Polypeptides with antimicrobial activity and polynucleotides coding them

FIELD: agriculture.

SUBSTANCE: polypeptide homological to polypeptide expressed by Eurotinium amstelodami, has antimicrobial activity and may be used to administer as medical or prophylactic agent to a person or animal, and also in fodder for animals.

EFFECT: improved efficiency of application.

19 cl, 2 tbl, 6 ex

 

The SCOPE of the INVENTION

The present invention relates to the selected polypeptides with antimicrobial activity and to selected polynucleotide coding for the polypeptides. This invention relates also to the structures of nucleic acids, vectors and cells of the host that contains polynucleotide, as well as to methods of production and use of polypeptides.

BACKGROUND of the INVENTION

The aim of the present invention is to provide polypeptides with antimicrobial activity and encoding the polypeptides of polynucleotides.

The INVENTION

The present invention relates to the selected polypeptides with antimicrobial activity, selected from the group consisting of

(a) a polypeptide with an amino acid sequence that has at least 60% identity to amino acids 1-42 sequence SEQ ID NO:2;

(b) a polypeptide which is encoded by a nucleotide sequence which hybridizes in conditions of at least moderate hardness (i) nucleotides 145-270 sequence SEQ ID NO:1, (ii) the cDNA sequence contained in nucleotides 1-270 in the sequence SEQ ID NO:1, or (iii) chain, complementary (i) or (ii); and

(c) a variant containing a conservative substitution, a deletion and/or insertion of one or several amino acids in amanaki is lots 1-42 in the sequence SEQ ID NO:2.

The present invention relates also to a selected polynucleotide coding for polypeptides with antimicrobial activity, selected from the group consisting of

(a) polynucleotide encoding a polypeptide with an amino acid sequence that has at least 60% identity to amino acids 1-42 sequence SEQ ID NO:2;

(b) polynucleotide having at least 60% identity to the nucleotide 145-270 sequence SEQ ID NO:1; and

(c) polynucleotide that hybridizes in conditions of at least moderate hardness (i) nucleotides 145-270 sequence SEQ ID NO:1, (ii) the cDNA sequence contained in nucleotides 1-270 sequence SEQ ID NO:1, or (iii) chain, complementary (i) or (ii).

The present invention relates also to the structures of nucleic acids, recombinant expressing vectors and recombinant cell host containing polynucleotide.

The present invention relates also to methods of producing such polypeptides with antimicrobial activity, comprising (a) cultivating a recombinant host cell containing the design of nucleic acid containing polynucleotide encoding the polypeptide, under conditions conducive for production of the polypeptide; and (b) isolation of the polypeptide.

The present invention relates t is the train to the uses of polypeptides and polynucleotides according to the invention.

DEFINITION

Antimicrobial activity:In the present description, the term "antimicrobial activity" is defined as an activity that can cause death or to inhibit the growth of microbial cells. In the context of the present invention mean that the term "antimicrobial" refers to the existence of bactericidal and/or bacteriostatic and/or fungicidal and/or fungistatic and/or virienga effect, where the term "bactericidal" should be understood as capable of killing bacterial cells. The term "bacteriostatic" should be understood as having the ability to inhibit the growth of bacteria, i.e. inhibiting the growth of bacterial cells. The term "fungicide" should be understood as capable of killing cells of fungi. The term "fungistatic" should be understood as having the ability to inhibit the growth of fungi, i.e. inhibiting the growth of fungi cells. The term "verocity" should be understood as having the ability to inactivate the virus. The term "microbial cells" refers to a bacterial cell or cells of fungi (including yeast).

In the context of the present invention mean that the term "inhibiting growth of microbial cells" means that the cells are in which is not growing condition, i.e. that they are not able to reproduce. For the purposes of the present invention the antimicrobial activity can be Opredelitel accordance with the method, described by Lehrer et al., Journal of Immunological Methods, Vol. 137 (2) pp. 167-174 (1991). Alternative antimicrobial activity can be determined in accordance with NCCLS guidelines from CLSI (Institute for clinical and laboratory standards; formerly known as national Committee for clinical laboratory standards).

Polypeptides with antimicrobial activity may have the ability to reduce the number of living cellsEscherichia coli(DSM 1576) to 1/100 after 8 hours (preferably after 4 hours, more preferably after 2 hours, most preferably after 1 hour, and in particular after 30 minutes) incubation at 20°C in an aqueous solution of 25% (wt./mass.); preferably in an aqueous solution of 10% (wt./mass.); more preferably in an aqueous solution of 5% (wt./mass.); more preferably in an aqueous solution of 1% (wt./mass.); most preferably in an aqueous solution of 0.5% (wt./mass.); and, especially, in an aqueous solution of 0.1% (wt./mass.) polypeptides with antimicrobial activity.

Polypeptides with antimicrobial activity can also possess the ability to inhibit the growth ofEscherichia coli(DSM 1576) for 24 hours at 25°C in the substrate for microbial growth when added at a concentration of 1000 ppm; preferably when added in a concentration of 500 ppm; more preferably when added in a concentration of 250 ppm; valueproposition when added at a concentration of 100 ppm; most preferably when added in a concentration of 50 ppm; and, especially, when added to a concentration of 25 ppm.

Polypeptides with antimicrobial activity may have the ability to reduce the number of living cellsBacillus subtilis(ATCC 6633) to 1/100 after 8 hours (preferably after 4 hours, more preferably after 2 hours, most preferably after 1 hour, and in particular after 30 minutes) incubation at 20°C in an aqueous solution of 25% (wt./mass.); preferably in an aqueous solution of 10% (wt./mass.); more preferably in an aqueous solution of 5% (wt./mass.); more preferably in an aqueous solution of 1% (wt./mass.); most preferably in an aqueous solution of 0.5% (wt./mass.); and, especially, in an aqueous solution of 0.1% (wt./mass.) polypeptides with antimicrobial activity.

Polypeptides with antimicrobial activity can also possess the ability to inhibit the growth ofBacillus subtilis(ATCC 6633) for 24 hours at 25°C in the substrate for microbial growth when added at a concentration of 1000 ppm; preferably when added in a concentration of 500 ppm; more preferably when added in a concentration of 250 ppm; more preferably when added in a concentration of 100 ppm; most preferably when added in a concentration of 50 ppm; and, in particular the military, when added to a concentration of 25 ppm.

The polypeptides according to the invention have at least 20%, preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, and most preferably at least 100% of the antimicrobial activity of the polypeptide consisting of the amino acid sequence represented as amino acids 1-42 sequence SEQ ID NO:2.

Defensin:As used in the present description, the term "defensin" refers to polypeptides that are known to specialists in this field, which belong to the class of antimicrobial peptides defensins. In order to determine whether the polypeptide by defensins in accordance with this invention, the amino acid sequence preferably compared with profile hidden Markov models (HMM profiles) PFAM database using open source software HMMER (see example 6).

The defensin family PFAM include defensin or defensin mammals" (registration no. PF00323), defensin or defensin arthropods" (registration no. PF01097), defensible or "be the a-defensin" (registration no. PF00711), dependingon or propeptide defensin" (registration no. PF00879) and gamma thionin or "the family of gamma mininov" (registration no. PF00304).

Defensin can belong to the class of alpha-defensin, to the class of beta-defensin to the class of theta defensin, class defensin insects (arthropods)class defensin plants, to the class defensin bivalve molluscs or other classes defensin, where amino acid sequence contains 6 or 8 cysteines, and which have structural similarity with any of the previously mentioned classes defensin. Defensin can also be a synthetic defensin, possessing in common with any of the classes defensin characteristic properties.

Examples of such defensins include, but are not limited to, α-defensin HNP-1 (peptide of human neutrophils) HNP-2 and HNP-3; β-defensin-12, josamycin, gelmicin, γ1-purothionins, defensin insects and defensive described in PCT applications WO 99/53053, WO 02/085934 and WO 03/044049.

The selected polypeptide:As used in the present description, the term "isolated polypeptide" refers to a polypeptide that is at least 20% pure, preferably at least 40% pure, more preferably at least 60% pure, more preferably at least 80% pure, more preferably at least 90% pure is m, and most preferably at least 95% pure as determined by SDS-PAGE.

Essentially pure polypeptide:In the present description, the term "essentially pure polypeptide" means a preparation of a polypeptide, which contains not more than 10%, preferably not more than 8%, more preferably not more than 6%, more preferably not more than 5%, more preferably not more than 4%, no more than 3%, more preferably not more than 2%, more preferably not more than 1%, and most preferably not more than 0.5% by weight of other polypeptide substances with which it is associated in nature. Thus, preferably essentially pure polypeptide was at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, more preferably at least 99%, more preferably at least 99.5% pure, and most preferably 100% pure by weight of the total polypeptide substances in the product.

The polypeptides according to the invention are preferably essentially in pure form. In particular, predpochtitel is about, to polypeptides were "essentially in pure form, i.e. to the product of the polypeptide essentially not contain any other polypeptide of the substances with which it is associated in nature. This can be achieved, for example, by obtaining the polypeptide by well-known recombinant methods or classical purification methods.

In the present description, the term "essentially pure polypeptide" is synonymous with the terms "isolated polypeptide" and "polypeptide in the selected form.

Identity:The similarity between two amino acid sequences or between two nucleotide sequences describe by the parameter "identity".

For the purposes of the present invention, the degree of identity between two amino acid sequences can be determined using the FASTA program, which is included in version 2.0x software package FASTA (see W. R. Pearson and D. J. Lipman (1988), "Improved Tools for Biological Sequence Analysis", PNAS 85:2444-2448; and W. R. Pearson (1990) "Rapid and Sensitive Sequence Comparison with FASTP and FASTA", Methods in Enzymology 183:63-98). Used assessment matrix was a BLOSUM50, the penalty for a deletion was -12, and the penalty for the continuation of the deletions was-2.

The degree of identity between two nucleotide sequences is determined using the specified algorithm and software provided with the I, as explained above. Used assessment matrix was an identity matrix, the penalty for a deletion was -16, and the penalty for the continuation of the deletions were 4.

Alternative alignment of two amino acid sequences is determined using the Needle program from the EMBOSS package (http://emboss.org version 2.8.0. The program Needle algorithm performs General alignment described in Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443-453. Used the wildcard matrix represents a BLOSUM62, the penalty for making deletions is 10, and the penalty for the continuation of deletions is 0.5.

The degree of identity between the amino acid sequence of the present invention ("sequence according to the invention; for example, amino acids 1-42 sequence SEQ ID NO:2) and a different amino acid sequence ("foreign sequence") is calculated as the number of exact matches in the alignment of the two sequences divided by the length of the sequences according to the invention or the length of the "foreign sequence", based on which one is shorter. The results are expressed as the percentage identity.

An exact match occurs when the sequence according to the invention" and "alien sequence have identical amino acid residues in the same what's the provisions of the overlapping area (in the example alignment below, they are represented by "|"). The length of the sequence represents the number of amino acid residues in the sequence (e.g., length to amino acids 1-42 in the sequence SEQ ID NO:2 is 42).

In the example alignment below the overlapping area represents the amino acid sequence "HTWGER-NL" sequence 1; or amino acid sequence "HGWGEDANL" sequence 2. In the example, the deletion is indicated by "-".

Example alignment

The polypeptide fragment:In the present description, the term "polypeptide fragment" is defined as a polypeptide having one or more amino acids deleted from the N-Terminus and/or C-Terminus SEQ ID NO:2 or a sequence homologous to it, where the fragment has antimicrobial activity. Preferably a fragment of a polypeptide according to the invention retains all cysteine residues and amino acid residues between the cysteine residues.

Subsequence:In the present description, the term "subsequence" is defined as a nucleotide sequence having one or several nucleotides deleted from the 5'end and/or 3'-end of SEQ ID NO:1 or a sequence homologous to it, where the subsequence encodes f is agment polypeptide, possessing antimicrobial activity.

Allelic variant:In the present description, the term "allelic variant" means any two or more alternative forms of a gene occupying the same locus on the chromosome. Allelic diversity occurs in nature due to mutations and can lead to polymorphism in populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. Allelic variant of a polypeptide is a polypeptide encoded by the allelic variant of a gene.

Essentially pure polynucleotide:In the present description, the term "essentially pure polynucleotide" refers to the drug polynucleotide that does not contain other extraneous or unwanted nucleotides and are in form suitable for use in the systems of production of proteins by means of genetic engineering. Thus, essentially pure polynucleotide contains not more than 10%, preferably not more than 8%, more preferably not more than 6%, more preferably not more than 5%, more preferably not more than 4%, more preferably not more than 3%, more preferably not more than 2%, more preferably not more than 1%, and most preferably not more than 0.5% by weight of other polynucleotide molecules to the which it is associated in nature. Essentially pure polynucleotide may, however, include the natural 5'- and 3'-noncoding region, such as promoters and terminators. Preferably essentially pure polynucleotide was at least 90% pure, preferably at least 92% pure, more preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, more preferably at least 99% and most preferably at least 99.5% pure by weight. Polynucleotide according to the invention are preferably essentially in pure form. In particular, it is preferable that polynucleotide described in the present description, was "essentially in pure form, i.e. that the drug polynucleotide essentially not contain any other polynucleotide substances with which it is associated in nature. In the present description, the term "essentially pure polynucleotide" is synonymous with the terms "isolated polynucleotide and polynucleotide in a highlighted form. Polynucleotide can be polynucleotide genomic origin, polynucleotide from cDNA, RNA, semisynthetic, synthetic origin, and is, and combinations thereof.

cDNA:In the present description, the term "cDNA" is defined as a DNA molecule that can be obtained by reverse transcription from a Mature splanirovannaya the mRNA molecule obtained from a eukaryotic cell. In no cDNA sequences of the introns that are normally presented in the corresponding genomic DNA. The original primary transcript RNA is a precursor mRNA that undergoes processing through a number of stages before the formation of Mature splanirovannaya mRNA. These stages include removing sequences of introns in a process called splicing. The source of the cDNA is mRNA, which, thus, no sequence of introns.

Structure of nucleic acids:In the present description, the term "design nucleic acid" refers to a nucleic acid molecule, either single-stranded or double-stranded, which is isolated from a natural gene or which is modified to contain segments of nucleic acids, in a way that otherwise does not occur in nature. The term structure of nucleic acids is synonymous with the term "expressing cassette, when the design of the nucleic acid contains regulatory sequences necessary for expression of the coding consistently the tee according to the invention.

Controlling the sequence:In the present description, the term "regulatory sequence" is defined as including all components that are necessary for the expression of, or promote the expression of polynucleotide encoding the polypeptide according to the invention. Each control sequence may be a native or alien nucleotide sequence encoding the polypeptide. Such regulatory sequences include, but are not limited to, leader sequence, a polyadenylation sequence, a sequence propeptide, the promoter sequence of the signal peptide, and a transcription terminator. Regulatory sequences include, at least, a promoter, and transcriptional and translational stop signals. For the purposes of introducing specific restriction sites facilitating ligation of control sequences with the coding region of the nucleotide sequence that encodes the polypeptide in the control sequences may be provided with linkers.

Functionally related:In the present description, the term "functionally linked" means a configuration in which a control sequence is placed in the appropriate position relative to the coding of the serial is the serial polynucleotide sequence, to control the sequence governed by the expression of the coding sequence of the polypeptide.

The coding sequence:In the present description, the term "coding sequence" means a nucleotide sequence, which directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence, as a rule, determined by the open reading frame, which, as a rule, begins with the initiating codon ATG or alternative initiator codons, such as GTG and TTG. The coding sequence may be a DNA, cDNA or recombinant nucleotide sequence.

Expression:The term "expression" includes any stage involved in the production of the polypeptide, including, but not limited to, transcription, post transcriptional modification, translation, post-translational modification and secretion.

Expressing the vector:In the present description, the term "expressing vector" is defined as a linear or circular DNA molecule that contains polynucleotide encoding the polypeptide according to the invention, and which is functionally linked to additional nucleotides that provide for the expression.

A host cell:In the present description, the term "cell-Ho is ain" includes any cell type, amenable to transformation, transfection, transduction, etc. design a nucleic acid that contains polynucleotide according to the invention.

Modification:In the present description the term "modification" means any chemical modification of the polypeptide consisting of amino acids 1-42 sequence SEQ ID NO:2, as well as genetic effects on DNA encoding this polypeptide. Modification(s) can be a replacement(s), deletion(s) and/or insert(s) amino acids(amino acids), and a permutation(and) side chain(s) of amino acids; or use unnatural amino acid sequence of amino acids with similar properties. In particular, the modification(s) may constitute an amidation, such as C-terminal amidation.

Artificial variant:In the present description, the term "artificial variant" means a polypeptide having antimicrobial activity produced by an organism expressing a modified nucleotide sequence of SEQ ID NO:1. The modified nucleotide sequence is obtained by modifying the nucleotide sequence described in SEQ ID NO:1, through human intervention.

DETAILED description of the INVENTION

Polypeptides with antimicrobial activity

In the first aspect of the present izobreteyonija to the selected polypeptides, having the amino acid sequence which has a degree of identity to amino acids 1-42 sequence SEQ ID NO:2 (i.e. with Mature polypeptide) of at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, and most preferably at least 97%, which have antimicrobial activity (hereinafter "homologous polypeptides"). In a preferred aspect, the homologous polypeptides have an amino acid sequence that differs by ten amino acids, preferably by five amino acids, more preferably by four amino acids, more preferably by three amino acids, more preferably by two amino acids, and most preferably by one amino acid from amino acids 1-42 sequence SEQ ID NO:2.

The polypeptide according to the invention preferably contains the amino acid sequence of SEQ ID NO:2 or allelic variant; or its fragment, which has antimicrobial activity. In a preferred aspect, the polypeptide contains the amino acid sequence of SEQ ID NO:2. In other the MD preferred aspect, the polypeptide contains amino acids 1-42 sequence SEQ ID NO:2 or allelic variant; or its fragment, which has antimicrobial activity. In another preferred aspect, the polypeptide contains amino acids 1-42 sequence SEQ ID NO:2. In another preferred aspect, the polypeptide consists of the amino acid sequence of SEQ ID NO:2 or allelic variant, or a fragment, which has antimicrobial activity. In another preferred aspect, the polypeptide consists of the amino acid sequence of SEQ ID NO:2. In another preferred aspect, the polypeptide consists of amino acids 1-42 sequence SEQ ID NO:2 or allelic variant, or a fragment, which has antimicrobial activity. In another preferred aspect, the polypeptide consists of amino acids 1-42 sequence SEQ ID NO:2.

In a second aspect the present invention relates to the selected polypeptides with antimicrobial activity that are encoded by polynucleotides, which hybridize under very low stringency, preferably under conditions of low stringency, more preferably under conditions of moderate stringency, more preferably, in conditions of low stringency, more preferably under conditions of high stringency, and most preferably, in terms of all the ü high rigidity, (i) nucleotides 145-270 sequence SEQ ID NO:1, (ii) the cDNA sequence contained between nucleotides 1-270 sequence SEQ ID NO:1, (iii) a subsequence of (i) or (ii), or (iv) complementary (i), (ii)or (iii) chain (J. Sambrook, E. F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York). A subsequence of SEQ ID NO:1 contains at least 100 contiguous nucleotides or preferably at least 200 contiguous nucleotides. Moreover, the subsequence may encode a polypeptide fragment which has antimicrobial activity. The nucleotide sequence of SEQ ID NO:1 or a subsequence and amino acid sequence of SEQ ID NO:2 or its fragment can be used to create a probe nucleic acid to identify and clone DNA encoding polypeptides with antimicrobial activity in strains of different genera or species according to methods well known in the field. In particular, such probes can be used for hybridization with the genomic or cDNA of interest genus or species, followed by the standard method of southern blotting, for the identification and selection of the appropriate gene. Such probes can be considerably shorter than the full sequence, but their length should be at least 14, suppose the equipment at least 25, more preferably at least 35, and most preferably at least 70 nucleotides. However, it is preferable that the length of the probe nucleic acid was at least 100 nucleotides. For example, the probe nucleic acid can be at least 200 nucleotides, preferably at least 270 nucleotides. Can be used as DNA and RNA probes. To identify the corresponding gene probes, as a rule, are labeled (for example,32P,3H,35S, Biotin or Avidya). Such probes are covered by the present invention.

For genomic DNA libraries or cDNA derived from such other organisms may, therefore, be screened for DNA that hybridizes with the probes described above and which encodes a polypeptide with antimicrobial activity. Genomic or other DNA from such other organisms can be distinguished by gel electrophoresis in agarose or polyacrylamide gel, or by other means of selection. DNA from the libraries or selected DNA can be transferred and immobilizative on the nitrocellulose or other suitable media. In order to identify a clone or DNA which is homologous to SEQ ID NO:1 or a subsequence, media use in the southern band.

For the purposes of the present invention, the hybridization shows the em what is the nucleotide sequence hybridized with labeled probe nucleic acids corresponding to the nucleotide sequence represented in SEQ ID NO:1, the complement her chain, or its subsequence, in conditions very from very low to very high stiffness. Molecules with which the probe nucleic acid hybridized in these conditions, can be determined using x-ray film.

In a preferred aspect, the probe nucleic acid is a polynucleotide sequence that encodes the polypeptide SEQ ID NO:2 or a subsequence. In another preferred aspect, the probe nucleic acid is a SEQ ID NO:1. In another preferred aspect, the probe nucleic acid represents a portion of SEQ ID NO:1 that encodes a Mature polypeptide.

For long probes of length at least 100 nucleotides, conditions from very low to very high stiffness, defined as prehybridization and hybridization at 42°C in 5X SSPE, 0.3% of SDS, 200 μg/ml cleaved and denatured DNA, salmon sperm, and either 25% formamide for very low and low stiffness, 35% formamide for medium and medium-high stringency, or 50% of formamide for high and very high stiffness, followed by the process southern blotting optimally within 12 to 24 hours.

DL the long probe length of at least 100 nucleotides, media in late washed three times each for 15 minutes using 2X SSC, and 0.2% SDS preferably at least at 45°C (very low stiffness), more preferably at least at 50°C (low stiffness), more preferably at least at 55°C (medium hardness), more preferably at least at 60°C (low stiffness), more preferably at least at 65°C (high rigidity), and most preferably at least at 70°C (very high stiffness).

For short probes, the length of which ranges from about 15 nucleotides to about 70 nucleotides, stiffness terms are defined as prehybridization, hybridization, and washing after hybridization at a temperature which is from about 5°to about 10°C below Tm, calculated using the calculation according Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390)in 0.9 M NaCl, and 0.09 M Tris-HCl pH to 7.6, 6 mm EDTA, 0,5% NP-40, 1X solution of Denhard, 1 mm the sodium pyrophosphate, 1 mm monobasic-sodium phosphate, 0.1 mm ATP, and 0.2 mg of yeast RNA per ml in accordance with the standard method of southern blotting. For short probes, the length of which ranges from about 15 nucleotides to about 70 nucleotides, the carrier is washed once in 6X SCC plus 0.1% of SDS for 15 minutes and twice for 15 using the-W 6X SSC at a temperature below the calculated Tm for 5°C to 10°C.

In the third aspect of the present invention relates to artificial variants comprising conservative substitution, a deletion and/or insertion of one or more amino acids of SEQ ID NO:2 or the Mature polypeptide. Preferably, amino acid changes in nature are minor changes, namely, conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of one to about 30 amino acids; small N - or C-terminal extension, such as the N-terminal methionine residue; a small linker peptide of up to about 20-25 residues; or a small extension that facilitates purification by changing the total charge or another function, such as polyhistidine plot, antigenic epitope or binding domain.

Examples of conservative substitutions are substitutions in the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid is ameny, which, as a rule, do not alter the specific activity are known in this field and are described, for example, H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. The most common substitutions are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly.

In addition to the 20 standard amino acid residues of the wild type may be replaced by non-standard amino acids (such as 4-hydroxyproline, 6-N-methyllysine, 2-aminoadamantane acid, isovaline and alpha metalsin). Amino acid residues can be replaced by a limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids. "Unnatural amino acid" modified after synthesis of the protein and/or have a chemical structure in their side chain(s), which is different from the chemical structure of the standard amino acids. Unnatural amino acids can be chemically synthesized, and, preferably, they are commercially available and include pipecolinic acid, carboxylic acid of thiazolidine, digitopolis, 3 - and 4-methylpropan, and 3.3-dimethylpropyl.

Alternative amino acid changes are changes of this nature, which modify the physico-chemical properties of polypeptides. For example, amino acid change which deposits can increase thermal stability of the polypeptide, to change the specificity in relation to the substrate to change the optimum pH value, etc.

Basic amino acids in the original polypeptide can be identified in accordance with methods known in this field, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter method, to identify amino acid residues that are responsible for the activity of molecules in each of the remainder of the molecule introducing a single mutation by alanine, and the resulting mutant molecules are examined for biological activity (i.e., antimicrobial activity). Cm. also, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. The active site of the enzyme or other biological interaction can also be determined by analysis of the structure, as determined by techniques such as nuclear magnetic resonance, crystallography, electronography or photoaffinity tagging, in conjunction with mutation of the alleged amino acids of the contact area. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309:59-64. Belonging to the essential amino acids can also be set, based on the analysis of identity with the polypeptides, which are similar to the polypeptide in accordance with this invention.

Single or multiple amino acid substitutions can wire the th and analyzed using known methods of mutagenesis, recombination and/or shuffling, followed suitable method of screening, such as the methods described Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include PCR with reduced accuracy, phage display (e.g., Lowman et al., 1991, Biochem. 30:10832-10837; U.S. patent No. 5223409; WO 92/06204), and site-directed mutagenesis (Derbyshire et al., 1986, Gene 46:145; Ner et al., 1988, DNA 7:127).

Methods of mutagenesis/shuffling can be combined with high-performance, automated screening methods to detect activity of cloned mutant polypeptide expressed by the cells of the host. Mutant DNA molecules that encode active polypeptides can be obtained from the host cells and rapidly sequenced using standard in this area ways. These methods provide the ability to quickly determine the values of the individual amino acid residues in the interest of the polypeptide, and can be applied to polypeptides of unknown structure.

The total number of amino acid substitutions, deletions and/or insertions in the amino acids 1-42 sequence SEQ ID NO:2 is 10, preferably 9, more preferably 8, more preferably 7, more preferably not more than 6, more preferably not more than 5, more preferably 4, b is more preferably 3, more preferably 2 and most preferably 1.

In a preferred embodiment, the polypeptides according to the invention are polypeptides defensin. In another embodiment, the polypeptides according to the invention contain three dicysteine connection.

N-terminal elongation

Suitable N-terminal elongation of polypeptides according to the invention may consist of from 1 to 50 amino acids, preferably from 2-20 amino acids, mainly from 3-15 amino acids. In one embodiment, N-terminal extension of the peptide does not contain Arg (R). In another embodiment, N-terminal extension contains a plot of the cleavage kex2 or kex2-like site of cleavage, as defined below. In a preferred embodiment, N-terminal extension is a peptide containing at least two amino acid residue Glu (E) and/or Asp (D), such as N-terminal extension containing the following sequence: EAE, EE, DE and DD.

The Kex2 sites

The Kex2 sites (see, for example, Methods in Enzymology, Vol 185, ed. D. Goeddel, Academic Press Inc. (1990), San Diego, CA, "Gene Expression Technology") and kex2-like areas represent different areas of recognition (i.e. lots of cleavage), located between the area coding for propeptide, and Mature plot of some proteins. It was shown that the insertion section kex2 or kex2-is such plot in certain cases leads to increased error-free processing by the endopeptidase in the area of cleft propeptide, which leads to an increased level of secretion of the protein.

In the context of this invention, the insert section kex2 or kex2-like site leads to the possibility of cleavage at a certain position of the N-terminal extension that leads to the fact that the antimicrobial polypeptide is elongated compared to the Mature polypeptide, are presented as amino acids 1-42 sequence SEQ ID NO:2.

Fused polypeptides

The polypeptides according to the invention also include fused polypeptides or split fused polypeptides in which another polypeptide is fused to the N-end or C-end of the polypeptide according to the invention or its fragment. Fused polypeptide get by merging the nucleotide sequence (or portion thereof), encoding another polypeptide to a nucleotide sequence (or part thereof) according to the invention. Methods of obtaining the fused polypeptides known in the field and include ligation of coding sequences that encode polypeptides, so that they were in the reading frame and to the expression of the fused polypeptide under control of the specified promoter(s) and terminator.

Sources of polypeptides with antimicrobial activity

The polypeptide according to the invention can be obtained from microorgani the MOU of any kind. As used in the present description, for the purposes of the present invention, the term "obtained from" as applied to this source means that the polypeptide encoded by the nucleotide sequence is produced by the source or strain, in which the nucleotide sequence of the source was built. In a preferred aspect, the polypeptide obtained from this source is secreted extracellular.

The polypeptide according to the invention may be a bacterial polypeptide. For example, the polypeptide can be a polypeptide gram-positive bacteria, such as polypeptideBacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus B. megaterium, Bacillus stearothermophilus,Bacillus subtilisorBacillus thuringiensis; or the polypeptideStreptomycesfor example, the polypeptideStreptomyces lividansorStreptomyces murinus; or the polypeptide of gram-negative bacteria, for example, the polypeptideE. coliorPseudomonas sp.

The polypeptide according to the invention may also be a peptide mushrooms, and more preferably a yeast polypeptide such as a polypeptideCandida, Kluyveromyces, Pichia, Saccharomyces, SchizosaccharomycesorYarrowia; or more preferably the polypeptide micellar fungi, such as the polypeptideAcremonium, Aspergillus, Aureobasidium, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocalimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, TolypocladiumorTrichoderma.

In a preferred aspect, the polypeptide is a polypeptide with antimicrobial activity ofSaccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensisorSaccharomyces oviformis.

In another preferred aspect, the polypeptide is a polypeptideAspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium frost, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reeseiorTrichoderma viride.

In another preferred aspect, the polypeptide is a polypeptideEurotium amstelodami, Aspergillus amstelodami, Aspergillus montevidensisorAspergillus vitis.

In a more preferred aspect, the polypeptide is a polypeptideEurotium amstelodamifor example, the polypeptide SEQ ID NO:2.

It is clear that for the above species, this invention applies to both perfect and imperfect stage, and other taxonomic equivalents, for example, anamorphism, regardless of the form under which they are known. Specialists in this field will easily determine the identity of the relevant equivalents.

Strains of these species are readily accessible to the public in a number of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).

Further, such polypeptides can be identified and obtained from other sources including microorganisms isolated from a natural source (e.g., soil, composts, water, etc) using the above-mentioned probes. Methods of isolation of microorganisms from natural environments is well known in this field. Polynucleotide then can be obtained similarly by screening genomic or cDNA library of another microorganism. After detection with probe(s) polynucleotide sequence that encodes a polypeptide, polynucleotide you can select or be cloned using methods that are well known to the average experts in this field (see, for example, Sambrook et al., 1989,above). The polypeptides according to the invention also include fused polypeptides or split fused polypeptides in which another polypeptide is fused to the N-end or C-end of the polypeptide or its fragment. Fused polypeptide get through mergers nucleotide the th sequence (or portion thereof), encoding another polypeptide to a nucleotide sequence (or part thereof) according to the invention. Methods of obtaining the fused polypeptides known in the field and include ligation of coding sequences that encode polypeptides that they were in the reading frame and to the expression of the fused polypeptide under control of a single promoter(s) and terminator.

Polynucleotide

The present invention relates also to a selected polynucleotide with nucleotide sequence that encodes a polypeptide according to the invention. In a preferred aspect, the nucleotide sequence indicated in SEQ ID NO:1. In another preferred aspect, the nucleotide sequence is encoding a Mature polypeptide plot of SEQ ID NO:1. The present invention relates to nucleotide sequences that encode the c polypeptide of amino acid sequence SEQ ID NO:2 or the Mature polypeptide, which differ from SEQ ID NO:1 due to degeneracy of the genetic code. The present invention relates also to a subsequence of SEQ ID NO:1 which encode fragments of SEQ ID NO:2, which possess antimicrobial activity.

The present invention relates to mutant polynucleotides containing at least one evolution is Yu in the coding of the Mature polypeptide sequence of SEQ ID NO:1, in which the mutant nucleotide sequence encodes a polypeptide which consists of amino acids 1-42 sequence SEQ ID NO:2.

The methods used for selection or cloning polynucleotide encoding the polypeptide, are known in this area and include isolation from genomic DNA, from cDNA, or a combination thereof. Cloning polynucleotides according to the invention from such genomic DNA can be performed, for example, using the well known polymerase chain reaction (PCR) or by screening expressing libraries with antibodies to detect cloned DNA fragments with shared structural elements. See, for example, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. You can use other methods of nucleic acid amplification, such as ligase chain reaction (LCR), activated legirovaniem transcription (LAT) and amplification on the basis of the nucleotide sequence (first NASBA). Polynucleotide can be cloned from a strain ofEurotium, or another or related organism and thus, for example, they may be an allelic or species variants encoding the polypeptide of the plot of the nucleotide sequence.

The present invention relates also to polynucleotides with nucleotide sequences that have a degree of identity the spine with the encoding a Mature polypeptide sequence of SEQ ID NO:1 (i.e., with nucleotides 145-270) at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, and most preferably at least 97% identity, which encode an active polypeptide.

Modification of a nucleotide sequence that encodes a polypeptide according to the invention, it may be necessary for the synthesis of polypeptides is essentially similar to the polypeptide. The term "essentially similar" polypeptide refers to non-natural forms of the polypeptide. These polypeptides may differ in some specified way from the polypeptide isolated from a natural source, for example, artificial variants that differ in specific activity, thermostability, optimal pH, or similar. Sequence variants can be designed based on the nucleotide sequence presented as encoding the polypeptide of the site SEQ ID NO:1, for example, as a subsequence, and/or by introduction of nucleotide substitutions that do not result in a different amino acid sequence of the polypeptide encoded well leotides sequence, but which correspond to the use of the codons of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions which may lead to different amino acid sequences. For a General description of nucleotide substitutions, see, for example, Ford et al., 1991, Protein Expression and Purification 2: 95-107.

Specialists in this field it is clear that such replacement may be performed outside areas responsible for the function of the molecule, and still get the active polypeptide. Amino acid residues required for activity of the polypeptide encoded by the selected polynucleotides according to the invention, and thus, are preferably not subject to substitution, may be identified in accordance with methods known in this field, such as site-directed mutagenesis or alanine scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter method, mutations contribute at every positively charged residue in the molecule, and the resulting mutant molecules are examined for antimicrobial activity to identify amino acid residues responsible for the activity of the molecule. The sites of interaction of substrate-enzyme also can be determined by analysis of the three-dimensional structure as determined by such methods as analysis through I the cluster magnetic resonance, crystallography or photoaffinity tagging (see, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).

The present invention relates also to a selected polynucleotide coding for the polypeptide according to the invention, which hybridize under low stringency, preferably under conditions of moderate stringency, more preferably under conditions of low stringency, more preferably under conditions of high stringency, and most preferably under very high stringency (i) nucleotides 145-270 sequence SEQ ID NO:1, (ii) the cDNA sequence contained in nucleotides 1-270 sequence SEQ ID NO:1, or (iii) chain, complementary (i) or (ii); or allelic variants and subsequences (Sambrook et al., 1989,above), as defined in the present description.

The present invention relates also to a selected polynucleotides obtained by (a) hybridizing a population of DNA under conditions of low, moderate, medium, high or very high stiffness (i) nucleotides 145-270 sequence SEQ ID NO:1, (ii) the cDNA sequence contained in nucleotides 1-270 sequence SEQ ID NO:1, or (iii) chain, complementary (i) or (ii); and (b) allocation hybridizing of polynucleotide, which encodes the polyp is Ted with antimicrobial activity.

Structure of nucleic acids

The present invention relates also to the structures of nucleic acids containing the selected polynucleotide according to the invention, functionally associated with one or more regulatory sequences that regulate the expression of the coding sequence in a suitable cell host under conditions compatible with the control sequences.

Selected polynucleotide encoding the polypeptide according to the invention can be processed in various ways to ensure the expression of the polypeptide. Processing polynucleotide sequence before its embedding into a vector may be desirable or necessary depending on expressing vector. Methods of modification of the polynucleotide sequences using methods of recombinant DNA, are well known in this field.

The regulatory sequence can be a suitable promoter sequence, a nucleotide sequence that is recognized by the host-cell for expression of polynucleotide encoding the polypeptide according to the invention. The promoter sequence contains sequences control transcription, which carry out the expression of the polypeptide. The promoter may represents the ü any nucleotide sequence, which shows transcriptional activity in preferable to select the cell host, including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the cell master.

Examples of suitable promoters for transcriptional regulation of the structure of nucleic acids according to the invention, especially in a bacterial cell host, are the promoters obtained fromlacoperonE. coligene and agarases (dagA)Streptomyces coelicolor, gene Lavansaari (sacB)Bacillus subtilisgene alpha-amylase (amyL)Bacillus licheniformisgene maltogenic amylase (amyM)Bacillus stearothermophilusgene alpha-amylase (amyQ)Bacillus amyloliquefaciensgene penitsillinazy (penP)Bacillus licheniformis,Bacillus subtilisgenesxylAandxylBand gene prokaryotic beta-lactamase (Villa-Kamaroff et al., 1978, Proceedings of the National Academy of Sciences USA 75: 3727-3731), as well as the promoter oftac(DeBoer et al., 1983, Proceedings of the National Academy of Sciences USA 80: 21-25). In addition, the promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242: 74-94; and in Sambrook et al., 1989,above.

Examples of suitable promoters for transcription regulation structures of nucleic acids according to the invention in the cells of the host in the form of micellar fungi are the promoters obtained from the genes TAKA amylase<> Aspergillus oryzae, aspartic proteaseRhizomucor mieheineutral alpha-amylaseAspergillus nigerstable against acid alpha-amylaseAspergillus niger, glucoamylase (glaA)Aspergillus nigerorAspergillus awamori, lipaseRhizomucor mieheialkaline proteaseAspergillus oryzae, triosephosphateAspergillus oryzae, acetamidateAspergillus nidulans, amyloglucosidaseFusarium venenatum(WO 00/56900), DariaFusarium venenatum(WO 00/56900), QuinnFusarium venenatum(WO 00/56900), trypsin-like proteaseFusarium oxysporum(WO 96/00787), beta-glucosidaseTrichoderma reesei, cellobiohydrolase ITrichoderma reeseiendoglucanase ITrichoderma reeseiendoglucanase IITrichoderma reesei,endoglucanase IIITrichoderma reeseiendoglucanase IVTrichoderma reeseiendoglucanase VTrichoderma reesei, xylanase ITrichoderma reesei, xylanase IITrichoderma reeseibeta-xylosideTrichoderma reeseiand the promoter NA2-tpi (a hybrid of the promoters from the genes of neutral alpha-amylaseAspergillus nigerand triosephosphateAspergillus oryzae); and mutant, truncated, and hybrid promoters.

In a yeast host suitable promoters obtained from the genes enolase (ENO-1)Saccharomyces cerevisiae, galactokinase (GAL1)Saccharomyces cerevisiae, alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP)Saccharomyces cerevisiae, triosephosphate (TPI)Saccharomyces cerevisiae, metallothionine (CUP1)Saccharomyces cerevisiaeand 3-postopia attinasi Saccharomyces cerevisiae. Other useful promoters for yeast host cells described by Romanos et al., 1992, Yeast 8: 423-488.

The regulatory sequence may also be a suitable sequence terminator of transcription, a sequence recognized by the cell host to complete the transcription. The termination sequence is functionally linked c 3'-end a nucleotide sequence that encodes a polypeptide. Any terminator which is functional in a preferred to select the cell master can be used in accordance with the present invention.

Preferred terminators for cells of the owners, representing micellar fungi, derived from genes TAKA amylaseAspergillus oryzae, glucoamylaseAspergillus nigerintranetsiteAspergillus nidulansalpha-glucosidaseAspergillus nigerand trypsin-like Fusarium oxysporum protease.

Preferred terminators for yeast host cells are obtained from the genes enolaseSaccharomyces cerevisiae, cytochrome C (CYC1)Saccharomyces cerevisiaeand glyceraldehyde-3-phosphate dehydrogenaseSaccharomyces cerevisiae. Other useful terminators for yeast host cells described by Romanos et al., 1992,above.

The regulatory sequence may also be a suitable leader sequence, netransliruemoi the region mRNA, which is important for broadcast host cell. A leader sequence is operatively linked to the 5'-end a nucleotide sequence that encodes a polypeptide. Any leader sequence that is functional in a preferred to select the cell host, can be used in accordance with the present invention.

Preferred leader sequences for host cells, representing micellar fungi, derived from genes TAKA amylaseAspergillus oryzaeand triosephosphateAspergillus nidulans.

Suitable leader sequences for yeast host cells are obtained from the genes enolase (ENO-1)Saccharomyces cerevisiae, 3-phosphoglyceraldehydeSaccharomyces cerevisiaethe alpha-factorSaccharomyces cerevisiaeand alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP)Saccharomyces cerevisiae.

The regulatory sequence may be a sequence for polyadenylation sequence, functionally associated with the 3'-end nucleotide sequence and transcription recognizes a host cell as a signal to add residues polyadenine to transcribed mRNA. Any sequence for polyadenylation, which is functional in a preferred to select kitchenaide, can be used in accordance with the present invention.

The preferred sequence for polyadenylation to host cells, representing micellar fungi, derived from genes TAKA amylaseAspergillus oryzae, glucoamylaseAspergillus nigerintranetsiteAspergillus nidulans, trypsin-like proteaseFusarium oxysporumand alpha-glucosidaseAspergillus niger.

Suitable sequences for polyadenylation for yeast host cells described by Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.

The regulatory sequence may also be an encoding signal peptide of land, which encodes the amino acid sequence associated with the N-end of a polypeptide and directs the encoded polypeptide in the secretory pathways of the cell. the 5'-end coding sequence of the nucleotide sequence may inherently contain a signal encoding the peptide of land, is naturally linked in translation reading frame with the segment of the coding section that encodes the secretory polypeptide. Alternative 5'-end of the coding sequence may contain encoding the signal peptide of land that is foreign to the coding sequence. Alien encoding the signal peptide of land may be required, to the Yes the coding sequence does not contain coding signal peptide of the site. Alternative alien encoding the signal peptide may simply replace the natural signal encoding the peptide of land in order to enhance secretion of the polypeptide. However, in accordance with the present invention can use any encoding a signal peptide portion which directs the expressed polypeptide in the secretory pathway in preferred host cell.

Efficient encoding the signal peptide sites for bacterial host cells are encoding the signal peptide plots obtained from the genes maltogenic amylase NCIB 11837, alpha-amylaseBacillus stearothermophilus, subtilisinBacillus licheniformisbeta-lactamaseBacillus licheniformisneutral protease (nprT, nprS, nprM)Bacillus stearothermophilusandprsA Bacillus subtilis. Signal peptides are described Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.

Efficient encoding the signal peptide of land for host cells, representing micellar fungi represent an encoding signal peptide plots obtained from the genes TAKA amylaseAspergillus oryzaeneutral amylaseAspergillus niger, glucoamylaseAspergillus niger, aspartic proteaseRhizomucor miehei, cellulaseHumicola insolensand lipaseHumicola lanuginosa.

In a preferred aspect of the encoding signal peptide of the plot is the way the th nucleotides 1-60 sequence SEQ ID NO:1, which encode amino acids -48 at -29 SEQ ID NO:2.

Suitable signal peptides for yeast host cells are obtained from the genes for alpha-factorSaccharomyces cerevisiaeand invertaseSaccharomyces cerevisiae. Additional suitable encoding signal peptides areas described Romanos et al., 1992,above.

The regulatory sequence may also be a coding propeptide section that encodes the amino acid sequence located at the N end of the polypeptide. The resulting polypeptide known as proferment or propolypeptide (or in some cases zymogen). Propolypeptide, as a rule, is inactive and can turn into Mature active polypeptide by a catalytic or autocatalytical off propeptide from propolypeptide. Encoding propeptide plot can be obtained from the genes for alkaline protease (aprE)Bacillus subtilisneutral protease (nprT)Bacillus subtilisthe alpha-factorSaccharomyces cerevisiae, aspartic proteaseRhizomucor mieheiand laccaseMyceliophthora thermophila(WO 95/33836).

In a preferred aspect, the encoding propeptide plot represents nucleotides 61-144 sequence SEQ ID NO:1 which encode amino acids -28 through -1 SEQ ID NO:2.

When the sites of the signal peptide and propeptide are on the N-end polypep is Yes, plot propeptide is located near the N end of the polypeptide, and the site of the signal peptide is located near the N end of the site propeptide.

Also it may be necessary to add regulatory sequences which allow the regulation of expression of the polypeptide that is associated with the growth of the host cell. Examples of regulatory systems are systems that lead to turning on or off gene expression in response to chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include system operatorslac,tacandtrp. In yeast, you can use the systemADH2orGAL1. In micellar fungi as regulatory sequences, you can use the promoter of the alpha-amylase TAKA, the promoter glucoamylaseAspergillus nigerand the promoter glucoamylaseAspergillus oryzae. Other examples of regulatory sequences are sequences that provide amplification of the gene. In eukaryotic systems, these include gene digidrofolatreduktazy that amplificates in the presence of methotrexate, and genes metallothionein that it provided amplification in the presence of heavy metals. In these cases, the nucleotide sequence encoding a polypeptide that is functionally related is Anna with the regulatory sequence.

Expressing the vectors

The present invention relates to recombinant expressing the vectors containing polynucleotide according to the invention, a promoter, and transcriptional and translational stop signals. The various nucleic acids and control sequences described above can be connected with each other with obtaining recombinant expressing vector, which may include one or more suitable restriction sites for making insertions or substitutions at these sites in the nucleotide sequence encoding the polypeptide. Alternative nucleotide sequence according to the invention can be Express by embedding the nucleotide sequence or structure of the nucleic acid containing the sequence into an appropriate vector for expression. When creating expressing vector encoding the sequence of features in the vector so that the coding sequence was functionally connected with the corresponding sequences to control the expression.

Recombinant expressing the vector may be any vector (e.g., plasmid or virus), which can be a convenient way to expose the processes associated with recombinant DNA, and which is what can lead to the expression of the nucleotide sequence. The choice of vector, as a rule, depends on the compatibility of the vector with the host-cell, which is injected vector. Vectors can represent a linear or closed circular plasmids.

The vector may be an autonomously can replicate the vector, i.e. the vector that fully exists extrachromosomal, the replication of which is independent of the replication of the chromosome, for example, it may be a plasmid, an extrachromosomal element, minichromosome or artificial chromosome. The vector can contain any items to ensure or infect other programs. Alternative vector may be a vector which, when introduced into the cell host is integrated into the genome and replicated together with the chromosome(s)in which it was built. Moreover, you can use a single vector or plasmid or two or more vectors or plasmids which together contain the entire DNA intended for introduction into the genome of the host cell, or a transposon.

The vectors according to the invention preferably contain one or more selective markers, which provide easy selection of transformed cells. The selective marker is a gene the product of which provides resistance to biocides or viruses, resistance to heavy metals, prototrophic auxotrophs etc.

Examples of bacterially selective markers are genes dalfromBacillus subtilisorBacillus licheniformisor markers, which give resistance to antibiotics, such as resistance to ampicillin, kanamycin, chloramphenicol or tetracycline. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selective markers for use in cell-owners representing micellar fungi include, but are not limited to,amdS(acetamides),argB(emitintermediate),bar(phosphonomethylglycine),hph(GigabitEthernet),niaD(nitroreductase),pyrG(orotidine-5'-phosphatedehydrogenase),sC(alfacariensis) andtrpC(anthranilate), and their equivalents. Preferred for use in the cellAspergillusare genesamdSandpyrGAspergillus nidulansorAspergillus oryzaegenebarStreptomyces hygroscopicus.

The vectors according to the invention preferably contain an element(s)that provide the integration of the vector into the genome of the host cell or Autonomous replication of the vector in the cell independent of the genome.

For integration into the genome of the host cell basis vector may be a polynucleotide sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alter ative the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell in the exact position(s) on the chromosome(s). To increase the likelihood of integration at a precise position, the embedded elements should preferably contain a sufficient number of base pairs of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, and most preferably from 800 to 10,000 base pairs, which have a high degree of identity with the corresponding sequence of the target to increase the probability of homologous recombination. Embedded elements can be any sequence that is homologous to a target sequence in the genome of the host cell. Moreover, the embedded elements may represent a non-coding or coding nucleotide sequence. On the other hand, the vector can integrate into the genome of the host cell by homologous recombination.

For Autonomous replication, the vector may additionally contain an origin of replication enabling the vector autonomously replicated in interest cage-owner. The origin of replication may be any plasmid Replicator, providing Autonomous replication that functions in the cell. In the present description, the term "origin of replication" or "plasmid Replicator" is defined as a nucleotide sequence that gives moznosti plasmid or vector to replicate in vivo.

Examples of bacterial original replication are originy replication of plasmids pBR322, pUC19, pACYC177, and pACYC184, provides replication inE. coliand pUB110, pE194, pTA1060, and pAMβ1, provides replication inBacillus. Examples of original of replication for use in a yeast cell host are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination ARS4 and CEN6.

Examples of original replication, suitable cells micellar fungi are AMA1 and ANS1 (Gems et al., 1991, Gene 98:61-67; Cullen et al., 1987, Nucleic acids Research 15: 9163-9175; WO 00/24883). The allocation of the AMA1 gene and construction of plasmids or vectors containing the gene can be carried out in accordance with the methods described in WO 00/24883.

To increase production of the gene product in the cell host, you can enter more than one copy of polynucleotide according to the invention. Increase the number of copies of polynucleotide can be achieved by embedding at least one additional copy of the sequence into the genome of the host cell or by including amplifierarava gene as a selective marker in conjunction with polynucleotides, where cells containing amplificatoare copy of the gene selective marker, and thereby additional copies of polynucleotide can be selected by culturing cells in the presence of a suitable substance for selection./p>

The methods used for ligating the above-described elements with constructs expressing recombinant vectors according to the invention, are well known to the person skilled in the art (see, for example, Sambrook et al., 1989,above).

Cell host

The present invention relates to a recombinant cell host containing polynucleotide according to the invention, which are preferably used for the recombinant production of polypeptides. A vector containing polynucleotide according to the invention, is introduced into the cell host such that the vector is maintained as integrated into the chromosome of an element or as a self-replicating extrachromosomal vector, as described earlier. The term "a host cell" includes any descendant of the original cells, which is not identical to the original cell due to mutations that occur during replication. The choice of host cell largely depends on the gene encoding the polypeptide, and its source.

A host cell may be a unicellular microorganism, e.g., a prokaryotic organism, or neodnokratny microorganism, for example, the eukaryotic organism. Suitable single-celled microorganisms are bacterial cells such as gram positive bacteria including, but is s limited to, cellBacillusfor example,Bacillus alkalophilus,Bacillus amyloliquefaciens,Bacillus brevis,Bacillus circulans,Bacillus clausii,Bacillus coagulans,Bacillus lautus,Bacillus lentus,Bacillus licheniformis,B. megaterium Bacillus,Bacillus stearothermophilus,Bacillus subtilisandBacillus thuringiensis; or the cellStreptomycesfor example,Streptomyces lividansandStreptomyces murinusor gram-negative bacteria such asE. coliandPseudomonas sp. In a preferred aspect, the bacterial cell host is a cellBacillus lentus,Bacillus licheniformis,Bacillus stearothermophilusorBacillus subtilis. In another preferred aspect, the cell isBacillusrepresents alcaliphilic cellBacillus.

Introduction of the vector into a bacterial cell host can, for example, be accomplished through the transformation of protoplast (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), by using competent cells (see, for example, Young and Spizizin, 1961, Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, for example, Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).

A host cell may also be eurytides cell, such as cell mammals, insects, plants, or fungi.

In a preferred aspect, a host cell is a cell of fungi. As used in this description of"fungi" include the types Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al, In, Ainsworth and Bisby''s Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK), and Oomycota (as cited in Hawksworth et al, 1995,abovep. 171) and all microsporidia fungi (Hawksworth et al, 1995,above).

In a more preferred aspect related to mushrooms a host cell is a yeast cell. As used in this description of "yeast" includes ascospores yeast (Endomycetales), basidiospores yeast, and yeast belonging to the imperfect fungi (Blastomycetes). Since the classification of yeast may change, for the purposes of this invention, the yeast should be defined as described in Biology and Activities of Yeast (Skinner, F.A., Passmore, S. M., and Davenport, R.R., eds, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

In a more preferred aspect, the yeast a host cell is a cellCandida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, SchizosaccharomycesorYarrowia.

In the most preferred aspect, the yeast cell-host is a cellSaccharomyces carlsbergensis,Saccharomyces cerevisiae,Saccharomyces diastaticus,Saccharomyces dougflasii,Saccharomyces kluyveri,Saccharomyces norbensisorSaccharomyces oviformis. In another most preferred aspect, the yeast a host cell is a cellKluyveromyces lactis. In another most preferred aspect, the yeast cell-host is a cellYarrowia lipoytica .

In another more preferred aspect related to mushrooms a host cell is a cell micellar fungi. "Micellar fungi" include all micellar form subgroups Eumycota and Oomycota (as defined by Hawksworth et al, 1995,above). Micellar fungi, mainly characterized by the wall of the mycelium composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth occurs by extension hypha, and catabolism of carbon is obligatorily aerobic. In contrast, vegetative growth of yeast, such asSaccharomyces cerevisiaeoccurs via budding unicellular thallus, and catabolism of carbon may be enzymatic.

In a more preferred aspect, a host cell, related to the micellar fungi, is a cellAcremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Coprinus, Coholus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, TrametesorTrichoderma.

In the most preferred aspect is a host cell, related to the micellar fungi, is aAspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus nigerorAspergillus oryzae. In another most preferred aspect is a host cell, related to the micellar fungi, pre what is a cell Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium frost, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioidesorFusarium venenatum. In another most preferred aspect is a host cell, related to the micellar fungi, is a cell strain ofBjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, or Ceriporiopsis subvermispora, Coprinus cinereus, Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reeseiorTrichoderma viride.

The transformation of the fungal cell can be performed through a process including the formation of protoplasts, transformation of the protoplasts, and regeneration of the cell wall is essentially known manner. Suitable methods of transforming cells of hostsAspergillusandTrichodermadescribed in EP 238 023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Suitable methods of transformation of the speciesFusariumdescribed by Malardier et al., 1989, Gene 78: 147-156, and in WO 96/00787. Yeast may be transformed using the methods described by Becker and Guarente, In Abelson, J.N. and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Itoet al, 1983, Journal of Bacteriology 153: 163; and Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920.

Ways to get

The present invention relates also to methods of producing the polypeptide according to the invention, comprising (a) cultivating a cell, which in its form wild type capable of producing the polypeptide under conditions conducive for production of the polypeptide; and (b) isolation of the polypeptide. Preferably, the cell is a cell of the genusEurotiumand more preferablyEurotium amstelodami.

The present invention relates also to methods of producing the polypeptide according to the invention, comprising (a) culturing the host cell under conditions conducive for production of the polypeptide; and (b) isolation of the polypeptide.

The present invention relates also to methods of producing the polypeptide according to the invention, comprising (a) culturing the host cell under conditions conducive for production of the polypeptide, where a host cell contains a mutant nucleotide sequence of at least one mutation encoding a Mature polypeptide plot of SEQ ID NO:1, where the mutant nucleotide sequence encodes a polypeptide which consists of amino acids 1-42 sequence SEQ ID NO:2, and (b) isolation of the polypeptide.

In methods of production according to the invention, the cells are cultivated in a nutrient medium, PR is suitable for production of the polypeptide, using methods well known in the field. For example, the cell can be grown by cultivation in shake flask, and small-scale or large-scale cultivation (including permanent, periodic cultivation, cultivation with water or solid-phase cultivation) in the laboratory or in industrial bioreactors, conducted in a suitable medium and under conditions that ensure the expression and/or secretion of the peptide. The cultivation is carried out in a suitable nutrient medium containing sources of carbon and nitrogen and inorganic salts, using known in the field of methods. Suitable environments are available from commercial suppliers or can be obtained in accordance with the published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be distinguished directly from the environment. If the polypeptide is not secreted, it can be isolated from cell lysates.

The polypeptides can be identified using well-known in this region in ways that are specific polypeptides. These methods of detection may include use of specific antibodies. For example, you can use the analysis of antimicrobial activity to determine the activity of the polypeptide, the AK is described in the present description.

The resulting polypeptide can be identified with the use of known in the field of methods. For example, the polypeptide can be isolated from the nutrient medium by using common methods, including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.

The polypeptides according to the invention can be cleaned in a variety of ways known in this field, including, but not limited to, chromatography (e.g. ion exchange, affinity, hydrophobic chromatography, chromatofocusing and gel filtration), electrophoretic methods (e.g., preparative isoelectric focusing), differential solubility (e.g., precipitation with ammonium sulfate), SDS-PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Plants

The present invention relates to a transgenic plant, plant part or plant cell that is transformed nucleotide sequence that encodes a polypeptide with antimicrobial activity according to the invention, in order to Express and receive polypeptide in measurable allocation quantities. The polypeptide can be isolated from plants or parts of plants. Alternative you can use by itself, the plant or plant part containing Ryoko is pinentry polypeptide, to improve the quality of food or feed, for example, to improve the nutritional value, taste and rheological properties, or to destroy anti-nutritional factor.

The transgenic plant can be dicotyledonous (dicot) or monocotyledonous (monocot). Examples of monocotyledonous plants are grasses, such as Kentucky bluegrass (PoA ordinary, Poa), forage grass such as Festuca, Lolium, temperate grass climate, such as Agrostis, and cereals, such as wheat, oats, rye, barley, rice, sorghum and maize (corn).

Examples of dicotyledonous plants include tobacco, legumes such as lupine, potatoes, sugar beet, pea, bean and soybean, and cruciferous plants (family Brassicaceae), such as cauliflower, rape and closely related model organismArabidopsis thaliana.

Examples of parts of plants are stem, callus, leaves, roots, fruits, seeds and tubers, as well as individual fibers that make up these parts, for example, epidermis, mesophyll, parenchyma, vascular tissue, meristem. Specific departments of plant cells, such as chloroplasts, apoplast, mitochondria, vacuoles, peroxisomes and cytoplasm, is also considered as parts of plants. Moreover, any plant cell, regardless of tissue source is considered as part of the plant. Similarly, parts of plants, such as specific tissues and cells selected for prestuplenie according to the invention, also considered as part of a plant, for example, the germ, the endosperm, the aleurone and the seed coat.

Also in the scope of the present invention includes progeny of such plants, plant parts and plant cells.

The transgenic plant or plant cell expressing the polypeptide according to the invention, can be obtained in accordance with known in this field means. In summary, the plant or plant cell get by embedding one or more expressing constructs encoding the polypeptide according to the invention, the genome of the host plant and reproduction obtained from modified plants or plant cells in a transgenic plant or a plant cell.

It is advisable to expressing the design was the design of nucleic acid that contains polynucleotide encoding the polypeptide according to the invention, is functionally linked with appropriate regulatory sequences required for expression of the nucleotide sequence in the preferred method for selecting a plant or plant part. Moreover, expressing the design may contain a selective marker, suitable for detection of host cells, which was built in expressing the design, and the DNA sequence needed to put what I design in the interest of the plant (the latter depends on the method used for introducing DNA).

The choice of regulatory sequences, such as sequences of promoter and terminator, and optionally signal or transport sequence, is determined, for example, on the basis of when, where and how you want to Express the polypeptide. For example, expression of the gene encoding the polypeptide according to the invention may be constitutive or inducible, or may be dependent on the development of specific in relation to the stage or tissue, and gene product can be directed in a specific tissue or plant part such as seeds or leaves. Regulatory sequences are described, for example, Tague et al., 1988, Plant discrimination 86: 506.

For constitutive expression, you can use the promoter of 35S-CaMV, the promoter, the maize ubiquitin 1, and the rice actin 1 (Franck et al., 1980, Cell 21: 285-294, Christensen et al., 1992, Plant Mo. Biol. 18: 675-689; Zhang et al., 1991, Plant Cell 3: 1155-1165). Specific authority promoters can represent, for example, the promoter of storing tissues, such as seeds, potato tubers, and fruits (Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or from accumulating metabolites in tissues, such as meristem (Ito et al., 1994, Plant Mol. Biol. 24: 863-878), a specific seed promoter such as the promoter for glutelin, prolamin, globulin, or albumin rice (Wu et al., 1998, Plant and Cell discrimination 39: 885-889), a promoterVicia fabafrom gene legumin B4 and neizvesten the th protein seeds of Vicia faba(Conrad et al., 1998, Journal of Plant discrimination 152: 708-711), a promoter of protein basics seed oil (Chen et al., 1998, Plant and Cell discrimination 39: 935-941), the promoter of the protein reserve napA fromBrassica napusor any other specific seed promoter known in this field, for example as described in WO 91/14772. Furthermore, the promoter may be a specific leaves a promoter such as the promoter ofrbcsfrom rice or tomato (Kyozuka et al., 1993, Plant discrimination 102: 991-1000), the promoter of the gene adenylatecyclase Chlorella virus (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the promoter of the genealdPfrom rice (Kagaya et al., 1995, Molecular and General Genetics 248: 668-674), or induced by damage to the promoter such as the promoter of the potato pin2 (Xu et al., 1993, Plant Molecular Biology 22: 573-588). Similarly, the promoter can be induced by abiotic stress such as temperature, drought, or change the content of salts, or it may coil the use of exogenous substances that activate the promoter, for example, ethanol, estrogen, plant hormones such as ethylene, altcineva acid and gibberelline acid, and heavy metals.

Also to achieve higher expression of the polypeptide according to the invention in the plant, you can use the element, amplifying the promoter. For example, element, amplifying the promoter may be an intron, which placed the EN between the promoter and the nucleotide sequence encodes a polypeptide according to the invention. For example, in Xu et al., 1993,abovedescribed the use of the first intron of the gene of the rice actin 1 for increased expression.

Gene selective marker and any other part of the structure for the expression can be selected from those available in this field.

The design of nucleic acid is inserted into the genome of plants in accordance with conventional methods known in this field, including mediatedAgrobacteriumtransformation mediated by virus transformation, microinjection, particle bombardment, biolistics transformation, and electroporation (Gasser et al., 1990, Science 244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).

Currently mediatedAgrobacterium tumefaciensgene transfer is preferable to select a method of obtaining a transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38) and it can be used for transforming monocots, although these plants often use other methods of transformation. Presently preferred to select the method of obtaining transgenic monocots is particle bombardment (microscopic particles of gold or tungsten coated with DNA for transformation) embryonic calluses or developing embryos (Christou, 1992, Plant Journal 2: 275-281; Shimamoto, 1994, Current Opinion Biotechnology 5 158-162; Vasil et al., 1992, Bio/Technology 10: 667-674). An alternative method of transformation of monocots is based on the transformation of protoplasts as described Omirulleh et al., 1993, Plant Molecular Biology 21: 415-428.

After the transformation, transformants with built-in construction for the expression, select and regenerate into whole plants in accordance with well-known in the field of ways. Often the process of transformation developed for the selective removal of genes, which direct the selection, or in the process of regeneration, or in subsequent generations, using, for example, co-transformation with two separate designs T-DNA or site-specific excision of the gene, which shall conduct sampling, using specific recombinases.

The present invention relates also to methods of producing the polypeptide according to the invention, comprising (a) cultivating a transgenic plant or the plant cells containing polynucleotide that encodes a polypeptide with antimicrobial activity according to the invention, under conditions promoting production of the polypeptide; and (b) isolation of the polypeptide.

Composition

The present invention relates also to compositions, such as pharmaceutical compositions containing the polypeptide according to the invention. Preferably, the composition is enriched in such a polypeptide. The term "enriched" UK which shows that what antimicrobial activity of the composition is increased, for example, with an enrichment factor of 1.1.

In addition, the composition may contain other pharmaceutically active substance, such as additional biocidal substance, such as other antimicrobial polypeptide exhibiting antimicrobial activity, as defined above. Biocidal substance can be a famous in this area is an antibiotic. Classes of antibiotics include penicillins, such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin, etc.; penicillins in combination with inhibitors of beta-lactamase, cephalosporins, for example, cefaclor, Cefazolin, cefuroxime, moxalactam etc.; carbapenems; carbapenems; aminoglycosides; tetracyclines; macrolides; lincomycin; polymyxins; sulfonamides; quinolones; chloramphenicol; metronidazole; spectinomycin; trimethoprim; vancomycin; etc. Biocidal substance may also be an antimicrobial substance, including, polyene, for example, amphotericin B, nystatin; 5-fluctin; and azoles, e.g., miconazole, ketoconazole, Itraconazole and fluconazole.

In one embodiment, the biocidal agent is a non-enzymatic chemical substance. In another embodiment, the biocidal substance is nepaliputi the Noah chemical substance.

The compositions may contain suitable media. The composition may also contain suitable carrier for delivery, can deliver antimicrobial polypeptides according to the invention in the desired area, using songs as a medicine.

The composition of the polypeptide can be obtained in accordance with known in this field ways, and they can be in the form of a liquid or a dry composition. For example, the composition of the polypeptide may be in the form of granules or micro-granulate. The polypeptide to be included in the composition may be stabilized in accordance with well-known in this field means.

Examples of compositions of the polypeptide according to the invention are presented below. The dose of the composition of the polypeptide according to the invention and other conditions of application of the composition can be determined on the basis of known in the field of methods.

Methods and application

The present invention also relates to methods of using the polypeptides with antimicrobial activity. Antimicrobial polypeptides generally suitable in any fire, vulnerable to infection by bacteria, fungi, yeast or algae. Typically, the lesions are found in water systems such as water cooling system, water for washing linen for washing, oil system which we such as cutting oils, lubricants, petroleum industry, etc. where the microorganisms must be destroyed or where their growth must be controlled. However, the present invention can be used in all methods of application, for which suitable known antimicrobial composition, such as the protection of wood, latex, adhesive, glue, paper, cardboard, textiles, leather, plastics, sealing composition and feed.

Other uses include food, beverages, cosmetics such as lotions, creams, gels, ointments, Soaps, shampoos, hair conditioners, antiperspirants, deodorants, liquid for rinsing the mouth, products for contact lenses or ingredients of food.

Thus, antimicrobial polypeptides according to the invention can be used as a disinfectant, for example, to treat infections of the eyes or mouth, skin infections; in antiperspirants or deodorants; for cleaning and disinfecting contact lenses and teeth (oral care mouth).

Typically, it is assumed that the antimicrobial polypeptides according to the invention are suitable for cleaning, disinfecting or inhibiting microbial growth on the surface. Examples of surfaces, which preferably can be contact on antimicrobial is of peptides according to the invention, represent the surface of the process equipment, e.g., dairy plants, chemical or pharmaceutical plants, systems sanitary water treatment, refineries, factories for the production of paper, water treatment plants and cooling towers. Antimicrobial polypeptides according to the invention should be used in an amount that is effective for cleaning, disinfecting or inhibiting microbial growth on a surface.

Antimicrobial polypeptides according to the invention, moreover, can be used for cleaning surfaces and kitchen utensils on the plants for food production and in any premises where the manufacture or serves food, such as hospitals, nursing homes and restaurants.

They can also be used as a preservative or disinfectant in water-based paints.

This invention also relates to antimicrobial polypeptide or composition according to the invention as a drug. In addition, the antimicrobial polypeptide or composition according to the invention can also be used for the manufacture of drugs to control or combat the microorganisms, such as related to mushrooms of the organisms or bacteria, preferably gram-positive bacteria.

Composition and antimicrobial polypeptide according to the invention can be used as an antimicrobial veterinary drugs or therapeutic or prophylactic agent for a person. Thus, the composition and antimicrobial polypeptide according to the invention can be used to obtain veterinary substances or drugs or prophylactic agents for humans for the treatment of microbial infections, such as bacterial or fungal infection, preferably infections gram-positive bacteria. In particular microbial infection can be associated with lung diseases, including, but not limited to, tuberculosis, pneumonia and cystic fibrosis; and sexually transmitted diseases, including, but not limited to, gonorrhoea and chlamydia.

The composition according to the invention contains an effective amount of the antimicrobial polypeptide according to the invention.

As used in the present description, assume that the term "effective amount" means the quantity of antimicrobial polypeptides according to the invention, which is sufficient to inhibit the growth of interest of microorganisms.

This invention relates also to compositions for wound healing of reproductie, such as support bandages, medical devices such as catheters, and in addition to products for hair dandruff, such as shampoos.

The antimicrobial compositions of polypeptides according to the invention is introduced into the host organism suffering from microbial infection or Prednisolonum to it. The introduction may be local, localized or systemic, depending on the particular microorganism, preferably it is localized. Typically, the dose of antimicrobial polypeptides according to the invention is sufficient to reduce the number of microbes with the destruction of at least about 50%, usually at least 1, and possibly 2 or more orders of magnitude. Compounds according to the invention is administered at a dosage that reduces the number of germs while minimizing side effects. It is assumed that for the application ofin vivocomposition was prepared and applied under the guidance of a therapist. Antimicrobial polypeptides according to the invention is particularly suitable for the destruction of gram-negative bacteria, includingPseudomonas aeruginosaandChlamydia trachomatis; and gram-positive bacteria, including streptococci, such asStreptococcus pneumoniae,S. uberis,S. hyointestinalis,S. pyogenesoragalactiae; and staphylococci, such asStaphylococcus aureus,S. epidermidis,S. simulans ,S. xylosus,S. carnosus.

The antimicrobial compositions of polypeptides according to the invention can be introduced into the host organism suffering from microbial infection of the lungs or prone to microbial infections of the lungs, such as pneumonia; or microbial wound infections, such as bacterial infection of the wound.

Drugs antimicrobial polypeptides according to the invention can also be entered in the host organism suffering from skin infections or Prednisolonum to skin infections such as acne, atopic dermatitis or seborrheic dermatitis; preferably the skin infection is a bacterial infection of the skin, for example, calledStaphylococcus epidermidis,Staphylococcus aureus,Propionibactehum acnes,Pityrosporum ovaleorMalassezia furfur.

Antimicrobial polypeptides according to the invention are also suitable for compounds to kill germsin vitroin particular, when it is undesirable to use many common antibiotics. For example, antimicrobial polypeptides according to the invention can be added to food products for animals and/or humans; or they can be included as additives in cell culturein vitroto prevent excessive microbial growth in tissue culture.

The sensitivity of a particular microbe to the destruction by antimicrobial polypeptides coz the ACLs to the invention can be determined by analysis of in vitroas described in detail in the experimental section. As a rule, the culture of microbes combined with antimicrobial polypeptide in various concentrations for a period of time sufficient to ensure exposure of the protein, typically from about one hour to one day. Then count the number of viable microbes and determine the level of destruction.

Interest microbes include, but are not limited to, gram-negative bacteria, e.g.:Citrobacter sp.;Enterobacter sp.;Escherichia sp., for example,E. coli;Klebsiella sp.;Morganella sp.;Proteus sp.;Providencia sp.;Salmonella sp., for example,S. typhi,S. typhimurium;Serratia sp.;Shigella sp.;Pseudomonas sp., for example,P. aeruginosa;Yersinia sp., for example,Y. pestis,Y. pseudotuberculosis,Y. enterocolitica;Franciscella sp.;Pasturella sp.;Vibrio sp., for example,V. cholerae,V. parahemolyticus; Campylobacter sp.,for example,C. jejuni; Haemophilus sp.,for example,H. influenzae, H. ducreyi; Bordetella sp.,for example,B. pertussis, B. bronchiseptica, B. parapertussis; Brucella sp., Neisseria sp.,for example,N. gonorrhoeae, N. meningitides,etc. Other interest bacteria includeLegionella sp., for example,L. pneumophila; Listeria sp.,for example,L. monocytogenes; Mycoplasma sp.,for example,M. hominis, M. pneumoniae; Mycobacterium sp.,for example,M. tuberculosis, M. leprae; Treponema sp.,for example,T. pallidum; Borrelia sp.,for example,B. burgdorferi; Leptospirae sp.; Rickettsia sp., for example,R. rickettsii, R. typhi; Chlamdia sp., for example,C. trachomatis, C. pneumoniae, C. psittaci; Helicobacter sp.,for example,H. pyloriand so on

Non-bacterial interest pathogens include pathogens, fungi and protozoa, for example,Plasmodia sp., for example,P. falciparum, Trypanosoma sp.,for example,T. brucei; shistosomes; Entaemoeba sp., Cryptococcus sp., Candida sp.,for example,C. albicans; etc.

You can use different techniques. The composition of the polypeptide can be administered orally or can be injected intravenously, subcutaneously, peritoneal, through aerosol, ophthalmicus, inside the bladder, topically, etc. for Example, methods of administration by inhalation is well known in this field. The dosage of therapeutic composition varies widely depending on the specific antimicrobial polypeptide, be inserted, the nature of the disease, frequency of administration, method of administration, excretion of funds from the host organism, and the like, the Initial dose may be larger with the next lower dose. Dose can be administered infrequently, once a week or every two weeks, or it can be divided into smaller doses and enter one or more times per day, twice per week, etc. for maintaining effective dose level. In many cases, for oral administration requires a higher dose than intravenous. Amide bond, and the C - and N-ends which you can modify for higher stability when administered orally. For example, C-end can be subjected to amidation.

Compounds

Compounds according to the invention can be included in a variety of formulations for therapeutic administration. More specifically, the compounds according to the invention can be in pharmaceutical compositions by combining with appropriate pharmaceutically acceptable carriers or diluents, and can be composed into preparations in solid, semi-solid, liquid or gaseous forms such as tablets, capsules, powders, granules, ointments, creams, foams, solutions, suppositories, injections, means for inhalation, gels, microspheres, lotions and aerosols. Essentially, the introduction of compounds can be performed in various ways, including oral administration, the introduction of the mucous membrane of the cheeks, rectal, parenteral, intraperitoneal, intradermal, transdermal, intratracheal, etc, introduction. Antimicrobial polypeptides according to the invention after administration can be systemic or can be localized through the use of an implant or other structure, which acts by delaying the active dose in the area of implantation.

In one embodiment, the composition for topical application contains a chelating agent, which reduces the effective concentration of divalent cations, particularly calcium and magnesium. In the example, you can include means, such as citrate, EGTA or EDTA, where citrate is preferred. The concentration of citrate, as a rule, is approximately from 1 to 10 mm.

Compounds according to the invention can be entered separately, in combination with each other, or they can be used in combination with other known compounds (e.g., perforin, anti-inflammatory drugs, antibiotics etc). In pharmaceutical dosage forms, the compounds can be introduced in the form of their pharmaceutically acceptable salts. The following methods and excipients are only illustrative and in no way limiting.

For oral preparations, the compounds can be used alone or in combination with additional, appropriate substances for the manufacture of tablets, powders, granules or capsules, for example, with conventional additional substances, such as lactose, mannitol, corn starch or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, gum Arabic, corn starch or gelatin; (C dezinfeciruyuhimi means, such as corn starch, potato starch or carboxymethylcellulose sodium; lubricating agents such as talc or magnesium stearate; and if desired, with diluents, b is atmospheric means, wetting agents, preservatives and flavors.

Connections can be composed into preparations for injection by dissolving, suspension or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable oil or other similar oils, synthetic aliphatic acids glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives, such as solubilization, isotonic agents, suspendresume substances, emulsifiers, stabilizers and preservatives.

The compounds can be used in the composition representing the aerosol subject to introduction through inhalation. Compounds according to the invention can be composed into pressurized acceptable substances for spraying, such as DICHLORODIFLUOROMETHANE, propane, nitrogen, etc.

The compounds can be used as lotions, for example, to prevent infection of burns, by composition with generally accepted additional substances, such as solubilization, isotonic agents, suspendresume substances, emulsifiers, stabilizers and preservatives.

Moreover, the compounds can be made into suppositories by mixing with a variety of bases such as emulsifying bases or water-soluble bases. The connection is possible according to the invention it is possible to enter rectally using the suppository. The suppository can include a carrier such as cacao butter, carbowax and glycols, which melt at body temperature, but which harden at room temperature.

Unit dosage forms for oral or rectal administration, such as syrups, elixirs and suspensions can be produced if each unit dosage, for example, teaspoonful, tablespoonful, tablet or suppository, contains a set amount of a composition containing one or more compounds according to the invention. Similarly, unit dosage forms for injection or intravenous administration may contain the compound according to the invention in a composition as a solution in sterile water, normal saline or another pharmaceutically acceptable carrier.

Implants for continuous release are well known in this field. Implants are as microspheres, plates, etc. with biologically dehydroamino polymers. For example, polymers of lactic acid and/or glycolic acid form destructible polymer, which is well tolerated by the host organism. The implant containing antimicrobial polypeptides according to the invention, placed near the area of infection to the local concentration of active gamestable increased relative to the other parts of the body.

As used in the present description, the term "unit dosage form" refers to physically fragmented units, suitable as a single dose for the subject animal or human subject-a person, where each unit contains a set number of compounds according to the invention, calculated in an amount sufficient to obtain the desired effect, together with a pharmaceutically acceptable diluent, carrier or agent for delivery. Characteristics of single dosage forms according to the invention depend on the particular connections in use and the expected effect, and the pharmacodynamics associated with the connection, the host organism. Pharmaceutically acceptable excipients, such as substance for delivery, adjuvants, carriers, or diluents, are publicly available. Moreover, the public are pharmaceutically acceptable excipients, such as altering the pH and buffer means altering toychest tools, stabilizers, moisturizing agents, etc.

Typical dosages for systemic injections are in the range from 0.1 PG to 100 milligrams per kg weight of subject per administration. A typical dosage may represent one tablet input from two to six times per day, or one capsule or tablet delayed release, the led once a day, and with proportionally higher content of active ingredient. Effect of sustained release can be achieved by using components of capsules that dissolve at different pH values, using capsules from which the release occurs slowly when the osmotic pressure, or by any other known methods of supervised release.

Specialists in this field will understand that dose levels can vary depending on the specific compound, the severity of symptoms and the sensitivity of the subject to side effects. Some of the specific compounds are more effective than others. Preferred dosages of this compound will easily identify experts in this field in many ways. The preferred method is to determine the physiological efficiency of this connection.

The use of liposomes as a carrier for delivery is one of interest methods. Liposomes are combined with cells intended for exposure to the field and deliver the contents of their intracellular lumen. Contact liposomes with cells maintained for sufficient to merge period of time using different ways of maintaining contact, such as localization, binders, etc. In about the nom aspect of this invention, liposomes are developing, that they were in aerosol state for pulmonary administration. Liposomes can be produced with purified proteins or peptides that carry out the fusion of membranes, such as Sendai virus or influenza virus, etc. Lipids may represent any suitable combination of known forming liposomes lipids, including cationic or zwitterionic lipids, such as phosphatidylcholine. Other lipids is usually a neutral or acidic lipids, such as cholesterol, phosphatidylserine, phosphatidylglycerol etc.

To obtain liposomes you can use the methods described by Kato et al. (1991) J. Biol. Chem. 266:3361. Briefly, the lipids and the composition of the cavity containing peptides, unite in an appropriate aqueous medium, it is convenient, in a salt environment, where the total solids content is in the range of about 1-10 percent by weight. After intensive mixing over short periods of time, approximately 5-60, the test tube is placed in a warm water bath at about 25-40°C, and this cycle is repeated approximately 5-10 times. Then the composition is treated with ultrasound for a suitable period of time, typically about 1-10, and, in addition, it can be mixed by shaking. Then the volume increases by the addition of an aqueous medium, as a rule, increasing the volume of the roughly 1-2 times and then shaken and cooled. This method integrates into the cavity of high molecular weight molecules.

Formulations with other active tools

For use in the present methods, antimicrobial polypeptides according to the invention can comprise other pharmaceutically active means, in particular with other antimicrobial agents. Other interest funds include a wide variety of antibiotics, known in this area. Classes of antibiotics include penicillins, such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin, etc.; penicillins in combination with inhibitors of beta-lactamase, a cephalosporin, such as cefaclor, Cefazolin, cefuroxime, moxalactam, etc.; carbapenems; carbapenems; aminoglycosides; tetracyclines; macrolides; lincomycin; polymyxins; sulfonamides; quinolones; chloramphenicol; metronidazole; spectinomycin; trimethoprim; vancomycin; etc.

Also suitable antimicrobial agents, including the polyene, for example, amphotericin B, nystatin; 5-fluctin; and azoles, e.g., miconazole, ketoconazole, Itraconazole and fluconazole. TB drugs include isoniazid, ethambutol, streptomycin, and rifampin. Also in the composition of the antimicrobial polypeptides according to the invention can in order to include cytokines, for example, interferon gamma, tumor necrosis factor alpha, interleukin 12, etc.

Synthesisin vitro

Antimicrobial peptides according to the invention can be obtained by synthesisin vitrousing conventional methods known in this field. Available are various commercial devices for synthesis, such as robotic devices for synthesis Applied Biosystems Inc., Beckman, etc. Through the use of devices for synthesis, natural amino acids can be substituted non-natural amino acids, in particular D-isomers (or D-forms) for example, D-alanine and D-isoleucine, diastereoisomerism, the side chains of different lengths or functionality, etc. of a Particular sequence and the method of obtaining determined on the basis of convenience, economic calculations, the required purity, etc.

It is possible to conduct the chemical binding of different peptides or proteins containing suitable for the formation of relations functional groups such as amino groups for the formation of amide or substituted amine, for example, by reductive amination, tirinya group for education tiefer or disulfide, carboxylic groups for the formation of amide, etc.

If necessary, in the process of synthesis or expression of the peptide can be administered in a number of groups that provide Ecevit binding with other molecules or with the surface. Thus, cysteine can be used to obtain thioesters, histidine for binding to complex metal ions, carboxylic groups to form amides or esters, amino groups to form amides and the like Polypeptides also can be extracted and cleaned in accordance with conventional methods of recombinant synthesis. You can get lysate expressing the owner and the clear lysate using HPLC, gel filtration, gel electrophoresis, affinity chromatography, or other purification methods. Mainly used compositions contain at least 20% by weight of the desired product, more often at least about 75% by weight, preferably at least about 95% by weight, and for therapeutic purposes, usually at least about 99.5% pure by weight, relative to the impurities associated with the method of obtaining the product and its purification. Usually percentage based on the total protein content.

Pet food

The present invention also relates to methods of using the polypeptides with antimicrobial activity in animal feed, as well as to compositions of feed and feed additives containing antimicrobial polypeptides according to the invention.

The term animal includes all animals, including humans. Note the Rami animals are ruminant animals and ruminants, such as cows, sheep and horses. In a specific embodiment, the animal is a ruminant animal. Ruminant animals include animals mono-gastric, for example, boars or swine (including, but not limited to, piglets, piglets at growing and pig; poultry such as turkeys and chickens (including, but not limited to, broiler chickens, laying hens); young calves; and fish (including, but not limited to, salmon).

The term food or feed composition means any compound, drug, mixture, or composition, suitable or intended for consumption by the animal.

Application in accordance with this invention, the antimicrobial polypeptide can be a feeding animal before, after or simultaneously with food. The latter is preferred.

In a particular embodiment, the antimicrobial polypeptide in the form in which it is added to feed, or for inclusion in feed additive, is strictly defined. Well-defined means that the drug is an antimicrobial polypeptide is at least 50% pure, as determined by gel-filtration (see example 12 in WO 01/58275). In another specific embodiment, the drug is an antimicrobial polypeptide is at least 60, 70, 80, 85, 88, 90, 92, 94, or at least 95% Chi is tym, as determined by this method.

A well-defined drug antimicrobial polypeptide is preferred. For example, much easier in the stern to dose accurately antimicrobial polypeptide, which essentially contains no other interfering or contaminating antimicrobial polypeptides. The term to dose accurately applies in particular to the desire to obtain a uniform and consistent results, and the ability to optimize the dosage, based on the desired effect.

For use in animal feed, however, it is not necessary to antimicrobial polypeptide was so pure; it may, for example, to include other enzymes, and in this case it can be called a drug antimicrobial polypeptide.

The drug is an antimicrobial polypeptide can (a) be added directly to the feed (or used directly in the processing of vegetable proteins), or (b) it can be used to obtain one or more intermediate compositions such as feed additives or pre-mixture, which is then added to feed (or used in the process). The above-described degree of purity refers to the purity of the original drug antimicrobial polypeptide, regardless of the application in accordance with (a) or (b)above.

The drug is an antimicrobial polypeptide with a degree of purity of this order, in particular, can be obtained using recombinant methods of production, while they are not easy to obtain and they also will remain higher changes from batch to the party when receiving antimicrobial polypeptide traditional methods of cultivation.

This drug is an antimicrobial polypeptide can certainly be mixed with other enzymes.

As used in the present description, the term plant proteins refers to any compound, composition, preparation or mixture that includes at least one protein obtained from a plant or from a plant, including modified proteins and protein derivatives. In specific embodiments, the implementation of the protein content in vegetable proteins is at least 10, 20, 30, 40, 50 or 60% (wt./mass.).

Plant proteins can be obtained from vegetable sources of protein such as beans and grains, for example, from materials of plant familiesFabaceae(Leguminosae),Cruciferaceae,ChenopodiaceaeandPoaceaesuch as soy flour, lupine flour and meal from rapeseed. In a specific embodiment, the source of vegetable protein is a substance from one or more plants of the familyFabaceaesuch as soybean, lupine, peas or beans.

In another specific embodiment, the implementation is s source of vegetable protein is a material from one or more plants of the family Chenopodiaceaefor example, beet, sugar beet, spinach or quinoa.

Other examples of vegetable protein sources are rapeseed and cabbage.

Soy is the preferred source of vegetable protein.

Other examples of vegetable protein sources are cereals, such as barley, wheat, rye, oats, maize (corn), rice, and sorghum.

Antimicrobial polypeptide can be added to food in any form, either as relatively clean antimicrobial polypeptide, or in a mixture with other components intended for addition to animal feed, i.e. in the form of additives in animal feed, such as the so-called pre-mixes for animal feed.

In an additional aspect, the present invention relates to compositions for use in animal feed, such as animal feed and additives to feed for the animals, for example, in the preliminary mixtures.

In addition to the antimicrobial polypeptide according to the invention an additive to feed for animals according to the invention contain at least one fat-soluble vitamin, and/or at least one water soluble vitamin, and/or at least one trace mineral, and/or at least one macro element.

In addition, optional, optional feed ingredients are colouring agents, and ematicheskie connection stabilizers, and/or at least one other enzyme selected from Fitz EC 3.1.3.8 or 3.1.3.26; the xylanase EC 3.2.1.8; galactans EC 3.2.1.89; and/or beta-glucanase EC 3.2.1.4.

In a specific embodiment, these other enzymes are well-defined (as defined above for drugs antimicrobial polypeptide).

Examples of other antimicrobial peptides (AMP) are CAP18, leucocin a, traction, protegrin-1, Tinatin, defensin, viperin, such as novispirin (Robert Lehrer, 2000), and their variants or fragments that retain antimicrobial activity.

Examples of other antifungal proteins (AFP) are peptidesAspergillus giganteusandAspergillus niger, and variants and fragments that retain antifungal activity as described in WO 94/01459 and WO 02/090384.

As a rule, fat soluble and water soluble vitamins and trace elements, form part of the so-called pre-mixes, designed to add to the feed, while the macronutrients, as a rule, added to feed separately. Any of these types of compositions, if it contains antimicrobial polypeptide according to the invention, is an additive in animal feed according to the invention.

In a specific embodiment, the additive in animal feed according to the invention is intended for VK is Uchenie (or provided, that it should be included in the rations of animals or in the feed at levels from 0.01 to 10.0%; more specifically from 0.05 to 5.0%; or from 0.2 to 1.0% (% means g of the additive per 100 g feed). This, in particular, observed for pre-mixes.

The following components are non-exclusive list of examples of these components:

Examples of fat-soluble vitamins are vitamin A, vitamin D3, vitamin E, and vitamin K, for example, vitamin K3.

Examples of the water-soluble vitamins are vitamin B12, Biotin and choline, vitamin B1, vitamin B2, vitamin B6, Niacin, folic acid and Pantothenate, for example, Ca-D-Pantothenate.

Examples of minerals are magnesium, zinc, iron, copper, iodine, selenium and cobalt.

Examples of macronutrients are calcium, phosphorus and sodium.

Nutritional needs in these components (illustrated for poultry and piglets/pigs) are presented in table A WO 01/58275. Under the food needs imply that these components should be provided in the diet in the indicated concentrations.

Alternatively, an additive in animal feed according to the invention contains at least one of the individual components listed in table WO 01/58275. At least one means any one or more of, one, or two, or three, or four and so on until all thirteen, or even on the all fifteen of the individual components. More specifically, this at least one separate component included in the additive according to the invention in such an amount to obtain a concentration in the feed being in the range specified in column four, or in column five, or in column six of table A.

The present invention relates also to compositions of feed for animals. The composition of feed for animals or rations have a relatively high protein content. Rations of poultry or pigs can be characterized as shown in table B WO 01/58275, columns 2-3. Rations for fish can be characterized as specified in column 4 of that table B. moreover, these diets for fish, generally have a content of crude fat 200-310 g/kg of the Composition of animal feed in accordance with this invention has a crude protein content of 50-800 g/kg, and, moreover, contains at least one antimicrobial polypeptide as claimed in the present application.

Moreover, or alternatively, the content of crude protein, above), the animal feed composition according to the invention has a content of metabolic energy of 10-30 MJ/kg; and/or calcium content of 0.1-200 g/kg; and/or the amount of free phosphorus of 0.1-200 g/kg; and/or the content of methionine 0.1 to 100 g/kg; and/or the content of methionine plus cysteine 0.1 to 150 g/kg; and/or the content l is Zina of 0.5-50 g/kg

In specific embodiments, the implementation of the content of metabolic energy, crude protein, calcium, phosphorus, methionine, methionine plus cysteine and/or lysine is in any of the ranges 2, 3, 4 or 5 in table B WO 01/58275 (R. 2-5).

Crude protein is calculated as nitrogen (N), multiplied by a factor of 6.25, i.e. Crude protein (g/kg)=N (g/kg)×6,25. The nitrogen content determined by the Kjeldahl method (A.O.A.C, 1984, Official Methods of Analysis 14th ed., Association of Official Analytical Chemists, Washington DC).

Metabolic energy can be derived from the publication of the NRC Nutrient requirements in swine, ninth revised edition 1988, subcommittee on swine nutrition, committee on animal nutrition, board of agriculture, national research council. National Academy Press, Washington, D. C., pp. 2-6, and the European Table of Energy Values for Poultry Feed-stuffs, Spelderholt centre for poultry research and extension, 7361 DA Beekbergen, The Netherlands. Grafisch bedrijf Ponsen &looijen bv, Wageningen. ISBN 90-71463-12-5.

The content in the diet of calcium-free phosphorus and amino acids in full rations of animals is calculated based on the feed table, such as Veevoedertabel 1997, gegevens over chemische samenstelling, verteerbaarheid en voederwaarde van voedermiddelen, Central Veevoederbureau, Runderweg 6, 8219 pk Lelystad. ISBN 90-72839-13-7.

In a specific embodiment, the feed composition for an animal according to the invention contains at least one vegetable protein or protein source, as defined above.

In additional specific embodiments, implementation, composition of feed for an animal according to the invention soda is incorporated 0-80% maize; and/or 0-80% sorghum; and/or 0-70% wheat; and/or 0-70% barley; and/or 0-30% oats; and/or 0-40% soy flour; and/or 0-10% fish meal; and/or 0-20% serum. Rations for animals can be made as fodder (not granulated or pelleted diets. Typically, the crushed material feed is mixed and add to it a sufficient amount of essential vitamins and minerals in accordance with the requirements for representing the interest of the species. Enzymes can be added as solid or liquid formulations of enzymes. For example, the solid composition of the enzyme, usually add up to or during the stage of mixing; and a liquid preparation of the enzyme, as is usually added after the stage of granulation. The enzyme can also be added to the feed Supplement or preliminary mixture.

The final concentration of the enzyme in the diet is in the range of 0.01-200 mg enzyme protein per kg diet, for example, in the range of 5-30 mg enzyme protein per kg of the animal's diet. Antimicrobial polypeptide can be entered in one or more of the following quantities (dose ranges): 0.01 to 200; or 0.01-100; or 0.05-100; or 0.05-50; or of 0.10-10 - all these ranges are presented in mg protein antimicrobial polypeptide per kg feed (ppm).

To determine mg protein antimicrobial polypeptide per kg feed, the antimicrobial polypeptide purified from the oppozitsii feed and specific activity of the purified antimicrobial polypeptide determined using a suitable assay (see antimicrobial activity, substrates and assays). Antimicrobial activity of the composition of the feed is essentially also determined using the same analysis, and based on these two definitions, calculate the dosage in mg protein antimicrobial polypeptide.

These principles are used to determine mg protein antimicrobial polypeptide in feed supplements. Of course, if is available a sample of the antimicrobial polypeptide used to retrieve the feed additive or feed, the specific activity determined in this sample (no need to clean the antimicrobial polypeptide of the composition of food or supplements).

The signal peptide and propeptide

The present invention relates also to the structures of nucleic acids containing the gene encoding a protein functionally associated with one or both of the first nucleotide sequence consisting of nucleotides 1-60 sequence SEQ ID NO:1 that encodes a signal peptide consisting of amino acids -48 at -29 SEQ ID NO:2, and the second nucleotide sequence consisting of nucleotides 61-144 sequence SEQ ID NO:1, encoding propeptide consisting of amino acids -28 through -1 SEQ ID NO:2, where the gene which is alien to the first and second nucleotide sequences.

The present invention relates also to expressing recombinant vectors and recombinant cell host containing such structures of nucleic acids.

The present invention relates also to methods of producing a protein, comprising (a) culturing such recombinant host cell under conditions suitable for production of the protein; and (b) isolation of the protein.

The first and the second nucleotide sequence may be functionally associated with alien genes separately from other kontroliruy sequences or in combination with other regulatory sequences. Such other regulatory sequences described above. As previously described, when the parts as a signal peptide, and propeptide, located on the N-end of the protein, plot propeptide is located near the N-end of the protein and the site of the signal peptide is located near the N end of the site propeptide.

Protein can be a native protein of the host cell or heterologous to her. The term "protein" is not meant in the present description for the assignment to a specific length of the encoded product and, thus, include peptides, oligopeptides and proteins. The term "protein" also includes two or more polypeptides, combined with the formation of the encoded product. Proteins also include hybrid polypeptide is, which contain a combination of parts or complete polypeptide sequences obtained from at least two different proteins, where one or more of them may be heterologous to the cell, the owner or her own. In addition, the proteins include natural allelic and obtained by means of engineered variants of the above proteins and hybrid proteins.

Preferably, the protein is a hormone or a variant enzyme, receptor or fragment, antibody, or its fragment, or a reporter. In a more preferred aspect, the protein is the oxidoreductase, a transferase, hydrolase, liasu, isomerase, or ligase. In a more preferred aspect, the protein is aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, tsiklodekstringlyukanotransferazy, desoksiribonukleaza, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, athanasou, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase or xylanase.

The gene can be obtained from any prokaryotic, eukaryotic, or other source.

The present invention is additionally described by the your the following examples, that should not be interpreted as limiting the scope of this invention.

EXAMPLES

Chemicals used as buffers and substrates, were at least analytical grade commercial products. In the following examples, the antimicrobial polypeptide represented as amino acids 1-42 sequence SEQ ID NO:2 is referred to as "eurotin".

EXAMPLE 1

The cDNA libraryEurotium amstelodami

The cDNA library was obtained fromE. amstelodamigrown for 5 days on potato agar with dextrose (PDA). RNA containing poly-A, purified, synthesized cDNA and got the library in accordance with standard methods of molecular biology. A detailed Protocol for the overall process can be found in the examples of international patent application WO 01/12794. The vector used for cloning was a pMhas5, which is represented in the sequence SEQ ID NO:8 and which has the following elements:

Table 1
Vector elements pMhas5
TheLocalizationDescription
CDS365-1156Sustainable is here to kanamycin
CDS2232-2387Alpha-peptide of beta-galactosidase
-10 signal sequence2189-2192The Shine-dalgarno sequence
The promoter2101-2189The promoter Lac
Different626-650Primer KanP1 system BACE

EXAMPLE 2

Design expressing vectorAspergillusfor eurozine

The coding eurotin nucleotide sequence amplified from the cDNA library (see example 1) as follows: 1 μl cDNA (approximately 10 ng DNA) was used as matrix in the reaction mixture for PCR with primer a and primer b

Primer A: TCTTGGATCCACCATGCACTTCACCAAGGTCTCC (SEQ ID NO:4)

Primer B: TCTTCTCGAGTTAGAAAGAACAGGTGCAGGTAGG (SEQ ID NO:5)

10 pmol of each primer used in the reaction volume 50 microlitres. The temperature of annealing was 55 degrees Celsius, and elongation was at 72 degrees Celsius for 1 minute. Just spent 35 cycles. Used the Expand High Fidelity PCR System (Roche).

Aliquots of the reaction mixture for PCR were separated in a 4% agarose gel. Father is Levi band was visible in the field, corresponding to the size of approximately 300 BP PCR Fragment was digested byBamH1 andXho1, which were digested in the projections made by the PCR primers. Splintered fragments were isolated and cloned in split by BamH1-Xho1 pMT2786 expressing plasmidAspergillusbased plasmids pMT2188, which is based on pCaHj527 (see example 7 of the international patent application WO 02/12472; and WO 00/70064). Confirmed that interest sequence encodes a sequence of eurozine, as defined above. The sequence of the fragment POR presented as SEQ ID NO:6.

Expressing plasmidAspergilluswith the insertion of the PCR product identified pMT2935 and it is presented as SEQ ID NO:7.

EXAMPLE 3

Expression of eurozine inAspergillus

pMT2935 (see SEQ ID NO:7) was transformed into strain BECXh2Aspergillus oryzae(see international patent application WO 00/39322). 30 transformants was re-isolated twice in selective and not inducing conditions on tablets with minimal environment Cove with sucrose and ndimethylacetamide. To analyze the expression of eurozine, transformants were grown for 6 days at 30 degrees Celsius in test tubes with 10 ml of YPM (2% peptone, 1% yeast extract, 2% maltose). Supernatant were separated in 10% gels Bis-Tris SDS NuPage (Invitrogen) according to the manufacturer's recommendations with a buffer to separate MES to ensure the treatment of separation in the low Mw range. TransformantsAspergillus oryzaegrew well, even after the induction of expression of eurozine.

A distinct band of the size expected for eurocine, was visible in most transformants, whereas this band was not visible in the untransformed strains hosts BECh2A. oryzae.

EXAMPLE 4

Cleaning eurozine

The broth for the cultivation was filtered through a 0.22 μm filter Corning 431118 and using formic acid pH was brought to 4.0. Filtration through a 0.22 μm filter was repeated to remove additional sediment after adjusting pH. Measured conductivity and brought up to approximately 10 MSM cm-1the addition of MQ water (Millipore). Then the filtrate was placed in a 12 ml column Source 30S (Amersham Biosciences 17-1273-01) using the device for analysis AKTA HPLC. Buffer for loading consisted of 50 mm formic acid, pH 4 buffer (buffer A).

Eurotin was suirable with a gradient of buffer B 0-100% in 20 column volumes. Buffer B consisted of 50 mm formic acid, 2 M sodium chloride, pH of 4.0. The identity of the purified fractions was checked by MALDI-TOF MS (Voyager DE Pro instrument, Applied Biosystems) and the purity of approximately verified by SDS-PAGE (Invitrogen, NuPage 12% Bis-Tris/MES, painted by Gel code Blue Stain Reagent, Pierce 24592)

The fractions containing the considered connection (based on MALDI-TOF MS), were combined and concentrated to filter the Amicon Ultra 5000 Da MWCO (Millipore UFC900524). Centrifugation was carried out at 4000 g for about 30 minutes. Then the solution was absoluely by three times washing in 0.01% acid by using the same filter and centrifugation conditions.

The product was analyzed by the exact sequence and purity through the analysis of amino acids and MALDI-TOF MS. The measured mass of eurozine was 4339 Yes. The calculated molecular weight was 4338,8 Yes, the average value, on the basis of amino acids 1-42 sequence SEQ ID NO:2.

The original solution was stored at -20°C.

EXAMPLE 5

Evaluation of antimicrobial activity

Purified eurotin were evaluated for antimicrobial activity in the analysis of microdesmidae. The minimum inhibiting concentration was determined in accordance with the guidelines of the NCCLS/CLSI from CLSI (Institute for clinical laboratory standards).

Eurotin analyzed in the following concentrations: 32; 16; 8; 4; 2; 1; 0,50; 0,25; 0,13; and 0.06 µg/ml

As shown in table 2, eurotin exhibits a strict antimicrobial activity against many strains ATCC.

Table 2

Antimicrobial activity of eurozine

EXAMPLE 6

Application of HMM files from the PFAM database to identify defensin

The sequence analysis using profile hidden Markov model (profile HMM) monoprotic or interactively via the Internet or locally on a computer using well-known, publicly available software package HMMER. The latest version is a HMMER 2.3.2, October 2003.

The profile HMM can be obtained from well known PFAM database. The latest version of PFAM is 16.0, November 2004. As HMMER and PFAM available for any standardized computer equipment, for example, from Washington University in St. Louis (USA), School of Medicine (http://pfam.wustl.edu and http://hmmer.wustl.edu).

If interest amino acid sequence, or a fragment, refers to the following five families PFAM, amino acid sequence represents defensin in accordance with the present invention:

- Defensible or "Beta defensin", registration number: PF00711;

- Dependingon or propeptide defensin", registration number: PF00879;

- Defensin or defensin mammals", registration number: PF00323;

- Defensin or defensin arthropods", registration number: PF01097;

- Gamma thionin or "the family of gamma mininov", registration number: PF00304.

Amino acid sequence belongs to the family PFAM, in accordance with the present invention, if it is the value of E is larger than 0.1, and the grade is greater than or equal to zero, using the PFAM database in interactive mode, or when the local use of the program hmmpfam (from a software package HMMER).

If the sequence analysis about the W ill result locally using the hmmpfam program, need to get (download) a profile HMM from a database PFAM. For each family there are two profile; xxxjs.hmm for General search and xxx_fs.hmm for local search ("xxx" is the name of the family). This leads to ten profiles for the five above-mentioned collections.

These ten profiles can be used separately or combine (add) in a single profile (using a text editor - profiles are ASCII files), which can be called, for example, defensin.hmm. Interest amino acid sequence can then be evaluated using the following command line:

hmmpfam-E 0,1 defensin.hmm sequence_file

where "sequence_file" is the file of interest amino acid sequence in any format understood by the software package HMMER.

If the score is greater than or equal to zero (0,0), and the value E is larger than 0.1, then the interest amino acid sequence is defensins in accordance with the present invention.

The PFAM database is additionally described in Bateman et al. (2004) The Pfam Protein Families Database", Nucleic acids Research, Vol. 32 (Database Issue), pp. D138-D141.

1. Polypeptide with antimicrobial activity, selected from the group consisting of
(a) a polypeptide containing the amino acid sequence that has at least 70%identity to amino acids 1-42 sequence SEQ ID NO:2;
(b) a polypeptide that is encoded by polynucleotides that hybridizes in conditions of high stringency to a nucleotide 145-270 sequence SEQ ID NO:1 or complementary to them by a chain.

2. The polypeptide according to claim 1, containing an amino acid sequence that has at least 80%identity to amino acids 1-42 sequence SEQ ID NO:2.

3. The polypeptide according to claim 2, containing an amino acid sequence that has at least 90%identity to amino acids 1-42 sequence SEQ ID NO:2.

4. The polypeptide according to claim 3, containing an amino acid sequence that has at least 95%identity to amino acids 1-42 sequence SEQ ID NO:2.

5. The polypeptide according to claim 4, containing the amino acid sequence of amino acids 1-42 sequence SEQ ID NO:2.

6. The polypeptide according to claim 5, which consists of amino acids 1-42 sequence SEQ ID NO:2.

7. Selected polynucleotide containing a nucleotide sequence that encodes a polypeptide according to any one of claims 1 to 6.

8. Selected Poliny eated according to claim 7, having at least one mutation in the sequence of SEQ ID NO:1 that encodes a Mature polypeptide, where the mutant nucleotide sequence encodes a polypeptide consisting of amino acids 1-42 sequence SEQ ID NO:2.

9. The design of nucleic acid containing polynucleotide according to claim 7, functionally associated with one or more regulatory sequences that regulate the production of expressing the polypeptide in the system of the host.

10. Recombinant expressing the vector containing the design nucleic acid of claim 9.

11. Recombinant cell host containing the design nucleic acid of claim 9.

12. The method of producing the polypeptide according to any one of claims 1 to 6, providing for (a) cultivating a cell, which is in the form of its wild-type capable of producing the polypeptide, under conditions conducive to the production of the polypeptide; and (b) isolation of the polypeptide.

13. The method of producing the polypeptide according to any one of claims 1 to 6, providing for (a) culturing the host cell containing the design of nucleic acid containing the nucleotide sequence encoding the polypeptide, under conditions conducive to the production of the polypeptide; and (b) isolation of the polypeptide.

14. The method of producing the polypeptide according to any one of claims 1 to 6, providing for (a) culturing cells Tran the gene of a plant or a transgenic plant containing polynucleotide that encodes a polypeptide having antimicrobial activity according to the invention under conditions conducive to protoperidinium polypeptide; and (b) isolation of the polypeptide.

15. The transgenic plant, plant part or plant cell expressing the polypeptide according to any one of claims 1 to 6, which transformed polynucleotide coding for the polypeptide according to any one of claims 1 to 6.

16. Method for killing or inhibiting growth of microbial cells, involving contacting the microbial cells with an antimicrobial polypeptide as defined in any one of claims 1 to 6.

17. Antimicrobial polypeptide according to any one of claims 1 to 6 for use as a drug, or antimicrobial veterinary drugs, or therapeutic or prophylactic agent for a person.

18. Antimicrobial polypeptide as defined in any one of claims 1 to 6, for use in the manufacture of veterinary medicinal product or a medicinal product for human for the treatment of microbial infections or for prophylactic use.

19. Antimicrobial polypeptide as defined in any one of claims 1 to 6, for use in animal feed.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: transformed soya bean seeds contain a nucleic acid sequence identical to a fragment of soya bean intron FAD2-1A and a nucleic acid identical to a fragment of soya bean FADB gene. Seeds of the transformed plant, as well as oil and flour obtained therefrom contain oleic acid in amount ranging from approximately 42 wt % to approximately 85 wt % of the total content of fatty acids. Content of saturated fatty acids is less than 8 wt % of the total amount of fatty acids.

EFFECT: higher fatty acid content.

28, 37 dwg, 26 tbl, 31 ex

FIELD: biotechnologies.

SUBSTANCE: agrobacterium-mediated transformation with application of meristematic cells of primary or higher leaf nodes as target tissue and further regeneration of whole plant from transformed cells provides for improved incorporation of DNA into genome of soya plant (Glycine max).

EFFECT: improved transformation of soya.

13 cl, 40 dwg, 11 tbl, 14 ex

FIELD: agriculture.

SUBSTANCE: method is described for improvement of crop capacity in plant parts that provide for crops versus according plants of wild type, including introduction of nucleic acid into plant, which codes cyclin-dependent kinase of D-type (CDKD), containing NXTALRE link, where X stands for any amino acid. Method is disclosed for production of transgenic plant with higher crop capacity, including introduction of CDKD coding nucleic acid into plant or vegetable cell, which contains NXTALRE link, where X stands for any amino acid, and cultivation of vegetable cells in conditions that promote regeneration and growth of mature plant.

EFFECT: invention makes it possible to improve crop capacity of plants.

14 cl, 3 dwg, 5 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: there is described a promoter region to control specific detection of transgenes in the plant epidermis. There is disclosed a recombinant molecule of nucleic acid which contains the described promoters is opened. There are presented transgene plants and plant cells that have been transformed by means of the disclosed molecule of nucleic acid. There is offered the method for producing the presented plants and cells.

EFFECT: invention allows producing pathogen resistant plants.

10 cl, 20 dwg, 8 ex

FIELD: biotechnologies.

SUBSTANCE: plants are transformed with application of nucleic-acid constructs, which contain the first nucleotide sequence that codes γ-sein, or its fragment, which is able to direct and retain protein in endoplasmic reticulum of plant cell, the second sequence of nucleic acid, which codes aminoacid sequence, which is specifically split by ferment or chemical compounds, and the third sequence of nucleic acid, which codes target peptide or protein.

EFFECT: transformation of plant by such constructs makes it possible to produce fused proteins accumulated in endoplasmic reticulum of cells in the form of protein bodies, from which target proteins may be extracted, in particular calcitonin.

47 cl, 19 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: plant is transformed with a genetic make-up that incorporates DNA sequence coding a receptor for systemic signal compound chosen from the group consisting of salicylic acid, jasmine acid and brassinosteroids. Preferentially, the receptor represents a RKS-receptor. The combinations of receptors and/or chimeric receptors also can be used.

EFFECT: improved resistance to pathogenic germs.

13 cl, 26 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: membrane pyrophosphatase gene of bacterium Rhodospirillum rubrum is introduced in a plant genome that enables synthesis of the related protein in plant cells. Particularly, there are designed transgene tobacco plants expressing a membrane H+ -pyrophosphatase gene from bacterium Rhodospirillum rubrum. As a result of transformation, when grown in vivo, the transgene plants exceed the reference length of root system and the reference weight of leaves. The average number of seed capsule of the transgene plants is more than in the reference, while the average amount and weight of seed material of the transgene plants is more as well. The chlorophyll content in leaves of the transgene plants exceeds that of the reference plants. The transgene plants considerably overtake the reference plants in growth.

EFFECT: plants with improved economic-valued indicators, such as accelerated growth, higher length and weight of the roots, increased weight of the leaves, improved biological efficiency and plant resistance to salinisation.

7 cl, 13 dwg, 6 tbl, 9 ex

FIELD: agriculture.

SUBSTANCE: in plant nucleic acid is introduced, which codes protein of cyclin A2, engaged to promoter, specific to seed genes. Produced plants have increase crop capacity both compared to according wild types of plants and relative to transgenic plants, which constitutively express cyclin A.

EFFECT: increased crop capacity of plant in optimal and suboptimal conditions.

19 cl, 4 dwg, 16 tbl, 4 ex

FIELD: agriculture.

SUBSTANCE: genetic modification of wheat in the form of mutation in gene SBEIIa with reduction of level of its activity.

EFFECT: grain with high content of amylose in its starch; wheat with reduced level of SBEIIb-activity with grain with non-wrinkled phenotype, with relatively high content of amylose.

62 cl, 28 dwg, 12 tbl, 16 ex

FIELD: genetic engineering.

SUBSTANCE: in a genetically transformed plant, activity of protein Rpi-blb2 is increased.

EFFECT: resistance of the plant to Oomycetes pathogens.

13 cl, 31 dwg, 8 tbl, 17 ex

FIELD: medicine.

SUBSTANCE: invention can be used in producing vaccines against Streptococcus agalactiae - a representative of streptococci group B (SGB) in diagnostics of the diseases - for creation of a detection system of immunoglobulin A level in biological fluids, in immunochemistry as accessible immunochemical reagents (affine recovered IgA fragments). Offered unique recombinant DNA are produced by polymerase chain reaction (PCR) with using chromosomal DNA of strain 219/4849 Ibc of serotype SGB and unique primers. One recombinant DNA contains three nucleotide substitutes in comparison with an initial site of chromosomal DNA. The following cloning of amplified fragments is carried out in a linear vector pGEM-T Easy, and at the final stage by the system of express ionic vectors pQE30/31/32 in E coli JM 109. The produced recombinant DNA code amino acid sequences of recombinant polypeptides exhibiting ability to connect selectively various molecular forms of IgA and designated as P6, P7, P8. Polypeptide P6 causes synthesis of long circulating high-affine anti-Rb antibodies possessing protective properties against SGB.

EFFECT: application of the invention provides production of recombinant polypeptides based N-terminal conservative part of surface Bac SGB of Ibc serotype and containing a first IgA-connecting site A with changed or native sequence MLKKIE, polypeptide exhibits immunologically relevant and protective properties, and they also high selectively connect IgA.

12 cl, 20 dwg, 4 tbl, 19 ex

Expressing system // 2385348

FIELD: medicine.

SUBSTANCE: invention concerns the method for making an immunogenic reagent which causes immune response on infection Bacillus anthracis, including one to several polypeptides which together represent three domains of a full-size protective antigen (PA) from B anthracis or their versions, and at least, one of specified domains contains domain 1 or domain 4 of the PA, or its version. Said polypeptides of specified immunogenic reagent, and the full-size PA are produced as a result of expression in a recombinant cell E.coli. The invention also discloses an expression vector and nucleic acid with percent of residual guanidine and cytosine more than 35%, coding immunigenic polypeptide which is said protective antigen (PA).

EFFECT: high-yield immunogenic polypeptide.

13 cl, 5 dwg, 3 tbl, 6 ex

FIELD: biotechnologies.

SUBSTANCE: invention is related to production of new hybrid polypeptide GST-CFP10 by microbiological synthesis with properties of species-specific protein-antigen CFP10 Mycobacterium tuberculosis, which may be used for early species-specific diagnostics of tuberculosis infection. Recombinant plasmid DNA pTB232 has been constructed, which codes hybrid polypeptide GST-CFP10 with properties of mycobacterial antigen CFP10, with average molecular weight (m.w.) 3.4 MDa and having size of 5257 p.n. Recombinant strain of bacteria E. coli BL21/pTB232 contains recombinant plasmid DNA pTB232, is producer of hybrid polypeptide GST-CFP 10 with properties of mycobacterial antigen CFP10 and is deposited in KM GNC VB "Vector" under number B-1027. Recombinant polypeptide GST-CFP10, produced with strain of bacteria E. coli BL21/pTB232, contains as protein-carrier N-end polypeptide fragment glutathione S-transferase S.j. (226 a.o. with m.w. of 26.3 kDa), joined via end site of thrombin hydrolysis (LVPRGS) with C-end polypeptide fragment of antigen CFP10 (100 a.o. with m.w. of 10.8 kDa) and has complete aminoacid sequence with length of 326 a.o. and m.w. of 37.1 kDa, given in text of description.

EFFECT: use of invention provides for the possibility to produce target highly pure hybrid polypeptide GST-CFP10 in preparative amounts with preservation of immunogenic properties of the latter.

3 cl, 4 dwg, 4 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention can be used in manufacturing of vaccines for Streptococcus pyogenes - streptococci of group A (SGA) and Streptococcus agalactiae - streptococci of group B (SGB). Substance of the invention involves development of recombinant DNA pB1 derived from PCR with using chromosomal DNA of strain 090R Ia of serotype SGB, primers Pb1 and Pb2 and following cloning with using expression plasmid pQE-30 in E coli M15. Recombinant DNA pB1 codes recombinant protein PB1 expressing protective properties in relation to specified streptococci which has no enzymatic activity and causes synthesis of anti-Pb1 antibodies expressing protective properties in relation to Streptococcus pyogenes and Streptococcus agalactiae. In the invention there is developed recombinant plasmid DNA pQE-pB1 representing plasmid DNA pQE-30 that bears recombinant DNA pB1, and strain-producer E. coli M15-PB1 enabling to express recombinant protein PB1.

EFFECT: no enzymatic activity of produced recombinant protein allows application as an ingredient of the vaccine for Streptococcus pyogenes and Streptococcus agalactiae.

7 cl, 7 dwg, 4 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention refers to genetic engineering and can be used in medicine. The mucosal vaccine contains effective amount of hybrid protein consisting of oncoprotein E7 of human papilloma virus fused with heat-shock protein of mycobacteria Hsp70, chitosan related to hybrid protein 1:0.1-10 and additives pharmaceutically acceptable manufacturing of suppositories. The mucosal vaccine is used in therapy of the diseases associated with human papilloma virus.

EFFECT: possibility for multiple improvement of clinical effectiveness of diseases associated with human papilloma virus, considerable reduction of treatment cost in comparison with common techniques of treating cervical carcinoma and "РПК"; elimination of injection by-effects undesirable and extremely dangerous for the patent's life, eg anaphylactic shock, owing to local application; simplification of medical process - the patient can receive medical treatment out of clinic by independent introduction of the preparation.

6 cl, 4 dwg, 2 tbl, 10 ex

FIELD: medicine.

SUBSTANCE: invention concerns protein NMB1870 which represents common surface protein Neisseria meningitidis expressed with all Neisseria serogroups. Protein is subdivided into three separate families. The whey induced against antigen of a certain family, has bactericidal effect within this family, but is inactive concerning strains expressing antigens of one of other two families, i.e. there is a cross protection within family, but not between families. It is established, that NMB1870 can be subdivided into domains and that antigen domains can be recovered from NMB1870 of all three families and expressed as a polypeptide chain that is implemented by the method disclosed in the invention. Also it is discovered that NMB1870 expresses some epitopes in surface loops located between alpha spirals, and that epitope substitution of the loop of one family with that of the other family enables making chimeric NMB1870 of antigenicity characteristic for proteins of several families. In the invention there are disclosed chimeric proteins NMB1870 (versions) partially containing NMB1870 of various families.

EFFECT: proteins produced according to the invention can be used as a medical agent as a component of immunological compositions for immunization against diseases caused by Neisseria meningitidis without family specificity of protection.

22 cl, 46 dwg

FIELD: medicine; microbiology.

SUBSTANCE: way is intended for reception of functionally active LF form, the basic toxic protein defining cellular disturbances, leading to death of an organism at infection with a malignant anthrax bacterium. For realisation of the way a recombinant plasmid pETHIS-LF (7816 items) is designed, containing a full-size gene of the lethal factor (LF) of malignant anthrax under the control of the promotor of bacteriophage T7 and to a determinant of ampicillin tolerance. The plasmide provides effective synthesis of LF protein of malignant anthrax merged with sequence of six Histidinums for clearing with the metal-chelate chromatography. The strain Escherichia coli BL-HISLF is designed using transformation of the specified plasmid DNA in the strain E.coli BL21 (DE3), synthesizing active LF protein. The target product is separated with the way including clearing on a metal-chelate sorbent with the subsequent additional clearing of the LF protein by gel-filtration.

EFFECT: reception of active recombinant protein LF on the simplified technology and with a high output of synthesised protein of the lethal factor.

3 cl, 3 dwg, 3 ex

FIELD: biology.

SUBSTANCE: designed is a new recombinant plasmid pETGST-LFmin (7704 nucleotide pairs), containing a catalytically active fragment of the gene of lethal factor anthrax (LF) controlled by a bacteriophage T7 promoter, determinant of resistance to ampicillin and a glutathione-S-transferase sequence for efficient purification of the recombinant protein on a sorbent with immobilised glutathione. The plasmid provided for efficient sythensis of the protein of LF anthrax, chimerised with a sequence of glutathione-S-transferase for purification on immobilised glutathione. Escherichia coli BL-LFminGST strain is obtained from transformation of the said plasmid DNA into a E.coli BL21 (DE3) strain, which provides for output of synthesised LF protein of not less than 90 mg/l g of raw biomass. The active LF protein is obtained using a method which involves culturing the said recombinant strain, destruction of bacterial cells in a buffer solution with pH 7.4 in the presence of Triton X-100 and a protease inhibitor, and purification on a sorbent with immobilised glutathione.

EFFECT: output of proteolytic active recombinant chimeric purified protein of LF anthrax in amount of not less than 70 mg/l g of raw biomass.

3 cl, 3 dwg, 3 ex

Neisseria antigens // 2347813

FIELD: chemistry; biochemistry.

SUBSTANCE: invented here are proteins of the meningococcus bacteria Neisseria meningitides (mainly strain B), with immunogenic properties. The proteins have defined amino acid sequences, presented in the description, and are coded with corresponding nucleotide sequences. Description is also given of an antibody, specific to the indicated meningococcus proteins. These proteins, coding their nucleotide sequences, as well as the specific antibody, can be used as an active ingredient in compositions for treating or preventing infection caused by Neisseria meningitides. The presented proteins can be used as antigens for making effective vaccines, immunogenic compositions.

EFFECT: obtaining proteins, used as ingredients for making effective vaccines, immunogenic compositions.

11 cl, 2 tbl, 104 ex

FIELD: medicine; biotechnologies.

SUBSTANCE: amino-acid sequences are presented in the list of the sequences obtained from a bacterium, mainly strains A and B which show properties of an antigene. The invention includes corresponding nucleotide sequences of fragments of the nucleinic acid, coding amino-acid sequences of the specified proteins. The proteins under the invention can be used as antigenes for obtaining of specific antibodies and manufacturing of compositions for treatment, preventive maintenance or diagnostics of the infection caused Neisseria meningitidis. The compositions are prepared on the basis of a protein, a fragment of nucleinic acid or an antibody with addition of the pharmaceutically comprehensible carrier and represent vaccinal, diagnostic or pharmaceutical compositions. Sequences of the obtained proteins have no any considerable homology with sequences Neisseria gonorrhoeae, that allows to receive treatment-and-prophylactic and diagnostic compositions with high specificity in relation to N. meningitidis and also to receive Diagnostic reagents for differentiation N. meningitidis from N. gonorrhoeae.

EFFECT: efficiency of application.

12 cl, 2 tbl, 17 ex

Up!