Strain of hybrid animal cells mus musculus l - producer of monoclonal antibodies for exposing vp40 protein of ebola virus, zaire subtype (mainga strain) (versions), monoclonal antibody produced by said strain (versions) and set for "sandwich" format immunoenzymometric test system for exposing vp40 protein of ebola virus, zaire subtype (mainga strain)

FIELD: chemistry; biochemistry.

SUBSTANCE: invention discloses a strain of hybrid animal cells Mus musculus L.4 A2, which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR, which is a producer of monoclonal antibodies which are specific to the matrix protein VP40 of the Ebola virus, Zaire subtype (Mainga strain), and a strain of hybrid animal cells Mus musculus L. 1C1 which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR, which is a producer of monoclonal antibodies which are specific to the matrix protein VP40 of the Ebola virus, Zaire subtype (Mainga strain). The invention is also aimed at obtaining monoclonal antibodies 4A2 which are produced by the 4A2 hybridome, (subclass of immunoglobulins IgGl which have a heavy 55 kDa and a light 25 kDa chain) and are used as binding antigens in the "sandwich" format immunoenzymometric system for exposing the matrix protein VP40 of the Ebola virus, Zaire subtype (Mainga strain), and monoclonal antibodies 1C1 produced by the 1C1 hybridome (subclass of immunoglobulins IgGl which have a heavy 55 kDa and a light 25 kDa chain), used as biotin labelled indicators in the "sandwich" format immunoenzymometric system for exposing the matrix protein VP40 of the Ebola virus, Zaire subtype (Mainga strain). The disclosed antibodies are used together in a "sandwich" format immunoenzymometric system for exposing the matrix protein VP40 of the Ebola virus, Zaire subtype (Mainga strain).

EFFECT: invention enables to obtain monoclonal antibodies which are specific and do not compete with each other for antigen epitopes and which, when used together in a "sandwich" format immunoenzymometric system, ensure high reliability of results for exposing the matrix protein VP40 of the Ebola virus.

5 cl, 3 dwg, 1 tbl, 6 ex

 

The invention relates to biotechnology, in particular for medical Virology and immunology, may be used for an immunoassay of Ebola haemorrhagic fever (EHF).

Ebola virus (VE) belongs to the family of filovirus that causes severe hemorrhagic fever person with a high level of mortality during unexpected outbreaks[1, 2, 3, 4, 5, 6]. The natural reservoir and vectors are not known, an effective means of specific prophylaxis for people missing. The filovirus spread from person to person through direct contact with biological fluids. Aerosol transmission is also possible, as shown by studies on experimentally infected animals [7, 8] and high mortality rates among health care workers during an outbreak in Uganda in 2000 and 2001 [9]. The distribution of VE among human populations is possible through the import of monkeys from Africa and the development of tourism in this region [10]. Vaccine VE is still under development. Full protection of the infected Guinea pigs [11] and monkeys [12] was shown when their immunization beakley as adenovirushnykh particles containing proteins glycoprotein (GP) and matrix protein (VP40) several strains of Ebola and Marburg. Protein filovirus VP40 is one of the three major components accounting for 37.7 per cent (protein VP35 - 24,5% and nucleoprotein (NP) - 17%, respectively) from the mass of the virion [13]. He appears in the culture fluid in infected cell culture Vero and L-68 for 3-4 days in the blood of infected Guinea pigs for 4-7 days in the blood of monkeys Papio Hamadryas on the 7th day of infection (day temperature) and can be detected by enzyme-linked immunosorbent assay (ELISA) [14, 15]. Patients suffering from EHF, the virus is present in blood and tissues in high titers of 10(6)-10(8) viral particles per milliliter and can be found on the third day after the onset of symptoms [16]. Currently in Russia there are no commercially available ELISA test kits for rapid detection of antigen Ebola virus for control of imported animals for zoos and research purposes and the tourists who have arrived from Africa with symptoms similar at EHF. Preparations of purified monoclonal antibodies (MAB) can serve as the basis of such a system on their own or as a confirmatory test for PCR diagnosis [17], which in Russia has not yet developed.

Known mouse hybridoma producing µa to proteins of Ebola virus: recombinant NP - 12 lines [18], glycoprotein - line 2 [19], glycoprotein - one line [23]. In [20] described 9 lines, producing µa to matrix protein VP40 inactivated Triton - 100 VE subtype Zaire (strain Mainga), and one laboratory is ornago ELISA test system format "sandwich" on the basis of two µa, not competing for antigenic epitopes matrix protein VP40. This system successfully identifies the virion-associated VP40 from vaccinated culture medium and inactivated by sodium dodecyl sulfate virus added to the serum of human blood, as well as recombinant protein VP40, obtained by infection of cells recombinant virus vaccine MVA-T7 containing plasmids encoding gene VP40 VE (subtype Zaire).

The technical result is the obtaining of such strains of hybrid cells Mus musculus L., which could yield something specific µa, not competing for antigenic epitopes that would allow them to be used in immunoassay format "sandwich" to identify protein VP40 VE together as "exciting" antigen and "indicator", labeled with Biotin, which will increase the reliability of ELISA in the laboratory the VE and when designing test systems for the detection of antigens.

This technical result is achieved by creating a hybrid Strain of animal cells Mus musculus 1. A deposited in the Collection of cell cultures SRC VB "Vector", which is the producer of monoclonal antibodies specific to the extracellular matrix protein VP40 of Ebola virus, subtype Zaire (strain Mainga), and used as exciting antigen in ELISA format "sandwich for detection of matrix protein VP40 of Ebola virus subtype Zaire (strain Mainga).

This technical result is also achieved by the creation of a hybrid Strain of animal cells Mus musculus l. 1C1, deposited in the Collection of cell cultures SRC VB "Vector", which is the producer of monoclonal antibodies specific to the extracellular matrix protein VP40 of Ebola virus, subtype Zaire (strain Mainga), and used as an indicator labeled with Biotin in immunoassay format "sandwich" to identify the matrix protein VP40 wirecable, subtype Zaire (strain Mainga).

This technical result is also achieved by obtaining monoclonal antibodies A produced by a strain of hybrid animal cells Mus musculus l. 4A2 (subclass of immunoglobulins IgG1, with heavy 55 kDa and 25 kDa light chain), and monoclonal antibodies 1C1, produced by a strain of hybrid animal cells Mus musculus 1. 1C1 (subclass of immunoglobulins IgG1, with heavy 55 kDa and 25 kDa light chain)used in immunoassay format "sandwich" to identify the matrix protein VP40 of Ebola virus, subtype Zaire (strain Mainga).

It is also possible for individual use MCA in immunofluorescence and enzyme immunoassay methods for detection of VE in infected cells and tissues.

The strains obtained by fusion of mouse cells p3-X63/Ag8.653 (NS/1) myeloma cells spleens of BALB/c mice immunized with the shelled, concentrated, inaktivirovannye 5% β-mercaptoethanol and 1% sodium dodecyl sulfate drug VE, subtype Zaire (strain Mainga) [21]. The inventive strains of hybrid cells obtained in the State research center of Virology and biotechnology "Vector" of Rospotrebnadzor, the Russian Federation and deposited in the Collection of cell cultures SRC VB "Vector". Author name hybridoma cell lines - A and 1C1.

Pedigree strains. Strains of hybrid cells obtained by fusion of mouse cells p3-X63/Ag8.653 (NS/1) myeloma cells spleens of BALB/c mice immunized with purified, concentrated, inaktivirovannye drug Weah. As a melting agent used 45% solution of polyethylene glycol "Sigma" with a molecular weight of 1300-1600 KD method [22].

Cells after fusion were grown in selective medium GAT in 96-well culture plates. As feeder cells used peritoneal macrophages outbred mice. Hybridoma, consistently producing specific MCA, cloned 3 times. The output of positive clones in the last clone was 100%.

The number of passages by the time deposits: 7-10 passages.

Marker signs and methods of their evaluation. Strains secrete murine monoclonal antibodies of subclass IgGl (with heavy 55 kDa and 25 kDa light chain), specifically inter is operating with protein VP40 VE. Analysis of mouse immunoglobulins performed by ELISA, using as antigen purified inactivated VE, subtype Zaire (strain Mainga) or recombinant protein VP40 (obtained as described [26], as a result of biosynthesis in cells of E. coli-based plasmid construction, including a full VP40 gene VE) and antibodies against mouse IgG labeled with horseradish peroxidase.

Contamination by bacteria and fungi were not found.

Cultural properties. Media for cultivation of DMEM/F12 with glutamine, pyridoxine, Hepes (fsri SRC VB "Vector" of Rospotrebnadzor). The content of fetal serum, optimized for hybrid (HyClone, USA) in growth medium at 10%. Wednesday also add 80-160 μg/ml gentamicin sulfate. Strains are monocline-suspension cultures, in which up to 20% of the cell is in suspension, being attached to the surface of the cookware for cultivation. Cells from the surface of the culture dishes are removed with a solution of trypsin/versene = 1/1 (volume/volume). Sowing dose of 200 thousand cells/ml, the Frequency of passage through 3-4 days. The proliferation index is not less than 5.

Cultivation of hybrid in the body of the animal. Female BALB/c mice (vivarium GMCVB "Vector") previously injected intraperitoneally with 0.3-0.5 ml of piers (Sigma). After 2-4 weeks the animals are vaccinated intraperitoneally 10 million hybrid cells. Ascitic tumor is formed on 7-10 is Yan. Hybridoma inoculated in 100% of cases. From one animal you can get 3-5 ml of ascitic fluid containing MAB.

The characteristic of a useful product. Typing monoclonal antibodies was performed by the method of solid-phase ELISA using monospecific mouse antibodies (Sigma, USA). MCA belong to the subclass IgGl. They specifically interact with native protein VP40 VE (40 kDa) and recombinant VP40 (40 kDa) in the reaction immunoblot. In ELISA titer µa in ascites is 1:6561000. Stable products µa persists for at least 10 passages in vitro under continuous cultivation. One ml of ascitic fluid can be obtained 3-5 mg of purified µa.

Cryopreservation. Environment for freezing - environment DMEM(M) - 50%, fetal serum - 40%, dimethylsulfoxide - 10%. 1-1,5 ml of cell suspension is transferred into a plastic cryoprobes and placed in a Styrofoam container with a wall thickness of 1 see the Container make a pair of liquid nitrogen and after 18-24 hours, the tubes are transferred into liquid nitrogen. Defrosting is carried out, omitting the tubes in water with a temperature 37-41°C. the cells of the plant with the environment DMEM(M) and centrifuged at 1000 rpm Sediment resuspended in the growth medium and the cells are transferred into culture flasks at a concentration of 200-300 thousand per milliliter. Cell viability after thawing status is made by 60-80% (according to the results of staining with 0.25% Trifanova blue). Each ampoule contains not less than 10 million/ml of cells.

The invention is illustrated graphic material presented on figure 1-3.

Figure 1 presents electrophoregram treated µa, where:

1, 2 drugs treated µa A and S (1 ál), arrows indicate chains of immunoglobulins:

t - heavy chain (55 kDa); l - light chain (25 kDa);

3 - protein molecular weight markers (10 ml) (Bio-Rad);

4 - molecular weight protein markers.

On figa presents electrophoregram native proteins of Ebola virus and recombinant protein VP40, where:

1 - molecular weight protein markers;

2 - protein molecular weight markers (10 ml)(Bio-Rad);

3 - purified recombinant protein VP40 (10 μl);

4 - preparation of Ebola virus (20 μl), arrows indicate viral proteins;

5 - labeling of viral proteins.

On FIGU presents an immunoblot of native and ramanantsoa VP40 proteins of Ebola virus with MCA, where:

1 - preparation of the Ebola virus, processed µa A in a dilution of 1:10000;

2 - preparation of Ebola virus, processed µa S in a dilution of 1:10000;

3 - recombinant protein VP40, processed µa A in a dilution of 1:10000;

4 - recombinant protein VP40, processed µa S in a dilution of 1:10000;

5 - preparation of virus Marburg, processed µa A in a dilution of 1:10000 (negative control);

6 - preparation of virus Marburg, processed the KA S in a dilution of 1:10000 (negative control);

7 - lysate of E.coli., processed µa A in a dilution of 1:10000 (negative control);

8 - lysate of E.coli., processed µa S in a dilution of 1:10000 (negative control).

Figure 3 shows a graph of the titration of antigen Ebola virus and recombinant protein VP40 pair µa A and S*where the initial concentration of the drug antigens SF 1 mg/ml, the first point of the reaction at a dilution of 1:400 corresponds to a concentration of 2500 ng/ml;

S* indicator µa labeled with Biotin;

as a negative control was used a couple µa 7D8 and N*specific to the protein VP40 of Marburg virus [24];

the concentration of MAB for capture of antigen 10 μg/ml;

the concentration of the indicator MCA labeled with Biotin - 1 µg/ml

The method of obtaining the claimed strains.

Strains of hybrid cells Mus musculus L. SRC VB "Vector" - A and Mus musculus L. SRC VB "Vector" IS obtained as follows. Female BALB/c mice (vivarium GMCVB "Vector") weighing 15-20 g subjected to immunization scheme, which is listed in the following table.

To merge use a ratio of 3/1 splenic cells of mice and cells of mouse myeloma NS/1. The mixture of cells centrifuged, the supernatant carefully removed and the cells draught add 0.4 ml of a 45% solution of polyethylene glycol (PEG) with a molecular mass of 1300-1600. The mixture was centrifuged 15 min at 1000 Rev/min After 3 min pause layer PEG honey is i.i.d. diluted with 5 ml of versene, then the precipitate resuspended. The cells are then again precipitated (10 min at 1000 rpm) and is dissolved in the growth medium. Cells are distributed in five 96-hole blade (Costar) in 100 μl into the hole. Selection of hybrid cells is carried out in the environment GAT, consisting of a nutrient medium, DMEM(M), which added 10% fetal cow serum (Gipco), 0.1 mm gipoksantina, 0.04 mm thymidine and 0.01 mm aminopterin. The selection of specific hybrids performed enzyme-linked immunosorbent assay (ELISA). In wells blade (Animepalm) as antigen absorb 100-200 ng purified VE. Place of nonspecific binding is saturated with 0.5% solution of casein (ICN). Then transferred into the wells, 100 μl of culture medium analyzed hybrid and incubated for 45 min at 37°C. After incubation, the wells are washed 3-5 times with physiological saline containing 0.05% tween-20 (Sigma). Later in the tablets make 100 ál individualo conjugate (rabbit immunoglobulins against mouse IgG, horseradish peroxidase) and incubated for 45 min at 37°C. the Tablets are washed and carry out the enzymatic reaction. The results of the analysis determined on spectrophotometer "Multiscan" (Finland). The resulting hybrid strains twice clone method of limiting dilutions, translated in popular culture and frozen in liquid nitrogen. The following examples explore in detail the beneficial properties of the object is in the invention.

Example 1. Culturing the hybrid cells of strains of Mus musculus L. SRC VB "Vector" - A and Mus musculus L. SRC VB "Vector" S producing µa to protein VP40 VE in animals, BALB/c mice.

Mice BALB/c (vivarium GMCVB "Vector") weighing 20-22 g not less than 10 days before inoculation of hybridoma cells injected intraperitoneally 0.3-0.5 ml of the Wharf. Cultured cells are in the logarithmic growth phase, sterile centrifuged for 5-10 minutes at 1000 rpm in a centrifuge ARF-3. Adosados removed, and the residue cells suspension in a sterile solution of Earl or Hanks. After 2-4 weeks the animals are vaccinated intraperitoneally 10 million hybrid cells in a volume of 1 ml cell suspension. After 7-10 days the animals are euthanized and the peritoneal cavity extract 3-5 ml of ascitic fluid. Cells from ascitic fluid is separated by centrifugation and the supernatant determine the titer of the MCA using ELISA as described above.

Example 2. The selection of the purified monoclonal antibodies produced by hybrid cultured cells of strains of Mus musculus L. SRC VB "Vector" - A and Mus musculus L. SRC VB "Vector" S. One volume of ascitic fluid containing MAB, diluted with 4 volumes of 0.6 M acetate buffer (0.04 M citric acid, 0.2 M sodium acetate), pH 4.0, and bring the pH to 4.5 using a 0.1 N sodium hydroxide solution. To the diluted sample is added dropwise with constant paramesh is of Caprylic acid at the rate of 25 µl per 1 ml and incubated overnight at +4°C. Then centrifuged 30 min at 8000 g, and the precipitate removed and adosados mixed with 10x phosphate-saline buffer (FSB) and set pH 7.4 with a solution of 1.0 N sodium hydroxide. Equal volume of a saturated solution of ammonium sulfate is added to this solution, shaken and incubated overnight at 4°C or 30 min at +20-25°C. Centrifuged 15 min at 5000 g. Adosados merge, and the residue is dissolved in FSB, pH 7.4. The remains of ammonium sulfate is removed by dialysis against 50 to 100 volumes of the FSB, pH 7.4. Electrophoresis of purified preparations of the MCA was carried out according to the method described in [25], in a discontinuous buffer system using 12-15% polyacrylamide gel with 0.1% sodium dodecyl sulfate in Tris-glycine buffer. The separating gel contained 0,M Tris-HCl (pH 8.8), 0.1 percent SDS, 10(15)% acrylamide, 1% N,N-methylenebisacrylamide. Drugs µa (1 μl) was applied to the track in a volume of 30 μl buffer containing 0,M Tris-HCl (pH 6.8), 2% SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.01% of bromophenol blue. Before applying a buffer containing MCA, warmed up 3 min. at 95°C. Electrophoresis was mode 10/see the color of the gel was performed using Kumasi G-250-Purified preparations of electrophoregram presented in figure 1.

Example 3. Determination by ELISA specific interaction MCA produced by hybrid cell strains of Mus musculus L. SRC VB "Vector" - A and Mus musculus L. SRC VB "Vector" S with the e or recombinant protein VP40.

ELISA was performed on polystyrene tablets; antigen in the working dilution (purified and inactivated VE or recombinant protein VP40) barbirolli the FSB, pH 7.4 in the amount of 100 μl/well to the plates. Place nonspecific binding was saturated at 37°C for 45 minutes with 0.5% solution of casein in buffer TSB-twin (0.145 M sodium chloride, 20 mM Tris-HCl, 5 mM PMSF (Sigma), 0.1% of Tween-20 (Serva), pH of 7.4) and then incubated with purified µa 45 minutes at 37°C. Specific binding of the MAB to the antigen was identified antivirovym peroxidase labeled antibodies against mouse IgG. Next was added a Chromogen, a 0.1% O-phenylenediamine, nitrate-phosphate buffer (0.2 M citric acid, 0.5 M Na2HPO3, pH 5.0) from 0.03% hydrogen peroxide). Stopped the reaction by adding 100 µl per well of 1 N HCl and measured the optical density of samples on a spectrophotometer "Multiscan" using a filter with a maximum transmission 492 nm. As negative and positive control used homologous normal (non-immune) and hyperimmune serum, respectively.

Example 4. Identifying the immunoblot interaction MCA produced by hybrid cell strains of Mus musculus L. SRC VB "Vector" - A and Mus musculus L. SRC VB "Vector" S with protein VP40 VE (subtype Zaire) and recombinant protein VP40.

Viral proteins and recombinant protein VP40 after 12% SDS page electrophoresis were transferred to n is tracellular membrane (Millipore, USA). Place nonspecific binding was saturated with 0.5% solution of casein in buffer TSB-twin (0,145 M sodium chloride, 20 mM Tris-HCl, 5 mM PMSF (Sigma), 0.1% Tween-20 (Serva), pH of 7.4) at 37°C for 2 hours. Then the individual strips of the membrane were incubated with purified µa 4 hours at 20-22°C. Specific binding of antibodies that interact with viral proteins were revealed using conjugate antivitamin antibodies against mouse IgG labeled with horseradish peroxidase. As a negative control used strips of the membrane with transferred after electrophoresis inaktivirovannye virus Marburg [24] and the E. coli lysate., also processed µa. The results are shown in figs 2A and 2B.

Example 5. Preparation of conjugates of MCA with Biotin.

For biotinidase monoclonal immunoglobulins used the following method: prepare a fresh solution NSB (N-hydroxysuccinimidobiotin)was dissolved 2 mg of Biotin in 0.5 ml DMSO and made up to 2 ml were Then prepared solution treated µa (0.1 m NaHCO3pH of 9.0) at a concentration of 1 mg/ml Solution NSB drip was added to a solution of immunoglobulins in a volume ratio of 1/1, and incubated at room temperature for 4 hours. Then brought the volume of solution to 1 ml of 0,05M phosphate buffer (PBS) with pH 7.0, containing 0,15M sodium chloride and 0.1% sodium azide. Were dialyzed against phosphate buffer. The process of inclusion of Biotin in immunodeficiency, globulin controlled by titration of labeled MCA on the antigen, immobilized on plastic, with peroxidase conjugate with streptavidin.

Example 6. Competitive ELISA format "sandwich" for the detection of native protein VP40 VE, subtype Zaire (strain Mainga), and recombinant protein VP40.

In the wells vysokozolnyh polystyrene plates (“Testiks” or "Nunc") barbirolli peeled µa A in 0.5 M carbonate buffer (pH 9,0) in a volume of 100 μl in working concentration (10 μg/ml) at 22°C for 12 hours Designated for non-specific binding of antibodies on tablets fed a 0.5% solution of casein and kept at 37°C for 30 minutes. Titration of antigen (inactivated virus or recombinant protein) was performed with a dilution of 1:400 double step over night at 4°C or at 37°C for one hour. Then in the wells of tablets made conjugate µa C with Biotin in a working dilution (1 mg/ml), kept at 37°C for one hour and after 3 times washing of the wells was made conjugate with streptavidin peroxidase. Specific binding of the antibody labeled with Biotin, with conjugate was detected liquid substrate system TMB (3,3', 5,5' - Tetramethylbenzidine, Sigma) no 100 μl per well. Stood tablets 30 min in the dark, stopped the reaction by adding 100 ál per well IN hydrochloric acid and measured the optical density of samples on a spectrophotometer scanreceiver" at a wavelength of 450 nm. Positive thought of the measurement result Of the in the hole, greater than 2 times that of the wells with negative control. For negative control of antibody binding to the antigen used a couple µa detecting protein VP40 of Marburg virus. The graph of the titration of antigens presented on figure 3.

The above properties of strains of hybrid cells Mus musculus L. SRC VB "Vector" - A and Mus musculus L. SRC VB "Vector" S (author's name cell lines A and C) allow to conclude that for the first time on the basis of mouse myeloma received hybridoma Mus musculus L. SRC VB "Vector" - A and Mus musculus L. SRC VB "Vector" S - producers MCA, do not compete for antigenic epitopes of the protein VP40 VE. Strains of hybrid cells provide a mouse monoclonal immunoglobulin IgGl in the amount of 3-5 mg of purified antibodies from ml of ascitic fluid. Peeled µa specific reacted in ELISA with VE and recombinant protein VP40 (titer MCA was not less than 1:6561000); detected in the immunoblot virus-associated protein VP40 and recombinant protein VP40, the resulting biosynthesis in cells of E. coli-based plasmid construction, including a full VP40 gene VE. Sharing µa in ELISA format "sandwich" allows you to identify native and recombinant proteins with sensitivity of less than 1ng/ml the Use of these drugs MCA and recombinant protein VP40 as a positive control what and antigen effectively identify cases of EHF in Russia in the format of ELISA "sandwich".

The above properties of strains of Mus musculus L. SRC VB "Vector" - A and Mus musculus L. SRC VB "Vector" S (author's name cell lines A and C) distinguish them from all previously described hybridomas producing µa to proteins of Ebola virus.

Sources of information

1. Bowen ET, Lloyd G, Harris WJ, Platt GS, Baskerville A.Vella HER. / Viral haemorrhagic fever in southern Sudan and northern Zaire. // Preliminary stadies on the aetiological agent. Lancet 1977. 1:571-573.

2. World Health organization reports 1995, 2007. / Ebola haemorrhagic fever in Zaire.

3. World Health organization reports 1996, 1997, 2001, 2002. / Ebola haemorrhagic fever in Gabon.

4. World Health organization reports 2000, 2001, 2007. / Ebola haemorrhagic fever in Uganda.

5. World Health organization reports 2002, 2003, 2005. / Ebola haemorrhagic fever in Congo

6. World Health organization report 2004. / Ebola haemorrhagic fever in Sudan.

7. The p'yankov O.V. Sergeev, A.N., Pyankova OG, Pereboev L.A. / Pathological changes in the body primates, aerosol infected with Ebola virus. // The study and prevention of dangerous viral infections. Interagency conference April 7-8, 1993, Koltsovo, abstracts.

8. Johnson E, Jaax N, White J, Jahrling P. / Lethal experimental infection of rhesus monkeys by aerosolized Ebola virus. // Int J Exp Pathol 1995 / 76(4):227-36.

9. World Health organization report 3 January 2001. / Ebola haemorrhagic fever in Uganda.

10. Science News. ScienceDaily Aug.31, 2005. / Poaching, logging, and outbreaks of Ebola threaten central african gorillas and chimpanzees.

11. Swenson D, Warfield KL, Negley DL, Schmaljohn A, Bavari S. / Virus-like particles exhibit potential as a pan-filovirus vaccine for both Ebola and Marburg viral infections. // Vaccine 23. 2005, pp.3033-3042.

12. Swenson D, Wang D, Luo M, Warfield KL, Woraratanadharm J, Holman DH, Dong JY, Pratt D. / Complete protection of nonhuman primates against multistrain Ebola and Marburg virus infections. // Clin Vaccine Immunol. 2008. 15(3):460-7.

13. Elliott LH, Kiley MP, McCormick JB. / Descriptive analysis of Ebola virus protein. // Virology 1985. 147. PP.169-176.

14. Merzlikin, NV, town Chepurnov A. A., N. Istomin., Officers V., Vorobiev MS / Development and application of immunoassay test kits for the diagnosis of Ebola. // Journal "problems of Virology" No. 1, 1995. Pp.31-35.

15. Merzlikin NV / enzyme Immunoassay system for the study of Ebola. // Abstract of thesis candling. Koltsov 1995.

16. Rowe AK, Bertolli J, Khan AS at all and Ksiazek TG. / Clinical, virologic and immunologic follow-up of convalescent Ebola haemorrhagic fever patients and their household contacts, Kikwit Democratic Republic of the Congo. // J Infect Dis, 1999. 179 (1), p.28-35.

17. Towner JS, Rollin PE, Bausch DG, Sanchez A, Crary SM, Vincent M, Lee WF, Spiropoulou CF, Ksiazek TG, Lukwiya M, Kaducu F, Downing R, Nichol ST. / Rapid diagnosis of Ebola fever by reverse reduced-PCR in an outbreak setting and assessment of patient viral load as a predictor of outcome. // J Virol 2004. 78(8):4330-41.

18. Niikura M, Ikegami T, Saijo M, Kurane I, Miranda M, Morikawa S. / Detection of Ebola viral antigen by enzyme-linked immunosorbent assay using a novel monoclonal antibody to nucleoprotein. // Journal of Clinical Microbiology 2001. 39(9):3267-71.

19. Luch A, Grunov R, Otterbein C, Moller P, Feldmann H, Becker S. / Production of monoclonal antibolies and development of an antigen capture ELISA directed against the envelope glycoprotein GP of Ebola virus. // Environ Med Immunol 2004. 193:181-187.

20. Luch A, Grunov R, Moller P, Feldmann H, Becker S. / Development, characterization and use of monoclonal VP40-antibodies for the detection of Ebola virus. // Journal of Virological Methods 111, pp.21-28. 2003.

21. The town Chepurnov A. A., Merzlikin N., Ryabchikova E.I., Chepurnova T.S., Volchkov VE, IP is omina NI, Kuzmin V.A., Vorobyov MS / Obtaining purified Ebola virus. // Journal "problems of Virology No. 6, 1994. S-257.

22. Gefler ML, Margulies DH, Schaff MD. / A simple method for polyethylene glycol promoted hybridization of mouse myeloma cells. // Somat Cell Genet 1977. V3, pp.231-236.

23. The restaurant take-out bag S.V., Lebedev V.N., Pashchenko SCI, Borisevich, GV, Khamitov R.A., Semenova I.S., Mironov A.N. / Strain hybrid cells A/N-6G5 animals MUS MUSCULUS L. producing monoclonal antibodies to Ebola virus. / Patent RF №2186106 published 27.07.2002.

24. Iherusalem, Appolonov, Aye, Ehitusaasta. Monoclonal antibodies to proteins of the virus Marburg and immunochemical characterization. / Virology N6. 1998, s-279.

25. Osterman AA / research Methods proteins and nucleic acids. Electrophoresis and ultracentrifugation. // Moscow, 1981. Pp.37-64.

26. Aviolin, Ehitusaasta, Avicci, Avianova, Aye, Iherusalem. / A comparative study of the antigenic and immunogenic properties of natural and recombinant proteins VP35 virus Marburg. / Virology N5. 1999, s-213.

1. The hybrid strain of animal cells Mus musculus L. 4A2, deposited in the Collection of cell cultures SRC VB "Vector", which is the producer of monoclonal antibodies specific to the extracellular matrix protein VP40 of Ebola virus, subtype Zaire (strain Mainga), and used as exciting antigen in ELISA format "sand is ICH" to identify the matrix protein VP40 of Ebola virus subtype Zaire (strain Mainga).

2. Monoclonal antibody 4A2, produced by a strain of hybrid animal cells Mus musculus L. 4A2 (subclass of immunoglobulins IgG1, with heavy 55 kDa and 25 kDa light chain)used in immunoassay format "sandwich" to identify the matrix protein VP40 of Ebola virus, subtype Zaire (strain Mainga).

3. The hybrid strain of animal cells Mus musculus L. 1C1, deposited in the Collection of cell cultures SRC VB "Vector", which is the producer of monoclonal antibodies specific to the extracellular matrix protein VP40 of Ebola virus, subtype Zaire (strain Mainga), and used as an indicator labeled with Biotin in immunoassay format "sandwich" to identify the matrix protein VP40 of Ebola virus, subtype Zaire (strain Mainga).

4. Monoclonal antibody 1C1, produced by a strain of hybrid animal cells Mus musculus L. 1C1 (subclass of immunoglobulins IgG1, with heavy 55 kDa and 25 kDa light chain)used in immunoassay format "sandwich" to identify the matrix protein VP40 of Ebola virus, subtype Zaire (strain Mainga).

5. Set for enzyme immunoassay systems format "sandwich" to identify the matrix protein VP40 of Ebola virus, subtype Zaire (strain Mainga), including monoclonal antibodies A produced by a strain of hybrid animal cells Mus musculus L. A and adsorbed on polystyrene p is anseth, the Biotin conjugates with monoclonal antibodies IS produced by a strain of hybrid animal cells Mus musculus L. 1C1, conjugate with streptavidin peroxidase and tetramethylbenzidine, quantitative content of which in the set is sufficient for enzyme reactions.



 

Same patents:

FIELD: chemistry; biochemistry.

SUBSTANCE: invention discloses a strain of hybrid animal cells Mus musculus L. 1B2, which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR, which is a producer of monoclonal antibodies which are specific to the nucleoprotein of the Ebola virus, Zaire subtype (Mainga strain) and are used as binding antigens in a "sandwich" format immunoenzymometric system for exposing the neucleoprotein of the Ebola virus, Zaire subtype (Mainga strain), and a strain of hybrid animal cells Rattus Norvegicus 7B11 which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR and which is a producer of monoclonal antibodies which are specific to the nucleoprotein of Ebola virus, Zaire subtype (Mainga strain) and are used as biotin labelled indicators in the "sandwich" format immunoenzymometric system for exposing nucleoprotein of the Ebola virus, Zaire subtype (Mainga strain). The invention describes monoclonal antibodies 1B2 which are produced by the strain of hybrid animal cells Mus musculus L. 1B2, which relate to the subclass of immunoglobulins IgGl which have a heavy 55 kDa and a light 25 kDa chain, and monoclonal antibodies 7B11 which are produced by the strain of hybrid animal cells Rattus Norvegicus 7B 11 related to the subclass of immunoglobulins IgG. The antibodies are used together in the "sandwich" format immunoenzymometric system for exposing nucleoprotein of the Ebola virus, Zaire subtype (Mainga strain).

EFFECT: use of the invention enables to obtain results during "ВЭ" laboratory reseach and when designing a test system for highly reliable exposure of an antigen.

5 cl, 3 dwg, 2 tbl, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention discloses a strain of hybrid animal cells Mus musculus L. 7D8, which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR, which is a producer of monoclonal antibodies which are specific to the VP40 matrix protein of the Marburg virus (Popp strain) and are used as binding antigens in a "sandwich" format immunoenzymometric system for exposing the VP40 matrix protein of the Marburg virus (Popp strain) and a strain of hybrid animal cells Mus musculus L. 7H10 which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR and which is a producer of monoclonal antibodies which are specific to the VP40 matrix protein of the Marburg virus (Popp strain) and are used as biotin labelled indicators in the "sandwich" format immunoenzymometric system for exposing the VP40 matrix protein of the Marburg virus (Popp strain). Monoclonal antibodies 7D8 which are produced by the strain of hybrid animal cells Mus musculus L. 7D8 relate to a subclass of immunoglobulins IgGl and have a heavy 55 kDa and a light 25 kDa chain. Monoclonal antibodies 7H10 which are produced by the strain of hybrid animal cells Mus musculus L. 7H10 relate to a subclass of immunoglobulins IgGl and have a heavy 55 kDa and a light 25 kDa chain. Monoclonal antibodies 7D8 and antibodies 7D8 and 7H10 are used together in the "sandwich" format immunoenzymometric system for exposing the VP40 matrix protein of the Marburg virus (Popp strain).

EFFECT: use of the invention increases reliability of enzyme immunoassay.

5 cl, 3 dwg,1 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: substance of the invention involves introduction of hydrocortisone in a minimal dose 0.3 mg per 1 g of body weight to white outbred mice to be infected with Chlamidia. Their spleen and liver is material to prepare 10% suspension that is centrifuged 2000 rpm for 10 minutes, while supernatant is used as an antigen material.

EFFECT: higher yield of the antigen material.

1 tbl

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of Marburg haemorrhagic fever. A strain of hybrid animal cells Mus musculus L. 3F9 is formed, which is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR. The hybridoma strain produces monoclonal antibodies which are specific to the VP35 protein of the Marburg virus (Popp strain) (hereinafter MCA). MCA 3F9 produced by hybrid animal cells Mus musculus L. 3F9 relate to a subclass of immunoglobulins IgGI, having a heavy 55 kDa and a light 25 kDa chain and having a unique feature of detecting the VP35 protein of the Marburg virus (Popp strain) in a "sandwich" immunoenzymometric system format owing to antigen "capture" properties and simultaneously be an indicator, labeled biotin. The antigen epitope for MCA 3F9 produced by the 3F9 hybridoma is localised between 252 and 278 aminoacid residues.

EFFECT: invention enables to obtain MCA with specificity to VP35 protein of the Marburg virus (Popp strain), suitable for immunodiagnosis of Marburg haemorrhagic fever.

2 cl, 3 dwg, 1 tbl, 5 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of human cytomegalovirus. The strain of hybrid animal cells Mus musculus L.5F10 is obtained by merging mouse myeloma cells p3-X63/Ag8.653 (NS/1) with mouse spleen cells BALBc, immunised by an affinity purified recombinant protein pp65. The hybridoma strain is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR and is used as a producer of monoclonal antibodies for detecting the pp65 protein of human cytomegalovirus.

EFFECT: invention enables to widening of range of strains of hybrid cells Mus musculus L - producers of MCA for detecting the pp65 protein of human cytomegalovirus and production of domestic diagnostic test-systems for detecting cytomegaly.

2 dwg, 1 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention belongs to medicine, notably to laboratory method of diagnostics. Principle of the method is isolation and identification of pathogenic and opportunistic microorganisms from biopsic material of common bile duct and assessment of antilysozim activity of isolated microorganisms. Antilysozim activity index 5.5±0.5 mcg/ml confirms acute purulent cholangitis diagnosis, 3.7±0.6 mcg/ml characterises acute recurrent purulent cholangitis, while index 1.1±0.4 mcg/ml supposes chronic purulent cholangitis.

EFFECT: method allows differential diagnostics of purulent cholangitis.

2 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: method of determining sensitivity of horses to antigens of microorganisms of various taxonomic keys, which includes carrying out reaction of leukocytolysis with blood leucocytes using antigen, calculation of leukocytes in Goryaev's chamber before and after incubation and further determination of organism sensitivity by leukocytolysis index, different in the fact that in setting of reaction, first, solution of acidin-pepsin is introduced into samples, calculation of leukocytes before incubation is carried out only in control sample, and leukocytolysis index (LCI) is determined after incubation of experimental and control samples with further deduction of percent of spontaneous leukocytolysis (SLC) in control sample and is final value of LCI (3) is to 20%, organism sensitivity is considered to be low, 20-40% - medium, 40% and higher -high.

EFFECT: increase of determination accuracy.

5 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention aims at treatment, diagnostics or prevention of parasitic disease. There is used combination histone proteins H2A, H2B, H3 and H4 recovered from Leishmania infantum for making a pharmaceutical composition and a diagnostic aid. It involves applying a vector containing nucleotides coding specified histones.

EFFECT: invention allows treating and preventing the parasitic disease caused by one type with using histones originated from the other type.

13 cl, 4 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: to detect or chrysanthemum virus B in plants, a diagnostic set containing polyclonal antibodies to protein of Chrysanthemum virus B shell, a conjugate marked with alkaline phosphatase, a fixing buffer; an extraction buffer, ECI-buffer and PNP-buffer is used. Protein of viral shell is produced by amplification of the purified gene of said protein with using a nonsynonymous primer ATGCCTCCCAAACCGGCACCAGGTGAT and synonymous primer TTTATAATGTCTTATTATTCGCAT.

EFFECT: improved antiviral action of the compound.

15 cl, 2 ex

FIELD: medicine.

SUBSTANCE: there is used for diagnostics of transient and persistent latent papilloma virus infection. The diagnostic technique for papilloma virus infection is ensured by history taking and integrated clinical-laboratory examination. As anamnestic signs, there are assumed compromised oncologic characteristics inheritance, early sexual life, age younger than 20 years old and promiscuity; as clinical - anogenital warts, erosion and ectopic neck of uterus, contact hemorrhagic diathesis, Ovuli nabotti, inflammatory diseases of small pelvis organs and intrauterine spiral. Herewith the laboratory signs are sexually transmitted diseases, mixtinfection, deficient lactic acid bacilli, vaginal disbiosis caused by conditional-pathogenic flora, bacterial vaginosis, virus-virus associations, urogenital herpes, urogenital mycoplasma infection, urogenital ureaplasma infection, urogenital candidiasis, urogenital Chlamidia infection and infection with various genotypes of human papilloma virus. Each sign is scored, and depending the number of points, persistent or transient clinical course of papilloma virus infections, or follow-up examination is performed.

EFFECT: determining tactics of the following management of the patient, forming group of potential risk for development of focal dysontogenetic and malignant transformations of urogenital epithelium.

1 dwg, 2 tbl, 2 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention discloses a strain of hybrid animal cells Mus musculus L. 1B2, which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR, which is a producer of monoclonal antibodies which are specific to the nucleoprotein of the Ebola virus, Zaire subtype (Mainga strain) and are used as binding antigens in a "sandwich" format immunoenzymometric system for exposing the neucleoprotein of the Ebola virus, Zaire subtype (Mainga strain), and a strain of hybrid animal cells Rattus Norvegicus 7B11 which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR and which is a producer of monoclonal antibodies which are specific to the nucleoprotein of Ebola virus, Zaire subtype (Mainga strain) and are used as biotin labelled indicators in the "sandwich" format immunoenzymometric system for exposing nucleoprotein of the Ebola virus, Zaire subtype (Mainga strain). The invention describes monoclonal antibodies 1B2 which are produced by the strain of hybrid animal cells Mus musculus L. 1B2, which relate to the subclass of immunoglobulins IgGl which have a heavy 55 kDa and a light 25 kDa chain, and monoclonal antibodies 7B11 which are produced by the strain of hybrid animal cells Rattus Norvegicus 7B 11 related to the subclass of immunoglobulins IgG. The antibodies are used together in the "sandwich" format immunoenzymometric system for exposing nucleoprotein of the Ebola virus, Zaire subtype (Mainga strain).

EFFECT: use of the invention enables to obtain results during "ВЭ" laboratory reseach and when designing a test system for highly reliable exposure of an antigen.

5 cl, 3 dwg, 2 tbl, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention discloses a strain of hybrid animal cells Mus musculus L. 7D8, which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR, which is a producer of monoclonal antibodies which are specific to the VP40 matrix protein of the Marburg virus (Popp strain) and are used as binding antigens in a "sandwich" format immunoenzymometric system for exposing the VP40 matrix protein of the Marburg virus (Popp strain) and a strain of hybrid animal cells Mus musculus L. 7H10 which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR and which is a producer of monoclonal antibodies which are specific to the VP40 matrix protein of the Marburg virus (Popp strain) and are used as biotin labelled indicators in the "sandwich" format immunoenzymometric system for exposing the VP40 matrix protein of the Marburg virus (Popp strain). Monoclonal antibodies 7D8 which are produced by the strain of hybrid animal cells Mus musculus L. 7D8 relate to a subclass of immunoglobulins IgGl and have a heavy 55 kDa and a light 25 kDa chain. Monoclonal antibodies 7H10 which are produced by the strain of hybrid animal cells Mus musculus L. 7H10 relate to a subclass of immunoglobulins IgGl and have a heavy 55 kDa and a light 25 kDa chain. Monoclonal antibodies 7D8 and antibodies 7D8 and 7H10 are used together in the "sandwich" format immunoenzymometric system for exposing the VP40 matrix protein of the Marburg virus (Popp strain).

EFFECT: use of the invention increases reliability of enzyme immunoassay.

5 cl, 3 dwg,1 tbl, 6 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of Marburg haemorrhagic fever. A strain of hybrid animal cells Mus musculus L. 3F9 is formed, which is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR. The hybridoma strain produces monoclonal antibodies which are specific to the VP35 protein of the Marburg virus (Popp strain) (hereinafter MCA). MCA 3F9 produced by hybrid animal cells Mus musculus L. 3F9 relate to a subclass of immunoglobulins IgGI, having a heavy 55 kDa and a light 25 kDa chain and having a unique feature of detecting the VP35 protein of the Marburg virus (Popp strain) in a "sandwich" immunoenzymometric system format owing to antigen "capture" properties and simultaneously be an indicator, labeled biotin. The antigen epitope for MCA 3F9 produced by the 3F9 hybridoma is localised between 252 and 278 aminoacid residues.

EFFECT: invention enables to obtain MCA with specificity to VP35 protein of the Marburg virus (Popp strain), suitable for immunodiagnosis of Marburg haemorrhagic fever.

2 cl, 3 dwg, 1 tbl, 5 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of human cytomegalovirus. The strain of hybrid animal cells Mus musculus L.5F10 is obtained by merging mouse myeloma cells p3-X63/Ag8.653 (NS/1) with mouse spleen cells BALBc, immunised by an affinity purified recombinant protein pp65. The hybridoma strain is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR and is used as a producer of monoclonal antibodies for detecting the pp65 protein of human cytomegalovirus.

EFFECT: invention enables to widening of range of strains of hybrid cells Mus musculus L - producers of MCA for detecting the pp65 protein of human cytomegalovirus and production of domestic diagnostic test-systems for detecting cytomegaly.

2 dwg, 1 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to humanised anti-TGF-beta-antibody which is linked to TGF-beta. The humanised antibody has a variable domain VH which contains residues of the hypervariable region (non-human), which are contained in the human domain VH which includes a modified framework region (FR) (amino acid and nucleotide sequences are given in the list of sequences). The humanised antibody can contain residues of the complementarity determining region (CDR) of the variable domain of the light strand VL. The invention also relates to a composition for treating TGF-beta mediated disorders, e.g. malignant tumours, nucleic acid, coding monoclonal antibody, and a method of obtaining the latter using host cells. The invention provides a method of treating and detecting TGF-beta in a sample from the body using the disclosed antibody, as well as to a product which contains the humanised antibody and directions for use for treating TGF-beta mediated disorders.

EFFECT: invention enables control of TGF-beta molecules, which can prevent possible changes in antibodies, enables preparation of high-affinity humanised antibodies which act as TGF-beta antagonists.

57 cl, 45 dwg, 4 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention aims at preparation of new strain of hybrid cells Mus. Musculus 6F3 - a producer of monoclonal antibody (MCA) to hemagglutinin protein of high-pathogen avian influenza virus A/duck/Novosibirsk/56/05. Strain 6F3 is prepared by fusing murine myeloma cells Sp2/0 with murine spleen cells BALB/c, immunised with a purified and inactivated preparation of avian influenza virus A/H5N1 (strain A/duck/Novosibirsk/56/05). Hybridoma produced MCA belong to IgA class. Strain 6F3 is deposited in the Collection of cell culture of Ivanovsky State Research Institution of Virology of the Russian Academy of Medical Sciences, No. 8/2/3. Using hybridoma allows producing specific monoclonal antibodies to hemagglutinin protein of avian influenza virus A/H5N1.

EFFECT: possibility to use antibodies to studying the antigenic structure of hemagglutinin for differential diagnostics of avian influenza virus A/H5 serotype.

1 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: invention can be used for production of monoclonal antibodies (MCAs) to heat shock protein 70 (HSP 70). A hybridoma strain is made by immunisation of BALB/c mice with bovine HSP 70 within 78 days. For the third days, splenocytes of immune mice (108 cells) are hybridised with murine myeloma cells P3-X63 Ag/8-653 (107 cells). A fusion agent is polyethylene glycol of molecular weight 4000 (Merk, Germany). The hybridisation is followed with selection, screening, cloning and cryopreservation of hybridoma. Hybridoma 6G2 is deposited in the microorganism collections of "ГНТТ ПМБ" under No. H-2. MCA.

EFFECT: produced hybridoma under the invention is more evident to be detected as HSP 70 on the cell surfaces, and change of endocellular HSP 70 level when exposed to the stress factors.

4 dwg, 1 tbl, 6 ex

FIELD: pharmacology.

SUBSTANCE: invention can be used to identify a pseudotuberculosis agent in bacterial cultures, a biological material and environmental objects by applying the indirect hemagglutination test. Substance of the invention consists in development of a new diagnosticum that represents formalinised sheep's erythrocytes sensitised with monoclonal antibodies to lipopolysaccharide antigen of cold version Yersinia pseudotuberculosis serotype I (strain 164/84 serovariant I) and frozen-dried in a protective medium. Shelf life of the preparation is 2 years.

EFFECT: diagnosticum provides high sensitivity, specificity to the UHAT in detecting Yersinia pseudotuberculosis serotype I.

FIELD: veterinary.

SUBSTANCE: strain 5A10 of hybridomal line of cells of mouse Mus. museums, producing monoclonal antibodies to immunoglobulin IgG of cattle (C) is permanent line of cells and is suitable for biotechnology in elaboration of preparations. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 71. Antibody titers in native culture liquid constitute 1:32-1:64, in ascitic liquid 1:640-1:5120 in immuno-enzymatic analysys. Monoclonal antibodiesproduced by strain are specific to immunoglobulin IgG of cattle and do not react with immunoglobulins of sheep. Peroxydase-marked monoclonal antibodies ensure high sensitivity and specificity of IEA for detection of antibodies to C leucosis virus in biological material. Strain 5A10 - producent of monoclonal antibodies to immunoglobulin IgG of cattle can be used in production of immuno-enzymatic test-system for diagnostics of C leucosis.

EFFECT: application of said test-system will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms.

5 ex

FIELD: veterinary.

SUBSTANCE: obtained is strain 1H8 of hybridomal line of cells of mouse Mus. musculus - producent of monoclonal antibodies to IgG of sheep, suitable for biotechnology in elaboration of diagnostic preparations. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 73. When determined by method of immuno-enzymatic analysys (IEA) antibodies titers in native culture liquid constituted in IEA 1:32-1:64, in ascitic liquid 1:640-1:5120. Monoclonal antibodies are specific to immunoglobulin IgG of sheep and do not react with immunoglobulin of cattle. When used for fixation on solid phase of glycoproteidal antigen of cattle (C) leucosis virus (in composition of complex glycoproteidal antigen- monoclonal antibodies of sheep to glycoproteidal antigen) in IEA, they ensure strength of fixation and optimal availability of antigen for antibodies in testes samples.

EFFECT: strain 1H8 can be used in production of immuno-enzymatic test-system for diagnostics of C leucosis, which will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms.

1 tbl, 4 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention discloses a strain of hybrid animal cells Mus musculus L. 1B2, which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR, which is a producer of monoclonal antibodies which are specific to the nucleoprotein of the Ebola virus, Zaire subtype (Mainga strain) and are used as binding antigens in a "sandwich" format immunoenzymometric system for exposing the neucleoprotein of the Ebola virus, Zaire subtype (Mainga strain), and a strain of hybrid animal cells Rattus Norvegicus 7B11 which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR and which is a producer of monoclonal antibodies which are specific to the nucleoprotein of Ebola virus, Zaire subtype (Mainga strain) and are used as biotin labelled indicators in the "sandwich" format immunoenzymometric system for exposing nucleoprotein of the Ebola virus, Zaire subtype (Mainga strain). The invention describes monoclonal antibodies 1B2 which are produced by the strain of hybrid animal cells Mus musculus L. 1B2, which relate to the subclass of immunoglobulins IgGl which have a heavy 55 kDa and a light 25 kDa chain, and monoclonal antibodies 7B11 which are produced by the strain of hybrid animal cells Rattus Norvegicus 7B 11 related to the subclass of immunoglobulins IgG. The antibodies are used together in the "sandwich" format immunoenzymometric system for exposing nucleoprotein of the Ebola virus, Zaire subtype (Mainga strain).

EFFECT: use of the invention enables to obtain results during "ВЭ" laboratory reseach and when designing a test system for highly reliable exposure of an antigen.

5 cl, 3 dwg, 2 tbl, 7 ex

Up!