Strain of hybrid animal cells mus musculus l5f10-producer of monoclonal antibodies used for detecting pp65 protein of human cytomegalovirus

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and can be used in immunodiagnosis of human cytomegalovirus. The strain of hybrid animal cells Mus musculus L.5F10 is obtained by merging mouse myeloma cells p3-X63/Ag8.653 (NS/1) with mouse spleen cells BALBc, immunised by an affinity purified recombinant protein pp65. The hybridoma strain is deposited in the collection of cell cultures of The State Research Center of Virology and Biotechnology VECTOR and is used as a producer of monoclonal antibodies for detecting the pp65 protein of human cytomegalovirus.

EFFECT: invention enables to widening of range of strains of hybrid cells Mus musculus L - producers of MCA for detecting the pp65 protein of human cytomegalovirus and production of domestic diagnostic test-systems for detecting cytomegaly.

2 dwg, 1 tbl, 5 ex

 

The invention relates to biotechnology, in particular for medical Virology and immunology, may be used for an immunoassay of human cytomegalovirus (CMV).

Cytomegalovirus - a widespread disease. The vast majority of infections are asymptomatic. Active infection can occur in pregnant women and newborns, and people with immune defects in patients with AIDS and in immunosuppressive patients after organ transplantation. Gateway cytomegalovirus infection (current cytomegalovirus infections) can be found in the epithelium of the urogenital tract, of the top departments of food or respiratory tract [1, 2]. Among the known intrauterine infections the current cytomegalovirus infections is the leading cause of brain damage and hearing loss in newborns [3, 4]. Equally important is the early detection of cytomegalovirus nature of infertility in men [5]. The lower matrix phosphoprotein RR (65-68 kDa major and highly specific protein CMV) [6]) is used for rapid diagnosis of current cytomegalovirus infections and its presence in the membranes of peripheral leukocytes currently considered to be one of the main criteria critical current cytomegalovirus infections. It is shown that the number RR antigen and viral DNA in the blood correlates with the risk and severity of current cytomegalovirus infections in immunosupression patients. The presence of antigen RR blood viewletcam just using a commercial monoclonal antibodies (CINAKit Rapid Antigenemia, Argene) to this protein on the surface of peripheral leukocytes methods immunofluorescence assay or immunoperoxidase[7, 8, 9].

Known hybridoma - producers of monoclonal antibodies to identify cytomegalovirus (Japan patent No. 4211364, IPC AC 39/395, publ. 03.08.1992 year).

Known hybridoma producing murine monoclonal antibodies (MAB) to the native early nuclear protein (R72 (72 kDa) CMV [10, 11, 12]. The first message of the MCA matrix to native protein RR described in [13] the comparison of their properties with commercial µa (Clonab CMV, Biotest Diagnostic Corporetion) and the second on recombinant Fab fragment µa to protein RR obtained by the technology of phage display from leukocytes of the patient [14]. Described property polyclonal rabbit antibodies to recombinant protein RR to identify productive form of current cytomegalovirus infections in the tissues of the heart patients who underwent coronary bypass surgery [15]. In Russia at the present time for the laboratory diagnosis of current cytomegalovirus infections in newborn infants using ICA to early native protein (R72 and commercial µa to protein RR [16, 17].

However, well-known foreign strains of hybrid cells Mus museums L. - producers μa, which can be used to identify protein RR human cytomegalovirus unavailable to receive MCA and domestic production of diagnostic is eating.

The technical result is to expand the range of strains of hybrid cells Mus museums L. - producers μa, which can be used to identify protein RR human cytomegalovirus.

This technical result is achieved by obtaining a strain of hybrid animal cells Mus museums L. 5F10, deposited in the Collection of cell cultures fsri SRC VB "Vector" of Rospotrebnadzor, used as a producer of monoclonal antibodies for detection of protein RR human cytomegalovirus.

The strain obtained by fusion of mouse cells p3-X63/Ag8.653 (NS/1) myeloma cells spleens of BALB/c mice immunized with affinity-purified recombinant protein RR [18], obtained by biosynthesis in cells .li based plasmid constructs comprising a fragment of the UL83 gene encoding the immunodominant region of the protein [19].

The inventive strain of hybrid cells obtained in the State research center of Virology and biotechnology "Vector" of Rospotrebnadzor, the Russian Federation and deposited in the Collection of cell cultures SRC VB "Vector". Author name hybridoma cell line - 5F10.

Pedigree strain. A hybrid strain of cells obtained by fusion of mouse cells p3-X63/Ag8.653 (NS/1) myeloma cells spleens of BALB/c mice immunized with affinity-purified recombinant protein RR cytomegalovirus of man. As a melting agent used 45% solution of polyethylene glycol "Sigma" with a molecular weight of 1300-1600 kDa method [20]. Cells after fusion were grown in selective medium GAT in 96-well culture plates. As feeder cells used peritoneal macrophages outbred mice. Hybridoma, consistently producing specific MCA, cloned 3 times. The output of positive clones in the last clone was 100%. The number of passages by the time deposits: 7-10 passages.

Marker signs and methods of their evaluation. Strain secretes a mouse immunoglobulins of the IgG subclass (with heavy 55 kDa and 25 kDa light chain), specifically interacts with recombinant protein RR and native viral protein R CMV. Analysis of mouse immunoglobulins performed by ELISA, using as antigen recombinant protein RR or virus-associated protein R in the lysate of infected cells. Contamination by bacteria and fungi were not found.

Cultural properties. Media for cultivation of DMEM/F12 with glutamine, pyridoxine, Hepes (fsri SRC VB "Vector" of Rospotrebnadzor). The content of fetal serum, optimized for hybrid (HyClone, USA) in growth medium at 10%. Wednesday also add 80-160 μg/ml gentamicin sulfate.

The strain is monocline-suspension culture, in the cat who swarm up to 20% of the cell is in suspension, being attached to the surface of the cookware for cultivation. Cells from the surface of the culture dishes are removed with a solution of trypsin/versene=1/1 (volume/volume). Sowing dose of 200 thousand cells/ml, the Frequency of passage through 3-4 days. The proliferation index is not less than 5.

Cultivation of a strain of Mus musculus L. SRC VB "Vector" 5F10 in the body of the animal. Female BALB/c mice (vivarium GMCVB "Vector") previously injected intraperitoneally with 0.3-0.5 ml of piers (Sigma). After 2-4 weeks the animals are vaccinated intraperitoneally 10 million hybrid cells. Ascitic tumor is formed at 7-10 days. Hybridoma inoculated in 100% of cases. From one animal you can get 3-5 ml of ascitic fluid containing MAB.

The characteristic of a useful product. Typing monoclonal antibodies was performed by the method of solid-phase ELISA using monospecific mouse antibodies (Sigma, USA). MCA belong to the subclass IgGl. They specifically interact with recombinant RR, virus-associated proteins RR (65-68 kDa) in the lysate of infected cells in the reaction immunoblot. In ELISA titer µa in ascites is 1:2187000 and 1:25600 on the recombinant antigen and the lysate of infected Vero cells, respectively. Stable products µa persists for at least 10 passages in vitro under continuous cultivation. One ml of ascitic W is drasti you can get 3-5 mg of purified monoclonal antibodies. Cryopreservation. Environment for freezing - environment DMEM(M) - 50%, fetal serum - 40%, dimethylsulfoxide - 10%. 1-1,5 ml of cell suspension is transferred into a plastic cryoprobes and placed in a Styrofoam container with a wall thickness of 1 see the Container make a pair of liquid nitrogen and after 18-24 hours, the tubes are transferred into liquid nitrogen. Defrosting is carried out, omitting the tubes in water with a temperature 37-41°C. the cells of the plant with the environment DMEM(M) and centrifuged at 1000 rpm Sediment resuspended in the growth medium and the cells are transferred into culture flasks at a concentration of 200-300 thousand per milliliter. Cell viability after thawing is 60-80% (according to the results of staining with 0.25% Trifanova blue). Each ampoule contains not less than 10 million/ml of cells.

The invention is illustrated by drawings.

Figure 1 presents electrophoregram treated µa 5F10, where:

1 - the drug is cleared µa 5F10, arrows indicate chain immunoglobulin:

t - heavy chain (55 kDa); l - light chain (25 kDa);

2 - protein molecular weight markers (Bio-Rad);

3 - molecular weight protein markers.

2 shows the immunoblot of the native viral protein R: solid nitrocellulose membrane with transferred as a result of electrophoresis of proteins treated with purified preparation 5F10 MAB at a dilution of 1:500;

1, 2, 3 - lysates INFI the new CMV cells Vero, RH, L68 (10 µl per lane);

4 - purified recombinant protein R (10 ml) (positive control);

5 - lysate of Vero cells infected with herpes simplex virus type 2 (negative control);

6 - molecular weight protein markers.

The method of obtaining the claimed strain.

The strain of hybrid cells Mus musculus L. SRC VB "Vector" - 5F10 obtained as follows. Female BALB/c mice (vivarium GMCVB "Vector") weighing 15-20 g subjected to immunization scheme, which is listed in the following table.

Table
Scheme immunization
daysthe diluent antigenantigen dose (μg/mouse)area injections
0full beta-blockers10intraperitoneally
7incomplete beta-blockers10intraperitoneally
11saline100intravenous
12saline100intravenous
14Hybridization(the fence spleen)

To merge use a ratio of 3/1 splenic cells of mice and cells of mouse myeloma NS/1. The mixture of cells centrifuged, the supernatant carefully removed and the cells draught add 0.4 ml of a 45% solution of polyethylene glycol (PEG) with a molecular mass of 1300-1600. The mixture was centrifuged 15 min at 1000 Rev/min After 3 min pause layer PEG slowly diluted with 5 ml of versene, after which the precipitate resuspended. The cells are then again precipitated (10 min at 1000 rpm) and is dissolved in the growth medium. Cells are distributed in five 96-hole blade (Costar) in 100 μl into the hole. Selection of hybrid cells is carried out in the environment GAT, consisting of a nutrient medium, DMEM(M), which added 10% fetal cow serum (Gipco), 0.1 mm gipoksantina, 0.04 mm thymidine and 0.01 mm aminopterin.

The selection of specific hybrids performed enzyme-linked immunosorbent assay (ELISA). In wells blade (Animepalm) as antigen absorb 100-200 ng of affinity-purified recombinant protein RR. Place of nonspecific binding is saturated with a 0.5 solution of casein (ICN). Then transferred into the wells, 100 μl of culture medium analyzed hybrid and incubated for 45 min at 37°C. After incubation, the wells are washed 3-5 times with physiological saline containing 0.05% tween-20 (Sigma). Later in the tablets make 100 ál individualo conjugate (rabbit immunoglobulins against mouse IgG, horseradish peroxidase) and incubated for 45 min at 37°C. the Tablets are washed and carry out the enzymatic reaction. The results of the analysis determined on spectrophotometer "Multiscan" (Finland).

The resulting hybrid strain twice clone method of limiting dilutions, translated in popular culture and frozen in liquid nitrogen.

The following examples explore in detail the beneficial properties of the objects of the invention.

Example 1. Cultivation of hybrid cells strain of Mus musculus L. SRC VB "Vector" - 5F10, producing µa recombinant protein RR CMV in animals, BALB/c mice.

Mice BALB/c (vivarium GMCVB "Vector") weighing 20-22 g not less than 10 days before inoculation of hybridoma cells injected intraperitoneally 0.3-0.5 ml of vaseline oil or Wharf. Cultured cells of strains that are in the logarithmic growth phase, sterile centrifuged for 5-10 minutes at 1000 rpm in a centrifuge ARF-3. Adosados removed, and the residue cells suspension in a sterile solution of Earl or Hanks. Female BALB/c mice (vivarium GMCVB "Vector" weighing 20-22 g intraperitoneally injected every 1 ml of cell suspension, containing not less than 10 million hybridoma cells. After 7-10 days the animals are euthanized and the peritoneal cavity extract 3-5 ml of ascitic fluid. Cells from ascitic fluid is separated by centrifugation, and the supernatant determine the titer of the MCA using enzyme immunoassay, as described above.

Example 2. The selection of the purified monoclonal antibodies produced by hybrid cultured cells of strain of Mus musculus L. SRC VB "Vector"-5F10.

One volume of ascitic fluid containing MAB, diluted with 4 volumes of 0.6 M acetate buffer (0.04 M citric acid, 0.2 M sodium acetate), pH 4.0 and bring the pH to 4.5 using a 0.1 N sodium hydroxide solution. To the diluted sample is added dropwise, with constant stirring, Caprylic acid at the rate of 25 µl per 1 ml and incubated overnight at +4°C. Then centrifuged 30 min at 8000 g, and the precipitate removed and adosados mixed with 10x phosphate-saline buffer (FSB) and set pH 7.4 with a solution of 1.0 N sodium hydroxide. Equal volume of a saturated solution of ammonium sulfate add (V:V) to this solution, shaken and incubated overnight at 4°C or 30 min at +20-25°C. Centrifuged 15 min at 5000 g. Adosados merge, and the residue is dissolved in FSB, pH 7.4. The remains of ammonium sulfate is removed by dialysis against 50 to 100 volumes of the SAT, pH 7.4. Electrophoresis of purified drug MCA was carried out according to the method described in [21] in a discontinuous buffer system using 12-15% polyacrylamide gel with 0.1% sodium dodecyl sulfate in Tris-glycine buffer. The separating gel contained 0, 0625 M Tris-Hcl (pH 8.8), 0.1 percent SDS, 10(15)% acrylamide, 1% N,N - methylenebisacrylamide. The drug µa (1 μl) was applied to the track in a volume of 30 μl buffer containing 0, 0625 M Tris-Hcl (pH 6.8), 2% SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.01% of bromophenol blue. Before applying a buffer containing MCA, warmed up 3 min. at 95°C. Electrophoresis was mode 10/see the color of the gel was performed using Kumasi G-250. The purified preparation µa 5F10 as electrophoregram presented in figure 1.

Example 3. Cultivation of human cytomegalovirus. The human cytomegalovirus strain AD-169, obtained from the American type culture Collection (ATSS) in infected cell cultures of human fibroblasts (L-68), stored in liquid nitrogen in the medium L-15 with 7% DMSO and 20% fetal serum. The virus was cultured in monolayer cells L-68 in DMEM medium containing 10% fetal serum. The adsorption of the virus was carried out at 37°C for 1-1 .5 hours. After adsorption, the cells were washed with medium Needle MEME, and covered the environment for cultivation. 7-8 days after infection the cells were destroyed by 2-fold by freeze/thawing. Cell d is Brice, precipitated by centrifugation at 1000g for 10 min (centrifuge BECMAN J2-21), in a small volume of supernatant was treated with ultrasound at 50 watts for 30 seconds on melting ice. The supernatant was released from cell membranes by centrifugation at 1000g for 10 minutes and used for isolation of viral DNA, further cultivation in cell culture L-68 (diploid lung cells of a human embryo), Vero (kidney cells of the African green monkey) and RH (kidney cells of a human embryo) and as an antigen for ELISA and Western blot test.

Example 4. Determination by ELISA specific interaction MCA produced by hybrid cell strain of Mus musculus L. SRC VB "Vector" - 5F10 with recombinant protein RR or native CMV in the lysate of infected cells L-68, Vero, RH.

ELISA was performed on polystyrene tablets; the antigen (recombinant protein RR or lysate of infected cells L-68, Vero, RH) barbirolli in 0.5 M carbonate buffer, pH 9.0 in the amount of 100 μl/well to the plates. Place nonspecific binding was saturated at 37°C for 45 minutes with 0.5% solution of casein in buffer TSB-twin (0.145 M sodium chloride, 20 mm Tris-HCl, 5 mm PMSF (Sigma), 0.1% of Tween-20 (Serva), pH of 7.4) and then incubated with MCA 45 minutes at 37°C. Specific binding of the MAB to the antigen was identified antivirovym peroxidase labeled antibodies against mouse IgG. Next was added a Chromogen, 01% O-phenylenediamine, in citrate-phosphate buffer (0.2 M citric acid, 0.5 M Na2HPO3, pH 5.0) from 0.03% hydrogen peroxide). Stopped the reaction by adding 100 µl per well of 1 N Hcl and measured the optical density of samples on a spectrophotometer "Multiscan" using a filter with a maximum transmission 492 nm. As negative and positive control used homologous normal (non-immune) and hyperimmune serum, respectively.

Example 5. Identifying the immunoblot interaction MCA produced by hybrid cell strain of Mus musculus L. SRC VB "Vector" - 5F10 with recombinant protein RR and native CMV in the lysate of infected cells L-68, Vero, RH.

Viral proteins in the lysates of cells L-68, Vero, RH infected with CMV and recombinant protein RR after 12% SDS page electrophoresis were transferred to nitrocellulose membrane (Millipore, USA). Place nespetsificheskogo binding was saturated with 0.5% solution of casein in buffer TSB-twin (0,145 M sodium chloride, 20 mm Tris-HCl, 5 mm PMSF (Sigma), 0.1% Tween-20 (Serva), pH of 7.4) at 37°C for 2 hours. Then the whole membrane was incubated with MCA 4 hours at 20-22°C. Specific binding of the antibody that interacts with viral and recombinant proteins were revealed using conjugate antivitamin antibodies against mouse IgG labeled with horseradish peroxidase. As a negative control was used lysate of Vero cells, with what's herpes simplex virus type 2 [22]. The results are presented in figure 2.

The above properties of the strain of hybrid cells Mus musculus L. SRC VB "Vector" - 5F10 (author's name cell lines 5F10) allow to conclude that for the first time on the basis of mouse myeloma received hybridoma Mus musculus L. SRC VB "Vector" 5F10 - producer µa recombinant protein RR of human cytomegalovirus. The strain of hybrid cells provides receiving murine monoclonal immunoglobulin IgGl in the amount of 3-5 mg of purified antibodies from ml of ascitic fluid. Peeled µa specific reacted in ELISA with recombinant protein and native in the lysate of infected Vero cells (titer MCA was 1:2187000 and 1:25600, respectively), as was also revealed in the immunoblot of recombinant protein RR obtained by biosynthesis in cells of E. coli-based plasmid constructs comprising a fragment of the UL83 gene (encoding the immunodominant region of protein and virus-associated protein R in lysates of infected cells L-68, Vero, RH, which allows efficient use of produced by a strain of ICA to identify cytomegaly. The above properties of strain Mus museums L. SRC VB "Vector" - 5F10 (author's name cell lines 5F10) distinguish them from all previously described hybridomas producing µa to proteins of cytomegalovirus.

Sources of information

1. Mcgavran MH, Smith MG. / Ultrastructural, cytochemical and microchmical observations on cytomegalovirus (salivary gland virus) infection of human cells in tissue culture. // Exp Mol Pathol 1965; 4:1-10.

2. Sinzger C, Jahn G. / Human cytomegalovirus cell tropism and pathogenesis. // Intervirology 1996; 39:302-319.

3. Barbi M, Binda S, Caroppo S, et al. / A wider role of congenital cytomegalovirus infection in sensorineural hearing loss. // Pediatr. Infect. dis 2003. Vol.22, pp.39-42.

4. Malinger G, Lev D, Zahalka N, et al. / Fetal cytomegalovirus infection of the brain: the spectrum of sonographic findings. // Am.J. Neuroradiol 2003. Vol.24, pp.28-32.

5. Shen C, Chang S, Yang S, Wu C, Yang Y, H.N. Ho, and E. Huang / Cytomegalovirus is present in semen from a population of men seeking fertility evaluation. // The Journal of Infectious Diseases., 1994; 169:222-3.

6. Craighead JE, Kanich RE, Almeida JD. / Nonviral microbodies with viral antigenicity produced in cytomegalovirus-infected cells. // J Virol 1972; 10:766-775.

7. Jahan M, Nabassum S, Islam MN. /Comparison of CMV RR antigen and IgM antibody detection for early recognition of CMV primary infection and reactivation. // MymensingMed J 2008. 17(1):28-31.

8. Gentile G, Picardi A, Capobianchi A, et al. / A prospective study comparing quantitative Cytomegalovirus (CMV) polymerase chain reaction in plasma and RR antigenemia assay in monitoring patients after allogeneic stem cell transplantation. // BMC Infect Dis 2006. 21;6:167.

9. Ksouri H, Eljed H, Greco A. / Analysis of cytomegalovirus (CMV) viremia using the pp65 antigenemia assay, the amplicor CMV test, and a semi-quantitative polymerase chain reaction test after allogeneic marrow transplantation. // Transpl Infect Dis 2007. 9(1): 16-21.

10. Stirk PR, Griffiths PD. / Use of monoclonal antibodies for the diagnosis of cytomegalovirus infection by the detection of early antigen fluorescent foci (DEAFF) in cell culture. // J Med Virol 1987. 21(4):329-37.

11. Zweygberg Wirgart D, Landqvist M, Hokeberg I, et al. / Early detection of cytomegalovirus in cell culture by a new monoclonal antibody, CCH2. // J Virol Methods 1990. 27(2):211-9.

12. Makarova N.E., Kushch A.A., Ivanova L.A., Martynov, VN, Barinskiy IVAN, Pustowoit Century / Obtaining monoclonal antibodies to early proteins of human cytomegalovirus and their PR is the application to identify infected cells. // Journal "problems of Virology" 1996. No. 1, pp.28-32.

13. Gerna G, Revello MG, Percivalle E, Morini F. / Comparison of different immunostaining techniques and monoclonal antibodies to the lower matrix phosphoprotein (pp65) for optimal quantitation of human cytomegalovirus antigemia. // J Clin Environ 1992. 30(5):1232-7.

14. Williamson RA, Lazzorotto T, Sanna PP, et al. / Use recombinant human antibody fragments for detection of cytomegalovirus antigenemia. // Clin Environ 1997. 35(8):2047-50.

15. Susloparov M.A., Susloparov IM, Makhova NM, Omehow CENTURIES, Litasov E.E., Lagan M.V., Slawkowska LE, Mironenko, S. p., Chernyavsky A.M., lukyanchikova D. / Study markers of herpesvirus infections with coronary heart disease. // Mol. genetics and Virology 2005. No. 4, p.36-40.

16. Ulanovskaya GA, Kesiman Y.S., adeeva S.M., she M.G., Fedorova N.E., Pustowoit D, Malakhov M.V., Rollin E., Govorun V.M., Kushch AA / direct Detection of markers of cytomegalovirus and antiviral antibodies in children of early age. // Journal "problems of Virology" 2005, No. 1, p.14-19.

17. Fedorov N.E., she M.G., Vorontsov O.N., Degtyarev D.N., Pustowoit D, Asadi Mobarhan, Samatova M.M., Kushch A.A., Volodin N.N. / Quantitative laboratory methods for the diagnosis of cytomegalovirus infection in preterm infants. / Journal "problems of Virology" 2005, No. 1, p.9-14.

18. Susloparov IM, Susloparov M.A., Ivchenko, S., Grishaev BTW, Cordova M.A., Kosovo EJ, Blinov, V.M., Sheds D.V., Makhova NM, Noskov NV / Construction of recombinant antigen RR cytomegalo the virus of man and the study of its immunochemical properties. // Molecular genetics, Microbiology and Virology 2005. 4:36-40.

19. Susloparov M.A., Susloparov IM / Recombinant plasmid DNA pUL83HCMV providing for expression in bacterial cells E. coli recombinant protein containing the immunodominant part of the phosphoprotein RR HCMV and a fragment of beta-galactosidase. // Patent RF №2218408, BI No. 34, 10.12.2003.

20. Gefter ML, Margulies DH, Scharff MD. / A simple method for polyethylene glycol promoted hybridization of mouse myeloma cells. // Somat. Cell Genet. 1977. V.3, p.231-236.

21. Osterman AA / research Methods proteins and nucleic acids. Electrophoresis and ultracentrifugation. // Moscow, 1981. Pp.37-64.

22. Susloparov M.A., Makhova NM, Noskov, NV, dancers IV, Susloparov IM, Sergeev A.N., Sherstoboev EJ

The hybrid strain of animal cells Mus musculus L. 5F10, deposited in the Collection of cell cultures fsri SRC VB "Vector" of Rospotrebnadzor, used as a producer of monoclonal antibodies for detection of protein RR of human cytomegalovirus.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention belongs to medicine, notably to laboratory method of diagnostics. Principle of the method is isolation and identification of pathogenic and opportunistic microorganisms from biopsic material of common bile duct and assessment of antilysozim activity of isolated microorganisms. Antilysozim activity index 5.5±0.5 mcg/ml confirms acute purulent cholangitis diagnosis, 3.7±0.6 mcg/ml characterises acute recurrent purulent cholangitis, while index 1.1±0.4 mcg/ml supposes chronic purulent cholangitis.

EFFECT: method allows differential diagnostics of purulent cholangitis.

2 ex, 2 tbl

FIELD: medicine.

SUBSTANCE: method of determining sensitivity of horses to antigens of microorganisms of various taxonomic keys, which includes carrying out reaction of leukocytolysis with blood leucocytes using antigen, calculation of leukocytes in Goryaev's chamber before and after incubation and further determination of organism sensitivity by leukocytolysis index, different in the fact that in setting of reaction, first, solution of acidin-pepsin is introduced into samples, calculation of leukocytes before incubation is carried out only in control sample, and leukocytolysis index (LCI) is determined after incubation of experimental and control samples with further deduction of percent of spontaneous leukocytolysis (SLC) in control sample and is final value of LCI (3) is to 20%, organism sensitivity is considered to be low, 20-40% - medium, 40% and higher -high.

EFFECT: increase of determination accuracy.

5 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention aims at treatment, diagnostics or prevention of parasitic disease. There is used combination histone proteins H2A, H2B, H3 and H4 recovered from Leishmania infantum for making a pharmaceutical composition and a diagnostic aid. It involves applying a vector containing nucleotides coding specified histones.

EFFECT: invention allows treating and preventing the parasitic disease caused by one type with using histones originated from the other type.

13 cl, 4 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: to detect or chrysanthemum virus B in plants, a diagnostic set containing polyclonal antibodies to protein of Chrysanthemum virus B shell, a conjugate marked with alkaline phosphatase, a fixing buffer; an extraction buffer, ECI-buffer and PNP-buffer is used. Protein of viral shell is produced by amplification of the purified gene of said protein with using a nonsynonymous primer ATGCCTCCCAAACCGGCACCAGGTGAT and synonymous primer TTTATAATGTCTTATTATTCGCAT.

EFFECT: improved antiviral action of the compound.

15 cl, 2 ex

FIELD: medicine.

SUBSTANCE: there is used for diagnostics of transient and persistent latent papilloma virus infection. The diagnostic technique for papilloma virus infection is ensured by history taking and integrated clinical-laboratory examination. As anamnestic signs, there are assumed compromised oncologic characteristics inheritance, early sexual life, age younger than 20 years old and promiscuity; as clinical - anogenital warts, erosion and ectopic neck of uterus, contact hemorrhagic diathesis, Ovuli nabotti, inflammatory diseases of small pelvis organs and intrauterine spiral. Herewith the laboratory signs are sexually transmitted diseases, mixtinfection, deficient lactic acid bacilli, vaginal disbiosis caused by conditional-pathogenic flora, bacterial vaginosis, virus-virus associations, urogenital herpes, urogenital mycoplasma infection, urogenital ureaplasma infection, urogenital candidiasis, urogenital Chlamidia infection and infection with various genotypes of human papilloma virus. Each sign is scored, and depending the number of points, persistent or transient clinical course of papilloma virus infections, or follow-up examination is performed.

EFFECT: determining tactics of the following management of the patient, forming group of potential risk for development of focal dysontogenetic and malignant transformations of urogenital epithelium.

1 dwg, 2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, particularly to laboratory examinations and can be used in selection of therapeutic approach to tonsillitis. The method involves microbiological study of tonsil lacunae contents. It involves detection of microorganism types and concentration. And if the association shows one or more microorganisms which are not normal tonsil lacuna inhabitants in concentration ≥105 CFU/ml, photodynamic therapy is predicted to be inefficient. The fact that test object is microflora enables to determine an etiological agent, as well as degree of activity of inflammatory process whereat photodynamic therapy aims.

EFFECT: method allows determining objective indications for photodynamic therapy in chronic tonsillitis that ensures more effective treatment of the patients.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine and can be used for express-estimation of severity of state of patient with burn disease. Laboratory analysis is carried out, degree of natural colonisation of buccal epithelium cells with bacteria Streptococcus salivarius, average number of bacteria Streptococcus salivarius adhesed on one buccal epithelium cell - index of natural colonisation of buccal epithelim cells (INCBEC), and if INCBEC value is greater than 10, conclusion about light degree of severity of patient's with burn disease state is made, of INCBEC value is from 5 to 10 - about medium degree of severity of patient's with burn disease state is made, and if INCBEC value is lower than 5 - about severe degree of severity of patient's with burn disease state.

EFFECT: method is simple in realisation, takes little time, non-traumatic, eliminates risk of infection.

3 ex

FIELD: chemistry.

SUBSTANCE: description is given of polyaniline in form of an emaraldine base of formula [(-C6 H4-NH)2-(NH=C6·H4=NH-)]n n=20 to 10000 or interpolymer of a complex of polyaniline with poly-(2-acrylamido-2-methyl-1-propane-sulphonic acid), i.e. salt of emaraldine with poly-2-acryloamido-2-methyl-1-propane sulphonic acid of formula , n=50 to 50000 as a sorbent for removing viruses, non-viral proteins and for making an immunoasorbent based on said sorbent for isolating antiviral antibodies.

EFFECT: following methods are also described: method of removing viruses through immobilisation on a sorbent; immunoadsorption method; method of sorption of non-viral proteins from complex mixtures using sorbent.

20 cl, 2 ex, 4 tbl, 2 dwg

FIELD: veterinary.

SUBSTANCE: claimed is test-system of immuno-enzyme analysis, which allows to determine antibodies to viruses of infectious rhinotracheitis (IRT), viral diarrhea-disease of mucous membranes (VD-DMM), parainfluenza viruses -3 (PIV-3), respiratory syncytial (RS) and adenoviral (AVI) infections of livestock. Serological examination of animals allows to detect zones of infection spreading and estimate post-vaccination immunity.

EFFECT: application of claimed test-system IEA will allow to carry out simultaneously epizootological monitoring of five important infections of livestock, retrospective diagnostics of respiratory infections, and estimation of immunity stress in animals resulting from application of vaccines, determination of level of colostral antibodies in young animals in the first weeks or days of life, estimation of therapeutic medicine quality.

10 tbl

FIELD: medicine.

SUBSTANCE: invention concerns medicine, namely to laboratory diagnostics of human tularemia and concerns differentiation of infectious and postvaccinal antibody response at human tularemia. The essence of the invention consists that as an antigenic preparation in addition to LPS Fransicella tularensis in a dot blotting in parallel LPS Fransicella novicida is used. For this purpose LPS preparations are preliminary allocated from corresponding strains which are dissolved in the distilled water and applied on a nitrocellulose membrane in volume 1 mcl from the 1-5 mg/ml solution, with the subsequent processing by a buffering normal saline solution at pH 7.0-7.1 with 1% bull seralbumin and 0.5% twin 20 within one hour. After that the filters are washed out and incubated in the investigated serum dissolved not less than 1:100, within an hour at temperature of 37°C, then the samples are washed three times, also presence of complexes an antigen-antibody is revealed by a withstanding within 1 hour at a room temperature in a working solution of protein A, labelled with horse-radish peroxidase, with the subsequent washing up and placing in a painting solution, thus the account and an estimation of results are spent on presence of two brown maculae on a place of drawing of LPS F.tularensis and LPS F.novicida preparations which presence testifies to infectious process at the investigated patient, and at vaccinal process one maculae on a drawing place only LPS F.tularensis is observed.

EFFECT: advantage of the invention consists in simultaneous revealing infectious and postvaccinal antibody responses.

3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to humanised anti-TGF-beta-antibody which is linked to TGF-beta. The humanised antibody has a variable domain VH which contains residues of the hypervariable region (non-human), which are contained in the human domain VH which includes a modified framework region (FR) (amino acid and nucleotide sequences are given in the list of sequences). The humanised antibody can contain residues of the complementarity determining region (CDR) of the variable domain of the light strand VL. The invention also relates to a composition for treating TGF-beta mediated disorders, e.g. malignant tumours, nucleic acid, coding monoclonal antibody, and a method of obtaining the latter using host cells. The invention provides a method of treating and detecting TGF-beta in a sample from the body using the disclosed antibody, as well as to a product which contains the humanised antibody and directions for use for treating TGF-beta mediated disorders.

EFFECT: invention enables control of TGF-beta molecules, which can prevent possible changes in antibodies, enables preparation of high-affinity humanised antibodies which act as TGF-beta antagonists.

57 cl, 45 dwg, 4 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention aims at preparation of new strain of hybrid cells Mus. Musculus 6F3 - a producer of monoclonal antibody (MCA) to hemagglutinin protein of high-pathogen avian influenza virus A/duck/Novosibirsk/56/05. Strain 6F3 is prepared by fusing murine myeloma cells Sp2/0 with murine spleen cells BALB/c, immunised with a purified and inactivated preparation of avian influenza virus A/H5N1 (strain A/duck/Novosibirsk/56/05). Hybridoma produced MCA belong to IgA class. Strain 6F3 is deposited in the Collection of cell culture of Ivanovsky State Research Institution of Virology of the Russian Academy of Medical Sciences, No. 8/2/3. Using hybridoma allows producing specific monoclonal antibodies to hemagglutinin protein of avian influenza virus A/H5N1.

EFFECT: possibility to use antibodies to studying the antigenic structure of hemagglutinin for differential diagnostics of avian influenza virus A/H5 serotype.

1 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: invention can be used for production of monoclonal antibodies (MCAs) to heat shock protein 70 (HSP 70). A hybridoma strain is made by immunisation of BALB/c mice with bovine HSP 70 within 78 days. For the third days, splenocytes of immune mice (108 cells) are hybridised with murine myeloma cells P3-X63 Ag/8-653 (107 cells). A fusion agent is polyethylene glycol of molecular weight 4000 (Merk, Germany). The hybridisation is followed with selection, screening, cloning and cryopreservation of hybridoma. Hybridoma 6G2 is deposited in the microorganism collections of "ГНТТ ПМБ" under No. H-2. MCA.

EFFECT: produced hybridoma under the invention is more evident to be detected as HSP 70 on the cell surfaces, and change of endocellular HSP 70 level when exposed to the stress factors.

4 dwg, 1 tbl, 6 ex

FIELD: pharmacology.

SUBSTANCE: invention can be used to identify a pseudotuberculosis agent in bacterial cultures, a biological material and environmental objects by applying the indirect hemagglutination test. Substance of the invention consists in development of a new diagnosticum that represents formalinised sheep's erythrocytes sensitised with monoclonal antibodies to lipopolysaccharide antigen of cold version Yersinia pseudotuberculosis serotype I (strain 164/84 serovariant I) and frozen-dried in a protective medium. Shelf life of the preparation is 2 years.

EFFECT: diagnosticum provides high sensitivity, specificity to the UHAT in detecting Yersinia pseudotuberculosis serotype I.

FIELD: veterinary.

SUBSTANCE: strain 5A10 of hybridomal line of cells of mouse Mus. museums, producing monoclonal antibodies to immunoglobulin IgG of cattle (C) is permanent line of cells and is suitable for biotechnology in elaboration of preparations. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 71. Antibody titers in native culture liquid constitute 1:32-1:64, in ascitic liquid 1:640-1:5120 in immuno-enzymatic analysys. Monoclonal antibodiesproduced by strain are specific to immunoglobulin IgG of cattle and do not react with immunoglobulins of sheep. Peroxydase-marked monoclonal antibodies ensure high sensitivity and specificity of IEA for detection of antibodies to C leucosis virus in biological material. Strain 5A10 - producent of monoclonal antibodies to immunoglobulin IgG of cattle can be used in production of immuno-enzymatic test-system for diagnostics of C leucosis.

EFFECT: application of said test-system will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms.

5 ex

FIELD: veterinary.

SUBSTANCE: obtained is strain 1H8 of hybridomal line of cells of mouse Mus. musculus - producent of monoclonal antibodies to IgG of sheep, suitable for biotechnology in elaboration of diagnostic preparations. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 73. When determined by method of immuno-enzymatic analysys (IEA) antibodies titers in native culture liquid constituted in IEA 1:32-1:64, in ascitic liquid 1:640-1:5120. Monoclonal antibodies are specific to immunoglobulin IgG of sheep and do not react with immunoglobulin of cattle. When used for fixation on solid phase of glycoproteidal antigen of cattle (C) leucosis virus (in composition of complex glycoproteidal antigen- monoclonal antibodies of sheep to glycoproteidal antigen) in IEA, they ensure strength of fixation and optimal availability of antigen for antibodies in testes samples.

EFFECT: strain 1H8 can be used in production of immuno-enzymatic test-system for diagnostics of C leucosis, which will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms.

1 tbl, 4 ex

FIELD: veterinary.

SUBSTANCE: obtained is strain 8C12 of inter-species hybrid cells of mouse Mus musculus and sheep Ovis aries - producent of monoclonal antibodies of sheep to glycoproteidal antigen of virus of cattle (C) leucosis. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 72. Strain is permanent hybrid line of cells and possesses high level of production of monoclonal antibodies of sheep. Antibody titers in native culture liquid constitute 1:32-1:64 in immuno-enzymatic analysys (IEA). Monoclonal antibodies are specific to general antigen determinant of glycoproteids of C leucosis - external gp51 and transmembranous gp30. When used in IEA for detection of antibodies in blood serum and milk of C infected with leucosis virus, antibodies provide strong selective binding with solid-phase carrier and optimal space orientation of glycoproteidal antigen.

EFFECT: strain 8C12 can be used in production of immuno-enzymatic test-system for diagnostics of cattle leucosis, which will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms and, as a result, reduce incidence of leucosis in cattle.

1 tbl, 4 ex

FIELD: pharmacology.

SUBSTANCE: present invention refers to immunology and biotechnology. There are antibody-antagonist to CD40 with their variable areas derived from an antibody produced of hybridoma 4D11 (FERM BP-7758). The constant areas of antibodies are derived from human IgG4 with mutations S228P and L235E. There are described related coding polynucleotides and the based expression vector. There is disclosed host-cell containing said vector. There is described method for preparing monoclonal antibody and application thereof in the pharmaceutical composition.

EFFECT: application of the invention provides reduced ADCC and CDC activity that can find application in therapy of autoimmune diseases and graft rejection.

10 cl, 26 dwg, 2 tbl, 22 ex

FIELD: medicine.

SUBSTANCE: method is suggested for production of antibody for binding to NK-cells, which crossly interacts with products of gene KIR2DL1 and KIR2DL2/3 and neutralises inhibitor activity of such KIR. Mentioned method includes selection of such antibodies that crossly interact at least with products of gene KIR2DL1 and KIR2DL2/3, are able to restore lysis with NK cells Cw3+ or Cw4+ target cells and are bound with NK cells or polypeptide of KIR primate. Antibodies produced by this method are described, as well as their derivatives, where antibody is linked with toxin, radionuclide, recognisable aggregation, solid carrier or polyethylene glycol.

EFFECT: invention provides for preparation of single type of antibodies, which controls activity of NK cells of various type, provides for amplification of their cytotoxicity, which may find application in therapy, for increase of activity or cytotoxicity of NK cells in individuals without preliminary detection of HLA type in individual.

7 cl, 13 dwg, 4 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention refers to antibody specifically getting bound with PRO87299 version. In addition, the antibody according to the invention has ability to block interaction HVEM and PRO87299 and to function as PRO87299 agonist. The antibody of agonist nature is produced by hybridoma Btig5F5.1 or Btig3B1.9. For the antibody, there is established amino acid sequence given in the description. The invention discloses the methods of using the antibodies to stimulate or reduction of immune response in immune-associated diseases connected, to relieve lymphoma, and inflammatory disease in requiring mammal, to detect polypeptide PRO87299 in a sample and to manage rejection of grafted cells.

EFFECT: antibody is an immunomodulator that allows applying therapeutically identical medicinal agents both to intensify and reduce immune response.

16 cl, 34 dwg, 7 tbl, 20 ex

FIELD: medicine.

SUBSTANCE: invention can be used for production of monoclonal antibodies (MCAs) to heat shock protein 70 (HSP 70). A hybridoma strain is made by immunisation of BALB/c mice with bovine HSP 70 within 78 days. For the third days, splenocytes of immune mice (108 cells) are hybridised with murine myeloma cells P3-X63 Ag/8-653 (107 cells). A fusion agent is polyethylene glycol of molecular weight 4000 (Merk, Germany). The hybridisation is followed with selection, screening, cloning and cryopreservation of hybridoma. Hybridoma 6G2 is deposited in the microorganism collections of "ГНТТ ПМБ" under No. H-2. MCA.

EFFECT: produced hybridoma under the invention is more evident to be detected as HSP 70 on the cell surfaces, and change of endocellular HSP 70 level when exposed to the stress factors.

4 dwg, 1 tbl, 6 ex

Up!