was used 1% solution of BSA with 10% goat serum. After washing in PBS the cells for 30 min at room temperature, incubated in PBS solution with fluorescently labeled secondary goat antibodies (1:100) against mouse IgG (Alexa 488, Molecular Probes, USA) or anti-rabbit immunoglobulin (Alexa 568, Molecular Probes, USA). The source in the selected ADSC observed or no expression nestin or low level of expression nestin and β3-tubulin, and after incubation of the cells in the presence of BDNF and 5-azacitidine observed an increase in the content of the two marker proteins that svidetel the part about the potential induction of neural differentiation in the obtained cell population (data not shown).

Example 3

Getting a subpopulation of TrkB-containing cells from the total population of ADSC

The fraction of cells that carry TrkB, the total population of ADSC were obtained using immunomagnetic selection or flow cytofluorimetry.

For immunomagnetic of sorting cells used magnetic particle size 40 nm, conjugated with antibodies against rabbit IgG (Dynabeads®Pan Rabbit IgG, prod. No 110.41). The magnetic particles were washed from sodium azide and incubated with rabbit antibodies against human TrkB for 40 minutes on ice with constant stirring. After incubation, the test tube with magnetic particles were placed in the magnet and washed from unbound antibodies. All manipulations were performed under sterile conditions the culture of Boxing. Then the prepared magnetic particles were incubated with a suspension of ADSC for 1 hour with constant shaking on ice. After incubation, the cells were placed in the magnet and separated into two fractions: contacting magnetic particles TrkB-positive cells remaining in suspension TrkB-negative cells. The purity of the obtained fractions TrkB-expressing cells was more than 90%.

Sorting of cells using the method of flow cytofluorimetry were performed as described in example 26. Cells were separated in the sorting on two populations expressing and not expressing Retz who ptor TrkB. The purity of the obtained fractions TrkB-positive cells was 90%-98%.

Example 4

A comparative analysis of the expression of marker genes in subpopulations Trk-positive subpopulation TrkB - negative ADSC

Total RNA was obtained as described in example 2A. Analysis of gene expression was performed by the method of CRL in real-time using Sybr Green ("Synthol", Russia).

For each test gene was prepared a mixture of forward primers and reverse in experimentally selected quantities. For preparation of one sample used 10 µl reaction mixture containing SYBR Green (Synthol), 13 μl ddH2O (Synthol), 1 μl of a mixture of primers and 1 µl of cDNA DNA of the studied cells. For the preparation of NTC (non-template control) samples instead of cDNA was added 1 μl ddH2O (Synthol). PCR detection in real time was performed on the IQ5 instrument (BioRad) using software IQ5 2.0 Optical system software (BioRad). The temperature of annealing for mixture of primers for each test gene was also pre-selected experimentally.

Sequences of primers and annealing temperature for each of the tested genes are presented in table 1.

Table 1
The sequences of primers
The name of the Prime is RA Sequencet°C, annealing of primersProduct length (BP)
Β-actin forCCTGGCACCCAGCACAAT60144
Β-actin revGGGCCGGACTCGTCATAC60
Gapdh forTGCACCACCAACTGCTTAGC6087
Gapgh revGGCATGGACTGTGGTCATGAG60
Tubb forGCCAGACGCGCCCAGTATGAGG64.4232
Tubb revGGTTCCGGGTTCCAGGTCCAC61.1
MAP-2 forCAACAGGAATTGACTCCCTCTAC6080
MAP-2 revTCACCAGGCTTACTTTGCTTC60.2
Eno-2 forCCACCGCCACCGCCACTACCA66.4162
Eno-2 rev GCACTGCAGCCCGGAAAAGACC63.6
Nestin forGCAGCTGGCGCACCTCAAGATGTC65.7225
Nestin revGGCAAGGGTGAGGGGAGGGAAGTT65.1
GFAP forCACCGCAGCCCTGAAAGAGA57.6172
GFAP revCTGGCGCCGGTAGTCGTT55.9
TrkB forTCAGCACATCAAGCGACATAAC6083
TrkB revAGCATTCAGCTAGGAACACTTTT60.2

It was found that a subpopulation of TrkB - positive ADSC presents mRNA such marker genes neural differentiation, as nestin and β3 tubulin (Figure 3). The analysis of a subpopulation of cells that do not contain specific BDNF receptor (TrkB), also revealed the presence of mRNA of these genes, however, the amount of the corresponding mRNA in these cells was several times lower than in cells expressing TrkB (Figure 3). It should be noted that in TrkB-positive cells also what was found higher mRNA content of neurotrophic growth factors, in particular, HGF and BDNF.

Example 5

Induction of neural differentiation in vitro and the study of indicators of neural differentiation of cells expressing TrkB

a) Verification of the effectiveness of various inducers of differentiation

Neural cell differentiation is accompanied by increased expression of specific genes. In particular, cells differentiate into neural direction, contain protein of the cytoskeleton nestin (early marker of neural precursors), the neuronal form of tubulin-β3, glial fibrillar acidic protein GFAP (astrocytic marker glial), a protein that interacts with microtubules MAR specific for neurons to enolase Eno2 and other markers of neural differentiation.

We have analyzed the content of the products listed above marker genes neural differentiation in ADSC, incubated in the presence of various induction factors, including IBMX, P-mercaptoethanol, 5-azacytidine [1, 4, 11], as well as neurotrophic growth factors BDNF and GDNF (table 1). Product GFAP gene is not detected neither in the control ADSC or in cells incubated in the presence of the inductors listed in table 1. Analysis of the mRNA content of other marker genes showed that the level of expression of Eno2, MAR, TUBB and Nestin was higher in cells incubated in the presence of retinoic acid BDNF amid 5-azacytidine (table 2).

Table 2
The relative level of amplification of fragments of the marker genes in ADSC, induced by different agents. The level of amplification is directly dependent on the mRNA level of the genes in ADSC
nestinTUBBEno2MAP2
-control11,7the 3.87,37,0
aza4,617,12,760,0
β-merc0,00,7the 3.82,9
IBMX0,04,12,90,7
BDNF1,97,47,610,0
GDNF0,0 0,72,81,4
RA0,00,82,31,4
Cond. Media9,04,5the 4.75,0
BDNF+aza60,410,2300,3170,0
GDNF+azathe 5.74,120,819,3
RA+aza262,1137,848,76,2
BDNF,GDNF, RA + aza17,41,43,03,5

However, in ADSC, cultured in the presence of other neural inducers of differentiation, increase mrtpc marker genes was not observed (table 3).

On the basis of the results obtained for the induction of neural differentiation of ADSC were selected combination of retinoic acid and BDNF, 5-azasite the other. Upon the induction of differentiation of ADSC derived from 8 donors, it was found that when culturing cells in the presence of retinoic acid in combination with 5-azacitidine in increasing the level of mRNA nestin and tubulin. Induction of neural differentiation of the cells by using a combination of BDNF and 5-azacytidine causes an increase in the expression of all 4 genes analyzed (table 3).

Table 3
The relative level of amplification of fragments of the marker genes in ADSC induced BDNF and RA on a background of 5-azacytidine. The level of amplification is directly dependent on the mRNA level of the genes in ADSC
NestinTUBBEno2MAP2
-control0,340,630,070,07
aza0,04,0,860,170,05
BDNF+aza1,021,642,09 2,11
RA+aza2,012,30,410,39

These data were confirmed using immunofluorescent staining of induced cells. Thus, it was found that incubation of the cells with retinoic acid leads to increased content nestin and β3-tubulin, and in ADSC, cultured in the presence of BDNF increases the content as nestin and β3-tubulin, and specific to neurons Eno2 enolase.

b) Determination of mRNA before and after induction

Both subpopulations of cells ADSC 2nd passage (TrkB-positive and Thcv negative), the result of sorting, as described in example 3, were planted in 6-well plate in a density of 40-50% of the monolayer in DMEM with addition of 10% FBS. The next day the medium was replaced with DMEM/3% FBS, to which was added BDNF at a final concentration of 20 ng/ml in combination with 5-azacitidine (1 mm). After 3 days inducing medium was changed for fresh, also containing inducer, were cultured for 4 more days and then spent the determination of mRNA as described in example 4.

It was found that both subpopulations of cells show after the induction of BDNF in vitro increase of mRNA level nestin, tubulin, protein MAP and neurospecific enolase. However, the induction of neural di the culture, differentiation TrkB-expressing cells at the level of transcription of the mentioned genes was expressed to a much greater extent, than in cells not expressing this receptor. In the subpopulation of TrkB-positive ADSC after 3 days the amount of mRNA nestin, tubulin, Eno2 and MAR-2 was increased by 3-6 times. 7 days after induction in these cells was also increased in the corresponding proteins.

It should be noted that a similar, although somewhat less pronounced, effect was observed after induction of the cells with retinoic acid (1 mm) in combination with 5-azacitidine (1 mm).

C) Determining the concentration of specific antigens method immunofluorescent staining

TrkB-expressing and TrkB-inexpressible ADSC 2nd passage cells were planted on 8-hole glass plates (Lab-Tek Chamber Slide, Nalge Nunc Int.) in DMEM with addition of 3% FBS. The next day was added BDNF in the same concentration as in example 5. After 3 days inducing medium was changed for fresh, also containing inducer, were cultured for 4 more days and recorded for analysis. Fixation was performed in 4% formalin solution (Sigma, USA) for 2 min at room temperature with a subsequent 3-fold with PBS washing. After washing the cells were incubated in 1% solution of BSA (bovine serum albumin) with 10% goat serum for 30 min, then incubated with rabbit antibodies against Nestin (Chemicon, 1:100), Eno2 (Chenicon, 1:50) and mouse against β3-tubulin (Abeam, 1:100) for 1 hour at room temperature. After hotmilk is in PBS the cells for 30 min were incubated in PBS solution with fluorescently-labeled secondary goat antibodies (1:100) against mouse immunoglobulin (Alexa 488, Molecular Probes, USA) or anti-rabbit immunoglobulin (Alexa 568, Molecular Probes, USA). As control was used cells, stained with only secondary antibody. The results showed that TrkB-expressing ADSC, cultured in the presence of BDNF and 5-azacitidine, increased the content of nestin and β3-tubulin, as well as specific neuronal enolase EPO. In TrkB-inexpressibly cells significant differences in the content nestin, β3-tubulin and Eno2 enolase before and after induction was not observed (data not shown).

In a similar experiment with the induction of retinoic acid was observed increased levels of two proteins: nestin and β3-tubulin.

Example 6

Transplantation-induced mouse ADSC in the striatum of the mouse

Comparison of the ability of ADSC cells TrkB-positive and TrkB-negative to integrate into the brain tissue after transplantation. For this purpose, freshly isolated ADSC mice B16, transgenic GFP gene, sorted by expression of TrkB, getting TrkB-positive and Thcv-negative subpopulation of cells induced their neural differentiation, as described in example 5, and then were injected with in the striatum of mice B16 using a syringe.

After 10 days, mice were perfesional 4% formalin, removed the brain and recorded 3-5 hours in 4% formalin, and then incubated for 10-16 hours in 30% sucrose and amraiwadi. Then did the slice thickness of 20 μm on a cryostat (NM 505 E., Microm, Germany). Finished products were stored at 4°C in the dark. The obtained preparations (Figure 5) was analyzed using a fluorescent microscope Axiovert 200M (Zeiss). Documentation of images made with a digital camera Axiocam HRC (Zeiss, Germany) and image processing in the program Axiovision 3.1. Induced in vitro ADSC cells not expressing TrkB, within the time specified was not found coming in contact with the tissue of the recipient and remained in the area of the track. During the same period of time, cells expressing TrkB, being induced in the direction of neural differentiation, showed a pronounced migration into the brain parenchyma (Figure 5).

Statistical analysis all data were performed using the program SigmaStat 9.0. For comparison, small groups and abnormal distributions were used U-test Mann-Whitney. Differences were considered statistically significant at a significance level of p<0,05.

Literature

1. Ashjian, R.N., et al., In vitro differentiation of human processed lipoaspirate cells into early neural progenitors. Plast Reconstr Surg, 2003. 111(6): p.1922-31.

2. Balmer, J.E. and R. Blomhoff, Gene expression regulation by retinoic acid. J Lipid Res, 2002. 43(11): p.1773-808.

3. Brzoska, M., et al, Epithelial differentiation of human adipose tissue-derived adult stem cells. Biochem Biophys Res Commun, 2005. 330(1): p.142-50.

4. Fujimura, J., et al., Neural differentiation of adipose-derived stem cells isolated from GFP transgenic mice. Biochem Biophys Res Commun, 2005. 333(1): p.116-2.

5. Garcia-Suarez, O., et al., Expression of the neurotrophin receptor TrkB in the mouse liver. Anat Embryol (Berl), 2006. 211(5): p.465-73.

6. Gronthos, S., et al., Surface protein characterization of human adipose tissue-derived stromal cells. J Cell Physiol, 2001. 189(1): p.54-63.

7. Kim, J., et al., Differentiation of adult bone marrow stem cells into neuroprogenitor cells in vitro. Neuroreport, 2002. 13(9): p.1185-8.

8. Lim, J.Y., et al., Brain-derived neurotrophic factor stimulates the neural differentiation of human umbilical cord blood-derived mesenchymal stem cells and survival of differentiated cells through MAPK/ERK and PI3K/Akt-dependent signaling pathways. J Neurosci Res, 2008.

9. Miranville, A., et al, Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation, 2004. 110(3): p.349-55.

10. Mizuno, H., et al., Myogenic differentiation by human processed lipoaspirate cells. Plast Reconstr Surg, 2002. 109(1): p.199-209; discussion 210-1.

11. Ning, H., et al., Neuron-like differentiation of adipose tissue-derived stromal cells and vascular smooth muscle cells. Differentiation, 2006. 74(9-10): p.510-8.

12. Planat-Benard, V., et al., Spontaneous cardiomyocyte differentiation from adipose tissue stroma cells. Circ Res, 2004. 94(2): p.223-9.

13. Planat-Benard, V., et al., Plasticity of human adipose lineage cells toward endothelial cells: physiological and therapeutic perspectives. Circulation, 2004. 109(5): p.656-63.

14. Reichardt, L.F., Neurotrophin-regulated signalling pathways. Philos Trans R Soc bond In Biol Sci, 2006. 361(1473): p.1545-64.

15. Rivera, F.J., et al., Adult hippocampus derived soluble factors induce a neuronal-like phenotype in mesenchymal stem cells. Neurosci Lett, 2006. 406(1-2): p.49-54.

16. Seo, M.J., et al., Differentiation of human adipose stromal cells into hepatic lineage in vitro and in vivo. Biochem Biophys Res Commun, 2005. 328(1): p.258-64.

17. Yan, Q., et al., " Immunocytochemical localization of TrkB in the central nervous system of the adult rat. J Comp Neurol, 1997. 378(1): p.135-57.

18. US 7,078,230; published 18.07.2006.

19. Anghileri, E., et al., Neuronal differentiation potential of human adipose-derived mesenchymal stem cells. Stem Cells Dev, 200. 17: p.909-916.

1. A method of obtaining a population of stromal cells in adipose tissue induced to neural differentiation, comprising the selection of a population of stromal cells from adipose tissue (ADSC), culturing them in a standard environment for mammalian cells and the induction of differentiation by transfer to medium containing the inducer of neural differentiation, and characterized in that after the allocation of the total population of ADSC it is subjected to immunosensing based on the use of antibodies against the receptor (TrkB) to neurotrophic factor brain (BDNF), with essentially homogeneous subpopulations TrkB-expressing cells are then cultivated and induce in the direction of neural differentiation, using as inductor of BDNF in combination with 5-azacitidine or retinoic acid in combination with 5-azacitidine.

2. The method according to claim 1, characterized in that the inductor is used BDNF in combination with 5-azacitidine.

3. The method according to claim 2, characterized in that the concentration of BDNF and 5-azacitidine in differencirovannoe environment is 20ng/ml and 1 mm, respectively.

4. The method according to claim 1, characterized in that the inductor is used retinoic acid in combination with 5-azacitidine.

5. The method according to claim 4, characterized in that the concentration of retinoic acid and 5-azacitidine in differentiated the internal environment is 1 mm and 1 mm, respectively.

6. The method according to claim 1, characterized in that immunosensing carried out using immunomagnetic selection or flow cytofluorimetry.

7. The method according to any one of claims 1 to 6, characterized in that the cultivation is carried out in DMEM medium containing 10%fetal bovine serum, and the induction in the same environment with the addition of inducer.



 

Same patents:

FIELD: medicine, veterinary science.

SUBSTANCE: invention refers to veterinary science. A culture medium for pre-implantation embryos contains DMEM medium, inactivated blood serum of 6-7-month nanny-goats with blood content of IGF1 and IGF2 making 54.73 and 231.50 nmol/l respectively, glucose, streptomycin and penicillin, in the following ratio, wt %: inactivated blood serum of 6-7-month nanny-goats - 15.0-20.0; glucose - 0.40-0.45; streptomycin - 0.004-0.005; penicillin - 0.003-0.0035; DMEM medium - the rest.

EFFECT: application of the presented culture medium for pre-implantation of embryos leads to prolonged storage stability of an unfrozen embryo, and also improves engraftment of previously implanted embryos when transplanted from donor goats to recipients.

1 tbl, 6 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to genetic engineering and can be used to produce mammal nucleolar protein SURF-6. The NIH/3T3-174 cell line is obtained through genetic modification of mouse fibroblast line NIH/3T3. Modification is carried out using two successive transfections when the cells reach 70% confluence. The first transfection is carried out with 5 mcg of the pUHrT62-1 plasmid which codes the cell neomycin resistance gene (G-418) and the tetracycline-dependant transactivator, and 15 mcl of a liposomal transfection reagent in 500 mcl of DMEM medium. The second transfection is carried out with a mixture of 2.5 mcg of the pBI-SURF6 plasmid which bears the EGFP gene (green fluorescent protein) and the SURF-6 protein, and 2.5 mcg of a linear DNA fragment which codes puromycin resistance gene, and 15 mcl of a liposomal transfection reagent in 500 mcl of DMEM medium. Expression of EGFP and SURF-6 genes is controlled by a promoter which is activated by addition of an inducing substance - doxycycline antibiotic to the culture medium.

EFFECT: obtaining a NIH/3T3-174 cell line capable of producing the SURF-6 protein 10-20 times more than protein content in the initial unmodified fibroblasts when an inducing substance is added.

5 dwg, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to genetic engineering and can be used to produce mammal nucleolar protein SURF-6. The NIH/3T3-174 cell line is obtained through genetic modification of mouse fibroblast line NIH/3T3. Modification is carried out using two successive transfections when the cells reach 70% confluence. The first transfection is carried out with 5 mcg of the pUHrT62-1 plasmid which codes the cell neomycin resistance gene (G-418) and the tetracycline-dependant transactivator, and 15 mcl of a liposomal transfection reagent in 500 mcl of DMEM medium. The second transfection is carried out with a mixture of 2.5 mcg of the pBI-SURF6 plasmid which bears the EGFP gene (green fluorescent protein) and the SURF-6 protein, and 2.5 mcg of a linear DNA fragment which codes puromycin resistance gene, and 15 mcl of a liposomal transfection reagent in 500 mcl of DMEM medium. Expression of EGFP and SURF-6 genes is controlled by a promoter which is activated by addition of an inducing substance - doxycycline antibiotic to the culture medium.

EFFECT: obtaining a NIH/3T3-174 cell line capable of producing the SURF-6 protein 10-20 times more than protein content in the initial unmodified fibroblasts when an inducing substance is added.

5 dwg, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to a method of producing three-dimensional matrices for tissue-like structures from animal cells. The method involves covalent bonding of histons with the surface of pre-activated biocompatible polymer microspheres made from crystalline dextran. The microspheres with covalently bonded histons are then deposited by centrifuging. Microspheres containing 160-200 mcg protein per 1.0 g are deposited on a substrate surface in amount of 0.5-1.0 mg per 1.0 cm2 and then dried at room temperature. Further, the substrate is washed with a solution at pH 7.5 to remove material which is not bonded to the substrate. The layer of microspheres obtained on the surface of the substrate on which cells are deposited is used as a base for obtaining tissue-like cell structures.

EFFECT: invention increases reliability of the structure and stability of the protein layer of the three-dimensional matrix, simplifies and reduces the cost of the method of producing three-dimensional matrices for tissue-like structures from animal cells.

6 cl, 11 dwg, 6 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and cell biology. It has been established that sensitivity of mouse embryonic stem cells to clinostatting increases depending on cell development stages: from embryonic stem cell colonies to embryoid bodies. It has been shown that embryoid body clinostatting leads to slow down of the beginning of cardiomyocyte differentiation and significant reduction of the amount of cardiomyocytes cut. The invention can also be used in space medicine.

EFFECT: delay of neuronal differentiation on later differentiation stages.

2 cl, 8 dwg, 1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: there is offered a method for preparing a soft tissue filler composition for injection to relief or treat skin damages caused by mechanical or physiological reasons, including the stages as follows: 1) digestion of autologous dermal tissue recovered from autologous skin of a patient by processing with pancreatine/EDTA solution, and cell isolation; 2) cultivation and proliferation of the recovered dermal cells by serum-free cultivation in vitro in a medium containing a growth factor and activation factor for preparing autologous cellular culture material of dermal nature containing dermal fibroblastic stem cells, dermal fibroblastic "transitional" dividing cells, dermal fibroblasts and collagen; 3) centrifugation of autologous cellular culture material of dermal nature for separation of autologous cellular sediment of dermal nature; and 4) slurrying of autologous cellular culture material of dermal nature in glucose solution for injection or any solution for injection to prepare suspension for injection. There is offered a composition prepared by specified method which contains 1×107 to 8×107 cells/ml of autologous cells of dermal origins and 10 to 100 mg/ml of collagen as an effective ingredient.

EFFECT: invention provides therapeutic effect over a short period of time and maintains it for a long time.

13 cl, 7 ex, 8 dwg

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line ILG has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The ILG cell line is deposited in the Special collection of cell cultures of vertebrates of the Russian collection of cell cultures under number RKKK (P) 697D. All cells of the ILG line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line 31G has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The 31G cell line is deposited in the Special collection of cell cultures of vertebrates of the Russian collection of cell cultures under number RKKK (P) 698D. All cells of the 31G line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line IG has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The IG cell line is deposited in the Special collection of cell cultures of cage vertebrates of the Russian collection of cell cultures under number RKKK (P) 700D. All cells of the IG line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line 26G has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The 26G cell line is deposited in the Special collection of cell cultures of cage vertebrates of the Russian collection of cell cultures under number RKKK (P) 701D. All cells of the 26G line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: organic chemistry, natural compounds, medicine, oncology.

SUBSTANCE: invention represents new saponin mixtures used for inhibition of initiation and activation of mammalian epithelial cell in pre-malignant or malignant state, for stimulation of apoptosis of mammalian malignant cell, prophylaxis of anomalous proliferation of mammalian epithelial cell, for treatment of inflammatory and regulation of angiogenesis in mammal. These mixtures are isolated form plants of species Acacia victoriae. Also, invention relates to methods for their applying. These compounds can comprise triterpene component, such as acacic or oleanolic acid to which oligosaccharides and monoterpenoid components are joined. Mixtures and compounds elicit properties associated with regulation of apoptosis and cytotoxicity of cells and strong anti-tumor effect with respect to different tumor cells.

EFFECT: valuable medicinal properties of compositions.

43 cl, 53 tbl, 50 dwg, 44 ex

FIELD: biotechnology, molecular biology, medicine, genetic engineering, pharmacy.

SUBSTANCE: the hemopoietic protein comprises the amino acid sequence of the formula: R1-L1-R1, R2-L1-R1, R1-R2 or R2-R1 wherein R1 represents the modified ligand flt-3; R2 represents the modified human IL-3, the modified or unmodified colony-stimulating factor. Modification of R1 is carried out by addition of N-end with C-end directly or through linker (L2) that is able to join N-end with C-end to form new C- and N-ends. The modified human IL-3 is prepared by replacing amino acids at positions 17-123. The human G-CSF is modified by exchange of amino acids. The hemopoietic protein is prepared by culturing cells transformed with vector comprising DNA that encodes the hemopoietic protein. The hemopoietic protein stimulates producing hemopoietic cells and this protein is used as a component of pharmaceutical composition used in treatment of humans suffering with tumor, infectious or autoimmune disease. Invention provides preparing multifunctional hemopoietic proteins eliciting the enhanced activity with respect to stimulation of hemopoietic cells and eliciting the improved physical indices. Invention can be used for preparing chimeric multifunctional hemopoietic proteins.

EFFECT: improved preparing and producing method, valuable medicinal properties of protein.

22 cl, 19 dwg, 18 tbl, 117 ex

FIELD: cellular biology, medicine.

SUBSTANCE: invention relates to isolating and cryopreserving precursor-cells. Methods involve treatment of human liver tissue for preparing the essentially monocellular suspension containing precursor-cells and cells that are not precursor-cells, a single or more lines of cellular differentiation presenting in the human liver. Invention describes methods involving stage for separating cellular population resulting to reducing amount of cells that are not precursor-cells and providing preparing the separated suspension enriched with precursor-cells expressing one or more markers and associated with a single or more lines of the cellular differentiation. Also, invention describes a method for selection cells from the separated suspension wherein these cells or their progeny, or their more matured forms express one or more markers associated with lines of the cellular differentiation. These markers involve: CD14, CD34, CD38, CD45 and ICAM. Hepatic precursor-cells have diameter size 6-16 mc, they are diploid and show indices: glycoforin A-, CD45-, AFP+++, ALB+, ICAM+ and they comprise subpopulations varying with respect to expression of CD14+, CD34++, CD38++ and CD117++. These cells are useful for carrying out cellular and genetic therapy in liver treatment and for preparing artificial organs also.

EFFECT: valuable biological and medicinal properties of cells.

41 cl, 7 tbl, 13 dwg, 15 ex

FIELD: medicine, genetic engineering.

SUBSTANCE: invention relates to applying genetic engineering approaches for treatment of autoimmune diseases, in particular, for treatment of cerebrospinal sclerosis. This is achieved by incorporation of one or some recombinant genes encoding autoantigens that represent a target for autoimmune response. In particular, invention claims a method for designation of gene encoding encephalitogenous epitope of proteolipid protein and expression of gene product in vivo by using the recombinant retroviral vector. Expression and secretion of encephalitogenous epitope improves histopathological and clinical indices in experimental autoimmune encephalomyelitis in mice that is used as a model of cerebrospinal sclerosis. The advantage of invention involves the development of a method for recovery the tolerance in treatment of cerebrospinal sclerosis being without suppression of immune system.

EFFECT: improved and valuable method for treatment.

6 cl, 13 dwg, 3 ex

FIELD: biotechnology and pharmaceutical industry.

SUBSTANCE: title operations are accomplished by following way. Three-dimensional culture of stromal cells is cultured in piston flow bioreactor, in particular being introduced in fibrous matrix incorporated into substrate, which is placed in container constituting a part of bioreactor piston. Stromal cells are grown until density 5 x 106 cell/cm3 substrate is attained, whereupon non-differentiated hemopoietic cells are either sowed directly into piston flow bioreactor or cultured in conditioned medium of stromal cells obtained by gathering medium from indicated flow bioreactor. Non-differentiated hemopoietic cells obtained by cultivation in presence of three-dimensional culture of stromal cells or their conditioned medium are transplanted to into recipient.

EFFECT: enabled growth of large amounts of stromal cells within a relatively small volume to provide longer maintenance of vital activity and reproduction of non-differentiated hemopoietic stem cells or precursor cells.

77 cl, 9 dwg, 3 tbl

FIELD: veterinary science.

SUBSTANCE: the present innovation deals with serological diagnostics of infectious diseases in cattle, viral diarrhea as mucosal disease in cattle (cattle VD) and evaluation of immunity strength in vaccinated animals. The method deals with growing finite cell line of coronary vessels in cow's embryo in Eagle's MEM nutritive medium with 20 mg/ml kanamycin and 10% equine serum. Double dilutions of inactivated tested serumal samples (56 C, 30 min) should be mixed at equal volume (0.05 ml) with 100 TCD50/0.1 ml virus to be incubated for 1 h at 37 C in CO2-incubator. On finishing the incubation one should add 0.1 ml suspension of the above-mentioned finite cell line in Eagle's MEM nutritive medium containing 20 mg/ml kanamycin and 5% (2.5% final concentration) of equine serum. Cell concentration in the culture corresponds to 3.5 x 105. Reaction registration should be carried out in 3 d while cytopathogenic viral action appears in control holes containing working viral dosage. The innovation enables to widen the number of diagnostic immunological methods for veterinary purposes.

EFFECT: higher efficiency of detection.

1 cl, 7 ex, 2 tbl

FIELD: biotechnology.

SUBSTANCE: claimed microarray represents ensemble of gel microcells on substrate made of glass, polymer, ceramic or composite material. Microcells contain immobilized procariotic or eucariotic cells. Microcells with immobilized cells are prepared using gel-forming solution including glycerol. Cellular microarray is used in living cell investigation. In this purpose cellular microarray is incubated in presence of marker, signal (e.g. cell fluorescence) is detected and according to signal level cell living function in microarray is evaluated.

EFFECT: simplified living cell investigation method without losses of cell viability.

12 cl, 5 dwg, 3 ex

FIELD: biology, medicine.

SUBSTANCE: invention relates to media used for reprogramming human and animal stem cells. Medium for the biochemical reprogramming human and animal stem cells containing the medium DI-MEM, fetal calve serum, insulin, 5-azacytidine, L-glutamine comprises additionally the medium F-12, dimethylsulfoxide, dexamethasone, hydrocortisone, N6-2'-dibutyryl-3',5'-cyclic adenosine monophosphate and ethanolamide in the required ratio of components. Invention provides enhancing the effectiveness in reprogramming stem cells in direction of cardiomyogenesis.

EFFECT: improved and valuable properties of medium.

2 dwg, 3 ex

FIELD: agricultural biotechnology, in particular, in vitro grape multiplication processes.

SUBSTANCE: method involves providing micro cutting of testing plants and planting thereof in liquid nutritive medium with reduced amount of macroelements and vitamins, with indole-acetic acid being added in an amount of 0.1-0.3 mg/l and emistim preparation with concentration of 10-7-10-10% being added into composition.

EFFECT: increased efficiency in multiplication of perspective sorts of grape sanitated from virus infection.

6 tbl

FIELD: biotechnology, medicine.

SUBSTANCE: peritoneal macrophages are placed in medium 1999 and subjected for effect of helium plasma obtained at current strength 30 A, voltage 20 V and gas consumption 2 l/min/ Cells are irradiated from distance 20 cm to plasmatron nozzle for 30 s. Method provides reducing time of physical factor effect on cells and allows carrying out the local effect on macrophage functions both in cultured cells and within the whole body. Invention can be used in clinical practice for stimulation of biological processes in cells and tissues.

EFFECT: improved method for stimulation.

1 tbl, 2 ex

Up!