T cell adhesion molecule and antibody against said molecule

FIELD: chemistry; biochemistry.

SUBSTANCE: invention pertains to biotechnology. The invention describes an antibody which specifically identifies a membrane or secretory protein selected from several proteins with sequences given in the application materials, or functional fragment thereof. The invention discloses a hybridoma which produces the said antibody and is deposited under inventory No. FERM BP-10376. A medicinal agent used in an autoimmune disease and which contains the described antibody or its functional fragment as an active ingredient is proposed. Described also, is a T cell adhesion inhibiting agent which contains the described antibody or its functional fragment as an active ingredient. The invention discloses a method of screening a substance which inhibits dendritic cell activation, or its salts or solvate involving the following steps: bringing the said antibody or its functional fragment into contact with a dendritic cell in the presence or absence of the substance under test and measuring the activation level of the said dendritic cell.

EFFECT: invention widens the range of agents for treating rheumatoid arthritis.

18 cl, 24 dwg, 12 ex

 

Description

TECHNICAL AREA

The present invention relates to the adhesion molecule T-cells, which is expressed on dendritic cells derived from bone marrow, and its gene, and the ligand for adhesion molecules (receptor), which is expressed on T-cells, and its gene. The present invention also relates to antibodies against adhesion molecules or ligand and their application. Moreover, the present invention also relates to a method of screening using adhesion molecules.

The LEVEL of TECHNOLOGY

In recent years it was reported that the molecule is cloned as an activator of dendritic cells, which is expressed on T-cells, is a key cytokine for the regulation of the differentiation of osteoclasts (Yasuda, H., et al. (1998) Proc Natl Acad Sci USA 95:3597-3602). Thus, it has become clear that the immune system is closely associated with bone metabolism.

Studies of the regulation of bone metabolism by molecules that regulate the immune system, rapidly and signal transmission associated with the regulation of the differentiation of osteoclasts, became apparent.

For example, as molecules involved in the differentiation of osteoclasts, became famous Oscar (associated with osteoclasts receptor). To date, there is evidence that Oscar is immunoglobulinovi receptor is, which is associated with the FcRγ chain and transmits a signal to the phospholipase Cγ by the ITAM motif of the FcRγ chain (Kim, N., et al. (2002) J Exp Med 195:201-209).

In addition, it was reported about the various interactions, such as CD80-CD28, CD40-CD40L or ICAM1-LFA1, for molecules that are expressed on dendritic cells and bind to T cells, thus being involved in the interaction between T-cells and dendritic cells associated with the immune response.

The INVENTION

The authors of the present invention by way of subtracting the identified gene that is specifically expressed on dendritic cells derived from bone marrow. Also, the authors of the present invention have found that the protein encoded by the above gene, is associated with the FcRγ chain, a component of the receptor for IgE, which is the expression of the above-mentioned protein enhances stimulation with LPS that dendritic cells are activated by cross-stimulation of antibodies to the aforementioned squirrel that the above-mentioned protein has the function of binding to T-cells and antibodies against the above-mentioned protein therapeutic effect on the model of collagen-induced arthritis, which is a model of rheumatoid arthritis. The authors present invention further identified ligand gene for said protein, calorieconscious on T-cells. The present invention is based on these discoveries.

The present invention relates to a membrane or secretory protein containing the amino acid sequence of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 or SEQ ID No. 8, or the amino acid sequence of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 or SEQ ID No. 8, which contains one or more conservative substitutions (hereinafter designated as a new protein of the first variant of implementation according to the present invention).

The present invention relates to a membrane or secretory protein, selected from the following (i), (ii), (iii) and (iv) (hereinafter identified as a novel protein of the second variant of implementation according to the present invention):

(i) membrane or secretory protein containing the amino acid sequence of SEQ ID No. 10;

(ii) membrane or secretory protein that contains the amino acid sequence of SEQ ID No. 10, in which one or more amino acids are inserted, substituted or deleted, or one or more amino acids are added to one or both ends, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 10;

(iii) membrane or secretory protein that is encoded by polynucleotides that hybridizes in harsh environments with polynucleotide that encodes amino acid placentas is the activity of SEQ ID No. 10, and which is functionally equivalent to the protein, consisting of amino acid sequence SEQ ID No. 10; and

(iv) membrane or secretory protein that contains an amino acid sequence having 90% or higher identity with the amino acid sequence SEQ ID No. 10, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 10.

The present invention relates to polynucleotide, codereuse new proteins of the first and second embodiments according to the present invention.

The present invention also relates to polynucleotide selected from the following (v), (vi), (vii) and (viii):

(v) polynucleotide containing the nucleotide sequence of SEQ ID No. 9;

(vi) polynucleotide, which contains the nucleotide sequence of SEQ ID No. 9, in which one or more nucleotides are inserted, substituted or deleted, or one or more nucleotides are added to one or both ends, and which encodes a membrane or secretory protein, is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 10;

(vii) polynucleotide that hybridizes in harsh environments with polynucleotide containing the nucleotide sequence of SEQ ID No. 9 and which encodes a membrane or secretory protein, is functionally equivalent to a protein consisting of aminokislot the th sequence SEQ ID No. 10; and

(viii) polynucleotide, which has 90% or greater identity with polynucleotides containing the nucleotide sequence of SEQ ID No. 9, and which encodes a membrane or secretory protein, is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 10.

The present invention also relates to antibodies against membrane or secretory proteins, selected from the following (ix), (x), (xi) and (xii) (hereinafter sometimes designated as protein TARM (interacts with T-cell activating receptor on myeloid cells), and their functional fragment (hereinafter designated as the antibodies of the first variant of implementation according to the present invention):

(ix) membrane or secretory protein containing the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12;

(x) a membrane or secretory protein that contains the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, in which one or more amino acids are inserted, substituted or deleted, or one or more amino acids are added to one or both ends, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12;

(xi) membrane or secretory Bel is to, which is encoded by polynucleotides that hybridizes in harsh environments with polynucleotide that encodes amino acid sequence SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12; and

(xii) membrane or secretory protein that contains an amino acid sequence having 70% or more identity with the amino acid sequence SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12.

The present invention relates to a new protein ligand, which is a ligand for a new protein according to the present invention, which is selected from the following (xiii), (xiv), (xv) and (xvi) (hereinafter sometimes referred to as a new protein ligand according to the present invention or the protein TARM-L (ligand TARM)):

(xiii) a protein containing the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 16;

(xiv) a protein that contains the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 16, in which one or more amino acids are inserted, substituted or deleted, or one or more amino acids EXT is go to one or both ends, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 16;

(xv) a protein that is encoded by polynucleotides that hybridizes in harsh environments with polynucleotide that encodes amino acid sequence SEQ ID No. 14 or SEQ ID No. 16, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 16; and

(xvi) a protein that contains an amino acid sequence having 70% or more identity with the amino acid sequence SEQ ID No. 14 or SEQ ID No. 16, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 16.

The present invention relates to polynucleotide, codereuse new protein ligand according to the present invention.

The present invention also relates to polynucleotide selected from the following (xvii), (xviii), (xix) and (xx):

(xvii) polynucleotide containing the nucleotide sequence SEQ ID No. 13 or SEQ ID No. 15;

(xviii) polynucleotide, which contains the nucleotide sequence SEQ ID No. 13 or SEQ ID No. 15, in which one or more nucleotides are inserted, substituted or deleted, or one or more nucleotides are added to one or both ends, and which encodes a protein functionally equivalent to the protein, consisting of amino acid sequence SEQ ID No. 14 or SEQ ID No. 16;

(xix) polynucleotide that hybridizes in harsh environments with polynucleotide containing the nucleotide sequence SEQ ID No. 13 or SEQ ID No. 15, and which encodes a protein functionally equivalent to the protein consisting of the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 16; and

(xx) polynucleotide, which has 70% or greater identity with polynucleotides containing the nucleotide sequence SEQ ID No. 13 or SEQ ID No. 15, and which encodes a protein functionally equivalent to the protein consisting of the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 16.

The present invention relates to antibodies against the new protein ligand according to the present invention and their functional fragment (hereinafter designated as the antibody of the second variant of implementation according to the present invention).

The present invention relates to a medicinal product in autoimmune diseases and the means for inhibiting the adhesion of T-cells, containing as active ingredient the antibody of the first and second embodiments according to the present invention (hereinafter, both types of antibodies can be described as "antibody according to the present invention"), or their functional fragments.

Nastoyascheevremya applies to the following screening methods.

According to the method of screening according to the first embodiment of the implement according to the present invention, a method of screening the substance or its salt, or its MES, which inhibits the adhesion of T cells to protein TARM, which involves the following stages:

(a) contacting the T cells with the protein TARM in the presence or in the absence of a test substance; and

(b) measuring the binding activity of T-cells with the indicated protein TARM.

According to the method of screening according to the second variant of implementation according to the present invention, a method of screening the substance or its salt, or its MES, which inhibits the activation of dendritic cells, which involves the following stages:

(d) contacting the antibody or functional fragment according to the present invention with dendritic cells in the presence or in the absence of a test substance; and

(e) measuring the level of activation of the specified dendritic cells.

According to the method of screening according to the third variant of implementation according to the present invention, a method of screening the substance or its salt, or its MES, which inhibits formation of a complex between the protein TARM and FcRγ chain, which involves the following stages:

(g) contacting the antibody or functional fragment according to the present invention with dendritic cells in the presence or in the absence of a TEC is dummy substances; and

(h) measuring the level of expression of FcRγ chain in the specified dendritic cell.

BRIEF DESCRIPTION of DRAWINGS

Figure 1 shows the amino acid sequences of genes TARM mouse (m1-m4 s1), where the underlining indicates the area of the loop structure of immunoglobulin (IG), and bold font indicates the transmembrane region.

Figure 2 presents the results obtained by the analysis of mRNA expression TARM in mouse tissues using real-time PCR using primer set 1.

Figure 3 presents the results obtained by the analysis of mRNA expression TARM in different types of cells using real-time PCR using primer set 1.

On figa presents the structure and the number of amino acid extracellular region, is used to obtain antibodies anti-TARM. On FIGU presents the results obtained when studying the specificity of the above-mentioned antibodies to protein TARM.

Figure 5 presents the results obtained by analysis of protein expression by mouse dendritic cells derived from bone marrow.

Figure 6 presents the results obtained by analysis of protein expression of the mouse on the cells derived from the normal immune tissues of the mouse.

Figure 7 presents the results obtained by analysis of the expression of the protein of the mouse c-kit-positive peritoneal fat cell is.

On Fig presents the results obtained by analysis of gene protein TARM mouse in the cells of the lymph nodes of the mouse using inflammatory stimulation by LPS, where the arrows indicate the expression of protein TARM mouse.

On figa presents the induction of production of IL-6 Mature dendritic cells from bone marrow by stimulation with antibodies anti-TARM. On FIGU presents the induction of the production of MCP-1 immature dendritic cells from the bone marrow by stimulation with antibodies anti-TARM.

Figure 10 presents the increase in the number of FcRγ chain associated with increases in the expression of protein TARM mouse on the cell surface.

Figure 11 presents the results obtained by the analysis of complex formation between protein TARM mouse and FcRγ chain using the method thus.

On Fig presents the results obtained by analysis of the expression of molecules that bind to the protein TARM mouse on activated T-cells.

On Fig presents the ability of activated T-cells to communicate with protein TARM mouse.

On Fig presents the inhibition of adhesion of cells to Th2 squirrel TARM mice using antibodies to TARM mouse.

On Fig presents external indicators and changes in body weight over time in model animal for collagen-induced arthritis, which was administered antibodies TARM mouse.

N is Fig presents the effect of introducing antibodies to TARM mouse animal model for collagen-induced arthritis in concentrations of serum amyloid A in the plasma.

On Fig presents the effect of introducing antibodies to TARM mouse animal model for collagen-induced arthritis in the titers of antibodies to collagen in the plasma.

On Fig presents the results obtained by the analysis of mRNA expression of protein TARM in human tissues using real-time PCR.

On Fig presents the amino acid sequence of the protein TARM person, where the underline indicates the area of the loop structure of immunoglobulin (Ig), bold indicates the transmembrane region and circled part indicates sequences that differ between hTARM and LOC441864.

On Fig presents the ability of activated T-cells to communicate with protein TARM person and inhibition of adhesion of T cells to protein TARM person using antibodies to TARM person.

On figa presents the results obtained by analysis of the expression of molecules that bind to the protein TARM mouse cell lines mouse. On FIGU presents the results obtained by the analysis of mRNA expression ENSMUSG00000035095, molecules candidate for mTARM-L in cell lines mouse using real-time PCR.

On figa presents specific binding of the chimeric protein TARM-AP mouse cells B300.19 expressing mTARM-L. On FIGU presents specific cell adhesion cell B300.19 expressing mTARM-L, to the chimeric protein TARM-AP mouse.

On Fig is redstavleny results obtained by the analysis of homology between proteins TARM-L human and mouse.

On Fig presents the results obtained by the analysis of homology between protein TARM person and protein TARM mouse (m3).

DETAILED description of the INVENTION

The present invention will be described in detail below. The following descriptions are given only as examples for explaining the present invention, and thus, such examples are not intended to limit the present invention only variants of implementation of the present invention. All technological terms, scientific terms and technical terms used in the present description, share the same values with those generally used by specialists in the technical field to which the present invention is intended. Such terms are used only to explain the specific embodiments, and thus, they are not intended to limit the present invention. The present invention can be realized in different variants of implementation, unless it deviates from its essence. All references to the prior art and patent documents, such as patent applications or patent publications, cited here, is given here as a reference in full, and you can use them to done by the means of the present invention.

[New proteins and polynucleotides]

Among the genes identified in the present invention, which is specifically expressed in dendritic cells derived from bone marrow, gene murine origin has 5 types of isoforms. Such isoforms of the gene of mouse origin include m1, m2, m3 and m4, which are genes of membrane-bound proteins (membrane proteins), and s1, which is the gene of the protein secretory type (secretory proteins). The nucleotide sequence and amino acid sequences of these isoforms correspond to the sequences of the following numbers:

m1 SEQ ID No. 11 and 12

m2 SEQ ID No. 1 and 2

m3 SEQ ID No. 3 and 4

m4 SEQ ID No. 5 and 6

s1 SEQ ID No. 7 and 8

Among the genes identified in the present invention, which is specifically expressed in originating from bone marrow dendritic cells, one type of membrane protein gene can be mentioned as the gene of human origin. The nucleotide sequence of this gene and amino acid sequence of the proteins encoded by the genome, match those presented in SEQ ID No. 9 and 10, respectively.

Since the nucleotide sequence of the gene identified in the present invention, encodes the signal peptide, the protein encoded by the above gene, forms a membrane protein or secrete the hydrated protein. C-end membrane protein according to the present invention is modified (for example, removing the transmembrane part) in order to obtain a secretory protein. C-the end of the secretory protein according to the present invention is modified (for example, by adding to it the transmembrane part) in order to obtain a membrane protein.

In the present description the expression "one or more amino acids are inserted, substituted or deleted, or added to one or both ends and one or more nucleotides are inserted, substituted or deleted, or one or more nucleotides are added to one or both ends" means that the modification was carried out according to well-known technical methods, such as site-specific mutagenesis, or replacement of a few amino acids or nucleotides to such an extent to get them naturally. The number of amino acids or nucleotides, which should be modified, may be, for example, from 1 to 30, preferably from 1 to 20, more preferably from 1 to 10, more preferably from 1 to 5, and particularly preferably 1 or 2.

A modified amino acid sequence may preferably be an amino acid sequence having one or several (preferably one or more, or 1, 2, 3, or 4) preserves the positive substitutions in amino acid sequence.

The modified nucleotide sequence may preferably be a nucleotide sequence having one or more (e.g., one or more, or 1, 2, 3, or 4) mutations that do not disrupt the function of the protein consisting of the amino acid sequence of SEQ ID No. 10.

In the present description, the term "conservative substitution" means that one or more amino acid residues substituted by other chemically similar amino acid residues so that the function of the protein, essentially, is not modified. Examples of such conservative substitutions include the case where the hydrophobic residue is replaced by another hydrophobic residue, and the case where a polar residue is replaced by another polar residue, which has the same electric charge. For each type of amino acids in this technical area known functionally similar amino acids that can be replaced this way. Examples of nonpolar (hydrophobic) amino acids include alanine, valine, isoleucine, leucine, Proline, tryptophan, phenylalanine and methionine. Examples of polar (neutral) amino acids include glycine, serine, threonine, tyrosine, glutamine, asparagine and cysteine. Examples of positively charged (basic) amino acids include arginine, histidine and lysine. Examples of negatively charged (acidic) Amin the acids include aspartic acid and glutamic acid.

In the present description, the term "hybreed" means hybridization with the target polynucleotide in tough conditions. Specifically, one can cite as an example polynucleotide having at least 70% or more, preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 95% or more, particularly preferably 98% or more, and most preferably 99% or more identity with the target nucleotide sequence, if such identity is calculated using the default setting (initialization) using the software to search for homology, such as FASTA, BLAST or Smith-Waterman [Meth. Enzym., 164, 765 (1988)]. In addition, the term "stringent conditions" means conditions in which the reaction is carried out in a hybridization buffer, which can usually be used specialists in this area at a temperature from 40°C to 70°C, and, preferably, from 60°C to 65°C, and the reaction product is then washed a wash solution having a salt concentration from 15 to 300 mmol/l and preferably from 15 to 60 mmol/L. Such a temperature and salt concentration can be appropriately selected depending on the length of the probe in use. Moreover, the conditions for washing the product obtained by hybridization, can present is a 0.2 or 2·SSC, 0,1% SDS, and temperature from 20°C to 68°C. it is Possible to determine harsh conditions (high rigidity) or mild conditions (low stiffness) by creating different conditions through the salt concentration or temperature used during washing. If this difference in terms of hybridization get through the salt concentration, of 0.2·SSC, 0,1% SDS can be used as a buffer for the hard of washing buffer (buffer for washing under conditions of high stringency), and 2·SSC, 0,1% SDS can be used as a buffer for soft washing buffer (buffer for washing in low stiffness). On the other hand, if this difference is obtained using the temperature, the temperature 68°C are used in high hardness, temperature 42°C use in the case of moderate hardness and room temperature (from 20°C to 25°C) used in the case of low rigidity. In all three above cases, the reaction can be performed in 0.2·SSC, 0,1% SDS.

Typically, prehybridization carried out in the same conditions as hybridization. However, the pre-hybridization and washing is not always performed in the same conditions.

Hybridization can be performed according to a known method. In the case of using commercially available libraries hybridization can be performed according to the method described in the attached instructions.

In the present about what Isani the term "identity" (sometimes referred to as "homology") with respect to amino acid sequences and nucleotide sequences indicates the degree of coincidence between the compared sequences in terms of amino acid residues or nucleotide residues, which constitute such sequences. At the same time take into account the presence of the admission and properties of amino acids (Wilbur, Natl. Acad. Sci. U.S.A. 80:726-730 (1983)). To calculate the homology can be used commercially available software to search for homology, such as BLAST (Altschul: J. Mol. Biol. 215:403-410 (1990)), FASTA (Peasron: Methods in Enzymology 183:63-69 (1990)) or Smith-Waterman [Meth. Enzym., 164, 765 (1988)].

The quantitative value of such "identity" can be calculated using the homology search, known to specialists in this field. For example, such a quantitative value as identity, can be calculated using the default setting (initialization) algorithm to search for homology BLAST (tool basic local alignment search) http://www.ncbi.nlm.nih.gov/BLAST/), National Center for Biotechnology Information (NCBI).

In the new protein according to the second variant of implementation according to the present invention amino acid sequence having 90% or higher identity with the amino acid sequence SEQ ID No. 10, may be an amino acid sequence having preferably 95% or more, particularly preferably 98% or greater and most preferably 99% or more identity with the above-mentioned amino acid consequently the stew.

In polynucleotide, encoding a novel protein on the second version of the implementation according to the present invention, the nucleotide sequence having 90% or more identity with the nucleotide sequence SEQ ID No. 9, may be a nucleotide sequence having preferably 95% or more, particularly preferably 98% or more, and most preferably 99% or more identity with the above-mentioned nucleotide sequence.

The antibodies according to the first embodiment of the implement according to the present invention amino acid sequence having 70% or more identity with the amino acid sequence SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, may be an amino acid sequence having preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 95% or more, particularly preferably 98% or more, and most preferably, 99% or more identity with the above-mentioned amino acid sequence.

In the present invention, if a given amino acid sequence SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, it is easy to determine its encoding nucleotide sequence. Thus, m is tenderly to choose different nucleotide sequence, encoding amino acid sequence SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12.

Accordingly, polynucleotide, encoding a protein containing the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, contains not only the complete DNA sequence of SEQ ID No.1, SEQ ID No.3, SEQ ID No.5, SEQ ID No.7, SEQ ID No. 9 or SEQ ID No. 11, or a portion, but also the sequence of the DNA encoding the same amino acids, which contains the codon located with polynucleotides in relation to the degeneracy in as the DNA sequence. The present invention further includes an RNA sequence corresponding to a sequence of DNA.

A preferred example of polynucleotide encoding a protein containing the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, is polynucleotide containing the nucleotide sequence SEQ ID No.1, SEQ ID No.3, SEQ ID No.5, SEQ ID No.7, SEQ ID No. 9 or SEQ ID No. 11.

In this description the fact, functionally equivalent or not a particular protein is a protein consisting of the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, may be determined by the assessment of biological characteristics or functions associated with the expression of a protein consisting of the amino acid sequence of SEQ ID No. 2, SEQ ID No. 4,SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10 or SEQ ID No. 12. For example, it can be determined, allowing the expression of specific protein genetic engineering method, and then, evaluating, operates or not the above-mentioned protein as a receptor that activates dendritic cells. Protein consisting of the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, interacts with T-cells and has a function of activating dendritic cells. Thus, for the above evaluation, you can use the following functions as an indicator:

The function of mediating the adhesion of T-cells (examples 5, 6, 10, and 11);

The activation function of dendritic cells cross-stimulation of antibodies (example 3);

Function of complex formation with the FcRγ chain (example 4); or

Sharing some or all of the above functions.

[New protein ligand and polynucleotide]

Among the genes identified in the present invention, which is specifically expressed in activated T-cells in the form of ligands for proteins TARM, one type of membrane protein gene may be referred to as a gene of mouse origin. The nucleotide sequence of this gene and amino acid sequence of the proteins encoded by the genome, are such as shown in SEQ ID No. 13 and 14, respectively. In addition, the genes which is specifically expressed on activated T-cells in the form of ligands for proteins TARM, one type of membrane protein gene can be mentioned as the gene of human origin. The nucleotide sequence of this gene and amino acid sequence of the proteins encoded by the genome, are such as shown in SEQ ID No. 15 and 16, respectively.

In the new protein ligand according to the present invention amino acid sequence having 70% or more identity with the amino acid sequence SEQ ID No. 14 or SEQ ID No. 16, may be an amino acid sequence having preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 95% or more, particularly preferably 98% or more, and most preferably 99% or more identity with the above-mentioned amino acid sequence.

In polynucleotide, encoding a new protein ligand according to the present invention, the nucleotide sequence having 70% or more identity with the nucleotide sequence SEQ ID No. 13 or SEQ ID No. 15, may be a nucleotide sequence having preferably 80% or more, more preferably 85% or more, more preferably 90% Ribolla, more preferably, 95% or more, particularly preferably 98% or more, and most preferably 99% or more identity with the above-mentioned nucleotide sequence.

In the present invention, if a given amino acid sequence SEQ ID No. 14 or SEQ ID No. 16, it is easy to determine its encoding nucleotide sequence. Thus, it is possible to choose different nucleotide sequence encoding the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 16.

Accordingly, polynucleotide, encoding a protein containing the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 16, contains not only the complete DNA sequence of SEQ ID No. 13 or SEQ ID No. 15, or part of it, but also the sequence of the DNA encoding the same amino acids, which contains the codon located with polynucleotides in respect of degeneracy as a DNA sequence. The present invention further includes an RNA sequence corresponding to a sequence of DNA.

A preferred example of polynucleotide encoding a protein containing the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 16 is polynucleotide containing the nucleotide sequence SEQ ID No. 13 or SEQ ID No. 15.

In this description the fact, functionally equivalent or not specific the protein protein consisting of amino acid sequence SEQ ID No. 14 or SEQ ID No. 16, may be determined by the assessment of biological characteristics or functions associated with the expression of a protein comprising amino acid sequence SEQ ID No. 14 or SEQ ID No. 16. For example, it can be determined, allowing the expression of specific protein genetic engineering method, and then evaluating, operates or not the above-mentioned protein as a ligand on the T-cell receptor that activates dendritic cells. Protein consisting of the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 16, binds with protein TARM. Thus, for the above-mentioned evaluation function binding with this protein TARM (example 12) can be used as an indicator.

New protein ligand according to the present invention contains a single transmembrane region, and it is expressed on the cell surface in the direction in which its N-terminal part can be located in the extracellular space. Accordingly, it is possible to obtain antibodies against the above protein using the aforementioned protein.

The present invention relates to a protein containing the polypeptide comprising at least 6 amino acid residues, or the entire amino acid sequence of amino acids 1 through 159 to SEQ ID No. 14, or amino acids 1 to 158 for SEQ ID No. 16. The above-mentioned protein contains a portion corresponding to the extracellular region of amino acid sequences TARM-L, and, thus, it can be used as antigen to generate antibodies against the above-mentioned protein.

The present invention relates to the use of the new protein ligand of the present invention to generate antibodies against the above-mentioned new protein ligand of the present invention.

[Antibodies]

Antibodies according to the present invention can specifically recognize the protein TARM or protein TARM-L. Accordingly, it is preferable that the protein TARM or protein TARM-L used to generate antibodies according to the present invention, had the antigenicity TARM or TARM-L. Such protein TARM or protein TARM-L includes a protein having the amino acid sequence of the protein TARM or protein TARM-L, where deleted, inserted, substituted, or added one or more amino acid residues. It is known that this protein retains the same biological activity as the source of protein (Mark et al. (1984) Proc. Natl. Acad. Sci. USA 81:5662-6; Zoller and Smith (1982) Nucleic Acids Res. 10:6487-500; Wang et al. (1984) Science 224:1431-3; Dalbadie-McFarland et al. (1982) Proc. Natl. Acad. Sci. USA 79:6409-13). A method of obtaining a specific protein by deletion, insertion, substitution or addition of one or several amino acids compared to the original protein PR is the preservation of antigenicity source of protein. For example, polynucleotide that encodes a mutant protein, receive site-specific mutagenesis and then provide the appropriate expression of the protein (Molecular Cloning, A Laboratory Manual, 2nded., Cold Spring Harbor Press (1989); Current Protocols in Molecular Biology, John Wiley & Sons, (1987-1997), Section 8.1-8.5; Hashimoto-Goto et al. (1995) Gene 152: 271-5; Kinkel (1985) Proc. Natl. Acad. Sci. USA 82:488-92; Kramer and Fritz (1987) Method. Enzymol 154:350-67; Kunkel (1988) Method. Enzymol. 85:2763-6).

Antibodies according to the present invention also include antibodies specific for a portion of the protein TARM or protein TARM-L.

Thus, this protein TARM or protein TARM-L used to generate antibodies according to the present invention includes not only the polypeptide having a full-sized amino acid sequence of the protein TARM or protein TARM-L, but also a polypeptide fragment having at least 6 amino acid residues (e.g., 6, 8, 10, 12, 15 or more amino acid residues) of the protein TARM or protein TARM-L. In the present description type polypeptide fragment of the protein TARM or protein TARM-L not specifically limited provided that it has the antigenicity protein TARM or protein TARM-L.

Preferred polypeptide fragment may be a polypeptide fragment, such as N-terminal or C-end of the protein TARM or protein TARM-L. Plot antigenic determinants of the polypeptide appreciate way analysis of hydrophobicity/Hydra is filenote amino acid sequence of the protein (Kyte-Doolittle (1982) J. Mol. Biol. 157:105-22) or method of analysis of secondary structure (Chou-Fasman (1978) Ann. Rev. Biochem. 47:251-76). Accordingly, this section antigenic determinants can be confirmed using a computer program (Anal. Biochem. 151:540-6 (1985)) or by using methods such as the PEPSCAN method of synthesis of short peptides and confirm the antigenicity (Japanese patent laid publication No. 500684/1985).

Antibodies according to the present invention are preferably antibodies, which have influence on the function of the protein TARM or protein TARM-L. for Example, the values of the expression "having influence on the function of the protein TARM include activation of dendritic cells cross-stimulation of protein TARM antibodies according to the first variant implementation of the present invention (example 3); the inhibition of adhesion of T cells to protein TARM by binding the above-mentioned antibodies with protein TARM (examples 6 and 11); and inhibition of complex formation between protein TARM and FcRγ chain by linking the above-mentioned antibodies with protein TARM (example 4). For example, the values of the expression "having influence on the function of the protein TARM-L" include inhibition of binding protein TARM-L protein TARM by binding of the antibodies according to the second variant of implementation according to the present invention with protein TARM-L.

Antibodies according to the present invention includes the t: monoclonal antibodies, obtained using protein TARM or protein TARM-L as antigen and immunization of a mammal, such as a mouse, the above-mentioned antigen; chimeric antibodies and humanized antibodies obtained by genetic recombination; and human antibodies produced using transgenic animals that produce human antibodies, or the like, If the antibodies according to the present invention is administered in the form of a medicinal product to a person, it is preferable to use human antibodies from the viewpoint of side effects.

"Human antibody" refers to antibodies in which all areas have a human origin. Such human antibodies can be obtained by introduction of the gene of human antibodies in the mouse. Such human antibodies can be obtained on the basis of the methods described, for example, in Nature Genetics, Vol. 7, pp. 13-21, 1994; Nature Genetics, Vol. 15, pp. 146-156, 1997; Japanese patent laid publication No. 504365/1992; Japanese patent laid publication No. 509137/1995; international publication WO94/25585; Nature, Vol. 368 pp. 856-859, 1994; and Japanese patent laid publication No. 500233/1994. In addition, these human antibodies can also be obtained by the method of phage display. They can be obtained, for example, on the basis of the method described in Marks, J. D. et al.: J. Mol. Biol., Vol. 222, pp. 581-597, 1991.

"Humanized ant the body" are antibodies, received transplantation (CDR-grafting) only gene sequence antigennegative plot (CDRs area determining complementarity) mouse antibodies in the gene of human antibodies. Such humanized antibodies can be obtained, for example, based on the methods described in Japanese patent laid publication No. 506458/1992 and Japanese patent laid publication No. 296890/1987.

"Chimeric antibodies" are antibodies obtained by legirovaniem variable regions of a mouse antibody with a constant region of a human antibody. In particular, the mouse subjected to immunization with antigen, and the variable region of the antibody V-region), which binds to the antigen, isolated from the gene of murine monoclonal antibodies. The thus obtained V-region then are ligated with the gene constant region of an antibody (C-region)derived from human bone marrow, thereby obtaining chimeric antibodies. Such chimeric antibodies can be obtained, for example, on the basis of the method described in Japanese patent publication No. 73280/1991.

Monoclonal antibodies according to the present invention can be obtained by using a method well known to specialists in this field (for example, "Current Protocols in Molecular Biology", John Wiley & Sons (1987)), Antibodies: A Laboratory Manual, Ed. Harlow and David Lane, Cold Spring Harbor Laboratory (1988)).

As immunogen is possible to use protein fragment TARM or protein TARM-L. Otherwise, you can also use the antigen synthesized on the basis of the above-mentioned amino acid sequence. This antigen can be used in the form of a complex with a protein carrier. To obtain antigen complex with protein carrier, you can use different types of binders. You can use glutaraldehyde, carbodiimide, active ester of maleinimide etc. as a protein carrier can, as a rule, use products such as bovine serum albumin, thyroglobulin or hemocyanin, and, as a rule, to enlist in the ratio of 1 to 5.

Examples of the animal subject immunization include mouse, rat, rabbit, Guinea pig and hamster. The method of inoculation includes subcutaneous injection, intramuscular and intraperitoneal administration. For the introduction of the antigen can be mixed with complete adjuvant's adjuvant or incomplete adjuvant's adjuvant. Introduction as a rule, carried out once every 2-5 weeks.

Producing antibodies cells derived from the spleen or lymph node immunized animal, subjected to cell fusion with myeloma cells, and distinguish them in the form of hybrid. As such myeloma cells can be used cells of mouse, rat and human origin or the like, and, preferably, what is happening is C the same species, that and producing antibodies cells. However, there are also cases in which such cell fusion can be carried out even between cells of different types.

Cell fusion can be carried out in a known way, such as the method described in Nature, 256, 495, 1975.

Examples of the activator of the merger include polyethylene glycol and Sendai virus. Typically, cell fusion can be performed, providing interaction producing antibodies cells with myeloma cells using polyethylene glycol (average molecular weight of 1000-4000)having a concentration of approximately 20%-50% at a temperature between 20°C and 40°C, and preferably between 30°C and 37°C, with a ratio of the number of producing antibodies cells to the number of myeloma cells, which is usually about from 1:1 to 10:1, for approximately 1 to 10 minutes.

You can use different types of immunochemical methods for screening hybridomas producing antibodies. Examples of such immunochemical method include: a method ELISA using a microplate coated with protein TARM or protein TARM-L; the method EIA using a microplate coated with antibodies to immunoglobulin; and the method of Western blot turns, including electrophoresis sample containing protein TARM, and then use nitrocellulose membrane.

In addition, for such screening hybridomas producing antibodies can be used instead of the above immunochemical method is a method of screening a hybrid, based on the fact, possess or not the above-mentioned antibodies influence on the function of the protein TARM or protein TARM-L. it is Possible to carry out screening of hybridomas producing antibodies on the basis of the influence of antibodies on the first version of the implementation according to the present invention on the function of the protein TARM, for example, based on whether activated or not dendritic cells cross-stimulation of protein TARM antibodies in the first embodiment of the implement according to the present invention (example 3), or can be, or not to inhibit the function of a protein TARM in mediating adhesion T-cells by binding the above-mentioned antibodies with protein TARM (examples 6 and 11), or can be, or not to inhibit the formation of complexes between protein TARM and FcRγ chain by linking the above-mentioned antibodies with protein TARM (example 4). You can also screening hybridomas producing antibodies on the basis of the influence of antibodies on the second version of the implementation according to the present invention on the function of the protein TARM-L, for example, based on whether you can or cannot inhibit the function of a protein TARM in protein binding TARM-L through binding of the antibodies according to the second variant of implementation according to this is the overarching invention with protein TARM-L. Using this screening method can be discriminates antibodies, which have influence on the function of the protein TARM or protein TARM-L, which represent a preferred variant of the antibodies of the present invention. Moreover, this method of screening can also be done as a way of secondary screening, which is carried out after the above-mentioned immunochemical method of screening, in which the selection producing antibodies of hybridoma based on whether it produces or not antibodies that bind to protein TARM or protein TARM-L.

Moreover, in order to obtain clones, cloning is carried out in such a hole, for example, using the method of restricted breeding. Breeding and cultivation of such a hybrid, as a rule, is carried out in a medium for animal cells (for example, RPMI1640 containing 10% to 20% fetal bovine serum, to which is added HAT (gipoksantin, aminopterin and thymidine). The clones thus obtained, transplanted in the peritoneal cavity of SCID mice, which have previously entered the Wharf. 10-14 days after collecting ascitic fluid containing a high concentration of monoclonal antibodies, and it can be used as a starting material for the purification of antibodies. Otherwise, the above clones were cultured and the resulting cool the tour can also be used as a starting material for the purification of antibodies.

Monoclonal antibodies can be cleaned in a known manner purification of immunoglobulins. For example, such a purification of monoclonal antibodies can be easily obtained by methods such as a method of fractionation with ammonium sulfate, the fractionation method using PEG method of fractionation with ethanol, the use of anion-exchange or affinity chromatography using a column with a protein A column, protein G and protein TARM.

"Functional fragment" of the present invention means a portion of antibodies (partial fragment)that specifically recognizes the protein of the present invention. Specific examples of such a functional fragment include Fab, Fab', F(ab')2the fragment of the variable region (Fv), linked by a disulfide bond Fv, single-chain antibodies (scFv) and a polymer.

Preferred examples of the antibodies according to the first variant of implementation according to the present invention include antibodies against the new protein in the first embodiment of the implement according to the present invention and their functional fragment.

These preferred examples of the antibodies according to the first variant of implementation according to the present invention also include antibodies against the new protein according to the second variant of implementation according to the present invention and their functional fragment.

Such predpochtitel the examples of antibodies in the first embodiment of the implement according to the present invention further include antibodies against the following proteins:

(ix') membrane or secretory protein containing the amino acid sequence of SEQ ID No. 12;

(x') of the membrane or secretory protein that contains the amino acid sequence of SEQ ID No. 12, in which one or more amino acids are inserted, substituted or deleted, or one or more amino acids are added to one or both ends, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 12;

(xi') of the membrane or secretory protein that is encoded by polynucleotides that hybridizes in harsh environments with polynucleotide that encodes amino acid sequence SEQ ID No. 12, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 12; and

(xii') a membrane or secretory protein that contains an amino acid sequence having 70% or more identity with the amino acid sequence SEQ ID No. 12 and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 12.

More preferable example of the antibodies according to the first variant of implementation according to the present invention is an antibody against a membrane or secretory proteins containing the amino acid sequence of SEQ ID No. 12, or amino acids follow etelnost SEQ ID No. 12, which contains one or more conservative substitutions, or functional fragment.

A specific example is a monoclonal antibody produced by hybridomas deposited under inventory No. FERM BP-10376.

Accordingly, the present invention relates to hybridoma (@TARM#6.11), deposited in National Institute of Advanced Industrial Science and Technology, International Patent Organism Depositary (AIST Tsukuba Central 6, Higashi 1-1-1, Tsukuba, Ibaraki, 305-8566, Japan)under inventory No. FERM BP-10376 15 July 2005.

Another preferable example of the antibodies according to the first variant of implementation according to the present invention is an antibody against a membrane or secretory proteins containing the amino acid sequence of SEQ ID No. 10, or the amino acid sequence of SEQ ID No. 10, which contains one or more conservative substitutions, or functional fragment.

A preferred example of the antibodies according to the second variant of implementation according to the present invention is an antibody against a membrane or secretory proteins containing the amino acid sequence of SEQ ID No. 14 or amino acid sequence SEQ ID No. 14, which contains one or more conservative substitutions, or functional fragment.

Another preferred example of the antibodies according to the second variant of implementation according to Nast is ademu the invention is an antibody against a membrane or secretory proteins, containing the amino acid sequence of SEQ ID No. 16, or the amino acid sequence of SEQ ID No. 16, which contains one or more conservative substitutions, or functional fragment.

More preferable example of the antibodies according to the second variant of implementation according to the present invention is an antibody, binding polypeptide region of the protein TARM-L, which is expressed in the extracellular space, or functional fragment. An example of such an antibody is an antibody against a protein containing a polypeptide comprising at least 6 amino acid residues, or the entire amino acid sequence of amino acids 1 to 159 of SEQ ID No. 14, or amino acids 1 to 158 of SEQ ID No. 16, or functional fragment.

[The use of the antibodies and pharmaceutical compositions]

Autoimmune disease

As T-cells, which are lymphocytes that are associated with immune responses, acting in conjunction with dendritic cells, which has the function of antigen presentation such T-cells, T-cells are involved in various immune responses (Kroczek, R.A., et al. (2004) Current Opinion in Immunology 16:321-327). As described in the examples below, revealed that the expression of protein TARM on dendritic cells was increased inflammatory stimulus (example 2) and that dendritic cells are contacted with T-to Adami through protein TARM (examples 5 and 10). In addition, it is confirmed that dendritic cells were activated protein TARM subjected to stimulation of cross-linking, and that were induced production of IL-6 (example 3). It was reported that overproduction of IL-6 is associated with autoimmune diseases (Ishihara, K., et al. (2002) Cytokine &Growth Factor Reviews 13:357-368). Moreover, adhesion of T cells to dendritic cells were significantly suppressed by antibodies against protein TARM (examples 6 and 11).

Moreover, in the above examples, it is confirmed that the antibodies according to the present invention did have a therapeutic effect on the model of collagen-induced arthritis (example 7). Model of collagen-induced arthritis model of rheumatoid arthritis which is an autoimmune disease.

Accordingly, the antibodies according to the first embodiment of the implement according to the present invention is suitable for treatment of autoimmune diseases.

An example of this autoimmune disease is rheumatoid arthritis.

Similarly, it is considered that the adhesion of T cells to dendritic cells is inhibited by antibodies against the protein TARM-L. Accordingly, the antibodies according to the second variant of implementation according to the present invention is suitable for treatment of autoimmune diseases.

The present invention relates to the use of antibodies is according to the present invention for obtaining a medicinal product for the treatment of autoimmune diseases.

The present invention relates to a method of treatment of autoimmune diseases, including the stage of introducing a therapeutically effective amount of the antibody according to the present invention is a mammal, including humans.

Means for inhibiting the adhesion of T-cells

As described later in examples, the adhesion of T cells to dendritic cells were significantly suppressed by antibodies against protein TARM (examples 6 and 11). Accordingly, the antibodies according to the first embodiment of the implement according to the present invention can be applied as a means for inhibiting the adhesion of T-cells.

Similarly, it is considered that the adhesion of T cells to dendritic cells is inhibited by antibodies against the protein TARM-L. Accordingly, the antibodies according to the second variant of implementation according to the present invention can be applied as a means for inhibiting the adhesion of T-cells.

In the present description, the term "adhesion of T-cells" means the adhesion of T cells to dendritic cells, namely the binding of the protein TARM expressed on dendritic cells, with protein TARM-L expressed on T-cells. When the inhibition of binding protein TARM expressed on dendritic cells, with protein TARM-L expressed on T-cells, using the means for inhibiting the adhesion of T-cells according to the present izopet the tion, you can supressive immune response caused by the interaction between dendritic cells and T-cells, such as activation, growth and differentiation of dendritic cells and T-cells and the production of cytokine/chemokine.

The pharmaceutical composition

Route of administration of the antibodies according to the present invention are not specifically limited. The foregoing antibodies can be entered mammals, including humans, using oral administration or parenteral administration (for example, intravenous injection, intramuscular injection, subcutaneous administration, rectal administration, percutaneous administration and local administration). Among them, preferred parenteral, in particular intravenous injection.

Dosage form for oral administration and parenteral administration and its preparation are well known to specialists in this field. Dosage form for oral administration and parenteral administration can be obtained conventional manner, for example, by mixing the antibodies according to the present invention, for example, with a pharmaceutically acceptable carrier.

As such, using pharmaceutically acceptable carrier substance which is usually used in the manufacture of medicinal products and which does not react with the antibodies according infusion is his invention. Pharmaceutically acceptable carriers include, for example, the most commonly used excipient, binder, disintegrator, lubricant, colorant and flavorant; and, if necessary, a stabilizer, emulsifier, stimulator absorption, surface-active substance, means for setting the pH, antiseptic, antioxidant, solvent, wetting agent, surface activator, dispersing agent, a buffer, a preservative, a solubilizer and a sedative, and can be according to the conventional method by mixing the ingredients normally used as starting substances for pharmaceutical products.

Examples of dosage forms for parenteral administration include injections (for example, a product for drip injection product for intravenous injection, the product for intramuscular injection, the product for subcutaneous injection and product for percutaneous injection), drugs for external use (for example, ointment, poultice, lotion, suppository, means for inhalation, eye drops, eye ointments, nasal drops, ear drops and liposomal agent.

The preparation for injection is obtained by dissolving the antibody according to the present invention, for example, in the distilled water used for injection. If necessary, you can add to this drug for injects the th solubilizer, buffer means for setting the pH of the tool to maintain the isotonic condition, soothing agent, preservative, stabilizer, etc. in Addition, such a drug for injection can be obtained in the form of dried product that can be cooked in use.

Examples of dosage forms for oral administration include solid and liquid dosage forms such as tablets, coated tablets, pills, small pills, granules, powder, capsules, syrup, emulsion, suspension, injection, or lozenges.

The pharmaceutical composition according to the present invention may further comprise other therapeutically effective tools. Moreover, if necessary, you can also add components, such as a circulatory stimulant, antibiotic, anti-inflammatory, cell activators, vitamins, amino acids, humidifier or keratolytic drug. The ratio of active ingredient to the carrier can be changed within the range from 1 to 90% by mass.

The dosage of the antibodies according to the present invention can determine the attending physician on the basis of various factors such as route of administration, the type of disease, severity of symptoms, age, sex and body weight of the patient, severity of disease, formats ticheskie indicators such as pharmacokinetics and Toxicological characteristics, the presence or absence of use of the delivery system for drugs and the possibility of introducing as a component of combination with other means, and it may generally be from 1 to 5000 mg/day, preferably from 10 to 2000 mg/day, and more preferably, from 50 to 2000 mg/day for oral administration, and from 1 to 5000 mg/day, preferably from 5 to 2000 mg/day, and more preferably, from 50 to 2000 mg/day for administration by injection, each for an adult (weighing 60 kg), who injected once or a few times per day. With the introduction of the child dose may be less than the introduction of an adult. Route of administration that is actually used can be changed by the decision of the attending physician, and, thus, the dosage may deviate from the above range.

[Method of screening]

Method of screening a substance that inhibits the adhesion of T cells to protein TARM

According to the method of screening according to the first variant implementation of the present invention, a method of screening for screening a substance which inhibits the adhesion of T cells to protein TARM.

Protein TARM is expressed on dendritic cells, and it is associated with the interaction between dendritic cells and T-cells, which are involved in immunodeficiency, is a substantive reply. In addition, as a result of stimulation of cross-linking protein TARM, may be the induction of the production of IL-6, which can cause autoimmune disease. Accordingly, the method of screening according to the first variant implementation of the present invention can be used for screening a substance which inhibits the adhesion of T cells to protein TARM, and, preferably, can be used for screening substances effective in the treatment of autoimmune diseases and, more preferably rheumatoid arthritis.

The method of screening according to the first embodiment of the implement according to the present invention may further include, after stage (b) stage (c) comparing the binding activity in the presence of a test substance with an activity of binding in the absence of the test substance.

If at the stage (c) binding activity in the presence of a test substance is lower than the binding activity in the absence of a test substance, and preferably below 50%, it is possible to establish that the test substance inhibits the binding of T-cells with the protein according to the present invention.

The term "contacting" in stage (a) is not specifically limited provided that the protein TARM can directly come in contact with T-cells. For example, it is possible to carry out a method of adding the labeled T-cells is to on the tablet, on which the immobilized protein TARM, or a way to add a labeled protein TARM on the tablet, containing T-cells.

T-cells are preferably activated T-cells and, more preferably, activated Th2 cells.

At the stage (b) binding activity can be measured in a known manner. For example, labeled T-cells add to the tablet on which is immobilized protein TARM, and you can cultivate a certain period of time. Next neprecejusies cells are removed by washing or the like, and then measure the level of adherent cells, thus measuring the activity of the binding.

For the above labeling, for example, you can use a radioisotope, enzyme, fluorescent substance (including fluorescent protein), fluorescent substance and the like, the Examples used here radioisotopes include [3H], [14C], [125I] and [35S]. The examples used here enzymes include β-galactosidase, alkaline phosphatase, peroxidase and luciferase. The examples used here, the fluorescent substances include fluorescein-isothiocyanate, BODIPY and calcein-AM (Dojindo Laboratories). Also as a fluorescent protein can be used GFP, etc. regarding such enzymes and fluorescent proteins, their genes can be introduced into the cell and can then Express it. The examples used deslumbrante substances include luciferin, lucigenin. In some cases, you can use the Biotin-avidin, to ensure binding of the above-mentioned ligand with aiming substance.

Moreover, add unlabeled T cells, and adherent T-cells can then be used to detect antibodies that are specific for T-cells, such as antibodies to CD3, or antibodies that are specific for helper T-cells, such as antibodies to CD4.

As for the activity of binding, then added to cells pre-measured and can be expressed as the ratio of adherent cells added to the cells.

Method of screening a substance which inhibits activation of dendritic cells

According to the method of screening according to the second variant of implementation of the present invention, a method of screening for screening a substance which inhibits activation of dendritic cells.

Dendritic cells can be activated protein TARM subjected to stimulation of cross-linking (examples 3 and 4). Accordingly, the system of dendritic cells, which cross-stimulation of antibodies to TARM, can be used for screening a substance which inhibits activation of dendritic cells.

As stated above, it is shown that autoimmune disease is caused by activation of dendritic cells. Thus, the method according to the present invention DL the screening substances which inhibits the activation of dendritic cells, can be used for screening substances effective in the treatment of, preferably, autoimmune diseases and, more preferably rheumatoid arthritis.

If cross-stimulation applied to protein TARM, which is expressed on dendritic cells, dendritic cells become activated. At the same time, protein TARM forms a complex with the FcRγ chain, known as the carrier signal molecule, and induced the production of IL-6, which causes autoimmune disease, or MCP-1, which acts as a chemotactic factor for monocytes. Accordingly, at the stage (e) of the method of screening according to the second variant of implementation according to the present invention, the level of activation of dendritic cells can be measured using an indicator of the amount of IL-6 and/or MCP-1 produced by dendritic cells. Otherwise, the level of activation of dendritic cells can be measured using, as an indicator of the level of expression of FcRγ chain in dendritic cells.

In the method of screening according to the second variant of implementation according to the present invention, if the level of activation of dendritic cells is measured using, as an indicator, the number of IL-6 and/or MCP-1 produced by dendritic cells, the method of screening may be more the tion to include after stage (e) stage (f-1) comparing the amount of IL-6 and/or MCP-1, produced in the presence of a test substance, with the number of IL-6 and/or MCP-1 produced in the absence of the test substance. If at stage (f-1) number of IL-6 and/or MCP-1 produced in the presence of a test substance, less the amount of IL-6 and/or MCP-1 produced in the absence of a test substance, and, preferably, if it is less than 50%, it is possible to establish that the test substance inhibits the activation of dendritic cells.

In the method of screening according to the second variant of implementation according to the present invention, if the level of activation of dendritic cells is measured using, as an indicator of the level of expression of FcRγ chain in dendritic cells, the screening method may further include after the stage (e) stage (f-2) comparing the level of expression of FcRγ chain in the presence of a test substance with the level of expression of FcRγ chain in the absence of the test substance.

If at stage (f-2) the level of expression of FcRγ chain in the presence of a test substance below the level of the expression of FcRγ chain in the absence of a test substance, and, preferably, if it is below 50%, it is possible to establish that the test substance inhibits the activation of dendritic cells.

At stage (d) the term "contacting" is not specifically limited provided that the protein TARM on dendritic cells subjected to cross article is stimulating antibodies according to the present invention. For example, it is possible to carry out the cultivation of dendritic cells in an environment that contains antibodies according to the present invention.

At the stage of (e) amount of produced protein or the expression level can be measured according to a known method. You can also use commercially available set.

Method of screening a substance that inhibits formation of a complex between the protein TARM and FcRγ chain

According to the method of screening according to the third variant of implementation according to the present invention, a method of screening a substance that inhibits formation of a complex between the protein TARM and FcRγ chain.

Protein TARM is expressed on dendritic cells and forms a complex with the FcRγ chain, which is well known as a transmission signal molecules. Moreover, assume that the FcRγ chain forms a complex with protein TARM so that increases its expression on the cell surface. Accordingly, the method of screening according to the present invention can be used for screening a substance which inhibits formation of a complex between the protein TARM and FcRγ chain, and, preferably, can be used for screening substances effective in the treatment of, preferably, autoimmune diseases and, more preferably rheumatoid arthritis.

The method of screening according to the present izaberete the Oia may further include after the stage (h) stage (i) comparing the level of expression of FcRγ chain in the presence of a test substance with the level of expression of FcRγ chain in the absence of the test substance.

If at the stage of (i) the level of expression of FcRγ chain in the presence of a test substance below the level of the expression of FcRγ chain in the absence of a test substance, and, preferably, if it is below 50%, it is possible to establish that the test substance inhibits the formation of the complex between the protein according to the present invention and FcRγ chain.

At stage (g) the term "contacting" is not specifically limited provided that dendritic cells, which expressed protein TARM and FcRγ chain, can directly come into contact with an antibody according to the present invention. For example, it is possible to carry out the cultivation of dendritic cells in an environment that contains antibodies according to the present invention.

At stage (h) the expression level can be measured according to a known method. For example, the expression level can be measured using flow cytometry.

In the present description examples "test substance" includes synthetic small molecule compound, a protein, a synthetic peptide, a purified or partially purified polypeptide, antibody, the substance secreted from bacteria (including bacterial metabolite), and nucleic acid (antisense, ribozyme, RNC etc). Preferred examples include a compound or its salt, or its MES (e.g., hydrate), but these examples are not granichen. "Test substance" may be a new substance, or known substance.

Examples

The present invention will be described in detail in the following examples. However, the examples described below are not intended to limit the scope of the present invention. Examples "protein TARM" and "protein TARM-L" can sometimes simply be referred to as "TARM" and "TARM-L", respectively. Moreover, protein TARM mouse origin and the protein TARM human origin can sometimes simply be referred to as "mTARM" and "hTARM" respectively.

[Example 1] the Selection gene TARM mouse and the analysis of gene

(1) Isolation of the gene mTARM

CD4-T-cells isolated from the spleen of the mouse was divided into Th1 or Th2 cultivationin vitro. The cDNA fragment for use as a driver or probe received from Th1 or Th2. Then search using the Blast was performed using the sequence of the cDNA fragments obtained during the stage of carrying out highly sensitive method of subtraction (N-RDA). The result is a gene that encodes a protein of the cell membrane with unknown functions (inventory No. in GenBank™ NM_177363).

The following primers were designed based on the sequence of GenBank™ (NM_177363) and analyzed gene expression mTARM in various organs of the mouse.

mTARM F1: GTGACTTTGCAGTGCCAGAA (SEQ ID no: 17)

mTARM R1: TGCACAGGAGTTGAGTGTCC (SEQ ID no: 18)

One is pachechnuyu cDNA was synthesized, on the basis of total RNA of each organ (Promega), using the set for PCR RNA (TAKARA). Using this single-stranded cDNA as a matrix real-time PCR was performed using ABI7700 (Applied Biosystems). PCR was carried out using the reaction solution of the following composition (12,5 µl of QuantiTect SYBR Green PCR Master Mix (QIAGEN), and 0.25 μl uracil-DNA glycosylase (Invitrogen), with 0.125 μl of 100 μm primer mTARM F, a 0.125 μl of 100 μm primer mTARM R, 2,5 µl matrix cDNA (10-fold dilution) and of 7.25 μl of distilled water). For this PCR, after treatment at 94°C for 10 minutes, the reaction cycle consisting of 94°C-30 seconds and 60°C-1 minute, repeated 35 times. The result found that mTARM expressively in the kidneys.

Thus, using total RNA from kidneys was performed 5'-RACE (rapid amplification of cDNA ends) and C'-RACE in an attempt to determine the full sequence of the gene mTARM.

First, double-stranded cDNA was synthesized, based on the total RNA of mouse kidney using the kit for cDNA synthesis (TAKARA), and cDNA was then purified using the kit for purification of PCR products Qiaquick (QIAGEN). Then thereto was added adapter ad29 (the product obtained by annealing ad29S (acatcactccgt; SEQ ID No. 19) and ad29A (acggagtgatgtccgtcgacgtatctctgcgttgatacttcagcgtagct; SEQ ID No. 20)) in order to obtain the matrix for the RACE.

The 1st PCR was carried out using the reaction solution after the ith compound (5 μl of 10×ExTaq buffer, 4 μl of 2.5 mm dNTP, and 0.25 μl of ExTaq and 0.5 μl of 100 μm primer (5'PCR4), and 0.5 μl of 100 μm gene-specific primer, 1 μl of cDNA added adapter ad29 (25-fold dilution) and 38,75 ál of distilled water).

mTARM_RACE_5'_4: CTTCTGGCACTGCAGAGTCACCCT (SEQ ID no: 22), or

mTARM_RACE_3'_4: GGAGAGTACACCTGTGAATACTAC (SEQ ID no: 23)

For this PCR, after treatment at 94°C for 5 minutes, the reaction cycle consisting of 94°C for 30 seconds, 65°C-1 minute, and 72°C for 5 minutes was repeated 30 times. In conclusion, the reaction was carried out at 72°C for 5 minutes.

The 2nd PCR was carried out using the reaction solution of the following composition (5 μl of 10×ExTaq buffer, 4 μl of 2.5 mm dNTP, and 0.25 μl of ExTaq and 0.5 μl of 100 μm primer (5'PCR1), and 0.5 μl of 100 μm gene-specific primer, 1 μl of the product of the 1st PCR (100-fold dilution) and 38,75 ál of distilled water).

The following sequences were used as primers.

5'PCR1: GTATCAACGCAGAGATACGTCGACGG (SEQ ID no: 24) mTARM_RACE_5'_3: TCCACCTGCGGTCACTGTACCCCT (SEQ ID no: 25), or

mTARM_RACE_3'_3: CTACAGAAAAGCATCCCCCCACATCCTTTC (SEQ ID no: 26)

For this PCR, after treatment at 94°C for 5 minutes, the reaction cycle consisting of 94°C for 30 seconds, 65°C-30 seconds, and 72°C for 5 minutes was repeated 25 times. In conclusion, the reaction was carried out at 72°C for 5 minutes. Amplificatory the cDNA fragment cloned in pCR2.1 (Invitrogen), and its nucleotide sequence was determined using the analyzer sequence ABI3100 (Applied Biosystems).

In resultate type cDNA obtained in 5'RACE, and 3 types of cDNA obtained in 3'RACE and, thus, revealed the presence of splice-isoforms.

Primers for the amplification splice-isoforms were constructed using information on the nucleotide sequence obtained by RACE. Double-stranded cDNA was synthesized, based on the total RNA bone marrow of the mouse, using the kit for cDNA synthesis (TAKARA), and cDNA was then purified using the kit for purification of PCR products Qiaquick (QIAGEN). PCR was carried out using the reaction solution of the following composition (5 μl of 10×ExTaq buffer, 4 μl of 2.5 mm dNTP, and 0.25 μl of ExTaq and 0.5 μl of 100 μm 5'-primer, and 0.5 μl of 100 μm 3'-primer, 1 µl of cDNA (25-fold dilution) and 38,75 ál of distilled water).

The following sequences were used as primers.

mTARM_5'UTR: GCTGATAGTAGACCTGCTGAAGAC (SEQ ID no:27)

mTARM_3'UTR-l: GTCCAGATATGTCCAGGCCTCTG (SEQ ID no: 28), or

mTARM_3'UTR-2: TTCAGTTATTTTACCAGGGTTTA (SEQ ID no: 29)

For PCR, after treatment at 94°C for 5 minutes, the reaction cycle consisting of 94°C for 30 seconds, 65°C-30 seconds, and 72°C for 5 minutes was repeated 35 times. In conclusion, the reaction was carried out at 72°C for 5 minutes. 6 types of splice-isoforms can be confirmed using 2 types of primers. As a result, the amplification products obtained in 5 types of the 6 combinations of hypothetical splice-isoforms. Amplificatory the cDNA fragment cloned in pCR2.1 (Invitrogen), and his nucleotidyltransferase was determined using the analyzer sequence ABI3100.

The results revealed that there is a splice-isoforms encoding the 4 types of membrane-bound genes TARM (m1, m2, m3 and m4) and one type of gene TARM secretory type (s1) (figure 1).

(2) Analysis of gene expression mTARM

Analyzed the gene expression mTARM in normal tissues of the mouse. As described above, due to the presence of splice-isoforms designed 3 types of sets of primers.

Set 1 (the Primers were designed so that they can be used to specifically amplify isoforms m1 and m2.)

mTARM_qF2: TCTGTGATAGACAACCATCT (SEQ ID no: 30)

mTARM_qR2: GTCATTGTACCCGGGGTCTT (SEQ ID no: 31)

Set 2 (the Primers were designed so that they can be used to specifically amplify isoforms m3 and m4.)

mTARM_qF4: ATGACAGAAGGCTACACTGTGGATAA (SEQ ID no: 32)

mTARM_qR3: TCATTTTTCTCCTGGGGCAC (SEQ ID no: 33)

Set 3 (the Primers were designed so that they can be used to specifically amplify the isoforms s1.)

mTARM_qF3: GATCTCTGTGATAGATGCAAG (SEQ ID no: 34)

mTARM_qR2: GTCATTGTACCCGGGGTCTT (SEQ ID no: 35)

Using set for PCR RNA (TAKARA) single-stranded cDNA was synthesized, based on the total RNA obtained from each organ of the mouse, using minnebar RNeasy (QIAGEN)or from commercial total RNA from each organ (Promega). Using the thus synthesized single-stranded cDNA as template, real-time PCR was performed using ABI7700. PCR was performed using reactio the aqueous solution of the following composition (12,5 ál QuantiTect SYBR GreenPCR Master Mix (QIAGEN), 0,25 μl uracil-DNA glycosylase (Invitrogen), with 0.125 μl of 100 μm F-primer, a 0.125 μl of 100 μm R-primer, and 2.5 µl of matrix cDNA (10-fold dilution) and of 7.25 μl of distilled water).

For this PCR, after treatment at 94°C for 10 minutes, the reaction cycle consisting of 94°C-30 seconds and 60°C-1 minute, repeated 35 times.

The result found that mTARM highly expressed in the bone marrow (figure 2).

Then analyzed the expression of mTARM in different cell types.

Using minnebar RNeasy (QIAGEN), total RNA was obtained from each type of cells, isolated and purified from the spleen of the mouse, cells, culturedin vitroand from different types of cell lines. Next, single-stranded cDNA was synthesized, based on the total RNA using a kit for PCR RNA (TAKARA). Using single-stranded cDNA as template, real-time PCR was performed using ABI7700 as well as PCR for analysis of gene expression in normal mouse tissues.

The result found that mTARM highly expressed in dendritic cells derived from bone marrow (figure 3).

[Example 2] to Obtain antibodies against TARM mouse and the analysis of gene

(1) Obtaining cells expressing mTARM

Vector for gene expression mTARM received as follows :

Primers were designed based on the nucleotide sequence of the isoform m1.

p> mTARM F2: cgcgtcgacgccaccATGATCTCTAGGCTCCTttccctt (SEQ ID no: 36)

mTARM R2: gcgggcggccgcTTACCAGGGTTTATTTGGAGacag (SEQ ID no: 37)

Using set for PCR RNA (TAKARA) single-stranded cDNA was synthesized, based on the total RNA bone marrow. Thus, the synthesized single-stranded cDNA was used as matrix. PCR was carried out using the reaction solution of the following composition (5 μl of 10×buffer, 4 μl of 2.5 mm dNTP, and 0.5 μl of Pyrobest polymerase (TAKARA), and 0.5 μl each of 100 μm primers, 1 µl of cDNA, and 2.5 μl of DMSO and 36 μl of distilled water). For this PCR, after treatment at 94°C for 5 minutes, the reaction cycle consisting of 94°C for 30 seconds, 65°C-30 seconds, and 72°C for 5 minutes was repeated 35 times. In conclusion, the reaction was carried out at 72°C for 2 minutes. Amplified cDNA was cloned into pBlueScriptII SK(+) (Stratagene), and its nucleotide sequence was then confirmed using the analyzer sequence ABI3100. The resulting cDNA fragment was inserted in expressing vector pMXII IRES EGFP (Oncogene (2000) 19(27):3050-3058) to get expressing vector for gene mTARM.

Recombinant retrovirus was received, as follows :

3×106cells 293/EBNA-1 (Invitrogen) suspended in medium (D-MEM/10% FBS), were placed at 10-cm Cup and then cultured in an incubator with CO2within 24 hours. On the following day the medium was replaced with fresh solution and the solution for transfection, obtained the, as described below, was then added to the medium to perform the transfection. The solution for transfection was obtained by adding 600 ál of OPTI-MEM (GIBCO BRL) and 24 μl of TransIT LT1 (TaKaRa) in a 5 ml test tube to mix, then incubare the mixture at room temperature for 5 minutes and then adding 9 µg expressing vector and 9 µg pCL-Eco (Imgenex), used as packing vector, to the reaction mixture followed by incubation of the mixture at room temperature for 5 minutes. 48 hours later, supernatant was collected for culture and then to obtain the solution of the recombinant virus was carried out by filtration through a 0.45 µm filter.

To obtain cells expressing mTARM, cells B300.19 (EMBO J. (1984) 3:1209-1219) infected with this recombinant virus as described below. 1×106cells B300.19 was added in 15 ml test tube, and then centrifuged at 1200 rpm at 25°C for 5 minutes. Next, the culture supernatant was removed by suction. A solution prepared by adding a mixture of 2 μl of polybrene (10 mg/ml) and 2 μl of 55 μm 2-mercaptoethanol to a 2 ml solution of recombinant virus was added to cells. The resulting mixture was then centrifuged at 2500 rpm at 30°C for 2 hours in order to infect cells with the recombinant virus. After infection solution of recombinant virus was removed and there was added to the medium (RPMI-1640/10% FB/55 μm 2-mercaptoethanol), followed by cultivation. To obtain cells expressing mTARM, EGFP-positive cells were isolated by sorting the cells.

(2) Obtaining chimeric protein by fusion of the extracellular region mTARM with SEAP or Fc

First, the received vector pcDNA3.1(+)-SEAP(His)10-Neo, as follows.

Removal of endogenous SalI site of the vector pcDNA3.1(+)-Neo (Invitrogen) was digested with SalI followed by blunt end and re-legirovaniem. The cDNA fragment SEAP(His)10amplified by PCR using pDREF-SEAP His6-Hyg (J. Biol. Chem., 1996, 271, 21514-21521) as a matrix, and by using a 5'-primer with added stretch for HindIII and 3'-primer with added stretch for XhoI. The resulting cDNA fragment was digested HindIII and XhoI, and then inserted into the vector pcDNA3.1(+)-Neo, which removed the SalI site.

Then extracellular region mTARM amplified by PCR using the full-size cDNA mTARM as a matrix, and by using a 5'-primer with added stretch for SalI (mTARM_F2: (SEQ ID No. 36)and 3'-primer with added stretch for NotI (mTARM_R3: cgcggcggccgcattatccacagtgtagccttctgtcat (SEQ ID No. 38)). PCR was carried out in the reaction solution of the following composition (5 μl of 10×buffer, 4 μl of 2.5 mm dNTP, and 0.5 μl of Pyrobest polymerase (TAKARA), and 0.5 μl each of 100 μm primers, 1 µl of cDNA, and 2.5 μl of DMSO and 36 μl of distilled water). For this PCR, after treatment at 94°C for 5 minutes, implement the operating cycle, consisting of 94°C for 30 seconds, 65°C-30 seconds, and 72°C for 5 minutes was repeated 35 times. In conclusion, the reaction was carried out at 72°C for 2 minutes. Amplified cDNA was cloned into pBlueScriptII SK(+) (Stratagene), and its nucleotide sequence was then determined using the analyzer sequence ABI3100. The resulting cDNA fragment was digested SalI and NotI, and then inserted into the aforementioned expressing vector pcDNA3.1(+)-SEAP(His)10-Neo, to obtain a vector for the expression of mTARM-AP.

Thus, carried out the merger of the extracellular region mTARM through a 3-amino acid linker (Ala-Ala-Ala) with alkaline phosphatase human placental secretory type, with 10-his-tag tag (His)10at its C-end, for expression as chimeric secretory protein (hereinafter referred to as chimeric protein AP). The received vector for expression of a chimeric protein AP was introduced into the cells 293/EBNA-1 using TransIT LT1 (TAKARA), and then were cultured for 4 or 5 days. Next, the culture supernatant was collected by centrifugation, and the chimeric protein AP secreted into the supernatant was then filtered through a 0.22 μm filter. Next to it was added Hepes (pH 7,4) and sodium azide to a final concentration of 20 mm and 0.02%, respectively, and the obtained product was stored at 4°C. the Concentration of the chimeric protein AP was calculated by measuring the activity of alkaline shall hosphatase using chemiluminescent analysis of reporter gene Aurora AP (ICN).

(3) generation of monoclonal antibodies against mTARM

For use as antigen in the immunization was first purified chimeric protein mTARM-AP.

This cleanup was performed using his-tag tag present at the C-end of the chimeric protein AP, and set His Trap (Amersham Biosciences). The culture supernatant containing the chimeric protein mTARM-AP was added to 1 ml of chelating HP HiTrap column (Amersham Biosciences) followed by rinsing with a solution of 10 mm imidazole. Next chimeric protein mTARM-AP was suirable from the column using a solution of 500 mm imidazole. The concentration of the chimeric protein mTARM-AP was calculated by measurement of enzyme activity using a chemiluminescent analysis of reporter gene Aurora AP (ICN) and using quantitative protein determination using a set of Protein Assay II (BIO-RAD).

The obtained chimeric protein mTARM-AP was mixed with TiterMax and then were immunized them WKY rats (Japan SLC, Inc.). From the thus immunized rats were isolated lymphocytes. Lymphocytes were mixed with myeloma cells P3 (ATCC) so that the ratio of myeloma cells P3 to the lymphocytes was 1:5. Next, the cell fusion was carried out using a solution of PEG1500 (Boehringer). Hybridoma selectively in the environment HAT (Invitrogen), and culture supernatant obtained hybridomas were subjected to screening using a sandwich ELISA using a chimeric protein mTARM-Fc. OS is Westlake cloning and positive holes got 3 types of clones (No. 6, No. 21 and No. 37). Cells B300.19, which was introduced mTARM-IRES-EGFP, was given the opportunity to interact with antibodies to mTARM followed by FACS analysis. The resulting antibodies interacted only with cells B300.19 in which expressively EGFP (pigv), and it was confirmed, therefore, the specificity of antibodies to mTARM.

Hybridoma producing the obtained monoclonal antibodies anti-mTARM No. 6, No. 21 and No. 37, was inoculable in the peritoneal cavity "Nude" mice, and then received ascitic fluid. Next, the antibody was purified using column G-protein. Hybridoma producing monoclonal antibodies anti-mTARM No. 6, deposited in National Institute of Advanced Industrial Science and Technology, International Patent Organism Depositary under inventory No. FERM BP-10376.

(4) Expression of protein TARM in cultured dendritic cells derived from bone marrow

Using the obtained monoclonal antibodies (mAb) have analyzed the expression of protein TARM on the cell surface of cultured dendritic cells derived from bone marrow.

Such cultured dendritic cells derived from bone marrow were obtained in the following way. Bone marrow cells of male C57BL/6 mice (Japan SLC, Inc.) suspended in the medium (RPMI1640/10% FBS/1 mm sodium pyruvate/55 μm 2-mercaptoethanol), which contained GM-CSF mouse (20 ng/ml) (R & D system), at a concentration of 2×106cells/10 ml The cells were placed in 10-cm uncoated Cup and then cultivated. 3 days later was added 10 ml of medium, which contained GM-CSF mouse (20 ng/ml), and then continued cultivation. Then 3 days later, 10 ml of the culture solution was collected and then centrifuged. Next clumps of cells suspended in 10 ml of fresh medium that contained GM-CSF mouse (20 ng/ml), and the resulting slurry is then returned to the original uncoated 10-cm Cup, followed by cultivation for 2 days. Thus derived immature dendritic cells suspended in the medium, which contained LPS (100 ng/ml) (Sigma), at a concentration of 1×107cells/10 ml in Order to obtain Mature dendritic cells, the cells were placed in 10-cm plates and then cultured for 1 day.

Immature dendritic cells derived from bone marrow, suspended in FACS buffer (PBS/1% FBS/1 mm EDTA)containing 5% mouse serum, and exercised their interaction with antibodies No. 6 or antibodies No. 21 (10 μg/ml). Next, cells were incubated with PE-labeled donkey secondary antibodies against rat IgG (Jackson), with subsequent measurement on FACSCalibur (BectonDickinson). As a result an antibody No. 6, and antibodies No. 21 had positive reactions, which was stronger than the response obtained with rat IgG was used as negative control

Thus, in detail, to analyze cells expressing mTARM, antibody No. 6 was fluorescently labelled with kit for labeling monoclonal antibodies Alex647 (Molecular Probe). Then immature dendritic cells or Mature dendritic cells obtained by the stimulation of LPS, suspended in FACS buffer (PBS/1% FBS/1 mm EDTA)containing 5% mouse serum and 5% rat serum. Solution for driving FcR (BD Pharmingen) was added to the suspension and incubated on ice for 10 minutes. Next, the reaction mixture was subjected to reaction on ice for 30 minutes with fluorescently-labeled antibodies to mTARM, antibodies to the marker on CD11c dendritic cells and antibodies to CD40 activation token, and the expression level of the protein mTARM then measured using FACSCalibur.

The results revealed that the protein mTARM is expressed in immature and Mature dendritic cells that the expression of protein mTARM increases rather Mature dendritic cells from the bone marrow than in immature dendritic cells, and the protein mTARM strongly expressed in cells that expressed the activation marker CD40 (figure 5).

(5) the Expression of protein TARM in normal mice

Because the expression of mTARM was confirmed in dendritic cells derived from bone marrow, analyzed the protein expression mTARM in the immune tissues of normal mice.

Cells received and the bone marrow, peripheral blood, spleen, mesenteric lymph node and pieroway plaques male C57BL/6 mice. The thus obtained cells suspended in FACS buffer (PBS/1% FBS/1 mm EDTA)containing 5% mouse serum and 5% rat serum. Solution for driving FcR was added to the suspension and incubated on ice for 10 minutes. Next, the reaction mixture was subjected to reaction on ice for 30 minutes with fluorescently-labeled antibodies to mTARM and different types of fluorescently-labeled antibodies to markers of cell lines, and the expression level of the protein mTARM then measured using FACSCalibur.

As a result, in the immune tissues of normal mice the expression of protein mTARM not observed in all T-cells CD3+, NK-cells DX5+, myeloid cells CD11b+ dendritic cells, CD11c+ spleen (SP), and b cells B220+, monocytes/macrophages F4/80+, neutrophils Grl+ with high SSC and eosinophils F4/80+ high SSC in the peripheral blood (PBL) (6).

Thus, the expression of protein mTARM in peripheral tissues of normal mice were analyzed using cells derived from the peritoneal cavity of mice.

As a result, the expression of protein mTARM not observed in T-cells CD3+, NK-cells DX5+, dendritic cells, CD11c+, b cells B220+, monocytes/macrophages F4/80+ and neutrophils Grl+ with high SSC from the peritoneal cavity. However, such expression was observed in frequent the myeloid cells CD11b+. Thus, carried out further analysis. The results revealed that the protein mTARM is expressed on mast cells (c-kit+ (Fig.7).

(6) Induction of protein expression TARM on dendritic cells during inflammatory stimulation LPS

Protein mTARM expressively on cultured dendritic cells, but this expression of protein mTARM not observed on dendritic cells derived from lymphoid and peripheral tissues of mice. Therefore, hypothesized that the expression of protein mTARM is induced by inflammatory stimulationin vivo. Thus, male C57BL/6 mice were injected with 100 µg of LPS intraperitoneally. 14-18 hours later, cells were collected from the mesenteric lymph node and then analyzed the expression of protein mTARM.

As a result, the expression of protein mTARM observed in myeloid dendritic cells, CD11c+/CD11b+, which migrated into the mesenteric lymph node in inflammatory stimulation of LPS (Fig). Accordingly, revealed that the protein mTARM is not expressed on the cell surface of dendritic cellsin vivoin normal conditions, but that it is selectively expressed on dendritic cells, and, in particular, myeloid dendritic cells during inflammation. Thus, it is hypothesized that protein mTARM functions on dendritic cells during inflammation.

[Example 3] Activation of cultured dendritic cleto the bone marrow-derived antibodies anti-TARM

mTARM selectively expressed on dendritic cells. Thus, analyzed the activation of such dendritic cells cross-stimulation mTARM.

Immature dendritic cells or Mature dendritic cells of bone marrow origin suspended in a concentration of 1×108cells in 350 ál of buffer for MACS (PBS/1% FBS/2 mm EDTA). 50 μl of the solution for driving FcR (Miltenyi) was added to the suspension and incubated at 4°C for 10 minutes. Next, 100 µl of the bus with CD11c (Miltenyi) was added to the reaction mixture and incubated at 4°C for 30 minutes. The cells CD11c+ were isolated and purified using Auto-MACS (Miltenyi). Antibody F(ab)'2 to rat IgG (10 μg/ml) (Jackson) was immobilized on 96-well-plate at 37°C for 2 hours, and the plate is then washed with PBS. Further, antibodies to mTARM No. 6, No. 21 or rat IgG (10 μg/ml), used as negative control, was immobilized on the plate at 37°C for 1 hour. The tablet then washed with PBS, and treated dendritic cells, CD11c+ cultivated in the environment or in an environment that contained agonistic antibodies, anti-CD40 (BD Pharmingen) at a final concentration of 2 μg/ml for 24 or 48 hours later, the culture supernatant was collected and cytokines were then detected using the kit DuoSet ELISA Development (R & D).

The results revealed that antibodies to mTARM induce the production of IL-6 Mature dendritic cells costoms the new origin at the level similar levels of antibodies anti-CD40, and had an additive effect with antibodies anti-CD40 (figa). Similarly, the above-mentioned antibodies had a tendency to induce the production of IL-6 also in immature dendritic cells. Moreover, antibodies anti-mTARM induced production of MCP-1 immature dendritic cells from bone marrow, antibodies, anti-CD40 not induced such products MCP-1 (pigv). The induction of the production of MCP-1 antibodies to mTARM not observed in Mature dendritic cells from bone marrow. Moreover, the study also analyzed the induction of production of IL-12, TNFα, IL-1β, IL-10 and KC, but antibodies anti-mTARM had no significant effects on immature dendritic cells and Mature dendritic cells.

Based on the above results confirmed that mTARM on dendritic cells is associated with the production of specific cytokines and chemokines (such as IL-6 and MCP-1).

[Example 4] the Formation of the complex between TARM and FcRγ chain

It is revealed that mTARM functions as a receptor that activates dendritic cells. Next explored the molecule that transmits the signal. mTARM has a transmembrane region, similar to the transmembrane region of the Oscar, which is involved in the differentiation of osteoclasts. It is known that Oscar forms a complex with the FcRγ chain, transmitting the signal molecule is well known as a component of the receptor for IgE Is allowed to assume, the interaction between the basic amino acid in the cellular transmembrane region Oscar and acidic amino acid FcRγ chain participates in the above-mentioned Association. mTARM also contains a basic amino acid in its transmembrane region. On the other hand, DAP10 and DAP12 known as molecules that transmit the activation signal with an acidic amino acid in its transmembrane region, and the FcRγ chain. Thus, analyzed the possibility of complex formation between the FcRγ chain, DAP10 or DAP12 and mTARM.

Each of expressing vectors for the FcRγ chain, DAP10 and DAP12 were obtained by inserting the cDNA fragment, amplified using the following primers, designed based on the nucleotide sequences, which are presented in the form of NM_010185, AF072846 and NM_011662 in GenBank™, in expressing vector pMXII IRES-Puro, designed so that the sequence Flag label attached at N-end, can be expressed on the cell surface.

FcRF: cgcctcgagCTGGGAGAGCCGCAGCTCTGCTAt (SEQ ID no: 39)

FcRR: gcgggcggccgcCTACTGGGGTGGTTTCTCATgctt (SEQ ID no: 40)

DAP10 F: cgcgtcgacCAGACATCGGCAGGTTCCTGCTCc (SEQ ID no: 41)

DAP10 R: gcgggcggccgcTCAGCCTCTGCCAGGCATGTtgat (SEQ ID no: 42)

DAP12 F: cgcgtcgacTTAAGTCCCGTACAGGCCCAGAGt (SEQ ID no: 43)

DAP12 R: gcgggcggccgcTCATCTGTAATATTGCCTCTgtgt (SEQ ID no: 44)

Next, the recombinant retrovirus was obtained in a manner similar to that used in isovale to obtain cells, expressing mTARM, and cells B300.19 expressing mTARM, then infected with recombinant retrovirus. Next, cells were cultured in the presence of puromycin and then selected the infected cells. The resulting transfectants B300.19 suspended in FACS buffer (PBS/1% FBS/1 mm EDTA) and subjected to interaction with antibodies No. 6 and murine antibodies anti-Flag (Sigma) at a final concentration of 10 μg/ml. Then they were subjected to interaction with PE-labeled donkey secondary antibody to rat IgG (Jackson) and Cy5-labeled donkey secondary antibodies to mouse IgG (Jackson) with subsequent measurement of the expression level using a FACSCalibur (Becton Dickinson).

The results revealed that if mTARM and FcRγ chain simultaneously expressed, increases the level of expression of FcRγ chain on the cell surface with increasing expression level mTARM on the cell surface. The levels of expression of DAP10 and DAP12 on the cell surface was not dependent on the expression level mTARM. Accordingly, it was suggested that the level of expression of FcRγ chain on the cell surface increases with the formation of its complex with mTARM (figure 10).

Then mTARM-svyazyamie proteins were analyzed biochemically.

The transfectants B300.19 suspended in the buffer for lysis of cells containing 1% of digitonin (1% digitonin/50 mm Tris-HCl (pH 7.5)/150 mm NaCl/5 mm NaF/1 mm orthovanadate/Complete™ (Roche)). Immunopro is epitacio was performed using antibodies anti-Flag, and analysis using Western blot turns then carried out using antibodies to mTARM No. 6.

The result found that mTARM was immunoprecipitated together with the FcRγ chain, but either DAP10 or DAP12 was not immunoprecipitated together with mTARM (figa). Immunoprecipitation FcRγ chain, DAP10 and DAP12 antibody anti-Flag confirmed by analysis using Western blot turns with antibodies anti-Flag. In addition, the expression of mTARM marked by Flag FcRγ chain, DAP10 and DAP12 in transfectants B300.19 confirmed by analysis using Western blot turns lysates of cells using antibodies to mTARM No. 6 or antibody anti-Flag. Accordingly, it was revealed that the FcRγ chain forms a complex with mTARM in the transfectants B300.19.

Moreover, Mature dendritic cells of bone marrow origin suspended in the buffer for lysis of cells containing 1% digitonin. Immunoprecipitation was performed using rat IgG as a negative control antibody to mTARM No. 21, antibodies anti-CD54 antibodies to the FcRγ chain, and analysis using Western blot turns then carried out using antibodies to the FcRγ chain.

The result found that the FcRγ chain was immunoprecipitated together with mTARM and that other protein cell membrane CD54 and FcRγ chain not-immunoprecipitation (pigv). Accordingly, it was revealed that the FcRγ chain and mTARM form a complex in Mature dendritic cells.

This result is suggested, the activation of dendritic cells cross-stimulation using mTARM mediated signal transmission from the FcRγ chain.

[Example 5] the Adhesion of activated lymphocytes to the immobilized TARM

(1) the Expression mTARM-binding molecules on activated T-cells

It is known that dendritic cells act as antigen presenting cells and interact with T-cells. Thus, we can assume that the molecules that are associated with mTARM is expressed on T-cells and that activation of dendritic cells is regulated by these molecules. Accordingly, we analyzed the presence or absence mTARM-svyazyami molecules on T-cells.

4×107the spleen cells of male mice C57BL/6 suspended in 70 μl of buffer for MACS (PBS/1% FBS/2 mm EDTA), and 10 µl of a solution for driving FcR (Miltenyi) was added to the suspension. The mixture was then incubated at 4°C for 10 minutes. 100 µl of the bus CD4 (Miltenyi) was then added to the reaction mixture and incubated at 4°C for 15 minutes. Next Auto MACS used to get resting T-cells are CD4+. CD4+, which was purified by MACS, suspended in medium (RPMI1640/10% FBS/1 mm sodium pyruvate/55 μm 2-mercaptoethanol) at a concentration of 1×106cells/ml of the suspension was added to the tablet, which was immobilized antibodies anti-CD3 (eBioscience) in a solution of 1 μg/ml at 37°C for 2 h is in and stimulated in the presence of 2 μg/ml of antibodies anti-CD28 (Pharmingen). If T-cells CD4+ differentiated into Th1, then the stimulation of antibodies anti-CD3 was carried out in the presence of IL-12 mouse (10 ng/ml) (Peprotech) and antibodies to IL-4 mouse (10 μg/ml) (MP4-25D2; Pharmingen). If T-cells CD4+ differentiated into Th2, then the stimulation of antibodies anti-CD3 was carried out in the presence of IL-4 mouse (15 ng/ml) (Genzyme) and antibodies to IL-12 mouse (15 μg/ml) (24910.1; Pharmingen). Two days after stimulation, in the case of Th1 added IL-2 mouse (20 ng/ml) (Genzyme) and IL-12 mouse (10 ng/ml), followed by cultivation. In the case of Th2 added IL-2 mouse (20 ng/ml) and IL-4 mouse (15 ng/ml), followed by cultivation. Differentiation into Th1 and Th2 confirmed by the production of IFN-γ and IL-4 respectively.

Resting T-cells CD4+ immediately after purification by MACS and activated T-cells CD4+ at 2 and 8 days after stimulation through CD3 was used to analyze the binding activity of the chimeric protein mTARM-AP on the cell surface. These cells are suspended in FACS buffer (PBS/1% FBS) and were subjected to interaction on ice for 30 minutes with a chimeric protein mTARM-AP or protein AP, used as a negative control at a final concentration of 30 μg/ml was Then added rabbit antibodies anti-PLAP (6000-fold dilution) (COSMO BIO Co., Ltd.) and then cooperated with them on ice for 30 minutes. Next I added PE-labeled donkey antibody to rabbit IgG (H + L) (50-fold dilution)(Jackson) and then cooperated with them on ice for 30 minutes. The binding activity of the chimeric protein mTARM-AP was measured using FACSCalibur.

The results revealed that mTARM-svyazyamie molecule is not expressed on resting T-cells CD4+, but that such expression is induced in activated T-cells CD4+ (Fig). mTARM-binding molecules that are already expressibility 2 days after stimulation and expression, also survived 8 days after stimulation. Such mTARM-binding molecules expressibility in terms of the differentiation of both Th1 and Th2. 8 days later, the expression mTARM-binding molecules in Th2-cells had a tendency to exceed this expression in Th1 cells (Fig).

(2) Adhesion of activated T-cells to recombinant protein mTARM

Next, we analyzed the possibility of functioning mTARM as adhesion molecules on activated T-cells.

First, 50 μl of antibodies against alkaline phosphatase (10 μg/ml) (Seradyn) was added to each well of 96-hole tablet for ELISA (Nunc) and incubated at 37°C for 30 minutes to immobilize. After washing by PBS, nonspecific binding sites were scored by Block Ace (Dainippon Pharma Co., Ltd.). Chimeric protein AP (10 nm) was added to each well and incubated at room temperature for 30 minutes to immobilize. In 6-9 days after stimulation, activated T-cells suspended in buffer for adhesion cell (RPMI164/0,5% BSA/20 mm HEPES (pH 7,4)) with subsequent fluorescent labeling by Calcein-AM (Dojindo Laboratories). Next, 1×105cells were added to each well and incubated at 37°C for 1 hour. Neprecejusies cells were removed by washing and then the wells were added to the buffer for lysis of the cells (10 mm Tris-HCl (pH 8.0)/1% TritonX-100). Further, the measurement was carried out at the wavelength of excitation 485 nm and the wavelength of detection 535 nm using a Wallac ARVO SX 1420 MULTILABEL COUNTER (PerkinElmer), and then quantify adherent cells. Regarding the level of cell adhesion ratio of adherent cells to the added cells were expressed as a percentage.

The results revealed that mTARM functions as adhesion molecules on activated T-cells (Fig). Both Th1-and Th2-cells have the adhesive activity against mTARM. The adhesive activity of Th2 cells relative to mTARM has a tendency to exceed the activity of Th1 cells in relation to mTARM.

[Example 6] Activity by inhibition of adhesion of cells in antibody anti-TARM

Analyzed the effect of antibodies anti-TARM on cell adhesion Th2 cells to mTARM.

10 μg/ml of antibodies to mTARM added to Th2-cells and pre-processed at room temperature for 10 minutes. Next, the resulting cells were added to the tablet with immobilized chimeric protein mTARM-AP and analyzed the activity of cell adhesion in the presence of antibodies.

In the result, the adhesion of Th2 cells to the chem is a wounded squirrel mTARM-AP was largely suppressed by any of the antibodies to mTARM No. 6, No. 21 and No. 37 (Fig).

[Example 7] therapeutic effect of the antibody anti-TARM on the model of collagen-induced arthritis

Model of collagen-induced arthritis (CIA) is a model of the autoimmune disease rheumatoid arthritis. Since detects T cells CD4+ and antibodies that react with collagen type II, we assume that both operate together in the induction of arthritis. In addition, it was reported that the susceptibility in the CIA model is associated with the MHC class II molecule. TARM is activating molecule, which is expressed on dendritic cells and induces cell adhesion of activated T-cells by TARM-binding molecules. Accordingly suggested that the interaction between dendritic cells and activated T-cells is inhibited by antibodies anti-TARM, thus possibly supressive immune response associated with dendritic cells or activated T-cells. Thus, analyzed therapeutic effect of the antibody anti-TARM on the model of CIA.

3% solution of bovine collagen type II articular origin (Collagen Gijutsu Kenshukai) and complete adjuvant's adjuvant (Difco) was mixed in equal amounts to obtain the emulsion. Next, 100 μl of the emulsion (150 μg/mouse) was subcutaneously injected into the tail of the mouse DBA/1J at 5 weeks of age (Charles River Laboratories Japan, Inc.) so the mouse was immunized at 21 days (initial immunization) and 0 day (re-immunization). After re-immunization antibody mTARM No. 6 was injected intravenously at a dose of 500 mcg twice a week. Through 3 days after the second immunization was carried out by measurement of body weight and external evaluation. On the 13th day, the mice were scored. External indicators were evaluated using the following scale. Namely, 0: normal; 1: erythema and mild swelling confined to the mid-foot (Tarsus) or ankle joint; 3: erythema and moderate swelling extending from the ankle to metatarsal joint; 4: erythema and severe swelling of the entire part, extending from the ankle, foot and toes.

Consequently, as a result of the introduction of antibodies to mTARM observed a marked relief of symptoms and delay reduction of body weight (Fig).

Moreover, heparinized blood was collected from the inferior Vena cava scored mice and measured the plasma concentrations of serum amyloid A (SAA) and the titer of antibodies to collagen. SAA is a plasma protein produced by the liver cells under the action of cytokines produced during inflammatory stimulation. The concentration of SAA in plasma is used as an indicator of inflammation. The titer of antibodies to collagen is used as an indicator of antigen-specific immune response.

The concentration of SAA in plasma was measured using an ELISA kit (BioSource) the use of plasma, divorced 8000 times.

Moreover, the titer of antibodies to collagen in the plasma was measured as follows.

First, 50 μl of a solution of 5 μg/ml bovine collagen type II articular origin was added to each well of 96-hole tablet for ELISA (Nunc) and incubated at 4°C overnight for immobilization. Next, the wells were washed with T-PBS (0.02% tween-20/PBS), and nonspecific binding sites were scored 1% BSA/PBS. The wells were washed with T-PBS 3 times and 50 μl of plasma was diluted 100,000 times with T-PBS, was then added to each well followed by incubation at room temperature for 2 hours. Next, the wells were washed with T-PBS 3 times, and biotinylated against mouse IgG1 (BD) and biotinylated against mouse IgG2a (BD) 50 ál each, which were diluted 1000 times with T-PBS, was then added to each well followed by incubation at room temperature for 2 hours. The wells were washed with T-PBS 3 times, and 50 μl of HRP-labeled streptavidin (Pierce), which was diluted 5000 times with T-PBS, was then added to each well followed by incubation at room temperature for 30 minutes. Next was added chromogenic substrate, and developing the painting.

As a result the concentration of SAA in plasma decreased with the introduction of antibodies to mTARM (Fig). However, the titer of antibodies to collagen in plasma were not affected by antibodies to mTARM (Fig).

[Example 8] the Definition of a full-sized after which outermost gene TARM person

To identify gene TARM man, a BLAST search was performed using the gene sequence TARM mouse. In the detected sequence with a high degree of homology with the cDNA sequence of TARM mouse (inventory No. in GenBank XM_497642). However, the signal sequence is absent in the amino acid sequence (LOC441864)encoded such XM_497642, and thus, it is not possible to assume that the above sequence functions as a protein in the cell membrane. Suggested that XM_497642 is a hypothetical sequence and that the sequence of cDNA, from genomic sequence is incorrect. Thus, efforts to determine the full sequence of the gene TARM person. Identified tissue with expression of TARM and full-size cDNA sequence TARM has identified the implementation of the 5'- and C'-RACE. Accordingly, based on the sequence region that encodes a protein TARM, designed the primers, and then allocated the full-size cDNA.

(1) Analysis of gene expression TARM person

First analyzed the expression of hTARM in human tissues. The primers were designed on the basis of inventory No. GenBank XM_497642.

hTARM F1: TGTGAATACTACAGAAAAGCATCC (SEQ ID no: 45)

hTARM R1: TCCACCTGCGGTCACTGTACCCCT (SEQ ID no: 46)

The result found that the gene hTARM, as in the case of gene mTARM, highly expressed in the bone marrow (Fig).

(2) Isolation of the gene TARM person

Because the gene hTARM is expressed in the bone marrow, the total RNA bone marrow used for the implementation of the 5'-RACE and 3'-RACE, to try to determine the full sequence of the gene hTARM.

First, double-stranded cDNA was synthesized, based on the total RNA from bone marrow, using the kit for cDNA synthesis (TAKARA), and cDNA was then purified using the kit for purification of PCR products Qiaquick (Qiagen). Then there was added adapter ad29, and the thus obtained product was used as matrix for the RACE. The 1st PCR was carried out using the reaction solution of the following composition (5 μl of 10×b is Fehr ExTaq, 4 μl of 2.5 mm dNTP, and 0.25 μl of ExTaq and 0.5 μl of 100 μm primer (5'PCR4), and 0.5 μl of 100 μm gene-specific primer, 1 μl of cDNA added adapter ad29 (25-fold dilution) and 38,75 ál of distilled water).

The following sequences were used as primers.

5'PCR4: AGCTACGCTGAAGTATCAACGCAGAG (SEQ ID no: 21)

hTARM_RACE_5'_4: CTTCTGGCACTGCAGAGTCACCCT (SEQ ID no: 47), or

hTARM_RACE_3'_4: GGAGAGTACACCTGTGAATACTAC (SEQ ID no: 48)

For this PCR, after treatment at 94°C for 5 minutes, the reaction cycle consisting of 94°C for 30 seconds, 65°C-1 minute, and 72°C for 5 minutes was repeated 30 times. In conclusion, the reaction was carried out at 72°C for 5 minutes.

The 2nd PCR was carried out using the reaction solution of the following composition (5 μl of 10×ExTaq buffer, 4 μl of 2.5 mm dNTP, and 0.25 μl of ExTaq and 0.5 μl of 100 μm primer (5'PCR1), and 0.5 μl of 100 μm gene-specific primer, 1 μl of the product of the 1st PCR (100-fold dilution) and 38,75 ál of distilled water).

The following sequences were used as primers.

5'PCRl: (SEQ ID no: 24),

h29B140 F1: TGTGAATACTACAGAAAAGCATCC (SEQ ID no: 49),

or

h29B140 R1: TCCACCTGCGGTCACTGTACCCCT (SEQ ID no: 50)

For this PCR, after treatment at 94°C for 5 minutes, the reaction cycle consisting of 94°C for 30 seconds, 65°C-30 seconds, and 72°C for 5 minutes was repeated 25 times. In conclusion, the reaction was carried out at 72°C for 5 minutes. Amplificatory the cDNA fragment cloned in pCR2.1 (Invitrogen), and its nucleotide sequence determined the Yali using the analyzer sequence ABI3100.

The result was obtained (SEQ ID No. 9) 5'- and 3'nucleotide sequence that is completely different from the sequence presented as XM_497642.

The following primers were designed using the information on the nucleotide sequence obtained by RACE:

h29B140_Sall-Kozac_F:

cgcgtcgacGCCACCATGATCCCTAAGCTGCTttccctc (SEQ ID no: 51)

h29B140_NotI-R: cgcgcggccgcCTAGCGCATGCTACCCTTGGCagc (SEQ ID no: 52)

With these primers was carried out by PCR using the single-stranded cDNA as a matrix, synthesized from total RNA bone marrow using a kit for PCR RNA (TAKARA). PCR was carried out in the reaction solution of the following composition (5 μl of 10×buffer, 4 μl of 2.5 mm dNTP, and 0.5 μl of Pyrobest polymerase (TAKARA), and 0.5 μl each of 100 μm primers, 1 µl of cDNA, and 2.5 μl of DMSO and 36 μl of distilled water). For this PCR, after treatment at 94°C for 5 minutes, the reaction cycle consisting of 94°C for 30 seconds, 65°C-30 seconds, and 72°C for 5 minutes was repeated 35 times. In conclusion, the reaction was carried out at 72°C for 2 minutes. Amplified cDNA was cloned into pBlueScriptII SK(+) (Stratagene), and its nucleotide sequence was then determined using the analyzer sequence ABI3100. The obtained nucleotide sequence of the cDNA hTARM were identical sequence, which was determined using RACE (SEQ ID No. 9). Amino acid sequence (SEQ ID which is 10), encoded by cDNA hTARM, had a signal sequence at its N end, which is necessary for its function as a protein in the cell membrane. hTARC and amino acid sequence encoded XM_497642 (LOC441864)had different N-end and C-end. Accordingly, it is revealed that this hypothetical cDNA sequence, XM_497642, estimated on the basis of genomic sequence, in reality did not exist, and that cDNA hTARM were valid gene coding for a protein hTARM cell membrane (Fig).

[Example 9] antibodies against TARM person

(1) Obtaining cells expressing TARM person

The vector expressing the gene TARM man, was obtained by inserting cDNA hTARM obtained in example 8, in expressing vector pMXII IRES EGFP (Oncogene (2000) 19(27):3050-3058).

Recombinant retrovirus was received, as follows :

Cells 293/EBNA-1 (Invitrogen) in an amount of 3×106cells suspended in the medium (D-MEM/10% FBS) and were placed in 10-cm culture Cup, and cultured in an incubator with CO2within 24 hours. On the following day the medium was replaced with fresh, and then there to perform the transfection, the solution was added to the transfection, obtained as described below. The solution for transfection was obtained by adding 600 ál of OPTI-MEM (GIBCO BRL) and 24 μl of TransIT LT1 (TaKaRa) in a 5 ml test tube for mixing, ZAT is m incubated the mixture at room temperature for 5 minutes, and then added to the reaction mixture 9 µg expressing vector and 9 µg pCL-Eco (Imgenex), used as packing vector, followed by incubation of the mixture at room temperature for 5 minutes. 48 hours later, the culture supernatant was collected and to obtain the solution of the recombinant virus was then carried out by filtration through a 0.45 µm filter.

To obtain cells expressing hTARM, cells B300.19 infected with this recombinant virus as described below. 1×106cells B300.19 was added in 15 ml test tube, and then centrifuged at 1200 rpm at 25°C for 5 minutes. Next, the culture supernatant was removed by suction. A solution obtained by adding 2 ál of polybrene (10 mg/ml) and 2 μl of 55 μm 2-mercaptoethanol to a 2 ml solution of recombinant virus was added to cells. The resulting mixture was then centrifuged at 2500 rpm at 30°C for 2 hours in order to infect cells with the recombinant virus. After infection solution of recombinant virus was removed and there was added to the medium (RPMI-1640/10% FBS/55 μm 2-mercaptoethanol), followed by cultivation. To obtain cells expressing mTARM, EGFP-positive cells were isolated by sorting the cells.

(2) Obtaining chimeric protein formed by the fusion of the extracellular region hTARM with SEAP or Fc

Extracellular about the region hTARM amplified by PCR using the full-size cDNA hTARM as a matrix, and also using 5'-primer with added stretch for SalI (h29B140_SalI-Kozac_F: cgcgtcgacGCCACCATGATCCCTAAGCTGCTttccctc (SEQ ID No. 51)and 3'-primer with added stretch for NotI (h29B140_NotI_SEAP_R: gcgggcggccgcACCCAGGGAGTAGTTGCTCGatgt (SEQ ID No. 53)). PCR was carried out in the reaction solution of the following composition (5 μl of 10×buffer, 4 μl of 2.5 mm dNTP, and 0.5 μl of Pyrobest polymerase (TAKARA), and 0.5 μl each of 100 μm primers, 1 µl of cDNA, and 2.5 μl of DMSO and 36 μl of distilled water). For this PCR, after treatment at 94°C for 5 minutes, the reaction cycle consisting of 94°C for 30 seconds, 65°C-30 seconds, and 72°C for 5 minutes was repeated 35 times. In conclusion, the reaction was carried out at 72°C for 2 minutes. Amplified cDNA was cloned into pBlueScriptII SK(+) (Stratagene), and its nucleotide sequence was then confirmed using the analyzer sequence ABI3100. The resulting cDNA fragment was digested SalI and NotI, and then inserted into the vector pcDNA3.1(+)-SEAP(His)10-Neo, described in example 2, to obtain a vector for the expression of hTARM-AP.

Thus, carried out the merger of the extracellular region hTARM through triaminotoluene linker (Ala-Ala-Ala) with alkaline phosphatase human placental secretory type, with 10-his-tag tag (His)10at its C-end, for expression as chimeric secretory protein (hereinafter referred to as chimeric protein AP). The received vector for expression of a chimeric the tree AP was introduced into the cells 293/EBNA-1 using TransIT LT1 (TAKARA), and then were cultured for 4 or 5 days. Next, the culture supernatant was collected by centrifugation, and the chimeric protein AP secreted into the supernatant was then filtered through a 0.22 μm filter. Next to it was added Hepes (pH 7,4) and sodium azide to a final concentration of 20 mm and 0.02%, respectively, and the obtained product was stored at 4°C. the Concentration of the chimeric protein AP was calculated by measurement of alkaline phosphatase activity using a chemiluminescent analysis of reporter gene Aurora AP (ICN).

(3) generation of monoclonal antibodies against hTARM

For use as antigen in the immunization was first purified chimeric protein hTARM-AP.

This cleanup was performed using his-tag tag present at the C-end of the chimeric protein AP, and set His Trap (Amersham Biosciences). The culture supernatant containing the chimeric protein hTARM-AP was added to 1 ml of chelating HP HiTrap column (Amersham Biosciences) followed by rinsing with a solution of 10 mm imidazole. Next chimeric protein hTARM-AP was suirable from the column using a solution of 500 mm imidazole. The concentration of the chimeric protein hTARM-AP was calculated by measurement of enzyme activity using a chemiluminescent analysis of reporter gene Aurora AP (ICN) and using quantitative protein determination using a set of Protein Assay II (BIO-RAD).

Then the resulting hiberni the protein hTARM-AP was used as antigen and Balb/c mice were immunized by the above protein using Kohjin Bio Co. Ltd. Lymphocytes were isolated from immunized mice, and the selected cells were then mixed with myeloma cells P3U1. Next, the cell fusion was carried out by a method with PEG. Using the culture supernatant obtained hybridomas was carried out by screening by ELISA using recombinant protein hTARM-Fc. Cloning was carried out of the positive holes and got 6 types of clones(№ 11, № 18, № 19, № 22, № 26 and # 40). The analysis of specificity using FACS found that all clones reacted only with cells B300.19 expressing hTARM, and that they did not react with the parent cells B300.19. Hybridoma which have produced monoclonal antibodies anti-hTARM№ 11, № 18, № 19, № 22, № 26 and No. 40, was inoculable in the peritoneal cavity "Nude" mice, and from them received ascitic fluid. Next, the antibody was purified using a column with A-protein.

[Example 10] the Adhesion of activated T-cells to recombinant protein hTARM

Peripheral human blood was collected with heparin, and Ficoll-Paque PLUS (Amersham Biosciences) was added to it in equal quantity with peripheral human blood and mononuclear cells were isolated by centrifugation in density gradient at 400×g for 30 minutes. The selected cells are suspended in buffer for MACS (PBS/1% FBS/2 mm EDTA), and the solution for driving FcR (Miltenyi) was added to a suspension of the C rate of 5 μl/1×10 7cells. The resulting mixture was subjected to interaction at 4°C for 15 minutes. The set of Treg (Miltenyi) for selection of CD25+CD4+ human and Auto MACS used to get resting T-cells are CD4+. PE-labeled mouse antibodies to human CD25 (Miltenyi) and FITC-labeled mouse antibodies to human CD4 (Miltenyi), each in the amount 1/11 solution was added to the cells CD4+, which was purified by MACS. They were then subjected to interaction at 4°C for 20 minutes. Further FACS Aria (BD Biosciences) were used to produce T-cells CD4+CD25-. T cells CD4+CD25 - activated using a set of activation/propagation of T cells (Miltenyi). In 3 days after stimulation, cells were added IL-2 (2 ng/ml). The possibility of functioning of the chimeric protein hTARM-AP as an adhesion molecule for activated T-cells was analyzed with the use of activated CD4-positive T-cells, obtained on 6's and 8 days after stimulation.

First, 50 μl of antibodies against alkaline phosphatase (10 μg/ml) (Seradyn) was added to each well of 96-hole tablet for ELISA (Nunc) and incubated at 37°C for 30 minutes to immobilize. After washing by PBS, nonspecific binding sites were scored by Block Ace (Dainippon Pharma Co., Ltd.). Chimeric protein AP (10 nm) was added to each well and incubated at room temperature for 30 minutes to immobilize. Activerow is by T-cells suspended in buffer for adhesion cell (RPMI1640/0,5% BSA/20 mm HEPES/55 nm 2ME (pH 7,4)) with subsequent fluorescent labeling by Calcein-AM (Dojindo Laboratories). Next, 5×104cells were added to each well and then incubated at 37°C for 1 hour. Neprecejusies cells were removed by washing, and then the wells were added to the buffer for lysis of the cells (10 mm Tris-HCl (pH 8.0)/1% TritonX-100). Further, the measurement was carried out at the wavelength of excitation 485 nm and the wavelength of detection 535 nm using a Wallac ARVO SX 1420 MULTILABEL COUNTER (PerkinElmer) and quantify adherent cells. Regarding the level of adhesion of cells, the ratio of adherent cells to the added cells were expressed as a percentage.

The results revealed that hTARM functions as an adhesion molecule to the activated T-cells (Fig).

[Example 11] the Activity of the antibodies anti-TARM in the inhibition of cell adhesion

Analyzed the effect of antibodies anti-TARM on cell adhesion of activated T-cells to hTARM.

Chimeric protein AP was added to each well and then incubated at room temperature for 30 minutes to immobilize. Next, 10 μg/ml for each antibody anti-hTARM(№ 11, № 18, № 19, № 22, № 26 and # 40) was added to each well and pre-processed at room temperature for 30 minutes. Next there was added fluorescently-labeled activated T-cells and analyzed adhesive activity of cells in the presence of each antibody. It should be noted that antibodies anti-IgG2a and is used as a control for No. 11, No. 19, # 26 and # 40, and antibodies anti-IgG2b was used as a control for No. 18 and No. 22.

The result found that the adhesion of activated T-cells to chimeric protein hTARM-AP was significantly suppressed in the presence of antibodies to hTARM No. 18, No. 19, No. 22 and No. 26 and that partial inhibition of this adhesion was observed in the presence of antibodies to hTARM No. 11 and No. 40 (Fig).

[Example 12] Identification of a new ligand mTARM-L for mTARM

(1) Selection of molecules candidate for mTARM-L (ligand mTARM)

mTARM-binding molecules are present on activated T-cells (example 5). Thus, the presence or absence of mTARM-binding molecules on murine cell lines (L5178Y-R, BW5147 and Raw264.7)originating from immune cells, analyzed by the method described in example 5.

The results revealed that mTARM-binding molecule highly expressed on cells L5178Y-R, but that they are poorly expressed on BW5147 cells and Raw264.7 cells (figa).

Then under the assumption that the unknown ligand for mTARM belongs to the immunoglobulin superfamily (IgSF), searched in the database Mouse Ensemble. Focusing on the 47 candidates of the IgSF, the expression in immune cells was investigated using real-time PCR. Total RNA was isolated from cells L5178Y-R, BW5147 cells and Raw264.7 cells using minnebar RNeasy (Qiagen, Hilden, Germany). Real-time PCR assests is whether in the presence of SYBR-green with the use of a detection system ABI7700 sequence (PE Applied Biosystems).

As a result, the mRNA expression ENSMUSG00000035095 (A530065I17Rik, NM_176953) (using primers No. 2558: CAGCTGGCAAGAGGAACAGT (SEQ ID No. 54) and primer No. 2559: GAGCATCGGCACTTATCTCC (SEQ ID No. 55)) showed correlation with the binding activity of the chimeric protein mTARM-AP cells (pigv). However, the transmembrane region was absent in the amino acid sequence encoded ENSMUSG00000035095, and thus, it is not possible to consider its functioning as a protein in the cell membrane. This amino acid sequence was hypothetical sequence, and thus, it is possible to assume that the assessment of the cDNA sequence of the genomic sequence was incorrect. Thus, first made an attempt to identify homologous gene product of man. Using the amino acid sequence encoded ENSMUSG00000035095, searched in the database. The result found amino acid sequence of human LOC196264 with a high degree of homology with the amino acid sequence encoded ENSMUSG00000035095. This amino acid sequence was related to the protein of the cell membrane containing one area of the loop structure of immunoglobulin. Accordingly, it was suggested that LOC196264 is full-length amino acid posledovatel the ability of the candidate to TARM-L man. Then using the amino acid sequence LOC196264 carried out in the database tblastn search. As a result, the region, the coding sequence having homology with the amino acid sequence LOC196264 found in the genomic nucleotide sequence of clone YOU mouse AC122305. The cDNA sequence and amino acid sequence of the candidate for TARM-L mice were evaluated on the basis of this sequence, therefore, designing the following primers and highlighting the cDNA encoding the full-size protein.

#2693: CGCGTCGACGCCACCATGCAGCTGGCAAGAGGAACAGTA (SEQ ID no: 56)

#2694: GCGGGCGGCCGCTCAGTACGCCTCTTCTTCGTAGTC (SEQ ID no: 57)

Total RNA Th1 over 2 nights) was used as matrix, and cDNA amplified by the method described in example 1. Amplified cDNA was inserted in expressing vector pMXII IRES EGFP (Oncogene (2000) 19(27):3050-3058), and then received vector expressing the gene candidate for mTARM-L. Analyzer sequences ABI3100 used to determine its nucleotide sequence (SEQ ID No. 13).

(2) Identification mTARM-L

Next, to examine whether or not the candidate for mTARM-L unknown ligand for TARM, cells in which this molecule had to Express, was obtained by the method described in example 2. The binding activity of the chimeric protein mTARM-AP on the cell surface of cells expressing Kandy is at mTARM-L, and adhesive activity of cells expressing candidate for mTARM-L, immobilized mTARM was measured by the method described in example 5.

In the mTARM-AP specifically associated with mTARM-L-expressing cells EGFP+ B300.19, but not contacted with cells B300.19, who entered with the control vector EGFP+ (figure 22A). AP used as a negative control, was not associated with such mTARM-L-expressing cells EGFP+ B300.19 (figa).

Furthermore, investigated the adhesive activity of cells B300.19 expressing mTARM-L, relative to the AP and chimeric protein mTARM-AP. The result found that the above-mentioned cells was associated only with the chimeric protein mTARM-AP (pigv).

Thus, the above results showed that the molecule is a candidate for mTARM-L really is a new ligand for TARM. This ligand was identified as mTARM-L (ligand for TARM).

As for hTARM-L, then the following primers designed based on the nucleotide sequence of NM_198275 that encodes the amino acid sequence LOC196264, and selected cDNA encoding the full-size protein.

#2721: CGCGTCGACGCCACCATGCAGCAGAGAGGAGCAGCTGGA (SEQ ID no: 58)

#2722: GCGGGCGGCCGCTCAATATGTCTCTTCATAGTCTGA (SEQ ID no: 59)

Using total RNA bone marrow as a matrix of cDNA amplified by the method described in example 1. Amplified cDNA was inserted in expressing, etc) is p pMXII IRES EGFP (Oncogene (2000) 19(27):3050-3058) to obtain a vector expressing the gene TARM-L, and its nucleotide sequence (SEQ ID No. 15) was then determined using the analyzer sequence ABI3100.

TARM-L of human and mouse were subjected to analysis of homology by ClustalW. The results are presented on Fig. hTARM-L consisted of 235 amino acids, and mTARM-L consisted of 237 amino acids. They have 86% homology. On the other hand, mTARM m3 (293 amino acids) had the highest degree of homology with hTARM (271 amino acid) at 50% (Fig).

1. An antibody that specifically recognizes a membrane or secretory protein, selected from the following (ix), (x), (xi) and (xii), or its functional fragment:
(ix) membrane or secretory protein having a sequence essentially corresponding to the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12;
(x) a membrane or secretory protein that has a sequence essentially corresponding to the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, in which one or more amino acids are inserted, substituted or deleted, or one or more amino acids are added to one or both ends, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10 or SEQ ID No. 12;
(xi) membrane or secretory protein, which is first encoded by polynucleotides, which hybridizes in harsh environments with polynucleotide consisting of a sequence complementary to the nucleotide sequence of polynucleotide encoding amino acid sequence SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12; and
(xii) membrane or secretory protein that has a sequence essentially corresponding to the amino acid sequence having 70% or more identity with the amino acid sequence SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12.

2. The antibody or functional fragment according to claim 1, which is an antibody that specifically recognizes a membrane protein or a secretory protein having a sequence essentially corresponding to the amino acid sequence of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 or SEQ ID No. 8, or the amino acid sequence of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 or SEQ ID No. 8, which contains one or more conservative substitutions, or functional fragment.

3. The antibody or functional fragment according to claim 1, to the / establishment, which is an antibody which specifically recognizes a membrane protein or a secretory protein, selected from the following proteins (i), (ii), (iii) and (iv):
(i) membrane or secretory protein having a sequence essentially corresponding to the amino acid sequence of SEQ ID No. 10;
(ii) membrane or secretory protein that has a sequence essentially corresponding to the amino acid sequence of SEQ ID No. 10, in which one or more amino acids are inserted, substituted or deleted, or one or more amino acids are added to one or both ends, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 10;
(iii) membrane or secretory protein that is encoded by polynucleotides that hybridizes in harsh environments with polynucleotide consisting of a sequence complementary to the nucleotide sequence of polynucleotide encoding amino acid sequence SEQ ID No. 10, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 10; and
(iv) membrane or secretory protein that has a sequence essentially corresponding to the amino acid sequence having 90% or higher identity with the amino acid sequence SEQ ID No. 10, and which is functionally equivalent the EN protein, consisting of amino acid sequence SEQ ID No. 10.

4. The antibody or functional fragment according to claim 3, which is an antibody that specifically recognizes a membrane protein or a secretory protein having a sequence essentially corresponding to the amino acid sequence of SEQ ID No. 10, or the amino acid sequence SEQ ID No. 10, which contains one or more conservative substitutions, or functional fragment.

5. The antibody or functional fragment according to claim 1, which is an antibody that specifically recognizes a membrane protein or a secretory protein, selected from the following: (ix'), (x), (xi') and (xii'), or a functional fragment:
(ix') membrane or secretory protein having a sequence essentially corresponding to the amino acid sequence of SEQ ID No. 12;
(x') of the membrane or secretory protein that has a sequence essentially corresponding to the amino acid sequence of SEQ ID No. 12, in which one or more amino acids are inserted, substituted or deleted, or one or more amino acids are added to one or both ends, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 12;
(xi') of the membrane or secretory protein that is encoded by polynucleotides, which hibri isoamsa in harsh environments with polynucleotides, consisting of a sequence complementary to the nucleotide sequence of polynucleotide encoding amino acid sequence SEQ ID No. 12, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 12; and
(xii') a membrane or secretory protein that has a sequence essentially corresponding to the amino acid sequence having 70% or more identity with the amino acid sequence SEQ ID No. 12, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No. 12.

6. The antibody or functional fragment according to claim 5, which is an antibody against a membrane or secretory proteins having a sequence essentially corresponding to the amino acid sequence of SEQ ID No. 12, or the amino acid sequence SEQ ID No. 12, which contains one or more conservative substitutions, or functional fragment.

7. The antibody or functional fragment of claim 6, which are produced by hybridomas deposited under inventory No. FERM BP-10376.

8. Hybridoma producing the antibody according to any one of claims 1 and 2, 5 and 6 deposited under inventory No. FERM BP-10376.

9. Medicine used in autoimmune disease, comprising the antibody or functional the actual fragment according to any one of claims 1 to 7 as an active ingredient.

10. Medicine in autoimmune disease according to claim 9 for use in the treatment of rheumatoid arthritis.

11. Means for inhibiting the adhesion of T-cells, comprising the antibody or functional fragment according to any one of claims 1 to 7 as an active ingredient.

12. Method of screening a substance that inhibits the activation of dendritic cells, or its salt, or its MES, which involves the following stages:
(d) bringing the antibody or functional fragment according to any one of claims 1 to 7 into contact with dendritic cells in the presence or in the absence of a test substance; and
(e) measuring the level of activation of the specified dendritic cells.

13. The method of screening according to item 12, in which in stage (e) the level of activation of the specified dendritic cells is measured using the number of IL-6 and/or MCP-1 produced by dendritic cells, as an indicator.

14. The method of screening according to item 13, which further includes after stage (f) stage (f-1) comparing the amount of IL-6 and/or MCP-1 produced in the presence of a test substance, with the number of IL-6 and/or MCP-1 produced in the absence of the test substance.

15. The method of screening according to item 12, in which in stage (e) the level of activation of dendritic cells is measured using the level of expression of FcRγ chain on dendritic cell as an indicator.

16. The way the TFR is the training on § 15, which further includes after stage (f) stage (f-2) comparing the level of expression of FcRγ chain in the presence of a test substance with the level of expression of FcRγ chain in the absence of the test substance.

17. Method of screening a substance that inhibits formation of a complex between the protein TARM and FcRγ chain, or its salt, or its MES, which involves the following stages:
(g) bringing the antibody or functional fragment according to any one of claims 1 to 7 into contact with dendritic cells in the presence or in the absence of a test substance; and
(h) measuring the level of expression of FcRγ chain on the specified dendritic cell
where this protein TARM is a membrane or secretory proteins, selected from the following (ix), (x), (xi) and (xii):
(ix) membrane or secretory protein having a sequence essentially corresponding to the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12;
(x) a membrane or secretory protein that has a sequence essentially corresponding to the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, in which one or more amino acids are inserted, substituted or deleted, or one or more amino acids are added to one or both ends, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ I, No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10 or SEQ ID No. 12;
(xi) membrane or secretory protein that is encoded by polynucleotides that hybridizes in harsh environments with Pauline cleotides consisting of a sequence complementary to the nucleotide sequence of polynucleotide encoding amino acid sequence SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12; and
(xii) membrane or secretory protein that has a sequence essentially corresponding to the amino acid sequence having 70% or more identity with the amino acid sequence SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12, and which is functionally equivalent to a protein consisting of the amino acid sequence of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6, SEQ ID No.8, SEQ ID No. 10 or SEQ ID No. 12.

18. The method of screening according to 17, which further comprises after stage (h) stage (i) comparing the level of expression of FcRγ chain in the presence of a test substance with the level of expression of FcRγ chain in the absence of the test substance.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention discovers an antibody containing a Fc-version component with at least one amino acid substitution in a Fc-region of initial polypeptide. Said substitution is in the amino acid position matched with that of human Fc-polypeptide amino acid sequence (the positions are presented in the patent claim). The antibody exhibits a modulated binding with FcγR. There are described versions of said antibody with increased affinity to FcγR wherein said substitution is in the amino acid position 239, 332 or 267 matched with that in human Fc-polypeptide amino acid sequence (numeration according to the EU index). The invention also describes a method of treating a mammal with an antibody-dependent disorder by using a pharmaceutical composition with the modulated linkage with FcγR and containing the antibody or its version.

EFFECT: according to the invention antibodies provide the affinity in 5 and more times higher in comparison with initial Fc-polypeptide.

43 cl, 44 dwg, 66 tbl, 12 ex

FIELD: chemistry.

SUBSTANCE: invention relates to humanised anti-TGF-beta-antibody which is linked to TGF-beta. The humanised antibody has a variable domain VH which contains residues of the hypervariable region (non-human), which are contained in the human domain VH which includes a modified framework region (FR) (amino acid and nucleotide sequences are given in the list of sequences). The humanised antibody can contain residues of the complementarity determining region (CDR) of the variable domain of the light strand VL. The invention also relates to a composition for treating TGF-beta mediated disorders, e.g. malignant tumours, nucleic acid, coding monoclonal antibody, and a method of obtaining the latter using host cells. The invention provides a method of treating and detecting TGF-beta in a sample from the body using the disclosed antibody, as well as to a product which contains the humanised antibody and directions for use for treating TGF-beta mediated disorders.

EFFECT: invention enables control of TGF-beta molecules, which can prevent possible changes in antibodies, enables preparation of high-affinity humanised antibodies which act as TGF-beta antagonists.

57 cl, 45 dwg, 4 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: there is offered application of group of survival-improving polypeptide cone cells originated from rod cells and designated as RDCF, and also coding molecules of nucleic acid to prepare medicines, particularly pharmaceutical compositions used to treat retinal dystrophy. Methods for preparing RDCF by recombinant DNA technologies, and required aids, as well as preparation of antibodies distinguishing said polypeptides are described.

EFFECT: improved clinical effectivenesses.

12 cl, 19 dwg, 1 ex

FIELD: biotechnologies.

SUBSTANCE: invention is related to biotechnology and represents monoclonal antibody or its antigen-binding fragment, containing antigen-binding site, which specifically binds with protein of prostatic stem cells antigen (PSCA). At the same time monoclonal antibody is produced with postfusional cell line, selected from group of postfusional cell lines deposited in American typical cultures collection (A.T.C.C.) under inventory No.PTA-6698, PTA-6699, PTA-6700, PTA-6701, PTA-6702 and PTA-6703. Besides invention is also related to expression vector, which contains polynucleotide coding this antibody, and also to method for analysis for detection of PSCA protein presence in biological sample with application of this antibody. Moreover, invention is related to method for delivery of cytotoxic agent or diagnostic agent to cell, which expresses PSCA protein, with application of this antibody, and also to method for detection of PSCA protein in biological sample with application of above-mentioned antibody.

EFFECT: invention may efficiently be used in active and passive immunisation against cancer diseases.

21 cl, 27 dwg, 11 tbl, 33 ex

FIELD: medicine.

SUBSTANCE: invention can be used for production of monoclonal antibodies (MCAs) to heat shock protein 70 (HSP 70). A hybridoma strain is made by immunisation of BALB/c mice with bovine HSP 70 within 78 days. For the third days, splenocytes of immune mice (108 cells) are hybridised with murine myeloma cells P3-X63 Ag/8-653 (107 cells). A fusion agent is polyethylene glycol of molecular weight 4000 (Merk, Germany). The hybridisation is followed with selection, screening, cloning and cryopreservation of hybridoma. Hybridoma 6G2 is deposited in the microorganism collections of "ГНТТ ПМБ" under No. H-2. MCA.

EFFECT: produced hybridoma under the invention is more evident to be detected as HSP 70 on the cell surfaces, and change of endocellular HSP 70 level when exposed to the stress factors.

4 dwg, 1 tbl, 6 ex

FIELD: pharmacology.

SUBSTANCE: present invention refers to immunology and biotechnology. There is offered recovered human antibody to RG1 polypeptide. There are described versions of antibodies, including one-chain antibody, and immunoconjugate based on said antibodies. There are disclosed methods of selective cell destruction, cell inhibition, treatment of disease state, detection of disease state, detection of RG1, monitoring of clinical course of prostate cancer, prediction in a person with using antibodies and immunoconjugate.

EFFECT: application of the invention provides new antibodies to RG1 polypeptide that can find application in treating tumours with RG1 overexpression.

16 cl, 4 dwg, 1 tbl, 13 ex

FIELD: medicine.

SUBSTANCE: invention refers to antibody specifically getting bound with PRO87299 version. In addition, the antibody according to the invention has ability to block interaction HVEM and PRO87299 and to function as PRO87299 agonist. The antibody of agonist nature is produced by hybridoma Btig5F5.1 or Btig3B1.9. For the antibody, there is established amino acid sequence given in the description. The invention discloses the methods of using the antibodies to stimulate or reduction of immune response in immune-associated diseases connected, to relieve lymphoma, and inflammatory disease in requiring mammal, to detect polypeptide PRO87299 in a sample and to manage rejection of grafted cells.

EFFECT: antibody is an immunomodulator that allows applying therapeutically identical medicinal agents both to intensify and reduce immune response.

16 cl, 34 dwg, 7 tbl, 20 ex

FIELD: medicine.

SUBSTANCE: invention relates to Bcl-2 proteins, fragments thereof, and to application thereof in patients with a malignant tumour. The declared proteins and peptide fragments particularly are applicable in vaccine compositions for treatment of malignant tumour. Besides, the invention concerns the methods of treatment with application of specified compositions. Also, an aspect of the invention is production of T-cells and receptors thereof which are specifically recognise declared proteins and peptide fragments.

EFFECT: higher clinical effectiveness with respect to tumours.

61 cl, 5 ex, 2 tbl, 12 dwg

FIELD: medicine.

SUBSTANCE: invention concerns immunology area. Versions of the artificial fused protein consisting of an antibody (or its fragment) and cytokine, fused through a link peptide are offered. The antibody or its fragment is chosen from an antibody 225, 425, KS 1/4, 14.18, anti-CDx-antibody where x has the whole value 1-25. Each of versions of the fused protein has lowered quantity T-epitopes, at least, in the component of the fused protein presented by an antibody, and as consequence, possesses the lowered adjuvanticity, in comparison with an initial molecule. Identification of T-lymphocyte epitopes is performed by the automated calculation of sizes for the binding centres of class II MHC molecules with the subsequent experimental test of the obtained versions of protein for presence of the lowered adjuvanticity. The automated way of T-epitopes calculation is based on use of the Bjom's function modified in such manner that contribution of Van-der-vaals repulsion and lipophilic interaction in pairs between all lipophilic atoms of the chosen segments of the fused protein and a binding groove of a MHC P molecule is taken into account. Also a way of protein construction on the basis of the modified function Bjom's function with the subsequent experimental test of the received versions for presence of the lowered adjuvanticity is revealed, and also application of the fused protein for preparation of a pharmaceutical composition for tumour treatment is in addition considered.

EFFECT: invention use allows obtaining the fused proteins with the lowered adjuvanticity and, basically, keeping identical biological activity in comparison with a parent molecule; it can be used in treatment of tumours.

4 cl, 6 dwg, 22 tbl, 19 ex

FIELD: chemistry.

SUBSTANCE: proposed is a recombinant single-strand trispecific antibody for treating tumours which express CEA. The said antibody consists of a series of three antibody fragments: anti-CEA-scFv, anti-CD3-scFv and VH CD28-antibody, linked by two intermediate linkers (intermediate linker Fc and intermediate linker HSA). If necessary, a c-myc-mark or (His)6-mark can be added at the C-end. Described is DNA, which codes the antibody, expression vector based on it and E.coli cell, containing the vector.

EFFECT: use of the invention is more beneficial in clinical use compared to bispecific antibodies and known trispecific antibodies, makes easier clearing and expression of an antibody, which can further be used in treating CEA-mediated tumours.

10 cl, 21 dwg, 11 ex

FIELD: medicine.

SUBSTANCE: there is offered a method to assess of enzyme's ability to the level of phosphorylation of polypeptide that implies a reaction of the analysed enzyme and a substratum presented with a biotin-conjugated fragment of 516 to 777 residues of a human insulin 1 receptor substratum (hIRS-1-p30), binding of the reaction product and immobilised streptavidin and detection of the level of phosphorylation by antibodies specific to the phosphorylated polypeptide residues.

EFFECT: according to the invention, the method allows identifying tyrosine and serine proteinases and can be taken as a basis of a test system for new modulators of their activity.

9 cl, 8 dwg, 4 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention pertains to biotechnology. In particular, the invention relates to an Escherichia coli BL21 (pVEGF-A165) strain and can be used to produce a vascular endothelial growth factor - GST-VEGF-A165 protein. A novel Escherichia coli BL21 (pVEGF-A165) cell strain is obtained, which is transformed by the pGEX-VEGF-A165 plasmid. This strain produces a recombinant GST-VEGF-A165 protein.

EFFECT: invention enables to obtain a Escherichia coli BL21 (pVEGF-A165) strain which is stably transformed by plasmid which codes VEGF, and which secrete this factor in extracellular space when cultured in vitro.

3 dwg, 4 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to molecular biology, specifically to proteins which regulate cell differentiation through inhibition of the TGF-beta cell superfamily. The invention is aimed at treating and preventing diseases related to human VgI orthologs. Noggin2 protein which contains VgI protein is injected into tissue in amount which is efficient for inhibiting VgI activity.

EFFECT: invention enables to solve the task of blocking the signal path activated by the TGF-beta factor of VgI in aniamal cells.

2 dwg, 4 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention relates to a process and apparatus for isolating and purifying protein of interest in a stream of a tissue culture liquid obtained from a continuous perfusion fermentation process. The proposed apparatus, in which sterile conditions are maintained, includes a continuous perfusion fermentation system, a continuous particle removal system integrated with the perfusion fermentation system and adapted for continuous reception of tissue culture liquid therefrom and continuous production of clarified tissue culture liquid, and a continuous purification system integrated with the particle removal system and adapted for continuous reception clarified tissue culture liquid therefrom and constant production of the extracted product which contain the protein of interest, where the continuous purification system is an ultrafiltration system. The process involves obtaining heterogeneous tissue culture liquid mixture containing the protein of interest during a continuous perfusion fermentation process, continuous removal of large particle impurities from the liquid mixture to obtain clarified tissue culture liquid containing protein of interest, and purification of the protein from the clarified culture liquid through ultrafiltration. Specific flow rate of the tissue culture liquid mixture during continuous perfusion fermentation, continuous removal of impurities and continuous purification is kept constant.

EFFECT: design of an efficient method of isolating and purifying protein.

9 cl, 17 dwg, 2 tbl

FIELD: biotechnologies.

SUBSTANCE: in modified molecule IL-4RA, which inhibits mediated IL-4 and IL-13 activity, amino-acid remains 37, 38 or 104 represent cysteine. Polynucleotide, which codes specified antagonist, in composition of expression vector, is used to transform host cell and produce IL-4RA. Produced molecule IL-4RA is PEGylated and used to eliminate abnormalities that are related to high activity of IL-4 and IL-13.

EFFECT: invention makes it possible to produce antagonist with longer period of half-decay compared to non-modified IL-4RA.

17 cl, 1 dwg, 7 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: there is offered application of group of survival-improving polypeptide cone cells originated from rod cells and designated as RDCF, and also coding molecules of nucleic acid to prepare medicines, particularly pharmaceutical compositions used to treat retinal dystrophy. Methods for preparing RDCF by recombinant DNA technologies, and required aids, as well as preparation of antibodies distinguishing said polypeptides are described.

EFFECT: improved clinical effectivenesses.

12 cl, 19 dwg, 1 ex

FIELD: pharmacology.

SUBSTANCE: invention refers to medicine, veterinary science and agriculture. There is presented exogenous modulator of metabolic and energy interchange processes between a cell and environment representing a polypeptide metabolic process modulator of molecular weight 15 to 10 KDa made of human placenta by chemical modification of placental biobased products with reactions of chlorination, oxidation, hydrolysis, and containing covalently bound chlorine atoms with nitrogen atoms of peptide bond in amount 0.5 to 40% of weight of an end product. There is also offered method for making said modulator.

EFFECT: correction and regulation of metabolic processes to ensure maximum viability of human body, animals and plants.

7 cl, 8 tbl, 10 ex

FIELD: biotechnologies.

SUBSTANCE: invention is related to biotechnology and represents substantially pure peptide for modulation of immune system, which is characterised with aminoacid sequence VAPEEHPTLLTEAPLNPK, and also pharmaceutical composition, which includes specified peptide.

EFFECT: possibility to modulate immune activity selected from the group that consists of suppression of T-lymphocytes transformation, suppression of activity of NK-cells and suppression of antibodies production.

7 cl, 5 dwg, 15 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: method of cultivation of pluripotential stem cells herewith conserving undifferentiated condition and pluripotency thereof without using feeder cells. The method applies fluid medium and culture bottle on the surface of which there are immobilised molecule of fused protein containing outer domain of E-cadherin and Fc-region of immunoglobulin.

EFFECT: invention can be used in regenerative medicine.

9 cl, 11 dwg, 7 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of genetic engineering and medicine. Described is animal, non-human, having sequence of nucleic acid encoding presenilin 1, carrying mutations, corresponding to M233T and L235P mutations in PS1 protein of mouse. Animal also contains sequence of nucleic acid, encoding whole gene or part of gene, encoding APP. APP protein represents APP751, originates from human and carries mutations Swedish and London. Animal is intended for application in fight against Alzheimer's disease. Also described are PS1 protein and encoding it nucleic acid.

EFFECT: invention can be used in medicine for discovering compounds intended for Alzheimer's disease treatment.

20 cl, 50 dwg, 1 tbl, 8 ex

FIELD: chemistry.

SUBSTANCE: present invention relates to phenylalanine derivatives and their pharmaceutically acceptable salts. In formula (1) R11 is a hydroxyl group, an alkoxyl group having 1-6 carbon atoms, which can be substituted with a methoxy group, cycloalkoxyl group having 3-6 carbon atoms, or a benzyloxy group; R12 and R13 each independently represents a hydrogen atom, alkyl group having 1-6 carbon atoms, cycloalkyl group having 3-6 carbon atoms, acetyl group or methyloxycarbonyl group, or N(R12)R13 is a 1-pyrrolidinyl group, 1-piperidinyl group, 4-morpholinyl group; R14 is a methyl group; R1' is a hydrogen atom, fluorine atom; X1 is -CH(R1a)-, -CH(R1a)CH(R1b)-, -CH(R1a)CH(R1b)CH(R1c)-, -N(R1a)CH(R1b)CH(R1c)-, -OCH(R1a)CH(R1b)-, -OCH(R1a)CH(R1b)CH(R1c)- or 1,3-pyrrolidinylene, where R1a, R1b, each independently represents a hydrogen atom or a methyl group, and R1c is a hydrogen atom; Y11 and Y12 represent any of the combinations (CI, Cl), (CI, Me), (CI, F). Invention also relates to phenylalanine derivatives of formulae (2)-(14), given in the formula of invention.

EFFECT: obtaining a pharmaceutical composition having antagonistic effect on α4-integrin, containing a phenylalanine derivative as an active ingredient, a α4-integrin antagonist and a therapeutic agent.

65 cl, 51 tbl, 244 ex

Up!