Genetically modified mouse fibroblast line nih/3t3-174

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to genetic engineering and can be used to produce mammal nucleolar protein SURF-6. The NIH/3T3-174 cell line is obtained through genetic modification of mouse fibroblast line NIH/3T3. Modification is carried out using two successive transfections when the cells reach 70% confluence. The first transfection is carried out with 5 mcg of the pUHrT62-1 plasmid which codes the cell neomycin resistance gene (G-418) and the tetracycline-dependant transactivator, and 15 mcl of a liposomal transfection reagent in 500 mcl of DMEM medium. The second transfection is carried out with a mixture of 2.5 mcg of the pBI-SURF6 plasmid which bears the EGFP gene (green fluorescent protein) and the SURF-6 protein, and 2.5 mcg of a linear DNA fragment which codes puromycin resistance gene, and 15 mcl of a liposomal transfection reagent in 500 mcl of DMEM medium. Expression of EGFP and SURF-6 genes is controlled by a promoter which is activated by addition of an inducing substance - doxycycline antibiotic to the culture medium.

EFFECT: obtaining a NIH/3T3-174 cell line capable of producing the SURF-6 protein 10-20 times more than protein content in the initial unmodified fibroblasts when an inducing substance is added.

5 dwg, 7 ex

 

The invention relates to biotechnology and created for the production and excretion of protein in the nucleus of the SURF-6 mammals for screening of antibodies, including autoimmune serum, immunoblot and biological microchips.

It is known that the yeast S. cerevisiae and S. pombe produce protein Rrp14p, which is the homologue protein SURF-6 mammals (Oeffinger et al. Yeast Rrp14p is required for ribosomal subunit synthesis and for correct positioning of the mitotic spindle during mitosis. Nucleic Acids Res. 2007, 35: 1354-1366). However, the low level of expression Rrp14p and only partial - about 20% homology Rrp14p with SURF-6 does not allow the use of yeast to highlight protein SURF-6, characteristic of the somatic cells of mammals.

It is known that the human cell line HeLa also contain the gene of the protein SURF-6 (Polzikov et al. Identification of an evolutionary conserved SURF-6 domain in a family of nucleolar proteins extending from human to yeast. Biochem. Biophys. Res. Commun. 2005, 327: 143-149). However, the neoplastic nature of HeLa cells does not allow you to use them for studying protein SURF-6 in normal (untransformed) cells of mammals.

It is also known that protein SURF-6 is transmitted in normal fibroblasts mouse line NIH/3T3 (Magoulas and Fried. The Surf-6 gene of the mouse surfeit locus encodes a novel nucleolar protein. DNA Cell Biol. 1996, 15: 305-316; Magoulas et al. The SURF-6 protein is a component of the nucleolar matrix and has a high binding capacity for nucleic acids in vitro. Eur. J. Cell Biol. 1998, 75:174-183). However, in these cells the expression of a gene SURF-6 is under the control of the standard intracellular tra is scription factors and can not be increased any external influences (Gurchenko and other Properties and function of a new protein of the nucleolus SURF-6 in mouse cells T. Bioorganic chemistry. 2005, 31: 578-585).

The objective of the invention is the creation on the basis of mouse fibroblasts line NIH/3T3 new - genetically-modified - cell line capable of producing the protein of the nucleolus SURF-6 at levels 10-20 times higher than its content in unmodified cells.

The problem is solved by a line of mouse fibroblasts NIH/3T3-174 for producing the protein of the nucleolus SURF-6 mammalian derived from the source cells NIH/3T3 when they reach 70% of confluently and transfection using 5 μg of DNA, including plasmids pUHrT62-1, pBI-SURF6 and linear DNA fragment carrying the gene of resistance to puromycin, and 15 ál for liposomal transfection in 500 µl medium DMEM.

The resulting cell line NIH/3T3-174 capable of producing a protein SURF-6 level, which is 10-20 times higher than the levels of SURF-6 in the original cell line NIH/3T3.

To obtain genetically modified cells using mouse fibroblasts line NIH/3T3 from the Russian cell culture collection (Institute of Cytology RAS, St. Petersburg). Genetic modification of cells produced using two plasmids. The first, or auxiliary, plasmid pUHrT62-1 provided by its developers (Urlinger et al. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield epanded range and sensitivity, Proc. Natl. Acad. Sci. U.S.A. 2000, 97: 7963-7968). It encodes tetracyclinebuy factor activation of transcription of the gene and the resistance of cells to neomycin (G418). The second, or acting, plasmid pBI-SURF6 created on the basis of commercial vector pBI-EGFP ("Clontech, USA). It contains tetracyclinebuy promoter activated tetracyclinepenicillin factor in the presence of the antibiotic tetracycline is doxycycline, the gene of the green fluorescent protein EGFP gene and the SURF-6 mouse (Figure 1).

The first transfection performed with plasmid pUHrT62-1. Transfected cells are grown in selective medium containing 450 μg/ml neomycin (G418), within one month. Cells resistant to neomycin, selected and raised to the status of 70% of confluently. The cells are then transferout the plasmid pBI-SURF6 and linear DNA fragment carrying the gene of resistance to puromycin and isolated from pLoxPuro the restriction sites BamHI and ScaI (Arakawa et al. Mutant loxP vectors for the selectable marker recycle and conditional knock-outs. BMC Biotechnology. 2001, 1:7). Transfected cells are grown in selective medium containing 450 μg/ml neomycin and 1 µg/ml puromycin, within one month. Cells are not sensitive to antibiotics, take away, grow and for long-term storage, freeze in liquid nitrogen. Cell line, obtained from two consecutive transfections, named NIH/3T3-174.

The genetic evidence is the second modification of the cell line NIH/3T3-174 are the following features.

Using polymerase chain reaction (PCR)using as template genomic DNA isolated from cells NIH/3T3-174, proved the presence of plasmids RW-SURF6, integrated in their genome (Figure 2).

After addition of culture medium with 5 μg/ml doxycycline for 24 h and exposed to light with a wavelength of 484 nm cells NIH/3T3-174 exhibit green fluorescence, which is caused by the expression of EGFP gene was present in the second - current - plasmid pBI-SURF6 (Figure 3).

Using reverse transcription and polymerase chain reaction (RT-PCR) cell line NIH/3T3-174 analyze mRNA level of the SURF-6 after induction with doxycycline. After 48 h induction revealed a significant increase in the mRNA content of the SURF-6 at a constant level of mRNA of the marker gene glyceraldehyde-2'-phosphate dehydrogenase (GAPDH) (Figure 4).

After electrophoretic separation equal amounts of total proteins extracted from cells NIH/3T3 and NIH/3T3-174, and their immunoproteasome, a significant increase in the content of the SURF-6, compared with the control cells NIH/3T3 cells and NIH/3T3-174, detected as early as 24 hours after induction of expression of additional copies of genes SURF-6. After 48 h induction level of the SURF-6 is approximately 20 times higher than in the control cells, as evidenced by the analysis of photogram using TotalLab version 2.00 ("Phoretix, USA) (Figure 5). Availability of products is agradeciy SURF-6, found in line NIH/3T3-174 48 h after induction and marked on figure 4 asterisks indicates the start in the cell mechanisms of enhanced proteolysis and degradation of additional copies of the protein molecules.

Thus, the results of the experiments say about genetic modification of the parent cell line NIH/3T3 and abilities derived cell line NIH/3T3-174 to produce nucleolus protein SURF-6 in the presence of inducer-antibiotic doxycycline at a higher level.

Genetically modified cells NIH/3T3-174 have the following characteristics:

Morphological features. The cell line NIH/3T3-174 shows the main phenotypic characteristics of the parent line - fibroblast cell line mouse NIH/3T3. These signs persist, at least for 40 passages, corresponding to approximately 5 months of cultivation (figure 3).

Cultural properties. Wednesday cultivation - DMEM containing 10% fetal bovine serum ("HyClone, USA), 2 mm L-glutamine, antibiotics penicillin and streptomycin (250 UNITS each), as well as selective antibiotics - neomycin (G418) at a concentration of 150 μg/ml and puromycin at a concentration of 0.5 μg/ml, at 37°C and 5% CO2/95% O2. Re-seeding culture carried out twice a week using trypsin-EDTA (Paneco", Russia). When reseeding cool the tours in a new culture vessel area of 25 cm 2make 106cells (2×105cells/ml).

Method of cryopreservation cell line NIH/3T3-174. Createdata environment: 90% bovine fetal serum and 10% dimethyl sulfoxide (DMSO). Ciampoli with a suspension of cells is placed for 3 hours in a refrigerator at -70° C and then in liquid nitrogen. Cell viability after thawing is 90-95%. Bacteria, fungi, yeast or Mycoplasma culture NIH/3T3-174 was not found.

The invention is illustrated graphics:

Figure 1. The scheme created plasmids pBI-SURF6.

Figure 2. PCR analysis of integration into the genome of cells NIH/3T3-174 plasmid pBI-SURF6.

Figure 3. Character tagging cells NIH/3T3-174 green fluorescent protein EGFP after 24 h after addition of doxycycline.

Figure 4. The mRNA level of the SURF-6 in the original (control) cells, NIH/3T3 and in cells NIH/3T3-174 48 h after induction detected by RT-PCR.

Figure 5. Protein SURF-6 in the original (control) cells, NIH/3T3 and in cells NIH/3T3-174 after 24 h and 48 h after addition of doxycycline identified by the method of immunoablative.

The invention is illustrated by the examples.

Example 1

Obtaining current plasmids pBI-SURF6.

To obtain the plasmid pBI-SURF6, the DNA fragment (1900 BP), the corresponding cDNA Surf-6, amplified by PCR, using as template the plasmid pBS-SURF6 containing cDNA SURF-6 mouse (Magoulas and Fried. The Surf-6 gene of the mouse surfeit locus encodes anovel nucleolar protein. DNA Cell Biol. 1996, 15: 305-316).

Conducted PCR reaction includes gene-specific primers (5'-primer-gctagcatggcttctctcctggccaaggat, 3'-primer -gctegcggagaggcctgcacgctccag built the sites of the restriction enzyme NheI underlined), and Taq polymerase (5 u/ál), ddNTP mix (10 mm each), as well as a buffer for DNA polymerase. The products of polymerase chain reaction separated by electrophoresis in 2%agarose gel in the presence of ethidium bromide at field strength of 5 V/see isolated from the gel fragment of double-stranded cDNA SURF-6 is cleaned by dialing "QIAEX II Gel Extraction Kit" ("Qiagen, Germany) and clone in the vector pBI-EGFP ("Clontech, USA). Reaction of leading, carried out in 10 μl, using 4 μl purified PCR product, 0.5 ál of T4 DNA ligase (3 u/ál), 1 ál of 10x buffer for ligation and 0.5 μl of the vector pBI-EGFP, linearized by restriction site NheI. The obtained plasmid was named pBI-SURF6 and tested for the presence of nucleotide substitutions in the cloned DNA fragment using the automatic DNA sequencing.

Example 2

Obtaining a linear DNA fragment carrying the gene of resistance to puromycin. To obtain a DNA fragment carrying a gene for resistance to puromycin use plasmid pLoxPuro (Arakawa et al. Mutant loxP vectors for the selectable marker recycle and conditional knock-outs. BMC Biotechnology. 2001, 1:7). For the reaction of the enzyme choose restrictase VAT and Scal, the sites of the restriction which the s flank the desired DNA fragment in pLoxPuro. For this to 2 µg plasmid pLoxPuro add 20 UNITS of restricted BamHI and SeaI in Bromphenol blue buffer and incubated the reaction mixture at 37°C for 2 hours After the conduct of the reaction restriction desired DNA fragment was separated by electrophoresis from linearized plasmids pLoxPuro, isolated from the gel and purified using a set of "QIAEX II Gel Extraction Kit" ("Qiagen, Germany).

Example 3

Conducting transfection of cells.

Transfection of cells spend liposomal method using Lipofectamine2000 reagent ("Invitrogen, UK) in Petri dishes with a diameter of 35 mm when the cells 70% of confluently. For the first transfection using 5 µg of plasmid pUHrT62-1, 15 μl of Lipofectamine2000 reagent in 500 µl medium DMEM. After 6 hours the cells are washed with medium, DMEM containing 10% fetal bovine serum, 2 mm L-glutamine, antibiotics penicillin and streptomycin (250 UNITS each) and 450 μg/ml neomycin (G418), and cultured for 1 month, twice a week, replacing the old culture medium with a fresh medium of the same composition. For the second transfection using 2.5 μg of the plasmid pBI-SURF6, 2.5 μg linear DNA fragment carrying the gene of resistance to puromycin, 15 ál Lipofectamine 2000 in 500 µl medium DMEM. After 6 hours after adding the components of the cells washed with growth medium, DMEM containing 10% fetal serum large ro is Togo cattle, 2 mm L-glutamine, antibiotics penicillin and streptomycin (250 UNITS each), 450 μg/ml neomycin (G418) and puromycin at a concentration of 1 μg/ml, and cultured for 1 month, twice a week, replacing the old culture medium with a fresh medium of the same composition. Described in example conditions for transfection of the cell line NIH/3T3 plasmids pUHrT62-1, pBI-SURF6 and a linear fragment of DNA yield clone cells NIH/3T3-174, capable of superproductive protein SURF-6 in the presence of the inducer doxycycline (Figure 5). Thus, along with confluently cells other condition of successful receipt of a clone with the desired properties is the ratio of the mass of DNA (µg) and volume of the liposomal reagent (µl)was used for each transfection, equal to 1:3.

Example 4

The selection of cell clones that are resistant to selective antibiotics.

From Petri dishes 60 mm in diameter ("Costar", Germany), containing the cells, remove the culture medium. Cells are washed twice with medium, DMEM (without serum) and add 100 ál of trypsin-EDTA (Paneco", Russia) for 3-5 min at 37°C, and then 5 ml of complete culture medium containing selective antibiotics. Under the control of a binocular microscope (LOMO, Russia) Pasteur pipette select the cells that make up the clones, and transfer them into a culture flask (25 cm2. Cells were cultured at 37°C and 5% CO2/95% O2to DOS is to achieve 60-70% of confluently.

Example 5

Evidence of genetic modification of cells NIH/3T3-174: PCR using genomic DNA.

Using polymerase chain reaction (PCR)using as template genomic DNA isolated from cells NIH/3T3-174, primer to TRE-element integrated into the genome of the plasmid pBI-SURF6 (1) (5' gtcgagctcggtacccgggtcgagtaggcgtgtacg) and gene-specific primer to the coding sequence of the SURF-6 mice (5' tcagttaaagatcagccctgattcctg), identify the DNA fragment with an electrophoretic mobility in the region of 850 BP, which corresponds to the estimated mobility of the expected PCR product (Figure 2).

Example 6

Evidence of genetic modification of cells NIH/3T3-174: RT-PCR.

Total RNA isolated in 100 μl of solution by means of a kit for RNA extraction SV Total RNA Isolation System (Promega, USA), and cDNA synthesized on messenger RNA (mRNA) by reverse transcription using 10 u/μl reverse transcriptase M-MLV virus leukemia mice Meloni. For the formation of the bare areas on the chain mRNA using random primers, 1 μm each. The reaction of cDNA synthesis is carried out in a volume of 20 µl.

For PCR using primers for the gene SURF-6 gene and "household" - GAPDH (glyceraldehyde-2'-phosphate dehydrogenase) mouse.

Primers for the amplification of gene SURF-6: 5' attttctgcgacagcggctgcgcagatgagtatcttgtccc, 5' tgcatcctgatcacgaagctcgttgagtccatggggagcttt AGC TTT; for amplification of a participant who and gene GAPDH 5'-tgcaccaccaactgcttagctgttatacagggagatgaaa, 5'-cattgtcataccaggaaatgagcatttgattctggaccatggc.

Example 7

Determining the content of the SURF-6 in total cell lysates method immunoablative.

Electrophoretic separation of proteins carried out according to the standard method proposed by the laemmli's method. To do this, cells are lysed on ice in buffer containing 50 mM Tris-(hydroxymethyl)-aminomethane (pH 7.5), 150 mM NaCl, 10% glycerol, 0.5% Triton X-100 and the mixture protease inhibitors (Sigma, USA) using pastillage homogenizer. Before lysis, the number of cells in each sample calculated using the camera Goriaev ("MiniMed", Russia). The total protein concentration in the lysates is determined by the method of Lowry (option Peterson) using a set of Protein Assay Kit (Sigma). Before electrophoretic separation for the cooked lysates add 5x buffer laemmli's method, containing 250 mm Tris-(hydroxymethyl)-aminomethane (pH 6.8), 50% glycerol, 10% LTOs, 500 mm β-mercaptoethanol, and 0.5% bromophenol blue. The samples subjected to heat treatment at 100°C for 5 minutes In each pocket 12% SDS page put lysates obtained from equal amounts of cells and containing not less than 50 μg of total protein. Electrophoretic separation of proteins was performed at 60 V for concentration of proteins in the "upper" (concentrating) the gel and 160 for further separation in the electrophoretic chamber. After separation of proteins gel Inka is irout buffer for holding semi-dry electroblotting, containing 50 mm Tris-(hydroxymethyl)-aminomethane, 38 mm glycine, 0.1% sodium dodecyl sulfate and 20% methanol. Transfer of proteins to nitrocellulose membrane (0.22 µm, "Millipore, USA) is carried out at constant voltage of 20 V for 30 minutes and Then the membrane is incubated with antibodies to protein SURF-6 (Magoulas et al. The SURF-6 protein is a component of the nucleolar matrix and has a high binding capacity for nucleic acids in vitro. Eur. J. Cell. Biol. 1998, 75: 174-183) (dilution 1:2500), and then with antibodies to rabbit immunoglobulins, conjugated with horseradish peroxidase (Sigma; dilution 1:2000 in TBST buffer containing 20 mm Tris-(hydroxymethyl)-aminomethane (pH 7.6), 150 mm NaCl, 0.05% Tween-20. The membrane shown by chemiluminescence using the set of ECL + Plus ("AmershamPharmaciaBiotech, UK).

Line of mouse fibroblasts NIH/3T3-174 for producing the protein of the nucleolus SURF-6 mammalian derived from the source cells NIH/3T3 when they reach 70% of confluently and transfection using 5 μg of DNA, including plasmids pUHrT62-1, pBI-SURF6 and linear DNA fragment carrying the gene of resistance to puromycin, and 15 ál for liposomal transfection in 500 µl medium DMEM.



 

Same patents:

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to a method of producing three-dimensional matrices for tissue-like structures from animal cells. The method involves covalent bonding of histons with the surface of pre-activated biocompatible polymer microspheres made from crystalline dextran. The microspheres with covalently bonded histons are then deposited by centrifuging. Microspheres containing 160-200 mcg protein per 1.0 g are deposited on a substrate surface in amount of 0.5-1.0 mg per 1.0 cm2 and then dried at room temperature. Further, the substrate is washed with a solution at pH 7.5 to remove material which is not bonded to the substrate. The layer of microspheres obtained on the surface of the substrate on which cells are deposited is used as a base for obtaining tissue-like cell structures.

EFFECT: invention increases reliability of the structure and stability of the protein layer of the three-dimensional matrix, simplifies and reduces the cost of the method of producing three-dimensional matrices for tissue-like structures from animal cells.

6 cl, 11 dwg, 6 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and cell biology. It has been established that sensitivity of mouse embryonic stem cells to clinostatting increases depending on cell development stages: from embryonic stem cell colonies to embryoid bodies. It has been shown that embryoid body clinostatting leads to slow down of the beginning of cardiomyocyte differentiation and significant reduction of the amount of cardiomyocytes cut. The invention can also be used in space medicine.

EFFECT: delay of neuronal differentiation on later differentiation stages.

2 cl, 8 dwg, 1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: there is offered a method for preparing a soft tissue filler composition for injection to relief or treat skin damages caused by mechanical or physiological reasons, including the stages as follows: 1) digestion of autologous dermal tissue recovered from autologous skin of a patient by processing with pancreatine/EDTA solution, and cell isolation; 2) cultivation and proliferation of the recovered dermal cells by serum-free cultivation in vitro in a medium containing a growth factor and activation factor for preparing autologous cellular culture material of dermal nature containing dermal fibroblastic stem cells, dermal fibroblastic "transitional" dividing cells, dermal fibroblasts and collagen; 3) centrifugation of autologous cellular culture material of dermal nature for separation of autologous cellular sediment of dermal nature; and 4) slurrying of autologous cellular culture material of dermal nature in glucose solution for injection or any solution for injection to prepare suspension for injection. There is offered a composition prepared by specified method which contains 1×107 to 8×107 cells/ml of autologous cells of dermal origins and 10 to 100 mg/ml of collagen as an effective ingredient.

EFFECT: invention provides therapeutic effect over a short period of time and maintains it for a long time.

13 cl, 7 ex, 8 dwg

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line ILG has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The ILG cell line is deposited in the Special collection of cell cultures of vertebrates of the Russian collection of cell cultures under number RKKK (P) 697D. All cells of the ILG line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line 31G has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The 31G cell line is deposited in the Special collection of cell cultures of vertebrates of the Russian collection of cell cultures under number RKKK (P) 698D. All cells of the 31G line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line IG has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The IG cell line is deposited in the Special collection of cell cultures of cage vertebrates of the Russian collection of cell cultures under number RKKK (P) 700D. All cells of the IG line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line 26G has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The 26G cell line is deposited in the Special collection of cell cultures of cage vertebrates of the Russian collection of cell cultures under number RKKK (P) 701D. All cells of the 26G line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line PG has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The PG cell line is deposited in the Special collection of cell cultures of cage vertebrates of the Russian collection of cell cultures under number RKKK (P) 702D. All cells of the PG line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and specifically to media for growing cultures of autologous lymphocytes and can be used for treating and preventing pyoinflammatory complications in patients. The medium for growing a culture of autologous lymphocytes based on the RPMI - 1640 (Roswell Park Memorial Institute) culture medium contains 10% phytohemagglutinin solution and blood plasma, obtained from any central or peripheral vein of a patient, for whom the culture of autologous lymphocytes is grown, with the following ratio of components in vol. %: blood plasma of the patient - 0.75-1.2; 10% phytohemagglutinin solution in the RPMI-1640 culture medium - 0.008-0.013; RPMI - 1640 culture medium - the rest up to 100%.

EFFECT: invention provides high reliability of preventing allergic reactions of the body of the patient, increases content of lymphocytes in the culture of autologous lymphocytes, prevents occurrence of foreign proteins and provides the required sterility due to prevention of bacteria germination.

3 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: method for combined immunobiological analysis of cells using a biochip involves incubation of the biochip which contains immobilised antibodies, with suspension of cells, washing the biochip from non-bonded cells, determination of coexpression of antigens on the bonded cells. The obtained result is assessed by determining presence of bonded cells in the region of the stain of the biochip and bonding density of cells and interpretation of the obtained result. Coexpression of antigens on cells bonded to the biochip is determined by carrying out one or more immunocytochemical reactions. When reading out the result, morphological analysis of cells bonded to the biochip is also carried out and presence and character of colouring of cells and their components with the reaction product are determined.

EFFECT: use of the disclosed method provides high reliability and information content of analysis.

9 cl, 6 dwg, 2 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to a method of producing three-dimensional matrices for tissue-like structures from animal cells. The method involves covalent bonding of histons with the surface of pre-activated biocompatible polymer microspheres made from crystalline dextran. The microspheres with covalently bonded histons are then deposited by centrifuging. Microspheres containing 160-200 mcg protein per 1.0 g are deposited on a substrate surface in amount of 0.5-1.0 mg per 1.0 cm2 and then dried at room temperature. Further, the substrate is washed with a solution at pH 7.5 to remove material which is not bonded to the substrate. The layer of microspheres obtained on the surface of the substrate on which cells are deposited is used as a base for obtaining tissue-like cell structures.

EFFECT: invention increases reliability of the structure and stability of the protein layer of the three-dimensional matrix, simplifies and reduces the cost of the method of producing three-dimensional matrices for tissue-like structures from animal cells.

6 cl, 11 dwg, 6 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and cell biology. It has been established that sensitivity of mouse embryonic stem cells to clinostatting increases depending on cell development stages: from embryonic stem cell colonies to embryoid bodies. It has been shown that embryoid body clinostatting leads to slow down of the beginning of cardiomyocyte differentiation and significant reduction of the amount of cardiomyocytes cut. The invention can also be used in space medicine.

EFFECT: delay of neuronal differentiation on later differentiation stages.

2 cl, 8 dwg, 1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: there is offered a method for preparing a soft tissue filler composition for injection to relief or treat skin damages caused by mechanical or physiological reasons, including the stages as follows: 1) digestion of autologous dermal tissue recovered from autologous skin of a patient by processing with pancreatine/EDTA solution, and cell isolation; 2) cultivation and proliferation of the recovered dermal cells by serum-free cultivation in vitro in a medium containing a growth factor and activation factor for preparing autologous cellular culture material of dermal nature containing dermal fibroblastic stem cells, dermal fibroblastic "transitional" dividing cells, dermal fibroblasts and collagen; 3) centrifugation of autologous cellular culture material of dermal nature for separation of autologous cellular sediment of dermal nature; and 4) slurrying of autologous cellular culture material of dermal nature in glucose solution for injection or any solution for injection to prepare suspension for injection. There is offered a composition prepared by specified method which contains 1×107 to 8×107 cells/ml of autologous cells of dermal origins and 10 to 100 mg/ml of collagen as an effective ingredient.

EFFECT: invention provides therapeutic effect over a short period of time and maintains it for a long time.

13 cl, 7 ex, 8 dwg

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line ILG has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The ILG cell line is deposited in the Special collection of cell cultures of vertebrates of the Russian collection of cell cultures under number RKKK (P) 697D. All cells of the ILG line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line 31G has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The 31G cell line is deposited in the Special collection of cell cultures of vertebrates of the Russian collection of cell cultures under number RKKK (P) 698D. All cells of the 31G line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line IG has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The IG cell line is deposited in the Special collection of cell cultures of cage vertebrates of the Russian collection of cell cultures under number RKKK (P) 700D. All cells of the IG line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line 26G has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The 26G cell line is deposited in the Special collection of cell cultures of cage vertebrates of the Russian collection of cell cultures under number RKKK (P) 701D. All cells of the 26G line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, particularly to obtaining cell lines and can be used for immunotherapy and immunoprophylaxis in patients with malignant growths. The human melanoma cell line PG has stable culture, morphological and immunological characteristics and can secrete a human recombinant granulocytic-macrophagal colony-stimulating factor (GM-CSF). The PG cell line is deposited in the Special collection of cell cultures of cage vertebrates of the Russian collection of cell cultures under number RKKK (P) 702D. All cells of the PG line are characterised by stable secretion of GM-CSF stored after inactivation of cells through exposure to 100 Gy of ionising radiation which reliably prevents proliferation of the inactivated cells.

EFFECT: invention enables introduction of inactivated tumour cells into patients in order to stimulate antitumuor immunity.

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and specifically to media for growing cultures of autologous lymphocytes and can be used for treating and preventing pyoinflammatory complications in patients. The medium for growing a culture of autologous lymphocytes based on the RPMI - 1640 (Roswell Park Memorial Institute) culture medium contains 10% phytohemagglutinin solution and blood plasma, obtained from any central or peripheral vein of a patient, for whom the culture of autologous lymphocytes is grown, with the following ratio of components in vol. %: blood plasma of the patient - 0.75-1.2; 10% phytohemagglutinin solution in the RPMI-1640 culture medium - 0.008-0.013; RPMI - 1640 culture medium - the rest up to 100%.

EFFECT: invention provides high reliability of preventing allergic reactions of the body of the patient, increases content of lymphocytes in the culture of autologous lymphocytes, prevents occurrence of foreign proteins and provides the required sterility due to prevention of bacteria germination.

3 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: method for combined immunobiological analysis of cells using a biochip involves incubation of the biochip which contains immobilised antibodies, with suspension of cells, washing the biochip from non-bonded cells, determination of coexpression of antigens on the bonded cells. The obtained result is assessed by determining presence of bonded cells in the region of the stain of the biochip and bonding density of cells and interpretation of the obtained result. Coexpression of antigens on cells bonded to the biochip is determined by carrying out one or more immunocytochemical reactions. When reading out the result, morphological analysis of cells bonded to the biochip is also carried out and presence and character of colouring of cells and their components with the reaction product are determined.

EFFECT: use of the disclosed method provides high reliability and information content of analysis.

9 cl, 6 dwg, 2 ex

FIELD: organic chemistry, natural compounds, medicine, oncology.

SUBSTANCE: invention represents new saponin mixtures used for inhibition of initiation and activation of mammalian epithelial cell in pre-malignant or malignant state, for stimulation of apoptosis of mammalian malignant cell, prophylaxis of anomalous proliferation of mammalian epithelial cell, for treatment of inflammatory and regulation of angiogenesis in mammal. These mixtures are isolated form plants of species Acacia victoriae. Also, invention relates to methods for their applying. These compounds can comprise triterpene component, such as acacic or oleanolic acid to which oligosaccharides and monoterpenoid components are joined. Mixtures and compounds elicit properties associated with regulation of apoptosis and cytotoxicity of cells and strong anti-tumor effect with respect to different tumor cells.

EFFECT: valuable medicinal properties of compositions.

43 cl, 53 tbl, 50 dwg, 44 ex

Up!