Human immunodeficiency virus reproduction inhibitor

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, specifically to obtaining a human immunoglobulin based preparation, and can be used in medicine. The preparation is obtained via purification of class G, A and M immunoglobulins isolated from the blood of HIV infected patients through affinity chromatography on a column with integrase-sepharose.

EFFECT: invention enables to obtain class G, A and M immunoglobulins isolated from the blood of HIV infected patients, capable of selectively splitting HIV integrase only.

7 dwg, 4 ex

 

The invention relates to the field of biochemistry and molecular biology, namely inhibitors of reproduction of the human immunodeficiency virus.

The human immunodeficiency virus (HIV) is the causative agent of one of the most dangerous human diseases acquired immunodeficiency syndrome (AIDS). Retroviruses, which include HIV, cause chronic infection of the human body. During the virus life cycle of its DNA is integrated (included) into the genome of a host cell with the help of a specific enzyme HIV - integrase [Masur H. et. al. N. Engl. J. Med. 1981. V.305. P.1431-1438; Varmus H. Science. 1988. V.240. P.1427-1428]. In this regard, the HIV integrase along with the reverse transcriptase of HIV one of the major drug targets.

Currently, there are many available antiviral drugs that can counteract the infection. These drugs can be divided into three classes, based on viral protein, which is their target, and the way their actions. In particular, the well-known drugs: saquinavir, indinavir, ritonavir, nelfinavir and APV, which are competitive inhibitors of the protease ispartially expressed HIV. Zidovudine, didanosine, stavudine, lamivudine, zalcitabine and abacavir are inhibitors of viral reverse transcriptase, which behave as mimetics is ubstrate, that should stop the synthesis of viral cDNA. Reverse transcriptase inhibitors: nevaripine, delaviridine and efavirenz inhibit the synthesis of viral cDNA through non-competitive (or uncompetitive) mechanism. The use of these drugs is effective to reduce viral replication. The effect is only temporary, because the virus can easily develop resistance to all known agents. Viral resistance is in turn caused by the high speed playback of HIV-1 in the manifestation of infection in combination with a high rate of viral mutation. Under these circumstances, incomplete viral suppression, caused by insufficient activity of medicines, lack of response to the many complex medicines as well as internal pharmacological barriers in the interaction, form a reasonable basis for the search for more effective means. Recently received numerous data suggest that low-level replication continues even when the levels of plasma viral decline below detectable levels (<50 copies/ml) (Carpenter, C.C.J.; Cooper, D.A.; Fischl, M.A.; Garil, J.M.; Gazzard, B.G.; Hammer, S.M.; Hirsch, M. S.; Jacobsen, D.M.; Katzenstein, D.A.; Montaner, J.S.; Richman, D.D.; Saag, M.S.; Schecter, M.; Schoolery, R.T.; Thompson, M.A.; Vella, S.; Yeni, P.G.; Volberding, P.A. JAMA 2000, 283, 381). In this regard, there is a need for new antiviral agents is Oh, target which preferably are other viral enzymes, in order to reduce the coefficient of stability and suppress further viral replication.

HIV expresses three enzymes: reverse transcriptase, aspartame protease and integrase, all of them are potential antiviral targets for development of drugs to treat AIDS. The integrase enzyme responsible for integration of viral cDNA into the genome of a host cell, which is a critical stage in the life cycle of the virus. The reaction of integration-the integration proceeds in several stages, including destruction of the enzyme terminal dinucleotides viral cDNA from each of the 3'-ends and joining the ends of the viral DNA ends cut by the enzyme DNA of the host cell. Studies have shown that in the absence of functional enzyme integrase HIV is not contagious. The HIV integrase is one of the main targets, "off" which directed some therapeutic drugs used to treat HIV-infected patients.

The known compound 4-oxacilin possessing inhibitory activity against HIV integrase (RF Patent No. 2275361, CLS In 215/56, op. 27.04.2006).

Known immunoglobulin G (IgG), gidrolizuemye proteins of the virus envelope gp120 (Paul S. et al. Appl. Biochem. Biotechnol. 2000, V.83, P.71-84) and gp41 (Hifumi E. et al., J. Immunol. Methos, 2002, V.269, P.283-98). However, IgG, cleave gp120, have very low activity, and in the case of gp41-splitting antibody activity is also very low and they are mouse AT, the application of which should lead to the development of the immune response to a foreign protein.

The closest to the claimed inhibitors prototype are natural antibodies active against human immunodeficiency virus (RF Application No. 2003125554, CL SC 16/42, op. 10.02.2005). The claimed pharmaceutical preparation containing human antibodies against the total fraction of immunoglobulin G (IgG) and these human antibodies are obtained by affinity chromatography of serum samples of normal, uninfected human immunodeficiency virus (HIV) individuals using the binding resin, the whole range of human IgG against human IgG of all classes and subclasses that exist in human blood. The claimed pharmaceutical drug can be used for passive immunotherapy of HIV-1, as well as for the prevention or treatment of HIV infections.

A disadvantage of the known inhibitor of reproduction of HIV on the basis of human antibodies against the total fraction of immunoglobulin G (IgG) is their low specificity. This requires the introduction into the body of this medication in an exceedingly high concentration the operations. In addition, these antibodies in the blood are associated not only with IgG antibodies against the viral reverse transcriptase and integrase, but also with all other immunoglobulin G, is performing in the human body a variety of functions, including protective. This should lead to blocking these functions and decrease the resistance of the organism to a variety of harmful internal factors, as well as harmful bacteria, toxins, mutagens and carcinogens that enter the body from the environment.

An object of the invention is to obtain an inhibitor of reproduction of HIV on the basis of natural highly effective and specific classes of immunoglobulins G, a and M, with the ability vysokoizbiratelnoe to interact only with the integrase of HIV and selectively hydrolyze this viral enzyme, depriving it of its ability to interact with viral DNA and catalyze the reaction of integration.

The goal of the project is achieved by the proposed inhibitor based on the immunoglobulin class G (IgG), A (IgA) and M (IgM), with the ability to specifically hydrolyze the HIV integrase and inhibit the reproduction of HIV.

The inventive inhibitor based on the immunoglobulin class G (IgG), A (IgA) and M (IgM) was isolated from the blood of HIV-infected people, they have proteoliticheskogo with unique specificity selectively decompose only the integrase, depriving it of catalytic activity and the ability to integrate HIV DNA into the DNA of the chromatin of the nuclei of human rights. Samples of total immunoglobulins from the blood of HIV-infected patients purified by affinity chromatography on protein-a-sepharose in complete removal of nonspecific related blood components, and then carry out the separation of IgG, IgA and IgM using high-performance gel filtration on Superdex-200.

The homogeneity of the claimed antibodies was confirmed using SDS-gel electrophoresis, and their unique and specific activity in the reaction of hydrolysis of HIV integrase.

The invention is based on the open us to the possibility of efficient solutions in the organisms of HIV-infected patients specific antibodies against viral integrase with proteolytic activity. It is established that a small fraction of IgG, IgA and IgM from the blood of HIV-infected patients with high efficiency hydrolyzing only the HIV integrase with the formation of short protein fragments that do not possess enzymatic activity. Based on the analysis of the implementation of a number of animology criteria found that the ability to hydrolyze the integrase is a private property of these polyclonal IgG, IgA and IgM. Found that polyclonal immunoglobulins in contrast to Kanoni is a mini protease, gidroliznaya any proteins, hydrolyzing only the integrase, but not other proteins of human, animal or HIV. Adding integrase-gidroliznaya Ig in the reaction mixture leads to a strong suppression of the catalytic activity of integrase. Because antibodies against integrase able to not only communicate, but also to hydrolyze the integrase, depriving her of activity, they reduce the likelihood of viral DNA into chromatin to the host cells and thus can slow down and even completely suppress the development of the virus in humans with HIV infection. Given this, the integrase-gidrolizuemye immunoglobulins are promising drugs for the treatment of HIV-inficirovannyh sick.

The unique substrate specificity of the catalytically active immunoglobulins of patients with HIV towards the integrase allows to conclude that in the treatment of such drugs will not be affected immunoglobulins person that performs in the body other various functions.

The invention is illustrated by the following examples.

Example 1. The secretion of IgG, IgA and IgM and the analysis of their homogeneity

Samples of total immunoglobulins (antibodies, AT) from the blood of HIV-infected patients were purified by affinity chromatography on protein-a-sepharose in complete removal of nonspecific related to the components of blood according to known methods (Baranovskii A.G. et al. Immunol. Lett. 2001. V.76. P.163-167; Andrievskaya O.A. et al. Immunol. Lett. 2002. V.81. P.191-198). Then the extraction IgA affinity chromatography on a column of separate containing murine polyclonal antibodies against human IgA (anti-IgA-sepharose), according to the method described for allocation on a protein-a-sepharose. Erwerbende when applied to anti-IgA-sepharose IgG and IgM were separated by high performance gel filtration on Superdex-200.

Separation of IgG and IgM from the blood of patients undergoing a high-performance gel-filtration on a column of Superdex-200 HR 10/30 (100×300 mm) (GC Biocad Sprint, "Pharmacia"), balanced 20 mm Tris-HCl, pH 7.5, containing 0.3 M KCl. Before the gel filtration for the dissociation of complexes 250 μl of a solution AT (~2.5 mg/ml) was mixed with 83 ál of 3 M MgCl2and 166 μl of 3 M NaCl, kept for 30 min, centrifuged (10 min, 10,000 rpm). Before applying the sample to the column missed 2 ml of buffer containing 0.5 M MgCl2and 1 M NaCl, as "salt pillows, and then a solution of Ig. The elution was performed 20 mm Tris-HCl, pH 7.5 (0.2 ml/min). Incubation AT with salts in high concentrations and salt cushion" to ensure an effective separation of proteins.

Figure 1 shows the profile of a high-performance gel filtration of immunoglobulins from the blood of HIV-infected patients on Superdex-200, where I is the immunoglobulin M, II - immunoglobulin g as a sorbent for gel filtration can is t to be used for any other sorbent with separating ability, such a Superdex-200.

Electrophoretic analysis of homogeneity of different proteins, including the claimed antibodies was performed using SDS-electrophoresis on Laemmli [Laemmli U.K. Nature. 1970. V.227(5259). P. 680-685]. Concentrating gel contained 4% acrylamide (AA ratio:bisaa=32:1), 125 mm Tris-HCl, pH 6.8, 0.1% of SDS; separating gel -12%, 15% or gradient (4.5 to 18%) acrylamide, 375 mm Tris-HCl, pH 8.8, 0.1% of SDS. Preparations of proteins (0.5 to 1.0 μg) were incubated in buffer containing 50 mm Tris-HCl, pH 6.8, 1% SDS, 15% glycerol, 0.025% of bromophenol blue at 100°C for 2 min, after which the solution was applied on the gel (0,6×100×150 mm). In the analysis of homogeneity of IgM in buffer was added 0.1% mercaptoethanol (dissociative conditions). The electrophoresis was carried out for 4-5 h at 25°C in buffer: 25 mm Tris-glycine, pH 8.3, 0.1% of SDS at 7-15 mA. Proteins were stained with AgNO3: gel were fixed for 20 min in 20% trichloroacetic acid, then washed with water throughout the night. Then the gel was kept for 30 min in a solution of DTT (4-5 mg/ml DTT, 300 ml of N2O) and 30 min in 0.1% solution of AgNO3(150 ml) in the dark. Then the gel was washed with water 4 times in 10 minutes the Gel showed a 2% solution of Na2CO3containing 0.02% formaldehyde until staining of proteins. Staining was stopped by adding 2%-aqueous solution of CH3COOH (100 ml) for 10 min and washed 2-3 times with water for 10 minutes

Analysis of homogeneity of the preparations by SDS-gel-e is entropies presented in figure 2, where 1 is the protein molecular weight markers; 2 - IgM blood of HIV-infected patients after treatment with 10 mm DTT; 3 - drug IgG blood of HIV-infected patients; 4 - drug IgA blood of HIV-infected patients.

From figure 2 it is seen that the obtained preparations of IgG and IgA were electrophoretic homogeneous, as indicated by the presence of one band with molecular mass of 150 and 170 kDa, respectively. SDS-electrophoretic analysis of IgM fractions was performed in reducing conditions, leading to the identification of two bands with molecular mass of 23 kDa and 70 kDa, which were attributed to the L-chain and H-chain IgM, respectively (figure 2). According to immunoblotting the antibody preparations did not contain impurities of any proteins.

Example 2. Proof facilities by (proteolytic) activity claimed immunoglobulins

One of the most important tasks in the characterization and study of catalytic functions of antibodies is evidence that a chemical reaction kataliziruetsa directly immunoglobulins, and not impurities enzymes. For an unambiguous classification of catalytic activity directly to the immunoglobulins there are a number of strict criteria (Paul et al., Science, 1989, V.244, P.1158-1162; premium G.A., Kanyshkova YEAR, Buneva NR. Biochemistry. 2000. T. S-1487).

The first criterion is the power eroticheska the homogeneity of the preparation AT (figure 2). Another criterion that has been tested, is the preservation of catalytic activity AT their gel filtration in acidic buffer (so-called "pH shock"), which destroys the strong non-covalent complexes. In this regard, electrophoretic homogeneous preparations of IgG, IgA and IgM were subjected to gel filtration. Drugs AT (0.7 to 1.2 mg/ml, 300 μl) were incubated in 50 mm glycine-HCl buffer, pH 2,6 containing 300 mm NaCl for 30 min at room temperature, after which it was subjected to gel filtration on a column of Superdex-200 (volume columns of 23.7 ml, the rate of elution of 0.5 ml/min, FPLC BioCAD Print) in the same buffer. the pH of the collected fractions directly after exiting the column was brought to a value between 7.0 and 7.5 with 1 M Tris-HCl, pH to 9.0. After that, the obtained fractions were dialyzed against 10 mm Tris-HCl, pH 7.5, for 16 h at 4°C.

Figure 3 presents the results of gel filtration of the preparation of IgG from the blood of HIV-infected patients in terms of "acid shock" on Superdex-200 Gly-HCl, pH 2.6, where:

(-) - absorption of the eluate at 280 nm, (-□-) - relative activity (OA) fractions of the eluate in the hydrolysis of integrase (IN), 100% passed the full hydrolysis IN 24 h incubation at 35°C.

After conducting gel filtration was performed determination of the proteolytic activity of antibodies in the reaction of hydrolysis of HIV integrase: the reaction mixture by volume of 20-60 ál contained 0.1 to 1.2 mg/ml of HIV-1 integrase, 50 mm T is IP-HCl, 30 mm NaCl and 0.05-0.2 mg/ml of one of the drugs AT (IgG, IgA or IgM). Samples were incubated for 2.5-24 h at 35°C. Then the reaction products were analyzed by SDS-electrophoresis in 12, 15% or gradient (4-18%) SDS page as described above. The depth of the reaction was assessed by loss of the protein substrate in the source lane or IN the accumulation of hydrolysis products in the experiment compared to control (incubation IN without AT) using computer software Gel-Pro Analyzer version 3.1.

Detection by activity only in the protein peak AT suggests that immunoglobulins, and not to any other proteins in the serum that can potentially interact with AT have by activity.

It was further tested the following criteria - adsorption of active molecules at specific IgG against human (figure 4). Anti-L-Sepharose obtained by immobilization of mouse monoclonal IgG against the light chain of human IgG (0.3 mg AT 0.7 ml resin). Drugs AT (0.2 mg in 1 ml) was applied on the column with anti-L-Sepharose (0.5 ml, 7×15 mm), pre-equilibrated with buffer A (50 mm Tris-HCl, pH 7.5, 150 mm NaCl). Next, the column was washed in the following order: 1 ml of buffer And 1 ml of 20 mm Tris-HCl, pH 7.5, containing 1 M NaCl, and again 1 ml of buffer A. the Fraction AT containing the light chain, was suirable buffer B (20 mm Tris-HCl, pH 2,6, 150 mm NaCl) and immediately after exiting the column neutralise the Wali of 1.5 M Tris-HCl, pH 8.0. Then spent dialysis received IgG fractions for 14 h against 100 volumes of 50 mm Tris-HCl, pH 7.5, 50 mm NaCl, 0.01% Of NaN3(at a temperature of 4°C). The level of proteolytic activity of the obtained fractions was evaluated in the reaction of hydrolysis of si as described above.

4 shows the results of affinity chromatography preparation of IgG from the blood of HIV-infected patients on a column with anti-L-IgG-separate, where: (-) - absorption of the eluate at 280 nm, (-□-) - relative activity (OA) fractions of the eluate in the hydrolysis of si for 100% passed the full hydrolysis IN 24 h of incubation.

From the data of figure 4 shows that the drugs AT quantitatively was barbirollis on sepharose with immobilized AT the mouse against the light chain of human IgG (anti-L-IgG-sepharose), and then loirevalley with sorbent only acidic buffer (pH of 2.6), destructive complexes with antigens AT; profile by activity corresponded to the protein profile AT.

One of the most reliable, objective and sufficient criteria for the inclusion of catalytic activity directly to the immunoglobulins based on the analysis of the enzymatic activity of the protein after SDS-electrophoresis. Because SDS destroys all non-covalent complexes, the implementation of this criterion is almost unequivocally, toiletries activity directly to the immunoglobulins, and not some hypothetical at Esam.

Testing integrase-hydrolysing activity Ig after electrophoresis. After separation of proteins by SDS-page in 4-15%gradient SDS page gel of the control lanes were separated and stained with a solution of Kumasi R-250. To remove SDS gel-experimental tracks were incubated for 1 h in 4 M urea, and then to remove urea gel was rinsed with water (10 times 5-7 min). Then a longitudinal strip of the gel was cut into fragments with a length of 2-3 mm For the elution of proteins from the gel, and renaturation of their activity, the gel was destroyed to very small pieces and incubated in 100 μl of buffer containing 20 mm Tris-HCl, pH 7.5, 5 mm MgCl2, 1 mm EDTA, within 24-48 h at 4°C. After prolonged incubation and periodic shaking on the shaker mixture of small pieces of gel buffer was observed effective elution of the protein; the gel was removed by centrifugation (10 min at 20000 g), a supernatant was separated and aliquots (5-10 μl) was used to determine the relative proteolytic activity as described above.

Figure 5, presents the results of the analysis of catalytic activity of IgG in the blood of HIV-infected patients after SDS-electrophoresis in SDS page. Longitudinal lane of the gel was cut into pieces of 2-3 mm relative activity (OA) integrase was defined in the eluates of these fragments, 100% passed the full hydrolysis of integrase.

the - Data electrophoretic analysis of IgG. Color gel Coomassie G-250.

As can be seen from figure 5, the position of the peak integrase-hydrolysing activity after SDS-electrophoresis corresponds to the position of the protein bands of IgG from the blood of HIV-infected patients.

From the aggregate data obtained show that the ability to hydrolyze the integrase have directly immunoglobulins, and not any impurity proteins, which could potentially savedelete with immunoglobulins. Moreover, the lack of proteolytic activity in Ig preparations obtained from blood of healthy people, indicates that the protease of the blood is not allocated in conjunction with antibodies in the application described in example 1 purification method.

Example 3. Determination of affinity Ig to the integrase and the analysis of their substrate specificity

High substrate specificity can also serve as proof of the lack of selected drugs immunoglobulins any suitesuite proteases, which is another criteria evidence toiletries proteolytic activity directly to the antibody.

Polyclonal Ig specific to different antigens can be divided into separate subfraction having an affinity for a particular substrate by chromatography on affinity sorbents with immobilized substrate [premium GA Kanyshkova YEAR, Boniva NR. Biochemistry. 2000. T. S-1487; Nevinsky G.A., Favorova O.O., Buneva B.N. Protein-protein interactions. A molecular cloning manual (Golemis E., ed.). Cold Spring Harbor Lab. Press. New York. 2002. P.523-534; Nevinsky G.A., Buneva V.N. J. Immunol. Methods. 2002. Vol.269. P.235-249; Buneva V.N., Kanyshkova T.G., A.V. Vlassov, Semenov D.V., Khiimankov D. Yu., Breusova L.R. Nevinsky G.A. Appl. Biochem. Biotechnol. 1998. V.75. P.63-76].

Affinity chromatography of immunoglobulins on integrase-sepharose was performed on a column with integrase-separate (1 ml, 1.5 mg integrase 1 ml resin). AT (1 mg in 1 ml) were applied to the column equilibrated with 50 mm Tris-HCl-buffer, pH 7.5, or the same buffer containing 0.1 M NaCl, and Ig was suirable gradient of NaCl (0.1 To 3 M), and then 2 and 3 M MgCl2in the same buffer and finally with 0.1 M glycine-HCl, pH of 2.6. The obtained fraction was neutralized with 1.5 M Tris-HCl, pH of 9.0, and then were dialyzed against a 100-fold excess of buffer 50 mm Tris-HCl, pH 7.5, and then evaluated their relative activity in the reaction of hydrolysis of integrase. The sorbent was contacted about 15±3% of the total number of polyclonal Ig. To determine the substrate specificity of drugs AT having affinity to the integrase, after chromatography on integrase-sepharose as control proteins used different proteins of humans and animals, as well as the reverse transcriptase OF HIV. The reaction mixture (20 μl) contained 50 mm Tris-HCl, pH 7.5, 30 mm NaCl, 0.2 mg/ml integrase (or 0.3-1 mg/ml of another protein) and 0.1-0.2 mg/ml AT. As an alternative substrates IP who was oltvai: albumin, lactoferrin, casein person, lactalbumin cows FROM HIV-1 and other proteins. The reaction mixture is in each case incubated overnight at 35°C, after which the reaction products were analyzed by SDS-electrophoresis in 15% or 4-18%SDS page as described above.

Figure 6 presents the results of SDS-electrophoretic analysis of the products of hydrolysis of different protein substrates by immunoglobulin G blood of HIV-infected patients in a gradient of 4.5-15% SDS page (AT purified on integrase-sepharose, odd tracks - in the absence, even in the presence of AT). A-integrase of HIV-1: tracks 1 and 2; B - 1 and 2 - human serum albumin, 3 and 4 - human lactoferrin, 5 and 6 - bovine serum albumin, 7 and 8 protein markers with known mole. weight, which is shown by arrows; 1 and 2 FROM HIV-1, 3, and 4 - human milk casein and lysozyme, 5 and 6 - egg lysozyme. Color gel AgNO3. Some proteins (lanes 1 and 2; 1, 2, 5, 6, B) were represented by their monomers and oligomeric forms or contained minor bands other extrinsic proteins (lanes 3, 4), which are also not subjected to appreciable hydrolysis.

From the above data it is seen that the preparations of immunoglobulins effectively hydrolyzed only the HIV integrase with the formation of small protein fragments that do not possess enzymatic activity.

The absence of al-chief of the independent hydrolysis of a large number of used control proteins can serve as proof of the lack of selected drugs immunoglobulins any suitesuite canonical proteases.

Example 4

The ability of the stated classes of immunoglobulins G, a and M to inhibit the reproduction of human immunodeficiency virus shown, for example, inhibition of the integrase-dependent reaction of 3'-processing and response integration.

The HIV integrase catalyzes two reactions. First, it is in the cytoplasm of human cells it from specific viral DNA end-GT-dinucleotides (reaction 3'-processing), and then after penetration of the integrase complex with specific DNA through the membrane into the cell nucleus catalyzes the incorporation of viral DNA into human cells (reaction of integration). For the reaction of 3'-processing usually use a 21-gauge double-stranded oligonucleotide in which one of the circuits contains 5'-[32P]labeled phosphate ([32P]GTGTGGAAAATCTCTAGCAGT). About the efficiency of the reaction of 3'-processing is judged by the formation of shorter 19-dimensional oligonucleotide ([32P]GTGTGGAAAATCTCTAGCA), devoid of end-GT-dinucleotide that during electrophoresis has more mobility than the original 21-dimensional oligonucleotide. In turn, the 19-dimensional oligonucleotide is used to analyze the reaction of integration. Integrase binds the nucleotide as included in the DNA substrate, and the DNA target, which includes this substrate. Since the inclusion of the oligonucleotide substrate in DNA is ishani occurs with rupture of the latter in different parts of the nucleotide sequence, it is usually observed the formation of a large number of different products which are longer than the original 19-dimensional oligonucleotide, which have a lower electrophoretic mobility. For inhibition of the integrase-dependent reaction of 3'-processing following the decline in the relative number of 19-dimensional [32R]of the oligonucleotide, and for the suppression of the reaction of integration to reduce the relative amount of [32R]oligonucleotides with mobility, less than the original 19-dimensional [32R]of the oligonucleotide.

The reaction mixture (10-20 ál) to determine the efficacy of inhibition of the integrase-dependent reactions of 3'-processing and integration of the immunoglobulin classes G, a and M from the blood of HIV-infected patients contained the following standard components: 20 mm Hepes (pH 7.5), 10 mm dithiothreitol, 0.1 mm ethylenediaminetetraacetic acid, 4 mm NaCl, 7.5 mm MnCl2, 0.05% non-ionic detergent NP 40. As the substrate in the reaction of 3'-processing used 1.5 nm double-stranded 21-dimensional oligonucleotide (5'-[32P]GTGTGGAAAATCTCTAGCAGT), and to analyze the reaction of integration of double-stranded 19-dimensional oligonucleotide (5'-[32P]GTGTGGAAAATCTCTAGCA) (Bugreev DV, Baranova S.V., Zakharova O.D., et al., Biochemistry. 2003. V.42. P.9235-9247; Lesbats P, Métifiot M, Calmels C, et al., Nucleic Acids Res. 2008, V.36. P.7043-7058). The reaction mixtures were incubated for 30-60 min at 37°C in the presence of 40 nm integrase of HIV in the absence or in the presence of 0.5-5.0 µm IgG, IgA and IgM. The reaction products of 3'-processing were analyzed by electrophoresis in 1.2%, and the reaction integration 15% polyacrylamide gel in the presence of 7 M urea in Tris-borate buffer and then radioautography gels. About the inhibition of the reaction of 3'-processing to be judged by the reduction of radioactive material in the band corresponding to the 19-dimensional oligonucleotide, and the reaction of integration in the bands above that of the oligonucleotide.

On figa presents the results of electrophoretic analysis of inhibition of the reaction of 3'-processing (education 19-dimensional [32R]of the oligonucleotide in the presence of IgM, figb the results of suppressing the formation of products integration in the presence of IgG from the blood of HIV-infected patients (AT purified on integrase-sepharose). Track To meet [32P]substrates, incubated in the absence of integrase, track 1 - in the presence of 40 nm integrase. On figa tracks 2-4 correspond to the reaction in the presence of IgM in different concentrations: 0,02, of 0.03 and 0.04 μm, respectively. Track 2 on figb in the presence of 40 nm integrase and 0.03 μm IgG.

As can be seen from Fig.7, the claimed immunoglobulin classes G, a and M are almost completely inhibit the reaction of 3'-processing and response integration.

Thus found that the blood of HIV-infected patients contains not described the wound is catalytically active IgG, IgA and IgM, which in contrast to the canonical proteases capable of selectively cleave only the integrase, depriving it of catalytic activity and the ability to integrate HIV DNA into the DNA of the chromatin of the nuclei of human rights. The inventive immunoglobulin class G (IgG), A (IgA) and M (IgM), with the ability to specifically hydrolyze only the HIV integrase and inhibit the reproduction of HIV, are potentially promising for use in anti-HIV therapy.

The drug selectively cleave the HIV integrase and consisting of classes of immunoglobulins G, a and M, isolated from the blood of HIV-infected patients by affinity chromatography on a column with integrase-separate.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention refers to virus inactivation in production of immunoglobulins, particularly of G fraction. The method virus inactivation for production of G fraction immunoglobulin includes purification of dissolved immunoglobulin recovered by Kohn's spirit fractionation. Purified dissolved immunoglobulin is prepared with a solvent detergent mixture which is acetate buffer solution 0.05 M at pH 5.5, containing 1 wt % tri-n-butylphosphate and 1 wt % polysorbate 80. Preparation represents stirring of the mixture within 12-16 hours followed with dilution with acetate buffer solution 0.05 M at pH 5.5 containing 1 wt % sodium octanoate, sodium chloride 0.15 M and propylene glycol concentrated 0.2 g/l. Prepared immunoglobulin is immobilised on sulphoprolylcation sorbent with grain size 50 mcm and sorption capacity 55 mg/cm3, and two-stage washed by column chromatography followed with elution. The first stage of washing implies acetate buffer solution 0.05 M at pH 5.5 containing 1 wt % sodium octanoate, sodium chloride 0.15 M and propylene glycol concentrated 0.2 g/l. The second stage of washing applies acetate buffer solution 0.05 M at pH 5.5. At the first stage the product is washed with volume related to 5 volumes of sorbent, while at the second stage washing is performed with volume related to three volumes of sorbent.

EFFECT: invention provides high-effective virus inactivation that improves viral safety of immunoglobulin preparations.

3 cl, 7 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to manufacturing of medical products. There is disclosed method for producing immunoglobulin G that involves ethanol fractionation of donor plasma to make sediment B and purification of prepared immunoglobulin. The sediment B is dissolved in 0.9% saline pH 5.15 and mixed with acetate buffer solution 2 M and 53% ethanol, and centrifugated. Centrifugate is mixed with sodium hydrocarbonate at solution pH 5.5. After centrifugation, the centrifugate is purified, mixed with acetate buffer solution at pH 5.4, 96% (vol/vol) ethanol and sodium bicarbonate at pH 7.2, centrifugated at minus (10-12)°C. The recovered sediment is dissolved in acetate buffer solution 0.05 M at pH 5.5, added with solvent detergent mixture containing acetate buffer solution 0.05 M at pH 5.5, and 1 wt % tri-n-butylphosphate and 1 wt % polysorbate 80. The mixture is stirred, then diluted with acetate buffer solution 0.05 M at pH 5.5 containing 1 wt % sodium octanoate, sodium chloride 0.15 M and propylene glycol concentrated 0.2 g/l. Immunoglobulin processed in such a way is immobilised and two-stage washed on sulphoprolylcation sorbent by column chromatography followed with elution, ultrafiltration and sterilisation filtration.

EFFECT: invention provides high-degree purification of immunoglobulin G, absence of viruses and stability of ready preparation.

3 cl, 2 ex

FIELD: medicine.

SUBSTANCE: invention concerns medicine and biotechnology, and method of obtaining immunoglobulin medicines. Method of obtaining immunoglobulin medicines involves a sequential processing of alcohol sediment B (Cohn III fraction) by tenfold volume of 0.9% sodium chloride solution and by chloroform in 0.1%-3.0% end concentration, centrifugation, addition of copper sulfate to centrifugate at pH 6-8, sediment removal by centrifugation, and further extraction of target product by ultrafiltration method in the presence of complex-forming compounds, product stabilisation, clearing and stabilising filtration. Copper sulfate is taken in 0.003-0.03% concentration.

EFFECT: increased content of separated immunoglobulin A fraction, improved product quality.

3 ex

FIELD: medicine.

SUBSTANCE: group of inventions concerns medicine, in particular, to immunology, and can be used for immunotherapy and immunologic prophylaxis of bacteriemic and virus diseases. The base for immunobiological preparations is offered; it contains IgG, IgM and IgA, and also subclasses IgG, IgG1, IgG2, TgG3 and IgG4, thus the content of immunoglobulins makes: IgG 70-80%, IgM 10-15% and IgA 10-15%. The way of reception of immunoglobulin marker base for immunobiological preparations is offered. Suppositories and ointment for prevention and therapy of bacteriemic and virus diseases are offered.

EFFECT: development of an economic and effective way of processing of a deposit A (II+III according Cohn), allowing to receive highly effective paste for immunoglobulin marker preparations.

4 cl, 5 ex, 2 tbl, 2 dwg

FIELD: technological processes; pharmacology.

SUBSTANCE: method is implemented in the following manner: pH of initial solution is brought to 4.6-4.95, and caprilat- and/or heptanoate-ions are added to it, while pH is maintained at the level of 4.8-4.95. Supernatant solution is incubated under conditions, at which concentration of caprilat- and/or heptanoate-ions makes 10-30 mM. Filtered solution is applied on anion-exchanging resin, under conditions that provide binding of contaminating admixtures with resin in the absence of considerable binding of antibodies with resin.

EFFECT: method makes it possible to produce preparation of antibody that is purified, virologically safe and inactivated from virological point of view.

22 cl, 2 dwg, 2 tbl, 3 ex

FIELD: medicine, biotechnology.

SUBSTANCE: invention proposes variants of antibodies showing specificity to peptide domain located by both side of hinged site R76S77 in pro-BNP(1-108). Indicated antibodies recognize specifically also circulating pro-BNP(1-108) in human serum or plasma samples but they don't recognize practically peptides BNP(1-76) or BNP(77-108). Also, invention describes variants of peptides used in preparing antibodies. Amino acid sequence is given in the invention description. Also, invention discloses methods for preparing indicated antibodies and among of them by using indicated peptides. Also, invention describes methods for preparing antibody-secreting hybridoma, and hybridoma is disclosed prepared by indicated method. Also, invention describes a monoclonal antibody secreted by hybridoma 3D4 and deposited at number CNCM I-3073. Also, invention discloses variants for diagnosis of cardiac insufficiency in vitro and by using antibodies proposed by the invention. Also, invention describes a set used for detecting pro-BNP(1-108) in a biological sample. Using this invention simplifies detection of pro-BNP(1-108) circulating in human serum or plasma samples and provides specific detection of pro-BNP(1-108) that can be used in early diagnosis of human cardiac insufficiency.

EFFECT: valuable medicinal properties of antibodies.

24 cl, 16 dwg, 5 tbl, 20 ex

FIELD: biochemical engineering; medicine.

SUBSTANCE: method involves producing immunoglobulin preparation by concentrating III Kohn spirit method fractions by means of ultrafiltration under рН 3.5-5.0 condition, washing from ethanol and carrying out final solution concentration process. The subsequent restoration hydrate immunoglobulin envelopes is carried out by means of molecular filtration method by creating concentration gradient by introducing low-molecular substance in concentration of 0.1-2.5% by weight into immunoglobulin solution, with water of рН 3.8-4.5 being used, cleared from dialyzing solution. Then stabilizing agent is added and рН value is fixed at 3.5-5.0. Sterilizing filtration is carried out and the produced preparation is dried by subliming when needed at the final stage of refinement process. The so produced immunoglobulin preparation for making intravenous injections has solution transparency index less than 0.01, and contains monomer immunoglobulin IgG more than 97% under full absence of polymeric forms, proteins 4.5-11% and sodium chloride no more than 0.3%.

EFFECT: reduced risk of side reactions when administering the immunoglobulin preparation; mechanically aided and automated process of preparation production; prolonged storage period.

5 cl, 1 dwg, 2 tbl

FIELD: medicine, preparative immunology.

SUBSTANCE: invention relates to a method for preparing IgG (immunoglobulin G) from blood plasma for medicinal using. Method involves the following steps: (1') removal of albumin with preparing IgG fraction followed by carrying out step (I) wherein IgG fraction prepared at stage (1') is concentrated; (2') this IgG fraction is purified on anion-exchange resin and unbound IgG fraction is collected; (3') this unbound IgG fraction is purified on cation-exchange resin and bound IgG fraction is collected and step (II) is carried out wherein pH value of IgG fraction eluted from cation-exchange resin at step (3') is brought about to 4 ± 0.1 and during all steps of the method pH value is maintained less 6.0; (4') virus in IgG fraction prepared from IgG fraction collected at step (3') is inactivated by using chemical reagents at temperature 30° ± 2°C for at least 4 h. Method provides preparing IgG that possesses anti-complementary activity less 1 titer value of complement providing 50% hemolysis (CH50)/mg of immunoglobulin.

EFFECT: improved preparing method.

7 cl, 1 dwg, 2 ex

The invention relates to veterinary medicine, in particular to methods for treating dyspepsia newborn calves

The invention relates to a method of purification of immunoglobulin G from containing the immunoglobulin protein fractions of crude plasma

Amide derivatives // 2396259

FIELD: chemistry.

SUBSTANCE: claimed invention relates to compound of formula I where m equals 0 or 1; R1 represents halogeno, (C1-6)alkyl, (C1-6)alkoxy, amino-(C2-6)alkoxy, (C2-6)alkylamino-(C2-6)alkoxy, di-[(C1-6)alkyl]amino-(C2-6)alkoxy, (C1-6)alkoxy-(C2-6)alkoxy, carbamoyl-(C1-6)alkoxy, N-(C1-6)alkylcarbamoyl-(C1-6)alkoxy, amino-(C1-6)alkyl, (C1-6)alkylamino-(C1-6)alkyl, di(C1-6)alkyl]amino-(C1-6)alkyl, carbamoyl-(C1-6)alkyl, N-(C1-6)alkylcarbamoyl-(C1-6)alkyl, (C1-6)alkoxy-(C2-6)alkylamino, heteroaryloxy, heterocyclyl-(C1-6)alkyl, heterocyclyloxy or heterocyclyl-(C1-6)alkoxy, and where any heteroaryl or heterocyclyl group in substituent R1 probably can have 1 or 2 substituents, selected from hydroxy, halogeno, (C1-6)alkyl, (C1-6)alkoxy, (C2-6)alkanoyl, hydroxy-(C1-6)alkyl, (C1-6)alkoxy-(C1-6)alkyl, and where any of determined above R1 substituents, which contains CH2 group bound with 2 carbon atoms, or group CH3, bound with an atom of carbon or nitrogen, probably can have on each said CH2 or CH3 group one or more substituents, selected from halogeno, hydroxy, amino, oxo, (C1-6)alkyl, (C2-6)alkenyl, (C2-6)alkinyl,. (C3-6)cycloalkyl, (C3-6)cycloalkoxy, (C1-6)alkoxy, (C1-6)alkoxy-(C1-6)alkyl, (C1-6)alkylsulphamoyl, heteroaryl, heteroaryl-(C1-6)alkyl and heterocyclyl, and where any heterocyclyl group in substituent R1 probably can have 1 or 2 oxo or tioxo substituents; R2 represents (C1-6)alkyl; R3 represents hydrogen; R4 represents (C3-6)cycloalkyl, (C1-6)alkyl or heteroaryl, and R4 probably can be substituted with one or more substituents, selected from halogeno, (C1-6)alkyl, (C1-6)alkoxy; and R5 represents hydrogen, halogeno or (C1-6)alkyl; or its pharmaceutically acceptable salt, to method of obtaining said compounds, to pharmaceutical composition for application in treatment of diseases mediated by based on them cytokines. Invention also relates to methods of inhibiting p38α-kinase enzymes, TNFα production and production of cytokines.

EFFECT: obtained and described are novel compounds, which can be applied in treatment of medical conditions mediated by cytokines.

14 cl, 31 ex, 9 tbl

FIELD: chemistry.

SUBSTANCE: invention describes a compound of formula I or its pharmaceutically acceptable salt , where R, R9, Z, X, Q and Y are defined in the formula of invention. The compounds are chemokine receptor 2 and chemokine receptor 5 antagonists and can be used as a medicinal agent for preventing, relieving or treating autoimmune or inflammatory diseases or conditions.

EFFECT: obtaining a formula (I) compound, a pharmaceutical composition based on the formula (I) compound, use of the compound in paragraph 1 to prepare a medicinal agent for treating an autoimmune or inflammatory disease or condition, as well as use of the compound in paragraph 1 to prepare a medicinal agent for treating HIV infection or AIDS.

11 cl, 181 ex

FIELD: chemistry.

SUBSTANCE: invention relates to compounds of formula I and their pharmaceutically acceptable salts. In formula I R1 is a halide, (C1-C6)alkyl or (C1-C6)alkoxy group; R2 is hydrogen; R3 is phenyl, substituted with one or two substitutes independently selected from a group comprising halide(C1-C6)alkyl, halide and a cyano group; R4 is CH2OH, CH2OC(=O)(CH2)2C(=O)OH or CH2OC(=O)(C1-C6)alkyl; R5 is (C1-C6)alkyl. The invention also relates to use of the compounds to make a medicinal agent, to a pharmaceutical composition containing a therapeutically effective amount of the compound and to a method of obtaining formula I compounds.

EFFECT: obtaining compounds with HIV reverse transcriptase inhibiting properties.

9 cl, 2 tbl,11 ex

FIELD: chemistry.

SUBSTANCE: invention pertains to biotechnology. Described is an anti-HIV monoclonal antibody or its functional fragment which has in the variable region of the H-(heavy) chain regions which determine complementarity, CDR1, CDR2 and CDR3, which have sequences given in the description, and CDR1, CDR2 and CDR3 regions with sequences given in the description in the variable region of the L-(light) chain. Expression vectors which code fragments of the heavy and light chain of the described antibody and host cells which are transformed by the said vectors are disclosed. A method for detecting the HIV strain and a method for individual passive immunotherapy are disclosed.

EFFECT: invention enables to obtain an antibody which enables neutralisation of HIV infection without an autoimmune side effect.

17 cl, 9 dwg, 2 tbl, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to medicine and aims at HIV-infection treatment. That is ensured by introduction of a T-cell depletor which effectively disintegrates all T-cells of the patient. Said depletor is a CD52 monoclonal antibody Alemtuzumab.

EFFECT: invention allows suppressing the immune system by the controlled method.

8 cl, 2 ex, 2 dwg

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to biochemistry and specifically to a modified polypeptide of a HIV-1 gp41 envelope glycoprotein, a polynucleotide which codes the modified polypeptide and an expression vector which contains a coding modified polypeptide of the HIV-1 gp41 envelope glycoprotein. The modified polypeptide of the HIV-1 gp41 envelope glycoprotein contains an amino acid sequence SEQ ID NO: 1 or SEQ ID NO: 14, where the sequence between positions 603 and 615 or 598 and 622 SEQ ID NO: 1 or the sequence between positions 530 and 542 or 525 and 549 SEQ ID NO: 14 is replaced by a linker fragment which is an oligopeptide SEQ ID NO: 2.

EFFECT: improved solubility of a modified polypeptide of the HIV-1 gp41 envelope glycoprotein without changing its immunogenic reactivity.

10 cl, 8 dwg, 1 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to new compounds of formula , to their salts, where R1 and R2 each independently is hydrogen or C1-10alkyl which can be optionally substituted with substitutes selected from a group comprising a hydroxyl group, NR4R5, pyrrolidinyl, piperidinyl, morpholinyl; R3 is a radical of formula , where n equals 1; R3a is nitro; X is -NR7 - or -O-; R4 and R5 each independently is C1-6alkyl; R7 is hydrogen, C1-6alkyl, optionally substituted with pyrrolidinyl. The invention also pertains to use of the compounds, to a pharmaceutical composition, to a method of preparing the pharmaceutical composition, as well as to a method of obtaining the chemical compound in any of paragraphs 1-3.

EFFECT: obtaining new biologically active compounds with antiviral activity.

7 cl, 4 ex, 2 tbl

FIELD: chemistry.

SUBSTANCE: present invention relates to novel compounds of formula , where X is -O-; values of Ar, R1-R5, R11 are given in the formula of invention. The said compounds have inhibitory effect on HIV reverse transcriptase. The invention also relates to a pharmaceutical composition containing the invented compounds or their pharmaceutically acceptable salts.

EFFECT: obtaining new compounds and a pharmaceutical composition containing said compounds.

8 cl, 61 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: there are described salts of 3-O-(3',3'-dimethylsuccinyl) betulinic acid (DSB). Particularly, there is disclosed production process, pharmaceutical estimation and bioavailability estimation in vivo of N-methyl-D-glucamine salt and alkali salt. The pharmaceutical compositions containing these salt forms are used in methods of treating HIV infection and related diseases. There is also described method for preparing DBS salts.

EFFECT: improved clinical effectiveness.

12 cl, 5 ex, 5 tbl

FIELD: chemistry.

SUBSTANCE: invention relates to a method of producing HIV protease inhibitor atazanavir sulphate in form of Form A crystals, which involves reacting a solution of a free base of atazanavir in an organic solvent in which atazanavir sulphate is virtually insoluble, at temperature ranging from 35°C to 55°C with a first portion of concentrated sulphuric acid in an amount sufficient for reaction with less than approximately 15 wt % free base of atazanavir, addition of nucleating centres of Form A atazanavir sulphate crystals, addition of an additional amount of concentrated sulphuric acid in several steps, where the acid is added at increasing rate to form atazanavir sulphate crystals and drying the atazanavir sulphate to form Form A crystals. A method of producing atazanavir sulphate in form of Form C crystals is also proposed.

EFFECT: improved method.

20 cl, 11 dwg, 6 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention pertains to biotechnology. Described is an anti-HIV monoclonal antibody or its functional fragment which has in the variable region of the H-(heavy) chain regions which determine complementarity, CDR1, CDR2 and CDR3, which have sequences given in the description, and CDR1, CDR2 and CDR3 regions with sequences given in the description in the variable region of the L-(light) chain. Expression vectors which code fragments of the heavy and light chain of the described antibody and host cells which are transformed by the said vectors are disclosed. A method for detecting the HIV strain and a method for individual passive immunotherapy are disclosed.

EFFECT: invention enables to obtain an antibody which enables neutralisation of HIV infection without an autoimmune side effect.

17 cl, 9 dwg, 2 tbl, 6 ex

Up!