Strain of hybrid animal cells mus musculus l3f9 - producer of monoclonal antibodies suitable for use in "sandwitch" immunoenzymometric system format for detecting vp35 protein of marburg virus and 3f9 monoclonal antibodies produced by said strain of hybrid cells

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of Marburg haemorrhagic fever. A strain of hybrid animal cells Mus musculus L. 3F9 is formed, which is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR. The hybridoma strain produces monoclonal antibodies which are specific to the VP35 protein of the Marburg virus (Popp strain) (hereinafter MCA). MCA 3F9 produced by hybrid animal cells Mus musculus L. 3F9 relate to a subclass of immunoglobulins IgGI, having a heavy 55 kDa and a light 25 kDa chain and having a unique feature of detecting the VP35 protein of the Marburg virus (Popp strain) in a "sandwich" immunoenzymometric system format owing to antigen "capture" properties and simultaneously be an indicator, labeled biotin. The antigen epitope for MCA 3F9 produced by the 3F9 hybridoma is localised between 252 and 278 aminoacid residues.

EFFECT: invention enables to obtain MCA with specificity to VP35 protein of the Marburg virus (Popp strain), suitable for immunodiagnosis of Marburg haemorrhagic fever.

2 cl, 3 dwg, 1 tbl, 5 ex

 

The invention relates to biotechnology, in particular for medical Virology and immunology, may be used as an immunodiagnostic hemorrhagic fever Marburg (GLM). The Marburg virus (VM), together with the Ebola virus belongs to the family of filovirus that causes people hemorrhagic fever with high mortality rate among the patients, as demonstrated by epidemiological studies during the large outbreak in 2004-2005 in Angola [1, 2]. The natural reservoir and vectors are not known, an effective means of specific prophylaxis are not available. The potential of aerosol transmission is high and the risk is spread among human populations in different regions of the world are possible [3, 4, 5]. Attempts to obtain vaccines based on inactivated virus did not produce results [6]. Currently searching for approaches to create a vaccine vector based gene delivery filovirus proteins [7]. The polymerase cofactor - protein VP35 (structural protein of the virion is a necessary element of the processes of transcription and replication, in which he directly interacts with RNA - dependent RNA polymerase [8, 9]. For the build process complete nucleocapsid necessarily the presence of VP35 protein [10, 11]. Similar to protein of Ebola virus (VE) acts as an antagonist of interferon, that is capable of giving the best antiviral effect of IFN - system of the host [12, 13]. In the study of protective activity of VE proteins, it was shown that immunodeficient mice C57BL/6 survived only after prior immunization alphaviruses replacename bearing proteins VP40, VP30, VP24, and VP35. Mice BALB/c mice to protect against infection was enough for three proteins, without the participation of VP35 [14]. Protein filovirus VP35 is one of the three major components, accounting for 24.5% (VP40 - 37,7% NP - 17%, respectively) from the mass of the virion [15]. Protein VP35 causes the formation of antibodies, along with nucleoprotein (NP) and matrix protein VP40, in humans, ill SLM [16]. The VM appears in the blood of infected Guinea pigs and monkeys of Massa mulatta over 4 days from infection and can be detected by enzyme-linked immunosorbent assay (ELISA) [17]. The high VM content in the saliva and secretions of experimentally infected Guinea pigs [18]. Currently in Russia there are no commercially available ELISA test kits for rapid detection of antigen VM for control of imported animals for zoos and research purposes and the tourists who have arrived from Africa with symptoms similar in GLM. Preparations of purified monoclonal antibodies (MAB) can serve as the basis of such a system on their own or as a confirmatory test for PCR-diagnostics, which in Russia has not yet developed.

Known the HN collection murine hybridomas producing MCA VM (strain Musoke) [21] and VM (strain Popp) [22].

However, none of them has hybridomas producing µa to protein VP35. As described in the literature ELISA test systems in the format of "sandwich" [17, 22, 23, 24] to identify the VM system on the basis of the MCA to protein VP35.

The closest analogue (prototype) is a hybrid strain of animal cells Mus museums L. M1/N-10G9, producing over 30 study of passages in vitro of monoclonal antibodies to the structural protein GP Marburg virus, strain Popp related to the IgG isotype, suitable for cooking on their basis based assays for specific detection of Marburg virus using enzyme-linked immunosorbent assay (patent RF №2186107, IPC 12N 5/18, publ. 27.07.2002,).

However, produced the specified strain of hybrid cells monoclonal antibodies specific for surface protein, which is a glycoprotein GP with a molecular mass (MM) 125 kDa, which is contained in small quantities insufficient for high-quality diagnostics.

The technical result of the proposed technical solution is getting such a strain of hybrid cells Mus museums L. producing specific µa to protein VP35 VM (strain Popp) and MCA 3F9 obtained on the basis of the specified strain of hybrid cells, which would be a unique feature to identify protein VP35 VM in immunoassay system format is a "sandwich" with the ability to use both as "exciting" antigen, and as the "indicator", labeled with Biotin, which will increase the reliability of ELISA in the laboratory the VM and when designing test systems for the detection of antigens.

This technical result is achieved by creating a hybrid strain of animal cells Mus musculus L. 3F9, deposited in the Collection of cell cultures fsri SRC VB "Vector" of Rospotrebnadzor, which is the producer of monoclonal antibodies specific to the VP35 protein of Marburg virus (strain Popp).

This technical result is also achieved by the use of monoclonal antibodies 3F9, produced by a strain of hybrid animal cells Mus musculus L. 3F9-related subclass of immunoglobulin IgGl with severe 55 kDa and 25 kDa light chain and with a unique feature detection VP35 protein of Marburg virus (strain Popp) in ELISA format "sandwich" with the simultaneous use them as "exciting" antigen and as an "indicator", labeled with Biotin. Antigenic epitope for the MAB 3F9 produced by this strain is localized between 252 and 278 amino acid residues.

You can also use the ICA in immunofluorescence and enzyme immunoassay methods for the detection of VM in infected cells and tissues.

The strain produced by the fusion of mouse cells p3-X63/Ag8.653 (NS/1) mi is crowbars with cells spleens of BALB/c mice, immunized with purified, concentrated, inaktivirovannye drug VM obtained from plasma of infected Guinea pigs [19] and inaktivirovannye dimer etilenimina to 0.17%, as described [20].

The inventive strain of hybrid cells Mus museums L. SRC VB "Vector" - 3F9 received at the State research center of Virology and biotechnology "Vector" of Rospotrebnadzor, the Russian Federation and deposited in the Collection of cell cultures SRC VB "Vector". Author name hybridoma cell line-3F9.

The inventive strain of hybrid cells is part of the collection fsri SRC VB "Vector"consisting of 21 hybridoma cell lines which produce 5 µa to VP35 protein of Marburg virus (strain Popp).

Pedigree strain. The strain of hybrid cells obtained by fusion of mouse cells p3-X63/Ag8.653 (NS/1) myeloma cells spleens of BALB/c mice immunized with purified, concentrated, inaktivirovannye drug VM. As a melting agent used 45% solution of polyethylene glycol "Sigma" with a molecular weight of 1300-1600 kDa method [26]. Cells after fusion were grown in selective medium GAT in 96-well culture plates. As feeder cells used peritoneal macrophages outbred mice. Hybridoma, consistently producing specific MCA, cloned 3 times. The output position is positive clones in the last clone was 100%. The number of passages by the time deposits: 7-10 passages.

Marker signs and methods of their evaluation. Strain secretes a mouse immunoglobulin of the subclass IgGl (with heavy 55 kDa and 25 kDa light chain), specifically interacts with the protein VP35 VM (antigenic epitope between 252 and 278 amino acid residues). Analysis of mouse immunoglobulins performed by ELISA, using as antigen vaccine, VM (strain Popp) or recombinant protein VP35 (obtained by biosynthesis in E.coli cells on the basis of plasmid construction, including a full VP35 gene VM, as described [27] and antibodies against mouse IgG labeled with horseradish peroxidase.

Contamination by bacteria and fungi were not found.

Cultural properties. Media for cultivation of DMEM/F12 with glucamine, pyridoxine, Hepes (fsri SRC VB "Vector" of Rospotrebnadzor). The content of fetal serum, optimized for hybrid (HyClone, USA) in growth medium at 10%. Wednesday also add 80-160 μg/ml of gentamicin sulfate

The strain is monocline-suspension culture, in which up to 20% of the cell is in suspension, being attached to the surface of the cookware for cultivation. Cells from the surface of the culture dishes are removed with a solution of trypsin/versene=1/1 (volume/volume). Sowing dose of 200 thousand cells/ml, the Frequency of passage through 3-4 days. The proliferation index of not less than 5. Cultivation of hybrid in the body of the animal. Female BALB/c mice (vivarium GMCVB "Vector") previously injected intraperitoneally with 0.3-0.5 ml of piers (Sigma). After 2-4 weeks the animals are vaccinated intraperitoneally 10 million hybrid cells. Ascitic tumor is formed at 7-10 days. Hybridoma inoculated in 100% of cases. From one animal you can get 3-5 ml of ascitic fluid containing MAB.

The characteristic of a useful product. Typing monoclonal antibodies was performed by the method of solid-phase ELISA using monospecific mouse antibodies (Sigma, USA). MCA belong to the subclass IgGl, have a heavy 55 kDa and 25 kDa light chain. They specifically interact with native protein VP35 VM (32 kDa) and recombinant protein VP35 (38 kDa) in the reaction immunoblot. In ELISA titer µa in ascites is 1:656100. Stable products µa persists for at least 10 passages in vitro under continuous cultivation. One ml of ascitic fluid can be obtained 3-5 mg of purified µa.

Cryopreservation. Environment for freezing - environment DMEM(M) - 50%, fetal serum - 40%, dimethylsulfoxide - 10%. 1-1,5 ml of cell suspension is transferred into a plastic cryoprobes and placed in a Styrofoam container with a wall thickness of 1 see the Container make a pair of liquid nitrogen and after 18-24 hours of transfer tubes in fluid is th nitrogen. Defrosting is carried out, omitting the tubes in water with a temperature 37-41°C. the cells of the plant with the environment DMEM(M) and centrifuged at 1000 rpm Sediment resuspended in the growth medium and the cells are transferred into culture flasks at a concentration of 200-300 thousand per milliliter. Cell viability after thawing is 60-80% (according to the results of staining with 0.25% Trifanova blue). Each ampoule contains not less than 10 million/ml of cells.

The invention is illustrated graphic material presented on Fig.1-3. Figure 1 presents electrophoregram cleaned µa 3F9 and antigens, where:

1 - the drug is cleared µa 3F9 (1 ál), arrows indicate chains of immunoglobulins:

t - heavy chain (55 kDa); l - light chain (25 kDa);

2 - purified recombinant protein VP35 (10 μl);

3 - preparation of virus Marburg (10 μl), arrows indicate viral proteins;

4 - molecular weight protein markers.

Figure 2 presents the immunoblot µa 3F9 with native and recombinant proteins VP35 virus Marburg, where:

1 - preparation of virus Marburg (10 μl), the arrow labeled virus protein VP35;

2 - preparation of Ebola virus (negative control antigen);

3 - E.coli lysate. (negative control for recombinant protein);

4 - purified recombinant protein VP35 (10 µl) of the arrow;

all strips and outreach to consumers sprayed on imennyh µa 3F9 in a dilution of 1:500;

5 - molecular weight protein markers.

Figure 3 shows a graph of the titration of antigen Marburg virus and recombinant protein VP35 pair µa 3F9 and 3F9*where: initial concentration of the drug antigens SF 1 mg/ml, the first point of the reaction at a dilution of 1:400 corresponds to a concentration of 2500 ng/ml; 3F9* indicator MCA-labeled Biotin;

as a negative control was used exciting antigen µa S specific to the VP35 protein of Ebola virus [28]; the concentration of MCA to capture antigens - 10 µg/ml; the concentration of the indicator MCA labeled with Biotin - 1 µg/ml

The method of obtaining the claimed strain.

The strain of hybrid cells Mus musculus L. SRC VB "Vector" - 3F9 obtained as follows. Female BALB/c mice (vivarium SRC VB "Vector"), weighing 15-20 g, subjected to immunization scheme, which is listed in the following table.

To merge use a ratio of 3/1 splenic cells of mice and cells of mouse myeloma NS/1. The mixture of cells centrifuged, the supernatant carefully removed and the cells draught add 0.4 ml of a 45% solution of polyethylene glycol (PEG) with a molecular mass of 1300-1600.

Table
Scheme immunization
dayssolution for the svedeniya antigen antigen dose (μg/mouse)area injections
0full adjuvant's adjuvant10intraperitoneally
7incomplete adjuvant's adjuvant10intraperitoneally
11saline33intravenous
12saline45intravenous
14Hybridization(the fence spleen)

The mixture was centrifuged 15 min at 1000 Rev/min After 3 min pause layer PEG slowly diluted with 5 ml of versene, after which the precipitate resuspended. The cells are then again precipitated (10 min at 1000 rpm) and is dissolved in the growth medium. Cells are distributed in five 96-hole blade (Costar) in 100 μl into the hole. Selection of hybrid cells is carried out in the environment GAT, consisting of a nutrient medium, DMEM(M), which added 10% fetal serum to the s (Gipco), 0.1 mm gipoksantina, 0.04 mm thymidine and 0.01 mm aminopterin.

The selection of specific hybrids performed enzyme-linked immunosorbent assay (ELISA). In wells blade (Animepalm) as antigen absorb 100-200 ng purified VM. Place of nonspecific binding is saturated with 0.5% solution of casein (ICN). Then transferred into the wells, 100 μl of culture medium analyzed hybrid and incubated for 45 min at 37°C. After incubation, the wells are washed 3-5 times with physiological saline containing 0.05% tween-20 (Sigma). Later in the tablets make 100 ál individualo conjugate (rabbit immunoglobulins against mouse IgG, horseradish peroxidase) and incubated for 45 min at 37°C. the Tablets are washed and carry out the enzymatic reaction. The results of the analysis determined on spectrophotometer "Multiscan" (Finland) at a wavelength of 492 nm. The resulting hybrid strain twice clone method of limiting dilutions, translated in popular culture and frozen in liquid nitrogen. The following examples explore in detail the beneficial properties of the object of invention.

Example 1. Culturing the hybrid cells of the strain of Mus musculus L. SRC VB "Vector" - 3F9, producing µa to protein VP35 VM in animals, BALB/c mice.

Mice BALB/c (vivarium GMCVB "Vector"), weighing 20-22 g, not less than 10 days before inoculation of hybridoma cells injected intraperitoneally 0.3-0.5 ml of the Wharf. To livermere cells, located in the logarithmic growth phase, sterile centrifuged for 5-10 minutes at 1000 rpm in a centrifuge ARF-3. Adosados removed, and the residue cells suspension in a sterile solution of Earl or Hanks. Female BALB/c mice (vivarium GMCVB "Vector") weighing 20-22 g intraperitoneally injected every 1 ml of cell suspension, containing not less than 10 million hybridoma cells. After 7-10 days the animals are euthanized and under aseptic conditions from the abdominal cavity extract 3-5 ml of ascitic fluid. Cells from ascitic fluid is separated by centrifugation and used for further perelivania hybridoma, and the supernatant determine the titer of the MCA using enzyme immunoassay, as described above.

Example 2. The selection of the purified monoclonal antibodies produced by hybrid cultured cells of strain of Mus musculus L. SRC VB "Vector" - 3F9.

One volume of ascitic fluid containing MAB, diluted with 4 volumes of 0.6 M acetate buffer (0.04 M citric acid, 0.2 M sodium acetate), pH 4.0 and pH adjusted to 4.5 using a 0.1 N sodium hydroxide solution. To the diluted sample is added dropwise, with constant stirring, Caprylic acid at the rate of 25 µl per 1 ml and incubated overnight at +4°C. Then centrifuged 30 min at 8000 g, and the precipitate removed and adosados mixed with 10x phosphate-saline buffer (FSB) and set p 7, 4 solution of 1.0 N sodium hydroxide. Equal volume of a saturated solution of ammonium sulfate is added to this solution, shaken and incubated overnight at 4°C or 30 min at +20-25°C. Centrifuged 15 min at 5000 g. Adosados merge, and the residue is dissolved in FSB, a pH of 7.4. The remains of ammonium sulfate is removed by dialysis against 50 to 100 volumes of the FSB, a pH of 7.4. Electrophoresis of purified drug MCA was carried out according to the method described in [31] in a discontinuous buffer system using 12-15% polyacrylamide gel with 0.1% sodium dodecyl sulfate in Tris-glycine buffer. The separating gel contained 0, M Tris-HCl (pH 8, 8), 0,1% SDS, 10(15)% acrylamide, 1% N,N-methylenebisacrylamide. The drug µa (1 μl) was applied to the track in a volume of 30 μl buffer containing 0, M Tris-HCl (pH of 6.8), 2% SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.01% of bromophenol blue. Before applying a buffer containing MCA, warmed up 3 min. at 95°C. Electrophoresis was mode 10/see the color of the gel was performed using Kumasi G-250. The purified preparation µa 3F9 as electrophoregram shown in Fig 1.

Example 3. Determination by ELISA specific interaction MCA produced by hybrid cell strain of Mus musculus L. SRC VB "Vector" - 3F9 with Marburg virus or recombinant protein VP35.

ELISA was performed on polystyrene plates. The antigen in the working dilution (purified and inactivated VM or recombinat the first protein VP35) barbirolli the FSB, pH 7, 4 in the amount of 100 μl/well to the plates. Place nonspecific binding was saturated at 37°C for 45 minutes with 0.5% solution of casein in buffer TSB-twin (0.145 M sodium chloride, 20 mm Tris-HCl, 5 mm PMSF (Sigma), 0.1% of Tween-20 (Serva), pH of 7.4) and then incubated with purified µa 45 minutes at 37°C. Specific binding of the MAB to the antigen was identified antivirovym peroxidase labeled antibodies against mouse IgG. Next was added a Chromogen, a 0.1% O-phenylenediamine in citrate-phosphate buffer (0.2 M citric acid, 0.5 M Na2NRA3, pH 5.0) from 0.03% hydrogen peroxide). Stopped the reaction by adding 100 µl per well of 1 N Hcl and measured the optical density of samples on a spectrophotometer "Multiscan" using a filter with a maximum transmission 492 nm. As negative and positive control used homologous normal (non-immune) and hyperimmune serum, respectively.

Example 4. Identifying the immunoblot interaction MCA produced by hybrid cell strain of Mus musculus L. SRC VB "Vector" - 3F9 with protein VP35 VM (strain Popp) and recombinant protein VP35.

Viral proteins and recombinant protein VP35 after 12% SDS page electrophoresis were transferred to nitrocellulose membrane (Millipore, USA). Place nonspecific binding was saturated with 0.5% solution of casein in buffer TSB-twin (0,145 M sodium chloride, 20 mm Tris-Hcl, 5 mM PMSF (Sigma), 0.1% Tween-20 (Serva), the N-of 7.4) at 37°C for 2 hours. Then the individual strips of the membrane were incubated with purified µa 4 hours at 20-22°C. Specific binding of antibodies that interact with viral proteins were revealed using conjugate antivitamin antibodies against mouse IgG labeled with horseradish peroxidase. As a negative control used strips of the membrane with transferred after electrophoresis inaktivirovannye Ebola virus [28] and E.coli lysate., also processed µa 3F9. The results are presented in Fig 2.

Example 5. Preparation of conjugates of antibodies with Biotin.

For biotinidase monoclonal immunoglobulins used the following method: prepare a fresh solution NSB(N-hydroxysuccinimidobiotin)was dissolved 2 mg of Biotin in 0.5 ml DMSO and made up to 2 ml were Then prepared solution treated µa (0.1 m NaHCO3pH of 9.0) at a concentration of 1 mg/ml Solution NSB drip was added to a solution of MCA in a volume ratio of 1/1, and incubated at room temperature for 4 hours. Then brought the volume of solution to 1 ml of 0,05M phosphate buffer (PBS) pH 7, 0, containing 0,15M sodium chloride and 0.1% sodium azide. Were dialyzed against phosphate buffer. The process of inclusion of Biotin in immunoglobulins was controlled by titration of labeled MCA on the antigen immobilized on plastic, with peroxidase conjugate with streptavidin.

Example 6. Competitive ELISA format "se who Dich" for the detection of native protein VP35 VM (strain Popp) and recombinant protein VP35. In the wells vysokozolnyh polystyrene plates ('Testiks" or "Nunc") barbirolli peeled µa 3F9 in 0.5 M carbonate buffer (pH 9,0) in a volume of 100 μl in working concentration (10 μg/ml) at 22°C for 12 hours Designated for non-specific binding of antibodies on tablets fed a 0.5% solution of casein and kept at 37°C for 30 minutes. Titration of antigen was performed with a dilution of 1:400 double step over night at 4°C or at 37°C for one hour. Then in the wells of tablets was made by conjugates µa 3F9 with Biotin in the working dilutions (1 μg/ml), kept at 37°C for one hour and, after 3 times washing of the wells, was made conjugate with streptavidin peroxidase. Specific binding of the antibody labeled with Biotin, with conjugate was detected liquid substrate system TMB (3,3', 5,5' -Tetramethylbenzidine, Sigma) at 10 μl per well. Stood tablets 30 min in the dark, stopped the reaction by adding 100 µl per well of 1N hydrochloric acid and measured the optical density of samples on a spectrophotometer scanreceiver" at a wavelength of 450 nm. Positive thought of the measurement results OP in well in excess of 2 times that of the wells with negative control. For negative control of antibody binding to the antigen used as "exciting" antigen µa S specific to the protein of the virus VP35 of Ebol is [27]. The graph of the titration of antigens presented on figure 3.

The above properties of the strain of hybrid cells Mus musculus L. SRC VB "Vector" - 3F9 (author's name cell lines 3F9) allow to conclude that for the first time on the basis of mouse myeloma received hybridoma Mus musculus L. SRC VB "Vector" - 3F9 - producer µa to VP35 protein of Marburg virus. The strain of hybrid cells provides receiving murine monoclonal immunoglobulin IgGl in the amount of 3-5 mg of purified antibodies from ml of ascitic fluid. Peeled µa specific reacted in ELISA with Marburg virus and recombinant protein VP35 (titer MCA was 1:656100 and 1:1822500, respectively), were detected in the immunoblot virus-associated protein VP35 and recombinant protein VP35 (obtained by biosynthesis in E.coli cells on the basis of plasmid construction, including a full VP35 gene ow). Antigenic epitope for the MAB 3F9 produced by this strain is localized between 252 and 278 amino acid residues. The use of MCA 3F9 in ELISA format "sandwich" at the same time as "exciting" antigen and as an "indicator", labeled with Biotin, helps to identify native and recombinant proteins with sensitivity of less than 1 ng/ml the Use of these drugs MCA and recombinant protein VP35 as a positive control antigen effectively to identify with acai GLM in Russia in the format of ELISA "sandwich".

The above properties of the strain of Mus musculus L. SRC VB "Vector" - 3F9 (author's name cell lines 3F9) distinguish it from all previously described hybridomas producing µa to proteins VM.

Sources of information

1. WHO report, 7 November 2005. The largest and deadliest outbreak of Marburg haemorrhagic fever on record.

2. Towner JS, Khristova ML, Sealy TK, Vinscent MJ, Erickson BR, Bawiec DA, Hartman AL, Comer JA, Zaki SR, Stroner U, Gomes da Silva F, del Castillo, Rollin PE, Ksiazek, TG, Nichol ST. / Marburgvirus genomics and association with a large hemorrhagic fever outbreak in Angola. J Virol 2006. 80(13):6497-516.

3. Bast M., Sergeev A.N., Pyankova OG, p'yankov O.V., Petrishenko VA Kotlyarov L.A. Clinical and virological characteristics of diseases of Guinea pigs, airborne-infected with Marburg virus./ The journal "problems of Virology, No. 3, 1995. Volume 40, p.119-121.

4. Bast M., Sergeev A.N., The p'yankov O.V., Pyankova OG, Petrishenko VA Kotlyarov L.A. / Some pathogenetic characteristics of the disease of monkeys, airborne-infected with Marburg virus./ The journal "problems of Virology, No. 4, 1995. S-161.

5. Belanov E.F., Montanov VP, Hook E, Sokolov A.V., Bormotov NI, p'yankov O.V. Sergeev, A.N. Save the infectivity of the virus Marburg on contaminated surfaces and aerosol. / Journal "problems of Virology", 1996, No. 1. P.32-34.

6. Ignatyev GM, Agafonov AR, Streltsova NA, Kashentseva EA. / Inactivated Marburg virus elicits a nonprotective immune response in Rhesus monkeys. / J of Biotechnology 44. 1996. p.111-118.

7. Swenson D, Wang D, Luo M, Warfield KL, Woraratanadharm J, Holman DH, Dong JY, Pratt WD. / Complee protection of nonhuman primates against multistrain Ebola and Marburg virus infections. // Clin Vaccine Immunol. 2008. 15(3):460-7.

8. Muhlberger E, Lotfering B, Klenk HD, Becker S. / Three of the four nucleocapsid proteins of Marburg virus NP, VP35, and L, are sufficient to mediate replication and reduced of Marburg virus-specific monocistronic minigenomes. / J Virol. 1998. 72(11):8756-64.

9. Moller P, Pariente N, Klenk HD, Becker S. / Homo-oligomerization of Marburg VP35 is essential for its function in replication and reduced. / J Virol 2005. 79(23): 14876-86.

10. Becker S, Rinne C, Hofsass U, Klenk HD, E. Muhlberger / Interections of Marburg virus nucleocapsid proteins. / Virology 1998. 249:406-417.

11. DiCarlo A, Moller P, Lander A, Kolesnikova, Becker S. / Nucleocapsid formation and RNA synthesis of Marburg virus is dependent on two coiled coil motifs in the nucleoprotein. / Virol 2007. 24;4:105.

12. Basler CF, Mikilasova A, Martinez-Sobrido L, Paragas J, Muhlberger E, Bray M, Klenk HD, Palese P, Garcia-Sastre A. / The Ebola virus VP35 protein inhibits activation of interferon regulatory factor 3. / J Virol. 2003 Jul; 77(14):7945-56.

13. Bray M. / The role of The Type I interferon response in the resistence of mice to filovirus infection. / Gen Virol 2001. 82(6):1365-73.

14. Wilson JA, Bray M, Bakken R, Hart MK. / Vaccine potential of Ebola virus VP24, VP30, VP35 and VP40 proteins. / J Virology 2001. 286(2):384-390.

15. Elliott LH, Kiley MP, McCormick JB. / Descriptive analysis of Ebola virus protein. / Virology 1985. 147, pp.l69-176.

16. Becker S, Feldmann H, Will C, Slenczka W. / Evidence for occurrence of filovirus antibodies in humans and monkeys imported: do subclinical filovirus infections occur worldwide? / J Environ Med Immunol (1992);181:43-55.

17. Kisimov H.B., M. Bast, Black NB, Belanov E.F. / Using enzyme-linked immunosorbent assay (ELISA) for the detection of virus antigen Marburg./ Interagency conference April 7-8, 1993 "the Study and prevention of especially dangerous viral infections. Koltsovo.

18. Chepurnova T.S., Pisanko, VA, Bakulina L. F., Zhukov V.A., town Chepurnov A. A. / Identified the e content of Marburg virus in the blood and secretions experimentally infected animals. / Virology N2. 2000, p.18-20.

19. Boukreev A.A., Skripchenko A.A., Gusev, Y.M., Frolov VG, Kondrashin E.V., krasnicka IM, Shestopalov A.M. / Promising method preparative developments and treatment of Marburg virus./ The journal "problems of Virology, No. 4, 1995. S-165.

20. Mitchel SW, McCormick JB. Phisicochemical inactivation of Lassa, Ebola and Marburg viruses and effect on clinical laboratory analyses. / J Clin Environ 1984. 20(3), pp.486-489.

21. Hevey M, Negley D, Geisbert J, Jahrling P, Schmaljohn A. / Antigenicity and vaccine potential of Marburg virus glycoprotein expressed by baculovirus recombinants. / Virology 239. 1997, pp.206-216.

22. The restaurant take-out bag S.V., Lebedev B.H., Pashchenko SCI, Borisevich, GV, Semenova I.S., Khamitov R.A., Maksimov V.A., Firsova IV, A.V. Petrovsky / Receipt and study of hybridomas producing monoclonal antibodies to the structural glycoprotein of Marburg virus./ The journal "problems of Virology, No. 6, 2001. P.21-24.

23. O Lord A.S., town Chepurnov A. A., Bystrov, S., Lemeshko N.N., Lukashevich I.S. / Detection of virus antigen Marburg method enzyme-linked immunosorbent assay. / Journal "problems of Virology, No. 5, 1991. S-421.

24. Saijo M, Georges-Courbor MC, Fukushi S, Mizutani T, Philippe M, Georges AJ, Kurane I, Morikawa S. / Marburgvirus nucleoprotein-capture enzyme-linked immunosorbent assay using monoclonal antibodies to recombinant nucleoprotein: detection of autothentic Marburgvirus. / J Infect. Dis, 2006. 59, pp.323-325.

25. Getter ML, Margulies DH, ScharfFMD. A simple method for polyethylene glycol promoted hybridization of mouse myeloma cells. /Somat Cell Genet 1977. V3, pp.231-236.

26. Aviolin, Ehitusaasta, Avicci, Avianova, Aye, Iherusalem. / Compare is inoe study of the antigenic and immunogenic properties of natural and recombinant proteins VP35 virus Marburg./ Questions Virology. N5. 1999, s-213.

27. Kazachinsko H., Interruption of AV, the town Chepurnov A. A., Belanov E.F., Razumov, IA Monoclonal antibodies to Ebola virus: fabrication, characterization and study of cross-reactivity with Marburg virus./ Questions Virology. N3. 2000, p.40-44.

28. The town Chepurnov A. A., Merzlikin N., Ryabchikova E.I., Chepurnova T.S., Volchkov VE, Istomin, N., Kuzmin V.A., Vorobyov MS/ Obtaining purified Ebola virus. // Journal "problems of Virology". No. 6, 1994. S-257.

29. Osterman AA / research Methods proteins and nucleic acids. Electrophoresis and ultracentrifugation. //Moscow, 1981. Pp.37-64.

1. The hybrid strain of animal cells Mus musculus L. 3F9, deposited in the Collection of cell cultures fsri SRC VB "Vector" of Rospotrebnadzor, which is the producer of monoclonal antibodies specific to the VP35 protein of Marburg virus (strain Popp).

2. Monoclonal antibodies 3F9, produced by a strain of hybrid animal cells Mus musculus L. 3F9 related to the subclass IgGI immunoglobulin having heavy 55 kDa and 25 kDa light chain and with a unique feature detection VP35 protein of Marburg virus (strain Popp) in ELISA format "sandwich" with the simultaneous use them as "exciting" antigen and as an "indicator", labeled with Biotin.



 

Same patents:

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of human cytomegalovirus. The strain of hybrid animal cells Mus musculus L.5F10 is obtained by merging mouse myeloma cells p3-X63/Ag8.653 (NS/1) with mouse spleen cells BALBc, immunised by an affinity purified recombinant protein pp65. The hybridoma strain is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR and is used as a producer of monoclonal antibodies for detecting the pp65 protein of human cytomegalovirus.

EFFECT: invention enables to widening of range of strains of hybrid cells Mus musculus L - producers of MCA for detecting the pp65 protein of human cytomegalovirus and production of domestic diagnostic test-systems for detecting cytomegaly.

2 dwg, 1 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention belongs to medicine, notably to laboratory method of diagnostics. Principle of the method is isolation and identification of pathogenic and opportunistic microorganisms from biopsic material of common bile duct and assessment of antilysozim activity of isolated microorganisms. Antilysozim activity index 5.5±0.5 mcg/ml confirms acute purulent cholangitis diagnosis, 3.7±0.6 mcg/ml characterises acute recurrent purulent cholangitis, while index 1.1±0.4 mcg/ml supposes chronic purulent cholangitis.

EFFECT: method allows differential diagnostics of purulent cholangitis.

2 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: method of determining sensitivity of horses to antigens of microorganisms of various taxonomic keys, which includes carrying out reaction of leukocytolysis with blood leucocytes using antigen, calculation of leukocytes in Goryaev's chamber before and after incubation and further determination of organism sensitivity by leukocytolysis index, different in the fact that in setting of reaction, first, solution of acidin-pepsin is introduced into samples, calculation of leukocytes before incubation is carried out only in control sample, and leukocytolysis index (LCI) is determined after incubation of experimental and control samples with further deduction of percent of spontaneous leukocytolysis (SLC) in control sample and is final value of LCI (3) is to 20%, organism sensitivity is considered to be low, 20-40% - medium, 40% and higher -high.

EFFECT: increase of determination accuracy.

5 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention aims at treatment, diagnostics or prevention of parasitic disease. There is used combination histone proteins H2A, H2B, H3 and H4 recovered from Leishmania infantum for making a pharmaceutical composition and a diagnostic aid. It involves applying a vector containing nucleotides coding specified histones.

EFFECT: invention allows treating and preventing the parasitic disease caused by one type with using histones originated from the other type.

13 cl, 4 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: to detect or chrysanthemum virus B in plants, a diagnostic set containing polyclonal antibodies to protein of Chrysanthemum virus B shell, a conjugate marked with alkaline phosphatase, a fixing buffer; an extraction buffer, ECI-buffer and PNP-buffer is used. Protein of viral shell is produced by amplification of the purified gene of said protein with using a nonsynonymous primer ATGCCTCCCAAACCGGCACCAGGTGAT and synonymous primer TTTATAATGTCTTATTATTCGCAT.

EFFECT: improved antiviral action of the compound.

15 cl, 2 ex

FIELD: medicine.

SUBSTANCE: there is used for diagnostics of transient and persistent latent papilloma virus infection. The diagnostic technique for papilloma virus infection is ensured by history taking and integrated clinical-laboratory examination. As anamnestic signs, there are assumed compromised oncologic characteristics inheritance, early sexual life, age younger than 20 years old and promiscuity; as clinical - anogenital warts, erosion and ectopic neck of uterus, contact hemorrhagic diathesis, Ovuli nabotti, inflammatory diseases of small pelvis organs and intrauterine spiral. Herewith the laboratory signs are sexually transmitted diseases, mixtinfection, deficient lactic acid bacilli, vaginal disbiosis caused by conditional-pathogenic flora, bacterial vaginosis, virus-virus associations, urogenital herpes, urogenital mycoplasma infection, urogenital ureaplasma infection, urogenital candidiasis, urogenital Chlamidia infection and infection with various genotypes of human papilloma virus. Each sign is scored, and depending the number of points, persistent or transient clinical course of papilloma virus infections, or follow-up examination is performed.

EFFECT: determining tactics of the following management of the patient, forming group of potential risk for development of focal dysontogenetic and malignant transformations of urogenital epithelium.

1 dwg, 2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, particularly to laboratory examinations and can be used in selection of therapeutic approach to tonsillitis. The method involves microbiological study of tonsil lacunae contents. It involves detection of microorganism types and concentration. And if the association shows one or more microorganisms which are not normal tonsil lacuna inhabitants in concentration ≥105 CFU/ml, photodynamic therapy is predicted to be inefficient. The fact that test object is microflora enables to determine an etiological agent, as well as degree of activity of inflammatory process whereat photodynamic therapy aims.

EFFECT: method allows determining objective indications for photodynamic therapy in chronic tonsillitis that ensures more effective treatment of the patients.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine and can be used for express-estimation of severity of state of patient with burn disease. Laboratory analysis is carried out, degree of natural colonisation of buccal epithelium cells with bacteria Streptococcus salivarius, average number of bacteria Streptococcus salivarius adhesed on one buccal epithelium cell - index of natural colonisation of buccal epithelim cells (INCBEC), and if INCBEC value is greater than 10, conclusion about light degree of severity of patient's with burn disease state is made, of INCBEC value is from 5 to 10 - about medium degree of severity of patient's with burn disease state is made, and if INCBEC value is lower than 5 - about severe degree of severity of patient's with burn disease state.

EFFECT: method is simple in realisation, takes little time, non-traumatic, eliminates risk of infection.

3 ex

FIELD: chemistry.

SUBSTANCE: description is given of polyaniline in form of an emaraldine base of formula [(-C6 H4-NH)2-(NH=C6·H4=NH-)]n n=20 to 10000 or interpolymer of a complex of polyaniline with poly-(2-acrylamido-2-methyl-1-propane-sulphonic acid), i.e. salt of emaraldine with poly-2-acryloamido-2-methyl-1-propane sulphonic acid of formula , n=50 to 50000 as a sorbent for removing viruses, non-viral proteins and for making an immunoasorbent based on said sorbent for isolating antiviral antibodies.

EFFECT: following methods are also described: method of removing viruses through immobilisation on a sorbent; immunoadsorption method; method of sorption of non-viral proteins from complex mixtures using sorbent.

20 cl, 2 ex, 4 tbl, 2 dwg

FIELD: veterinary.

SUBSTANCE: claimed is test-system of immuno-enzyme analysis, which allows to determine antibodies to viruses of infectious rhinotracheitis (IRT), viral diarrhea-disease of mucous membranes (VD-DMM), parainfluenza viruses -3 (PIV-3), respiratory syncytial (RS) and adenoviral (AVI) infections of livestock. Serological examination of animals allows to detect zones of infection spreading and estimate post-vaccination immunity.

EFFECT: application of claimed test-system IEA will allow to carry out simultaneously epizootological monitoring of five important infections of livestock, retrospective diagnostics of respiratory infections, and estimation of immunity stress in animals resulting from application of vaccines, determination of level of colostral antibodies in young animals in the first weeks or days of life, estimation of therapeutic medicine quality.

10 tbl

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of human cytomegalovirus. The strain of hybrid animal cells Mus musculus L.5F10 is obtained by merging mouse myeloma cells p3-X63/Ag8.653 (NS/1) with mouse spleen cells BALBc, immunised by an affinity purified recombinant protein pp65. The hybridoma strain is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR and is used as a producer of monoclonal antibodies for detecting the pp65 protein of human cytomegalovirus.

EFFECT: invention enables to widening of range of strains of hybrid cells Mus musculus L - producers of MCA for detecting the pp65 protein of human cytomegalovirus and production of domestic diagnostic test-systems for detecting cytomegaly.

2 dwg, 1 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to humanised anti-TGF-beta-antibody which is linked to TGF-beta. The humanised antibody has a variable domain VH which contains residues of the hypervariable region (non-human), which are contained in the human domain VH which includes a modified framework region (FR) (amino acid and nucleotide sequences are given in the list of sequences). The humanised antibody can contain residues of the complementarity determining region (CDR) of the variable domain of the light strand VL. The invention also relates to a composition for treating TGF-beta mediated disorders, e.g. malignant tumours, nucleic acid, coding monoclonal antibody, and a method of obtaining the latter using host cells. The invention provides a method of treating and detecting TGF-beta in a sample from the body using the disclosed antibody, as well as to a product which contains the humanised antibody and directions for use for treating TGF-beta mediated disorders.

EFFECT: invention enables control of TGF-beta molecules, which can prevent possible changes in antibodies, enables preparation of high-affinity humanised antibodies which act as TGF-beta antagonists.

57 cl, 45 dwg, 4 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention aims at preparation of new strain of hybrid cells Mus. Musculus 6F3 - a producer of monoclonal antibody (MCA) to hemagglutinin protein of high-pathogen avian influenza virus A/duck/Novosibirsk/56/05. Strain 6F3 is prepared by fusing murine myeloma cells Sp2/0 with murine spleen cells BALB/c, immunised with a purified and inactivated preparation of avian influenza virus A/H5N1 (strain A/duck/Novosibirsk/56/05). Hybridoma produced MCA belong to IgA class. Strain 6F3 is deposited in the Collection of cell culture of Ivanovsky State Research Institution of Virology of the Russian Academy of Medical Sciences, No. 8/2/3. Using hybridoma allows producing specific monoclonal antibodies to hemagglutinin protein of avian influenza virus A/H5N1.

EFFECT: possibility to use antibodies to studying the antigenic structure of hemagglutinin for differential diagnostics of avian influenza virus A/H5 serotype.

1 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: invention can be used for production of monoclonal antibodies (MCAs) to heat shock protein 70 (HSP 70). A hybridoma strain is made by immunisation of BALB/c mice with bovine HSP 70 within 78 days. For the third days, splenocytes of immune mice (108 cells) are hybridised with murine myeloma cells P3-X63 Ag/8-653 (107 cells). A fusion agent is polyethylene glycol of molecular weight 4000 (Merk, Germany). The hybridisation is followed with selection, screening, cloning and cryopreservation of hybridoma. Hybridoma 6G2 is deposited in the microorganism collections of "ГНТТ ПМБ" under No. H-2. MCA.

EFFECT: produced hybridoma under the invention is more evident to be detected as HSP 70 on the cell surfaces, and change of endocellular HSP 70 level when exposed to the stress factors.

4 dwg, 1 tbl, 6 ex

FIELD: pharmacology.

SUBSTANCE: invention can be used to identify a pseudotuberculosis agent in bacterial cultures, a biological material and environmental objects by applying the indirect hemagglutination test. Substance of the invention consists in development of a new diagnosticum that represents formalinised sheep's erythrocytes sensitised with monoclonal antibodies to lipopolysaccharide antigen of cold version Yersinia pseudotuberculosis serotype I (strain 164/84 serovariant I) and frozen-dried in a protective medium. Shelf life of the preparation is 2 years.

EFFECT: diagnosticum provides high sensitivity, specificity to the UHAT in detecting Yersinia pseudotuberculosis serotype I.

FIELD: veterinary.

SUBSTANCE: strain 5A10 of hybridomal line of cells of mouse Mus. museums, producing monoclonal antibodies to immunoglobulin IgG of cattle (C) is permanent line of cells and is suitable for biotechnology in elaboration of preparations. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 71. Antibody titers in native culture liquid constitute 1:32-1:64, in ascitic liquid 1:640-1:5120 in immuno-enzymatic analysys. Monoclonal antibodiesproduced by strain are specific to immunoglobulin IgG of cattle and do not react with immunoglobulins of sheep. Peroxydase-marked monoclonal antibodies ensure high sensitivity and specificity of IEA for detection of antibodies to C leucosis virus in biological material. Strain 5A10 - producent of monoclonal antibodies to immunoglobulin IgG of cattle can be used in production of immuno-enzymatic test-system for diagnostics of C leucosis.

EFFECT: application of said test-system will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms.

5 ex

FIELD: veterinary.

SUBSTANCE: obtained is strain 1H8 of hybridomal line of cells of mouse Mus. musculus - producent of monoclonal antibodies to IgG of sheep, suitable for biotechnology in elaboration of diagnostic preparations. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 73. When determined by method of immuno-enzymatic analysys (IEA) antibodies titers in native culture liquid constituted in IEA 1:32-1:64, in ascitic liquid 1:640-1:5120. Monoclonal antibodies are specific to immunoglobulin IgG of sheep and do not react with immunoglobulin of cattle. When used for fixation on solid phase of glycoproteidal antigen of cattle (C) leucosis virus (in composition of complex glycoproteidal antigen- monoclonal antibodies of sheep to glycoproteidal antigen) in IEA, they ensure strength of fixation and optimal availability of antigen for antibodies in testes samples.

EFFECT: strain 1H8 can be used in production of immuno-enzymatic test-system for diagnostics of C leucosis, which will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms.

1 tbl, 4 ex

FIELD: veterinary.

SUBSTANCE: obtained is strain 8C12 of inter-species hybrid cells of mouse Mus musculus and sheep Ovis aries - producent of monoclonal antibodies of sheep to glycoproteidal antigen of virus of cattle (C) leucosis. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 72. Strain is permanent hybrid line of cells and possesses high level of production of monoclonal antibodies of sheep. Antibody titers in native culture liquid constitute 1:32-1:64 in immuno-enzymatic analysys (IEA). Monoclonal antibodies are specific to general antigen determinant of glycoproteids of C leucosis - external gp51 and transmembranous gp30. When used in IEA for detection of antibodies in blood serum and milk of C infected with leucosis virus, antibodies provide strong selective binding with solid-phase carrier and optimal space orientation of glycoproteidal antigen.

EFFECT: strain 8C12 can be used in production of immuno-enzymatic test-system for diagnostics of cattle leucosis, which will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms and, as a result, reduce incidence of leucosis in cattle.

1 tbl, 4 ex

FIELD: pharmacology.

SUBSTANCE: present invention refers to immunology and biotechnology. There are antibody-antagonist to CD40 with their variable areas derived from an antibody produced of hybridoma 4D11 (FERM BP-7758). The constant areas of antibodies are derived from human IgG4 with mutations S228P and L235E. There are described related coding polynucleotides and the based expression vector. There is disclosed host-cell containing said vector. There is described method for preparing monoclonal antibody and application thereof in the pharmaceutical composition.

EFFECT: application of the invention provides reduced ADCC and CDC activity that can find application in therapy of autoimmune diseases and graft rejection.

10 cl, 26 dwg, 2 tbl, 22 ex

FIELD: medicine.

SUBSTANCE: method is suggested for production of antibody for binding to NK-cells, which crossly interacts with products of gene KIR2DL1 and KIR2DL2/3 and neutralises inhibitor activity of such KIR. Mentioned method includes selection of such antibodies that crossly interact at least with products of gene KIR2DL1 and KIR2DL2/3, are able to restore lysis with NK cells Cw3+ or Cw4+ target cells and are bound with NK cells or polypeptide of KIR primate. Antibodies produced by this method are described, as well as their derivatives, where antibody is linked with toxin, radionuclide, recognisable aggregation, solid carrier or polyethylene glycol.

EFFECT: invention provides for preparation of single type of antibodies, which controls activity of NK cells of various type, provides for amplification of their cytotoxicity, which may find application in therapy, for increase of activity or cytotoxicity of NK cells in individuals without preliminary detection of HLA type in individual.

7 cl, 13 dwg, 4 tbl, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of human cytomegalovirus. The strain of hybrid animal cells Mus musculus L.5F10 is obtained by merging mouse myeloma cells p3-X63/Ag8.653 (NS/1) with mouse spleen cells BALBc, immunised by an affinity purified recombinant protein pp65. The hybridoma strain is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR and is used as a producer of monoclonal antibodies for detecting the pp65 protein of human cytomegalovirus.

EFFECT: invention enables to widening of range of strains of hybrid cells Mus musculus L - producers of MCA for detecting the pp65 protein of human cytomegalovirus and production of domestic diagnostic test-systems for detecting cytomegaly.

2 dwg, 1 tbl, 5 ex

Up!