Strain of hybrid animal cells mus musculus l - producer of monoclonal antibodies for exposing vp40 protein of marburg virus, (popp strain) (versions), monoclonal antibody produced by said strain (versions) and set for "sandwich" format immunoenzymometric system for exposing vp40 matrix protein of marburg virus (popp strain)

FIELD: chemistry; biochemistry.

SUBSTANCE: invention discloses a strain of hybrid animal cells Mus musculus L. 7D8, which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR, which is a producer of monoclonal antibodies which are specific to the VP40 matrix protein of the Marburg virus (Popp strain) and are used as binding antigens in a "sandwich" format immunoenzymometric system for exposing the VP40 matrix protein of the Marburg virus (Popp strain) and a strain of hybrid animal cells Mus musculus L. 7H10 which is deposited in the Collection of cell cultures of the State Research Center of Virology and Biotechnology VECTOR and which is a producer of monoclonal antibodies which are specific to the VP40 matrix protein of the Marburg virus (Popp strain) and are used as biotin labelled indicators in the "sandwich" format immunoenzymometric system for exposing the VP40 matrix protein of the Marburg virus (Popp strain). Monoclonal antibodies 7D8 which are produced by the strain of hybrid animal cells Mus musculus L. 7D8 relate to a subclass of immunoglobulins IgGl and have a heavy 55 kDa and a light 25 kDa chain. Monoclonal antibodies 7H10 which are produced by the strain of hybrid animal cells Mus musculus L. 7H10 relate to a subclass of immunoglobulins IgGl and have a heavy 55 kDa and a light 25 kDa chain. Monoclonal antibodies 7D8 and antibodies 7D8 and 7H10 are used together in the "sandwich" format immunoenzymometric system for exposing the VP40 matrix protein of the Marburg virus (Popp strain).

EFFECT: use of the invention increases reliability of enzyme immunoassay.

5 cl, 3 dwg,1 tbl, 6 ex

 

The invention relates to biotechnology, in particular for medical Virology and immunology, and can be used as an immunodiagnostic hemorrhagic fever Marburg (GLM).

The Marburg virus (VM) belongs to the family of filovirus that causes hemorrhagic fever man with a mortality rate of 40 to 90%, as shown by epidemiological studies during the large outbreak in 2004-2005 in Angola [1, 2]. The natural reservoir and vectors are not known, an effective means of specific prophylaxis for people missing. Despite the geographically restricted area of occurrence of unexpected outbreaks, the potential of aerosol transmission is high and the risk is spread among human populations in different regions of the world are possible [3, 4, 5]. Attempts to obtain vaccines based on inactivated virus did not produce results [6]. Currently, only one Centre (military medical research Institute of infectious diseases United States) searching for approaches to create a vaccine vector based gene delivery filovirus proteins. Describes several candidates for vaccines: 1) DNA vaccination with plasmids carrying genes VM, 2) defective viral particles Venezuelan encephalomyelitis, containing filovirus proteins, 3) adenoviral vector system, 4) bisaccia on the basis of ad is novirusthanks particles, bearing proteins of several strains VM and Ebola virus (VE) [7, 8, 9, 10]. Researchers have identified the key proteins that cause full protection of infected animals, is a glycoprotein (GP) and matrix protein VP40. It is possible that the protection of people against deadly filovirus fevers eventually be achieved. Matrix protein VP40 plays an important role in the final stages of Assembly of virions. It was shown that for the formation of virus-like particles morphologically similar to natural, with transfection culture of 293 cells with plasmids containing the gene encoding the protein VP40 enough participation one [11, 12]. Protein filovirus VP40 is one of the three major components, accounting for 37.7 per cent (VP35 protein is 24.5% and nucleoprotein (NP) - 17%, respectively) from the mass of the virion, causes the formation of antibodies in humans, ill SLM [13, 14]. The VM appears in the blood and secretions of infected Guinea pigs and monkeys of Massa mulatta over 4 days from infection and can be detected by enzyme-linked immunosorbent assay (ELISA) [15, 16]. Guinea pigs were infected blood, semen, urine and flush water from the nasopharynx of an employee, the infected VM accidental laboratory infection. All the animals fell, and from their bodies was allocated VM [17]. Currently in Russia there are no commercially available ELISA test kits for rapid detection of antigen VM to the control of the imported animals for zoos and research purposes and tourists, arrived from Africa with symptoms similar in GLM. Preparations of purified monoclonal antibodies (MAB) can serve as the basis of such a system on their own or as a confirmatory test for PCR-diagnostics, which in Russia has not yet developed.

A known strain of hybrid animal cells Mus musculus L. M1/N-10G9, producing over 30 study of passages in vitro of monoclonal antibodies to the structural protein GP Marburg virus, strain Popp related to the IgG isotype, suitable for cooking on their basis based assays for specific detection of Marburg virus using enzyme-linked immunosorbent assay (patent RF №2186107, IPC C12N 5/18, publ. 27.07.2002,).

However, produced the specified strain of hybrid cells monoclonal antibodies specific for surface protein, which is a glycoprotein GP with a molecular mass (MM) 125 KD.

The closest analogue (prototype) is a murine hybridoma cell line producing the MCA to the matrix protein VP40 [7] of Marburg virus (strain Musoke).

However, it is not known hybrid cell line animals, producing µa, not competing for antigenic epitopes matrix protein VP40.

Known µa used in laboratory ELISA test systems in the format of "sandwich" for the detection of antigen VM[15, 22, 23, 24].

However, of these laboratory ELISA those who t-systems in the format of "sandwich" for the detection of antigen VM system on the basis of two µa, not competing for antigenic epitopes matrix protein VP40.

The technical result of the proposed technical solution is obtaining such strains of hybrid cells Mus musculus L. producing specific µa to protein VP40 VM (strain Popp), not competing for antigenic epitopes, which allows their use in immunoassay format "sandwich" to identify protein VP40 of VMS sharing the MCA as "exciting" antigen and as an "indicator", labeled with Biotin, which will increase the reliability of ELISA in the laboratory the VM and when designing test systems for the detection of antigens.

This technical result is achieved by creating a hybrid strain of animal cells Mus musculus L. 7D8 deposited in the Collection of cell cultures fsri SRC VB "Vector" of Rospotrebnadzor, which is the producer of monoclonal antibodies specific to the extracellular matrix protein VP40 of Marburg virus (strain Popp) and used as "exciting" antigen in ELISA format "sandwich" to identify the matrix protein VP40 of Marburg virus (strain Popp).

This technical result is also achieved by creating a hybrid strain of animal cells Mus musculus L. 7H10 deposited in the Collection of cell cultures fsri SRC is B "Vector" of Rospotrebnadzor, which is the producer of monoclonal antibodies specific to the extracellular matrix protein VP40 of Marburg virus (strain Popp) and used as an indicator labeled with Biotin in immunoassay format "sandwich" to identify the matrix protein VP40 of Marburg virus (strain Popp).

This technical result is also achieved by use of a monoclonal antibody 7D8 produced by a strain of hybrid animal cells Mus musculus L. 7D8 related to the subclass IgGI immunoglobulin having heavy 55 kDa and 25 kDa light chain and monoclonal antibodies N produced by a strain of hybrid animal cells Mus musculus 1. N related to the subclass IgGI immunoglobulin having heavy 55 kDa and 25 kDa light chain and used in ELISA format "sandwich" to identify the matrix protein VP40 of Marburg virus (strain Popp).

It is also possible to use MCA in immunofluorescence and enzyme immunoassay methods for the detection of VM in infected cells and tissues.

The strains obtained by fusion of mouse cells p3-X63/Ag8.653 (NS/1) myeloma cells spleens of BALB/c mice immunized with purified, concentrated, inaktivirovannye drug VM obtained from plasma of infected Guinea pigs [18] and inaktivirovannye dimer etilenimina to 0.17% as described [19].

The inventive strains of hybrid cells Mus musculus L. SRC VB "Vector" - 7D8 and Mus musculus L. SRC VB "Vector" - N received at the State research center of Virology and biotechnology "Vector" of Rospotrebnadzor, the Russian Federation and deposited in the Collection of cell cultures SRC VB "Vector". Author name hybridoma cell lines - 7D8 and N.

The inventive strains of hybrid cells are part of the collection fsri SRC VB "Vector"consisting of 21 hybridoma cell lines, 11 of which produce µa to protein VP40 of Marburg virus (strain Popp) [20].

Pedigree strains. Strains of hybrid cells obtained by fusion of mouse cells p3-X63/Ag8.653 (NS/1) myeloma cells spleens of BALB/c mice immunized with purified, concentrated, inaktivirovannye drug VM. As a melting agent used 45% solution of polyethylene glycol "Sigma" with a molecular weight of 1300-1600 KD according to the method

[25]. Cells after fusion were grown in selective medium GAT in 96-well culture plates. As feeder cells used peritoneal macrophages outbred mice. Hybridoma, consistently producing specific MCA, cloned 3 times. The output of positive clones in the last clone was 100%. The number of passages by the time deposits: 7-10 passages. Marker signs and methods of their evaluation. Strains before irout mouse immunoglobulins of the IgG subclass (with heavy 55 kDa and 25 kDa light chain), specifically interact with the protein VP40 VM. Analysis of mouse immunoglobulins performed by ELISA, using as antigen vaccine, VM (strain Popp) or recombinant protein VP40 (obtained by biosynthesis in E.coli cells on the basis of plasmid construction, including a full VP40 gene VM as described [21]) and antibodies against mouse IgG labeled with horseradish peroxidase. Contamination by bacteria and fungi were not found.

Cultural properties. Media for cultivation of DMEM/F12 with glutamine, pyridoxine, Hepes (fsri SRC VB "Vector" of Rospotrebnadzor). The content of fetal serum, optimized for hybrid (HyClone, USA) in growth medium at 10%. Wednesday also add, 80-160 μg/ml gentamicin sulfate.

Strains are monocline-suspension cultures, in which up to 20% of the cell is in suspension, being attached to the surface of the cookware for cultivation. Cells from the surface of the culture dishes are removed with a solution of trypsin/versene = 1/1 (volume/volume). Sowing dose of 200 thousand cells/ml, the Frequency of passage through 3-4 days. The proliferation index is not less than 5. Cultivation of hybrid in the body of the animal. Female BALB/c mice (vivarium GMCVB "Vector") previously injected intraperitoneally with 0.3-0.5 ml of piers (Sigma). After 2-4 weeks the animals are vaccinated intraperitoneally 10 million hybrid cells. Ascitic tumors of the ü is formed at 7-10 days. Hybridoma grafted in 100% of cases. From one animal you can get 3-5 ml of ascitic fluid containing MAB.

The characteristic of a useful product. Typing monoclonal antibodies was performed by the method of solid-phase ELISA using monospecific mouse antibodies (Sigma, USA). MCA belong to the subclass IgGl. They specifically interact with native protein VP40 VM (32 kDa) and recombinant protein VP40 VM (36 kDa) in the reaction immunoblot. In ELISA titer µa in ascites is for 7D8 - 1:2187000 and N - 1:729000 respectively. Stable products µa persists for at least 10 passages in vitro under continuous cultivation. One ml of ascitic fluid can be obtained 3-5 mg of purified monoclonal antibodies.

Cryopreservation. Environment for freezing - environment DMEM(M) - 50%, fetal serum - 40%, dimethylsulfoxide - 10%. 1-1,5 ml of cell suspension is transferred into a plastic cryoprobes and placed in a Styrofoam container with a wall thickness of 1 see the Container make a pair of liquid nitrogen and after 18-24 hours, the tubes are transferred into liquid nitrogen. Defrosting is carried out, omitting the tubes in water with a temperature 37-41°C. the cells of the plant with the environment DMEM(M) and centrifuged at 1000 rpm Sediment resuspended in the growth medium and the cells are transferred into culture flasks at a concentration of 200-300 you the ball in the Cup. Cell viability after thawing is 60-80% (according to the results of staining with 0.25% Trifanova blue). Each ampoule contains not less than 1 million/ml of cells.

The invention is illustrated graphic material presented on figure 1-3.

Figure 1 presents electrophoregram purified monoclonal antibodies, where:

1, 2 drugs treated µa N and 7D8 (1 ál), arrows indicate chains of immunoglobulins:

t - heavy chain (55 kDa); l - light chain (25 kDa);

3 - protein molecular weight markers (10 ml)(Bio-Rad);

4 - molecular weight protein markers.

On figa presents electrophoregram native protein of Marburg virus and the recombinant protein VP40, where:

1 - molecular weight protein markers;

2 - protein molecular weight markers (10 ml)(Bio-Rad);

3 - purified recombinant protein VP40 (10 μl);

4 - preparation of virus Marburg (10 μl), arrows indicate viral proteins;

5 - labeling of viral proteins;

On FIGU presents an immunoblot of native and recombinant proteins VP40 with MCA, where:

1 - preparation of virus Marburg processed µa N in a dilution of 1:500;

2 - preparation of virus Marburg treated MAB 7D8 at a dilution of 1:500;

3 recombinant protein VP40 processed µa N in a dilution of 1:500;

4 recombinant protein VP40 treated MAB 7D8 at a dilution of 1:500;

5 - p is apart Ebola processed µa N in a dilution of 1:500 (negative control);

6 - preparation of Ebola virus treated MAB 7D8 at a dilution of 1:500 (negative control);

7 - E.coli lysate. processed µa N in a dilution of 1:500 (negative control);

8 - E.coli lysate. processed µa 7D8 at a dilution of 1:500 (negative control).

Figure 3 shows a graph of the titration of antigen Marburg virus and recombinant protein VP40 pair µa 7D8 and N*where the initial concentration of the drug antigens SF 1 mg/ml, the first point of the reaction at a dilution of 1:400 corresponds to a concentration of 2500 ng/ml;

N* indicator MCA-labeled Biotin;

as a negative control was used a couple µa A and S*specific to the protein VP40 of Ebola virus;

the concentration of MAB for capture of antigen 10 μg/ml;

the concentration of the indicator MCA labeled with Biotin - 1 µg/ml

The method of obtaining the claimed strains

Strains of hybrid cells Mus musculus L. SRC VB "Vector" - 7D8 and Mus musculus L. SRC VB "Vector" N obtained as follows. Female BALB/c mice (vivarium GMCVB "Vector"), weighing 15-20 g, subjected to immunization scheme, which is listed in the following table.

Scheme immunization
daysthe diluent antigenantigen dose (μg/mouse)the region is injectie
0full adjuvant's adjuvant10intraperitoneally
7incomplete adjuvant's adjuvant10intraperitoneally
11Saline33intravenous
12Saline45intravenous
14Hybridization(the fence spleen)

To merge use a ratio of 3/1 splenic cells of mice and cells of mouse myeloma NS/1. The mixture of cells centrifuged, the supernatant carefully removed and the cells draught add 0.4 ml of a 45% solution of polyethylene glycol (PEG) with a molecular mass of 1300-1600. The mixture was centrifuged 15 min at 1000 Rev/min After 3 min pause layer PEG slowly diluted with 5 ml of versene, after which the precipitate resuspended.

The cells are then again precipitated (10 min at 1000 rpm) and is dissolved in the growth medium. Cells are distributed in five 96-hole blade (Costar) in 100 m is l in the hole. Selection of hybrid cells is carried out in the environment GAT, consisting of a nutrient medium, DMEM(M), which added 10% fetal cow serum (Gipco), 0.1 mm hypoxanthine, 0.04 mm thymidine and 0.01 mm aminopterin.

The selection of specific hybrids performed enzyme-linked immunosorbent assay (ELISA). In wells blade (Animepalm) as antigen absorb 100-200 ng purified VM. Place of nonspecific binding is saturated with 0.5% solution of casein (ICN). Then transferred into the wells, 100 μl of culture medium analyzed hybrid and incubated for 45 min at 37°C. After incubation, the wells are washed 3-5 times with physiological saline containing 0.05% tween-20 (Sigma). Later in the tablets make 100 ál individualo conjugate (rabbit immunoglobulins drink mouse IgG labeled with horseradish peroxidase and incubated for 45 min at 37°C. the Tablets are washed and carry out the enzymatic reaction. The results of the analysis determined on spectrophotometer "Multiscan" (Finland). The resulting hybrid strains twice clone method of limiting dilutions, translated in popular culture and frozen in liquid nitrogen. The following examples explore in detail the beneficial properties of the objects of the invention.

Example 1. Culturing the hybrid cells of strains of Mus musculus L. SRC VB "Vector" - 7D8 and Mus musculus L. SRC VB "Vector" N producing µa to protein VP40 VM in animals, BALB/c.

Mice BALB/c (vivarium GMCVB "Vector"), weighing 20-22 g, not less than 10 days before inoculation of hybridoma cells injected intraperitoneally 0.3-0.5 ml of the Wharf. Cultured cells are in the logarithmic growth phase, sterile centrifuged for 5-10 minutes at 1000 rpm t a centrifuge ARF-3. Adosados removed, and the residue cells suspension in a sterile solution of Earl or Hanks. Female BALB/c mice (vivarium GMCVB "Vector") weighing 20-22 g intraperitoneally injected every 1 ml of cell suspension, containing not less than 10 million hybridoma cells. After 7-10 days the animals are euthanized and under aseptic conditions from the abdominal cavity extract 3-5 ml of ascitic fluid. Cells from ascitic fluid is separated by centrifugation, and the supernatant is determined tiger µa using ELISA as described above.

Example 2. The selection of the purified monoclonal antibodies produced by hybrid cultured cells of strains of Mus musculis L. SRC VB "Vector"- 7D8 and Mus musculus L. SRC VB "Vector" N.

One volume of ascitic fluid containing MAB, diluted with 4 volumes of 0.6 M acetate buffer (0.04 M citric acid, 0.2 M sodium acetate), pH 4.0 and bring the pH to 4.5 using a 0.1 N sodium hydroxide solution. To the diluted sample is added dropwise, with constant stirring, Caprylic acid at the rate of 25 µl per 1 ml and incubated overnight at +4°C. Then the center is pageroot 30 min at 8000 g, and the precipitate is removed, and adosados mixed with tenfold phosphate-saline buffer (FSB) and set pH 7.4 with a solution of 1.0 N sodium hydroxide. Equal volume of a saturated solution of ammonium sulfate is added to this solution, shaken and incubated overnight at 4°C or 30 min at +20-25°C. Centrifuged 15 min at 5000 g. Adosados merge, and the residue is dissolved in FSB, pH 7.4. The remains of ammonium sulfate is removed by dialysis against 50 to 100 volumes of the FSB, pH 7.4. Electrophoresis of purified preparations of the MCA was carried out according to the method described in [27] in a discontinuous buffer system using 12-15% polyacrylamide gel with 0.1% sodium dodecyl sulfate in Tris-glycine buffer. The separating gel contained 0,0625 M Tris-HCl (pH 8.8), 0.1 percent SDS, 10(15)% acrylamide, 1% N,N - methylenebisacrylamide. Drugs µa (1 μl) was applied to the track in a volume of 30 μl buffer containing 0,0625 M Tris-HCl (pH 6.8), 2% SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.01% of bromophenol blue. Before applying a buffer containing MCA, warmed up 3 min. at 95°C. Electrophoresis was mode 10/see the color of the gel was performed using Kumasi G-250. Purified preparations of electrophoregram presented in figure 1.

Example 3. Determination by ELISA specific interaction MCA produced by hybrid cell strains of Mus musculus L. SRC VB "Vector"- 7D8 and Mus musculus L. SRC VB "Vector" N with VM and recombinant protein VP40.

ELISA spend the camping on polystyrene plates. The antigen in the working dilution (purified and inactivated Marburg virus or recombinant protein VP40) barbirolli the FSB, pH 7.4 in the amount of 100 μl/well to the plates. Place nonspecific binding was saturated at 37°C for 45 minutes with 0.5% solution of casein in buffer TSB-twin (0.145 M sodium chloride, 20 mM Tris-HCl, 5 mM FMSF (Sigma), 0.1% of Tween-20 (Serva), pH of 7.4) and then incubated with purified µa 45 minutes at 37°C. Specific binding of the MAB to the antigen was identified antivirovym peroxidase labeled antibodies against mouse IgG. Next was added a Chromogen, a 0.1% O-phenylenediamine in citrate-phosphate buffer (0.2 M citric acid, 0.5 M Na2HPO3, pH 5.0) from 0.03% hydrogen peroxide). Stopped the reaction by adding 100 µl per well of 1 N HCl and measured the optical density of samples on a spectrophotometer "Multiscan" using a filter with a maximum transmission 492 nm. As negative and positive control used homologous normal (non-immune) and hyperimmune serum, respectively.

Example 4. Identifying the immunoblot interaction MCA produced by hybrid cell strains of Mus musculus Mus musculus L. L. SRC VB "Vector" - 7D8 and Mus musculus L. SRC VB "Vector" N with protein VP40 VM (strain Popp) and recombinant protein VP40. Viral proteins and recombinant protein VP40 after 12% SDS page electrophoresis were transferred to nitrocellulose membrane (Milipore, USA). Place nonspecific binding was saturated with 0.5% solution of casein in buffer TSB-twin (0,145 M sodium chloride, 20 mM Tris-HCl, 5 mM PMSF (Sigma), 0.1% Tween-20 (Serva), pH of 7.4) at 37°C for 2 hours. Then the individual strips of the membrane were incubated with purified µa 4 hours at 20-22°C. Specific binding of antibodies that interact with viral proteins were revealed using conjugate antivitamin antibodies against mouse IgG labeled with horseradish peroxidase. As a negative control used strips of the membrane with transferred after electrophoresis inaktivirovannye Ebola virus [26] and the E. coli lysate., also processed µa. The results are presented on figa and 2B.

Example 5. Preparation of conjugates of the ICA with Biotin.

For biotinidase monoclonal immunoglobulins used the following method: prepare a fresh solution NSB(N-hydroxysuccinimidobiotin)was dissolved 2 mg of Biotin in 0.5 ml DMSO and made up to 2 ml were Then prepared solution treated µa (0.1 m NaHCO3pH of 9.0) at a concentration of 1 mg/ml Solution NSB drip was added to a solution of MCA in a volume ratio of 1/1, and incubated at room temperature for 4 hours. Then brought the volume of solution to 1 ml of 0,05M phosphate buffer (PBS) with pH 7.0, containing 0,15M sodium chloride and 0.1% sodium azide. Were dialyzed against phosphate buffer. The process of inclusion of Biotin in immunoglobulins to what was trenirovali titration labeled MCA on the antigen, immobilized on plastic, with a conjugate of peroxidase with streptavidin.

Example 6. Competitive ELISA format "sandwich" for the detection of native protein VP40 virus VM (strain Popp) and recombinant protein VP40.

In the wells vysokozolnyh polystyrene plates ("Testiks" or "Nunc") barbirolli peeled µa 7D8 in 0.5 M carbonate buffer (pH 9,0) in a volume of 100 μl in working concentration (10 μg/ml) at 22°C for 12 hours Designated for non-specific binding of antibodies on tablets fed a 0.5% solution of casein and kept at 37°C for 30 minutes. Titration of antigen was performed with a dilution of 1:400 double step over night at 4°C or at 37°C for one hour Then in the wells of tablets made conjugates µa N with Biotin in the working dilutions (1 μg/ml), kept at 37°C for one hour and, after three times washing of the wells, was made conjugate with streptavidin peroxidase. Specific binding of the antibody labeled with Biotin, with conjugate was detected liquid substrate system TMB (3,3',5,5'-Tetramethylbenzidine, Sigma) in 100 μl per well. Stood tablets 30 min in the dark, stopped the reaction by adding 100 µl per well of 1N hydrochloric acid and measured the optical density of samples on a spectrophotometer scanreceiver" at a wavelength of 450 nm. Positive thought of the measurement results OP in well in excess of 2 times that of the wells with Autry is telnum control. For negative control of antibody binding to the antigen used a couple of not competing µa detecting protein VP40 of Ebola virus. The graph of the titration of antigens presented on figure 3.

The above properties of strains of hybrid cells Mus musculus L. SRC VB "Vector" - 7D8 and Mus musculus L. SRC VB "Vector" N (author's name cell lines 7D8 and N) allow to conclude that for the first time on the basis of mouse myeloma received hybridoma Mus musculus L. SRC VB "Vector" - 7D8 and Mus musculus L. SRC VB "Vector" N - producers µa, not competing for the antigenic epitopes of the protein VP40 VM. Strains of hybrid cells provide mouse monoclonal IgGI immunoglobulin in the amount of 3-5 mg of purified antibodies from ml of ascitic fluid. Peeled µa specific reacted in ELISA with VM (titer µa 7D8 and N was 1:2187000 and 1:729000 respectively) and recombinant protein VP40 (titer µa 7D8 and N was 1:243000 1:729000 respectively), were detected in the immunoblot virus-associated protein VP40 and recombinant protein VP40 (obtained by biosynthesis in cells R.coli based plasmid construction, including a full VP40 gene ow). Sharing µa in ELISA format "sandwich" allows you to identify native and recombinant proteins with sensitivity of less than 1 ng/ml the Use of these drugs MCA and recombinant Bel is and VP40 as a positive control antigen, effectively identify cases of GLM on the territory of Russia in the format of ELISA "sandwich".

The above properties of strains of Mus musculus L. SRC VB "Vector" - 7D8 and Mus musculus L. SRC VB "Vector" N (author's name cell lines 7D8 and N) distinguish them from all previously described hybridomas producing µa to proteins of the virus Marburg.

1. The hybrid strain of animal cells Mus musculus L. 7D8 deposited in the Collection of cell cultures fsri SRC VB "Vector" of Rospotrebnadzor, which is the producer of monoclonal antibodies specific to the extracellular matrix protein VP40 of Marburg virus (strain Popp) and used as exciting antigen in ELISA format "sandwich" to identify the matrix protein VP40 of Marburg virus (strain Popp).

2. Monoclonal antibody 7D8 produced by a strain of hybrid animal cells Mus musculus L. 7D8 (subclass of immunoglobulins IgG1)with severe 55 kDa and 25 kDa light chain and used in ELISA format "sandwich" to identify the matrix protein VP40 of Marburg virus (strain Popp).

3. The hybrid strain of animal cells Mus musculus L. 7H10 deposited in the Collection of cell cultures fsri SRC VB "Vector" of Rospotrebnadzor, which is the producer of monoclonal antibodies, pacificnew to the matrix protein VP40 of Marburg virus (strain Popp) and used as the indicator, labeled with Biotin, enzyme-linked immunosorbent format "sandwich" to identify the matrix protein VP40 of Marburg virus (strain Popp).

4. Monoclonal antibody 7H10 produced by a strain of hybrid animal cells Mus musculus L. 7H10 (subclass of immunoglobulins IgG1)with severe 55 kDa and 25 kDa light chain and used in ELISA format "sandwich" to identify the matrix protein VP40 of Marburg virus (strain Popp).

5. Set for enzyme immunoassay systems format "sandwich" to identify the matrix protein VP40 of Marburg virus (strain Popp), ukucali monoclonal antibody 7D8 produced by a strain of hybrid animal cells Mus musculus L. 7D8 and adsorbed on polystyrene tablets, Biotin conjugates with monoclonal antibodies N produced by a strain of hybrid animal cells Mus musculus L. 7H10, conjugate with streptavidin peroxidase and tetramethylbenzidine, quantitative content of which in the set is sufficient for enzyme reactions.



 

Same patents:

FIELD: medicine.

SUBSTANCE: substance of the invention involves introduction of hydrocortisone in a minimal dose 0.3 mg per 1 g of body weight to white outbred mice to be infected with Chlamidia. Their spleen and liver is material to prepare 10% suspension that is centrifuged 2000 rpm for 10 minutes, while supernatant is used as an antigen material.

EFFECT: higher yield of the antigen material.

1 tbl

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of Marburg haemorrhagic fever. A strain of hybrid animal cells Mus musculus L. 3F9 is formed, which is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR. The hybridoma strain produces monoclonal antibodies which are specific to the VP35 protein of the Marburg virus (Popp strain) (hereinafter MCA). MCA 3F9 produced by hybrid animal cells Mus musculus L. 3F9 relate to a subclass of immunoglobulins IgGI, having a heavy 55 kDa and a light 25 kDa chain and having a unique feature of detecting the VP35 protein of the Marburg virus (Popp strain) in a "sandwich" immunoenzymometric system format owing to antigen "capture" properties and simultaneously be an indicator, labeled biotin. The antigen epitope for MCA 3F9 produced by the 3F9 hybridoma is localised between 252 and 278 aminoacid residues.

EFFECT: invention enables to obtain MCA with specificity to VP35 protein of the Marburg virus (Popp strain), suitable for immunodiagnosis of Marburg haemorrhagic fever.

2 cl, 3 dwg, 1 tbl, 5 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of human cytomegalovirus. The strain of hybrid animal cells Mus musculus L.5F10 is obtained by merging mouse myeloma cells p3-X63/Ag8.653 (NS/1) with mouse spleen cells BALBc, immunised by an affinity purified recombinant protein pp65. The hybridoma strain is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR and is used as a producer of monoclonal antibodies for detecting the pp65 protein of human cytomegalovirus.

EFFECT: invention enables to widening of range of strains of hybrid cells Mus musculus L - producers of MCA for detecting the pp65 protein of human cytomegalovirus and production of domestic diagnostic test-systems for detecting cytomegaly.

2 dwg, 1 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention belongs to medicine, notably to laboratory method of diagnostics. Principle of the method is isolation and identification of pathogenic and opportunistic microorganisms from biopsic material of common bile duct and assessment of antilysozim activity of isolated microorganisms. Antilysozim activity index 5.5±0.5 mcg/ml confirms acute purulent cholangitis diagnosis, 3.7±0.6 mcg/ml characterises acute recurrent purulent cholangitis, while index 1.1±0.4 mcg/ml supposes chronic purulent cholangitis.

EFFECT: method allows differential diagnostics of purulent cholangitis.

2 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: method of determining sensitivity of horses to antigens of microorganisms of various taxonomic keys, which includes carrying out reaction of leukocytolysis with blood leucocytes using antigen, calculation of leukocytes in Goryaev's chamber before and after incubation and further determination of organism sensitivity by leukocytolysis index, different in the fact that in setting of reaction, first, solution of acidin-pepsin is introduced into samples, calculation of leukocytes before incubation is carried out only in control sample, and leukocytolysis index (LCI) is determined after incubation of experimental and control samples with further deduction of percent of spontaneous leukocytolysis (SLC) in control sample and is final value of LCI (3) is to 20%, organism sensitivity is considered to be low, 20-40% - medium, 40% and higher -high.

EFFECT: increase of determination accuracy.

5 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention aims at treatment, diagnostics or prevention of parasitic disease. There is used combination histone proteins H2A, H2B, H3 and H4 recovered from Leishmania infantum for making a pharmaceutical composition and a diagnostic aid. It involves applying a vector containing nucleotides coding specified histones.

EFFECT: invention allows treating and preventing the parasitic disease caused by one type with using histones originated from the other type.

13 cl, 4 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: to detect or chrysanthemum virus B in plants, a diagnostic set containing polyclonal antibodies to protein of Chrysanthemum virus B shell, a conjugate marked with alkaline phosphatase, a fixing buffer; an extraction buffer, ECI-buffer and PNP-buffer is used. Protein of viral shell is produced by amplification of the purified gene of said protein with using a nonsynonymous primer ATGCCTCCCAAACCGGCACCAGGTGAT and synonymous primer TTTATAATGTCTTATTATTCGCAT.

EFFECT: improved antiviral action of the compound.

15 cl, 2 ex

FIELD: medicine.

SUBSTANCE: there is used for diagnostics of transient and persistent latent papilloma virus infection. The diagnostic technique for papilloma virus infection is ensured by history taking and integrated clinical-laboratory examination. As anamnestic signs, there are assumed compromised oncologic characteristics inheritance, early sexual life, age younger than 20 years old and promiscuity; as clinical - anogenital warts, erosion and ectopic neck of uterus, contact hemorrhagic diathesis, Ovuli nabotti, inflammatory diseases of small pelvis organs and intrauterine spiral. Herewith the laboratory signs are sexually transmitted diseases, mixtinfection, deficient lactic acid bacilli, vaginal disbiosis caused by conditional-pathogenic flora, bacterial vaginosis, virus-virus associations, urogenital herpes, urogenital mycoplasma infection, urogenital ureaplasma infection, urogenital candidiasis, urogenital Chlamidia infection and infection with various genotypes of human papilloma virus. Each sign is scored, and depending the number of points, persistent or transient clinical course of papilloma virus infections, or follow-up examination is performed.

EFFECT: determining tactics of the following management of the patient, forming group of potential risk for development of focal dysontogenetic and malignant transformations of urogenital epithelium.

1 dwg, 2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, particularly to laboratory examinations and can be used in selection of therapeutic approach to tonsillitis. The method involves microbiological study of tonsil lacunae contents. It involves detection of microorganism types and concentration. And if the association shows one or more microorganisms which are not normal tonsil lacuna inhabitants in concentration ≥105 CFU/ml, photodynamic therapy is predicted to be inefficient. The fact that test object is microflora enables to determine an etiological agent, as well as degree of activity of inflammatory process whereat photodynamic therapy aims.

EFFECT: method allows determining objective indications for photodynamic therapy in chronic tonsillitis that ensures more effective treatment of the patients.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine and can be used for express-estimation of severity of state of patient with burn disease. Laboratory analysis is carried out, degree of natural colonisation of buccal epithelium cells with bacteria Streptococcus salivarius, average number of bacteria Streptococcus salivarius adhesed on one buccal epithelium cell - index of natural colonisation of buccal epithelim cells (INCBEC), and if INCBEC value is greater than 10, conclusion about light degree of severity of patient's with burn disease state is made, of INCBEC value is from 5 to 10 - about medium degree of severity of patient's with burn disease state is made, and if INCBEC value is lower than 5 - about severe degree of severity of patient's with burn disease state.

EFFECT: method is simple in realisation, takes little time, non-traumatic, eliminates risk of infection.

3 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of Marburg haemorrhagic fever. A strain of hybrid animal cells Mus musculus L. 3F9 is formed, which is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR. The hybridoma strain produces monoclonal antibodies which are specific to the VP35 protein of the Marburg virus (Popp strain) (hereinafter MCA). MCA 3F9 produced by hybrid animal cells Mus musculus L. 3F9 relate to a subclass of immunoglobulins IgGI, having a heavy 55 kDa and a light 25 kDa chain and having a unique feature of detecting the VP35 protein of the Marburg virus (Popp strain) in a "sandwich" immunoenzymometric system format owing to antigen "capture" properties and simultaneously be an indicator, labeled biotin. The antigen epitope for MCA 3F9 produced by the 3F9 hybridoma is localised between 252 and 278 aminoacid residues.

EFFECT: invention enables to obtain MCA with specificity to VP35 protein of the Marburg virus (Popp strain), suitable for immunodiagnosis of Marburg haemorrhagic fever.

2 cl, 3 dwg, 1 tbl, 5 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of human cytomegalovirus. The strain of hybrid animal cells Mus musculus L.5F10 is obtained by merging mouse myeloma cells p3-X63/Ag8.653 (NS/1) with mouse spleen cells BALBc, immunised by an affinity purified recombinant protein pp65. The hybridoma strain is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR and is used as a producer of monoclonal antibodies for detecting the pp65 protein of human cytomegalovirus.

EFFECT: invention enables to widening of range of strains of hybrid cells Mus musculus L - producers of MCA for detecting the pp65 protein of human cytomegalovirus and production of domestic diagnostic test-systems for detecting cytomegaly.

2 dwg, 1 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to humanised anti-TGF-beta-antibody which is linked to TGF-beta. The humanised antibody has a variable domain VH which contains residues of the hypervariable region (non-human), which are contained in the human domain VH which includes a modified framework region (FR) (amino acid and nucleotide sequences are given in the list of sequences). The humanised antibody can contain residues of the complementarity determining region (CDR) of the variable domain of the light strand VL. The invention also relates to a composition for treating TGF-beta mediated disorders, e.g. malignant tumours, nucleic acid, coding monoclonal antibody, and a method of obtaining the latter using host cells. The invention provides a method of treating and detecting TGF-beta in a sample from the body using the disclosed antibody, as well as to a product which contains the humanised antibody and directions for use for treating TGF-beta mediated disorders.

EFFECT: invention enables control of TGF-beta molecules, which can prevent possible changes in antibodies, enables preparation of high-affinity humanised antibodies which act as TGF-beta antagonists.

57 cl, 45 dwg, 4 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention aims at preparation of new strain of hybrid cells Mus. Musculus 6F3 - a producer of monoclonal antibody (MCA) to hemagglutinin protein of high-pathogen avian influenza virus A/duck/Novosibirsk/56/05. Strain 6F3 is prepared by fusing murine myeloma cells Sp2/0 with murine spleen cells BALB/c, immunised with a purified and inactivated preparation of avian influenza virus A/H5N1 (strain A/duck/Novosibirsk/56/05). Hybridoma produced MCA belong to IgA class. Strain 6F3 is deposited in the Collection of cell culture of Ivanovsky State Research Institution of Virology of the Russian Academy of Medical Sciences, No. 8/2/3. Using hybridoma allows producing specific monoclonal antibodies to hemagglutinin protein of avian influenza virus A/H5N1.

EFFECT: possibility to use antibodies to studying the antigenic structure of hemagglutinin for differential diagnostics of avian influenza virus A/H5 serotype.

1 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: invention can be used for production of monoclonal antibodies (MCAs) to heat shock protein 70 (HSP 70). A hybridoma strain is made by immunisation of BALB/c mice with bovine HSP 70 within 78 days. For the third days, splenocytes of immune mice (108 cells) are hybridised with murine myeloma cells P3-X63 Ag/8-653 (107 cells). A fusion agent is polyethylene glycol of molecular weight 4000 (Merk, Germany). The hybridisation is followed with selection, screening, cloning and cryopreservation of hybridoma. Hybridoma 6G2 is deposited in the microorganism collections of "ГНТТ ПМБ" under No. H-2. MCA.

EFFECT: produced hybridoma under the invention is more evident to be detected as HSP 70 on the cell surfaces, and change of endocellular HSP 70 level when exposed to the stress factors.

4 dwg, 1 tbl, 6 ex

FIELD: pharmacology.

SUBSTANCE: invention can be used to identify a pseudotuberculosis agent in bacterial cultures, a biological material and environmental objects by applying the indirect hemagglutination test. Substance of the invention consists in development of a new diagnosticum that represents formalinised sheep's erythrocytes sensitised with monoclonal antibodies to lipopolysaccharide antigen of cold version Yersinia pseudotuberculosis serotype I (strain 164/84 serovariant I) and frozen-dried in a protective medium. Shelf life of the preparation is 2 years.

EFFECT: diagnosticum provides high sensitivity, specificity to the UHAT in detecting Yersinia pseudotuberculosis serotype I.

FIELD: veterinary.

SUBSTANCE: strain 5A10 of hybridomal line of cells of mouse Mus. museums, producing monoclonal antibodies to immunoglobulin IgG of cattle (C) is permanent line of cells and is suitable for biotechnology in elaboration of preparations. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 71. Antibody titers in native culture liquid constitute 1:32-1:64, in ascitic liquid 1:640-1:5120 in immuno-enzymatic analysys. Monoclonal antibodiesproduced by strain are specific to immunoglobulin IgG of cattle and do not react with immunoglobulins of sheep. Peroxydase-marked monoclonal antibodies ensure high sensitivity and specificity of IEA for detection of antibodies to C leucosis virus in biological material. Strain 5A10 - producent of monoclonal antibodies to immunoglobulin IgG of cattle can be used in production of immuno-enzymatic test-system for diagnostics of C leucosis.

EFFECT: application of said test-system will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms.

5 ex

FIELD: veterinary.

SUBSTANCE: obtained is strain 1H8 of hybridomal line of cells of mouse Mus. musculus - producent of monoclonal antibodies to IgG of sheep, suitable for biotechnology in elaboration of diagnostic preparations. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 73. When determined by method of immuno-enzymatic analysys (IEA) antibodies titers in native culture liquid constituted in IEA 1:32-1:64, in ascitic liquid 1:640-1:5120. Monoclonal antibodies are specific to immunoglobulin IgG of sheep and do not react with immunoglobulin of cattle. When used for fixation on solid phase of glycoproteidal antigen of cattle (C) leucosis virus (in composition of complex glycoproteidal antigen- monoclonal antibodies of sheep to glycoproteidal antigen) in IEA, they ensure strength of fixation and optimal availability of antigen for antibodies in testes samples.

EFFECT: strain 1H8 can be used in production of immuno-enzymatic test-system for diagnostics of C leucosis, which will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms.

1 tbl, 4 ex

FIELD: veterinary.

SUBSTANCE: obtained is strain 8C12 of inter-species hybrid cells of mouse Mus musculus and sheep Ovis aries - producent of monoclonal antibodies of sheep to glycoproteidal antigen of virus of cattle (C) leucosis. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 72. Strain is permanent hybrid line of cells and possesses high level of production of monoclonal antibodies of sheep. Antibody titers in native culture liquid constitute 1:32-1:64 in immuno-enzymatic analysys (IEA). Monoclonal antibodies are specific to general antigen determinant of glycoproteids of C leucosis - external gp51 and transmembranous gp30. When used in IEA for detection of antibodies in blood serum and milk of C infected with leucosis virus, antibodies provide strong selective binding with solid-phase carrier and optimal space orientation of glycoproteidal antigen.

EFFECT: strain 8C12 can be used in production of immuno-enzymatic test-system for diagnostics of cattle leucosis, which will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms and, as a result, reduce incidence of leucosis in cattle.

1 tbl, 4 ex

FIELD: pharmacology.

SUBSTANCE: present invention refers to immunology and biotechnology. There are antibody-antagonist to CD40 with their variable areas derived from an antibody produced of hybridoma 4D11 (FERM BP-7758). The constant areas of antibodies are derived from human IgG4 with mutations S228P and L235E. There are described related coding polynucleotides and the based expression vector. There is disclosed host-cell containing said vector. There is described method for preparing monoclonal antibody and application thereof in the pharmaceutical composition.

EFFECT: application of the invention provides reduced ADCC and CDC activity that can find application in therapy of autoimmune diseases and graft rejection.

10 cl, 26 dwg, 2 tbl, 22 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of Marburg haemorrhagic fever. A strain of hybrid animal cells Mus musculus L. 3F9 is formed, which is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR. The hybridoma strain produces monoclonal antibodies which are specific to the VP35 protein of the Marburg virus (Popp strain) (hereinafter MCA). MCA 3F9 produced by hybrid animal cells Mus musculus L. 3F9 relate to a subclass of immunoglobulins IgGI, having a heavy 55 kDa and a light 25 kDa chain and having a unique feature of detecting the VP35 protein of the Marburg virus (Popp strain) in a "sandwich" immunoenzymometric system format owing to antigen "capture" properties and simultaneously be an indicator, labeled biotin. The antigen epitope for MCA 3F9 produced by the 3F9 hybridoma is localised between 252 and 278 aminoacid residues.

EFFECT: invention enables to obtain MCA with specificity to VP35 protein of the Marburg virus (Popp strain), suitable for immunodiagnosis of Marburg haemorrhagic fever.

2 cl, 3 dwg, 1 tbl, 5 ex

Up!