Nucleic acid structure and methods of obtaining oil with modified composition from seeds

FIELD: chemistry.

SUBSTANCE: transformed soya bean seeds contain a nucleic acid sequence identical to a fragment of soya bean intron FAD2-1A and a nucleic acid identical to a fragment of soya bean FADB gene. Seeds of the transformed plant, as well as oil and flour obtained therefrom contain oleic acid in amount ranging from approximately 42 wt % to approximately 85 wt % of the total content of fatty acids. Content of saturated fatty acids is less than 8 wt % of the total amount of fatty acids.

EFFECT: higher fatty acid content.

28, 37 dwg, 26 tbl, 31 ex

 

Cross-reference to related applications

This application claims under section 35 of the Code of laws of the United States on the priority of the provisional application for U.S. patent No. 60/772614, entitled “Modified Gene Silencing”, which was filed on February 13, 2006; provisional application for U.S. patent No. 60/781519 entitled “Soybean Seed and Oil Compositions and Method for Making Same”, which was filed on March 10, 2006; and application for U.S. patent No. 11/376328, entitled “Nucleic Acid Constructs and Methods for Producing Altered Seed Oil Compositions”, which was filed on March 16, 2006

The inclusion of a list of sequences

In the present description of the invention, the links included in the paper copy of the list of sequences and computer form the list of sequences on diskette, containing the file named “Omni2 AS FILED.txt” size 60690 bytes (measured in MS-DOS), which was recorded on September 25, 2003 and filed in the application for U.S. patent No. 10/669888. In the present description of the invention, the links included in the paper copy of the list of sequences and computer form the list of sequences on diskette, containing the file named “OmniChild.txt” 61434 bytes (measured in MS-DOS), which was recorded on March 15, 2006

The technical field to which the invention relates

The present invention relates to molecules of recombinant nucleic acids, structures and other agents in associirovannyy with the coordinated manipulation of many genes in the pathway of fatty acid synthesis. In particular, the agents of the present invention is associated with a simultaneous increase in the expression of certain genes in the pathway of fatty acid synthesis and suppression of the expression of other genes in the same way. The present invention also relates to plants containing such agents, and in particular, for plants containing such constructs, which are characterized by altered composition of the oil from the seeds.

The level of technology

Vegetable oils are used in different areas. New compositions of vegetable oils and improved methods of obtaining compositions of oil from biosynthetically or natural plant sources. Depending on the intended use of the oil is desirable different compositions of fatty acids. Plants, particularly species that synthesize large quantities of oil in the seeds are an important source of oil for food and industrial applications. Oil from seeds is almost entirely composed of triacylglycerides, in which fatty acids tarifitsirovana three hydroxyl groups of glycerol.

Soybean oil typically contains approximately 16-20% of saturated fatty acids: 13-16% palmitate and 3-4% stearate. Cm. publication Gunstone et al., The Lipid Handbook, Chapman & Hall, London (1994). Soybean oil were modified by different methods of selection in accordance with the requirements of a particular market sat is the same. However, until now, there is no soybean oil, which would meet the requirements of major users, such as the food industry, where oil is used for salad dressings, butter and baking oil for frying, and industrial markets, where soybean oil is used for production of biodiesel and bio lubricants. Previously used soybean oil were either too expensive, or they lacked important property of food quality, such as resistance to oxidation, good taste fried foods or saturated fat, or important property of biological fuel, such as the desired selection of nitric oxide, the resistance in the cold state or fluidity in the cold.

Higher plants synthesize fatty acids in accordance with the usual way of metabolism, which is the path of fatty acid synthase (FAS), localized in plastids. β-Ketoacyl-ACP-synthase are important limiting synthesis FAS enzymes in plant cells and exist in several versions. β-Ketoacyl-ACP synthase I, catalyzes the lengthening of the chain before the formation of Palmitoyl-ACP (C16:0), while β-ketoacyl-ACP-synthase II catalyzes the lengthening of the chain before the formation of stearoyl-ACP (C18:0). β-Ketoacyl-ACP synthase IV is a variant of β-ketoacyl-ACP-synthase II and may also kataliziruet the ü extending the chain to 18:0-ACP. In soybeans, the main products of the FAS are 16:0-ACP and 18:0-ACP. Desaturation of 18:0-ACP with the formation of 18:1-ACP catalyzed by localized in plastids soluble Delta-9-desaturase (also referred to as “stearoyl-ASR-desaturase”). Cm. publication Voelker et al., 52 Annu. Rev. Plant Physiol. Plant Mol. Biol. 335-61 (2001).

Products FAS and Delta-9-desaturase in plastids, 16:0-ACP and 18:-ACP and 18:1-ACP, hydrolyzed specific thioesterase (FAT). Vegetable thioesterase can be attributed to two gene families based on homology sequences and preferences of the substrate. The first family, FATA, includes acyl-ACP-thioesterase long chains, with primary activity 18:1-ACP. The enzymes of the second family, FATB, usually use a 16:0-ACP (Palmitoyl-ACP), 18:0-ACP (stearoyl-ACP and 18:1-ACP (oleoyl-ACP). Such thioesterase play an important role in determining the chain length in the biosynthesis of new fatty acids in plants, so the enzymes can be used for various modifications of the compositions of fatty acids, in particular, to determine the relative proportions of the different fatty acids present in the oils from the seeds.

The products of the reactions FATA and FATB, free fatty acids, derived from plastid and converted into the corresponding esters of acyl-COA. The acyl-COA are substrates for the biosynthesis pathway of lipids (the path is Ennedi), which localized to the endoplasmic reticulum (ER). This path is responsible for the formation of membrane lipids, as well as for the biosynthesis of triacylglycerol forming the oil from the seeds. In the endoplasmic reticulum are more membranebased desaturase that may Desaturate 18:1 in polyunsaturated fatty acids. Delta-12 desaturase (FAD2) catalyzes the introduction of a double bond in 18:1 with the formation of linoleic acid (18:2). Delta-15 desaturase (FAD3) catalyzes the introduction of a double bond in 18:2 with the formation of linolenic acid (18:3).

Many complex biochemical pathway currently amenable to genetic manipulation, usually by suppression or overexpression of individual genes. Further use of the possibilities of genetic manipulation of plants requires the coordinated manipulation of many genes in the path. There were used different methods of combining transgenes in a plant that comprise crossing, retransformation, cotransformation and application of linked transgenes. For the coordinated suppression of many endogenous genes in plants can be used in the chimeric transgene associated with incomplete gene sequences. The design created on the basis of viral polyproteins, can be used for the simultaneous introduction of multiple coding is related genes in plant cells. Cm. publication Halpin et al., Plant Mol. Biol. 47:295-310 (2001).

Thus, the desired phenotype plants may require the expression of one or more genes and simultaneous reduction of the expression of another gene or genes. There is therefore a need for simultaneous overexpression of one or more genes and the suppression or reduction of expression of another gene or genes in plants using the same transgenic construct.

The invention

The present invention relates to one or more molecules of recombinant nucleic acids, which when introduced into a cell or organism capable of inhibiting, at least partially reduce, reduce, substantially reduce or effectively eliminate the expression of at least one or more endogenous RNA FAD2, FAD3, or FATB and at the same time to coexpression, at the same time to Express the or in a coordinated manner to produce one or more RNA or proteins transcribed from the gene encoding beta-ketoacyl-ACP synthase I, β-ketoacyl-ACP synthase IV, Delta-9-desaturase or CP4 EPSPS protein. The present invention relates to plant cells and plants transformed with one or more nucleic acid molecules, to seeds, oil and other products derived from transformed plants.

The present image is the buy includes a recombinant molecule of nucleic acid, containing the first set of DNA sequences that, when expression in a cell-master is able to suppress the endogenous expression of at least one, preferably two genes selected from the group comprising the genes of FAD2, FAD3, and FATB; and a second set of DNA sequences that, when expression in a cell-master capable of increasing the endogenous expression of at least one gene selected from the group containing the gene beta-ketoacyl-ACP synthase I gene, a beta ketoacyl-ACP synthase IV gene, Delta-9-desaturase and CP4 EPSPS protein.

The present invention further relates to a recombinant molecule of nucleic acid containing the first set of DNA sequences that, when expression in a cell-master is able to form a design dsrnas and to suppress the endogenous expression of at least one, preferably two genes selected from the group comprising the genes of FAD2, FAD3, and FATB, the first set of DNA sequences includes a first non-coding sequence expressing a first RNA sequence that is at least 90% identical to the non-coding region of the gene FAD2, the first antisense sequence, expressing the first antisense RNA sequence capable of forming a molecule of double-stranded RNA with the first sequence is NC, the second non-coding sequence expressing the second RNA sequence which is at least 90% identical to the non-coding region of the gene FATB, and the second antisense sequence, expressing the second antisense RNA sequence capable of forming a molecule of double-stranded RNA from the second RNA sequence; and a second set of DNA sequences that, when expression in a cell-master way of increasing the endogenous expression of at least one gene selected from the group containing the gene beta-ketoacyl-ACP synthase I gene, a beta ketoacyl-ACP synthase IV gene, Delta-9-desaturase and CP4 EPSPS protein.

The present invention relates to methods of plant transformation using these recombinant molecules of nucleic acid. These methods include a method of creating transgenic plants with increased oleic acid content, low content of saturated fatty acids and a low content of polyunsaturated fatty acids in the seed, which comprises (A) transforming plant cells with the recombinant molecule of nucleic acid containing the first set of DNA sequences that, when expression in a cell-master is able to suppress the endogenous expression of at least one, preferably two genes selected from the group including genes FAD2, FAD3, and FATB, and the second set of DNA sequences that, when expression in a cell-master capable of increasing the endogenous expression of at least one gene selected from the group containing the gene beta-ketoacyl-ACP synthase I gene, a beta ketoacyl-ACP synthase IV gene, Delta-9-desaturase and CP4 EPSPS protein; and (B) growing the transformed plant produces a seed with an increased oleic acid content, low content of saturated fatty acids and a low content of polyunsaturated fatty acids compared to seed plants that have such genetic environment, but does not contain a molecule of recombinant nucleic acids.

The present invention further relates to methods of transforming plant cells with the recombinant molecules of nucleic acid. These methods include a method of changing the composition of the oil plant cells, which comprises (A) transforming plant cells with the recombinant molecule of nucleic acid comprising the first set of DNA sequences that, when expression in a cell-master is able to suppress the endogenous expression of at least one, preferably two genes selected from the group comprising the genes of FAD2, FAD3, and FATB, and the second set of DNA sequences that, when the expression in CL is TKE host capable of increasing the endogenous expression of at least one gene, selected from the group containing the gene beta-ketoacyl-ACP synthase I gene, a beta ketoacyl-ACP synthase IV gene, Delta-9-desaturase and CP4 EPSPS protein; and (B) growing the plant cell under conditions of transcription initiation of the first set of DNA sequences and the second set of DNA sequences, resulting in a change in the composition of the oil compared with plant cell with a similar genetic environment, but does not contain a molecule of recombinant nucleic acids.

The present invention relates to a transformed plant containing a recombinant molecule of nucleic acid comprising the first set of DNA sequences that, when expression in a cell-master is able to suppress the endogenous expression of at least one, preferably two genes selected from the group comprising the genes of FAD2, FAD3, and FATB, and the second set of DNA sequences that, when expression in a cell-master capable of increasing the endogenous expression of at least one gene selected from the group containing the gene beta-ketoacyl-ACP synthase I gene, a beta ketoacyl-ACP synthase IV, gene Delta-9-desaturase and CA4 EPSPS protein. The present invention further relates to transformed plant soybean seed, the oil composition which comprises 55-80 wt.% oleic acid, 10-40 wt.% linoleic key is lots 6 wt.% or less linolenic acid and 2-8 wt.% saturated fatty acids to feed the product, the parts of the plant and the seed obtained from the plant. Another variant of implementation of the present invention relates to a transformed plant soybean seed, the composition of the oil which contains about 65-80% oleic acid, about 3-8% of saturated fatty acids and about 12-32% polyunsaturated fatty acids. The present invention relates also to a feed product, plant parts and seed obtained from such plants. Another variant of implementation of the present invention relates to a transformed plant soybean seed, the composition of the oil which contains about 65-80% oleic acid, about 2-3,5% saturated fatty acids and about 16.5-33% polyunsaturated fatty acids. The present invention relates also to a feed product, plant parts and seed obtained from such plants.

The present invention relates to the seeds of soybean, oil composition which comprises 55-80 wt.% oleic acid, 10-40 wt.% linoleic acid, 6 wt.% or less linolenic acid and 2-8 wt.% saturated fatty acids, and also relates to the seeds of soybean, the composition of the oil which is 65-80 wt.% oleic acid, 10-30 wt.% linoleic acid, 6 wt.% or less linolenic acid and 2-8 wt.% saturated fatty acids. Another option is done by the means of the present invention relates to the seeds of soybean, the composition of the oil which contains about 65-80% oleic acid, about 3-8% of saturated fatty acids and about 12-32% polyunsaturated fatty acids. Another variant of implementation of the present invention relates to the seeds of soybean, the composition of the oil which contains about 65-80% oleic acid, about 2-3,5% saturated fatty acids and about 16.5-33% polyunsaturated fatty acids.

The present invention relates also to the products of soybean, the composition of the oil which is 69-73 wt.% oleic acid, 21-24 wt.% linoleic acid, 0.5 to 3 wt.% linoleic acid and 2-3 wt.% saturated fatty acids.

Crude soybean oil of the present invention has a composition comprising 55-80 wt.% oleic acid, 10-40 wt.% linoleic acid, 6 wt.% or less linolenic acid and 2-8 wt.% saturated fatty acids. Another crude soybean oil of the present invention has a composition comprising 65-80 wt.% oleic acid, 10-30 wt.% linoleic acid, 6 wt.% or less linolenic acid and 2-8 wt.% saturated fatty acids. In another embodiment of the invention the crude soybean oil of the present invention has a composition comprising about 65-80% oleic acid, about 3-8% of saturated fatty acids and about 12-32% polyunsaturated fatty acids. In another embodiment of the invention the crude soybean oil really invented the Yu has the composition including about 65-80% oleic acid, about 2-3,5% saturated fatty acids and about 16.5-33% polyunsaturated fatty acids.

The present invention relates to the seeds of soybean, oil composition which comprises from about 42 wt.% to about 85 wt.% oleic acid and from about 8 wt.% up to about 1.5 wt.% saturated fatty acids. In another embodiment of the invention, the soybean seed of the present invention has an oil composition that includes from about 42 wt.% to about 85 wt.% oleic acid, from about 8 wt.% up to about 1.5 wt.% saturated fatty acids, less than 35 wt.% linolenic acid, while the combined number of oleic acid and linolenic acid is from about 65 wt.% to about 90 wt.% of the total composition of the oil; and the specified seed contains the cell host molecule recombinant nucleic acid with a DNA sequence comprising a fragment of a FAD2 intron-1 in length from about 50 to about 400 consecutive nucleotides of the 3'-UTR FATB and 5'-UTR FATB, heterologous beta-ketoacyl-ACP synthase IV and heterologous Delta-9-desaturase.

The soybean seed of the present invention may have the composition of the oil comprising from about 50 wt.% to about 80 wt.% oleic acid, from about 8 wt.% up to about 1.5 wt.% saturated fatty acids, from about 2 wt.% to about 45 wt.% linoleic acid, from about 4 wt.% to about 14 wt.% linolenic acid, with the United amount of oleic acid and linolenic acid is from about 65 wt.% to about 90 wt.% of the total composition of the oil, and this seed contains a molecule of recombinant nucleic acid with a DNA sequence comprising a fragment of intron FD2-1 in length from about 50 to about 400 consecutive nucleotides encoding the region P FATB and 42 consecutive nucleotide 5'-UTR FATB. In another embodiment of the invention the seed soya may contain a recombinant molecule of the nucleic acid sequence of DNA, suppressing the endogenous expression of FAD2 and FATB, but such seed has an oil composition that includes 46-75 wt.% oleic acid, 1.5 to 8.5 wt.% saturated fatty acids, 2,5-38 wt.% linoleic acid and 4.5-17.5 wt.% linolenic acid.

The present invention relates also to a method of reducing the magnitude of the suppression of the FAD2 gene in comparison with the magnitude of the suppression of the FAD2 gene reached in the result of the expression constructs crnci containing recombinant FAD2 sequence, including all of the FAD2 intron UTR or all FD2 by: i) expression of recombinant FAD2 sequence in a plant cell, with recombinant FAD2 sequence allocated from the endogenous FAD2 gene in a plant cell, contains a fragment of a FAD2 intron or fragment FAD2 UTR, and (ii) suppression of endogenous FAD2 gene recombinant FAD2 sequence, the value of the suppression of the FAD2 gene of magnitude less than the expression of the gene is reached in the financial p the resulting expression constructs crnci, containing recombinant FAD2 sequence, including all of the FAD2 intron or the entire FAD2 UTR.

The present invention relates also to a method of changing the composition of the oil in the plant cell by: transformation of plant cells with recombinant FAD2 sequence, selected from a portion of the endogenous FAD2 gene, which includes a fragment of a FAD2 intron or fragment FAD2 UTR, and growing the plant cell under conditions of initiation of transcription of the recombinant FAD2 sequence, resulting in the composition of the oil changes compared with plant cell with a similar genetic environment, but not containing recombinant FAD2 sequence. Another variant embodiment of the invention relates to a method of increasing the content of oleic acid and reduce the content of saturated fatty acids in the seed plants by: (i) shortening the length of the first recombinant FAD2 sequence until at least partial reduction of the magnitude of the suppression of the FAD2 gene in the plant, the transformed first recombinant FAD2 sequence, compared with the magnitude of the suppression of the FAD2 gene in the plant cell with a similar genetic environment and the second recombinant FAD2 sequence, which consists of more endogenous FAD2 sequence than the first recombinant FAD2 sequence;ii) expression of recombinant sequence FATB, capable of at least partially reduce the expression of FATB gene in the plant cell compared with the suppression of FATB in plant cell with a similar genetic environment, but not containing recombinant FATB sequence; (iii) the cultivation of plants with a recombinant molecule of nucleic acid containing the first recombinant FAD2 sequence and recombinant FATB sequence, and (iv) cultivation of plants, forming a seed with a lower content of saturated fatty acids compared with the seed of a plant having a similar genetic environment, but not containing the first recombinant FAD2 sequence and recombinant FATB sequence.

Another variant of implementation of the present invention relates to a method for obtaining transgenic plants, the seed of which is characterized by a lower content of saturated fatty acids, by: transformation of plant cells with recombinant molecule of nucleic acid containing a sequence of recombinant DNA, suppressing the endogenous expression of FAD2 and FATB, which includes the nucleic acid sequence of recombinant FAD2 gene and recombinant FATB gene, and the sequence of the FAD2 contains the entire sequence of the FAD2 intron; and cultivation of transgenic plants, forming behold the I with reduced content of saturated fatty acids, compared with the seed of a plant having a similar genetic environment, but not containing the sequence of recombinant DNA.

Another variant of implementation of the present invention relates to a method of modulation of fatty acid composition in the oil from the seeds of oil crops of the temperate zone by isolating the genetic element length equal to at least 40 nucleotides, capable of suppressing the expression of the endogenous gene in the pathway of fatty acid synthesis; create multiple short fragments of the genetic element; all short fragments into the plant cell oil crops of the temperate zone with the aim of creating transgenic plants and selecting a transgenic plant containing a shortened fragment of defined length and sequence, providing the desired change in the fatty acid composition of oil from the seed.

The present invention relates to the seeds of soybean oil composition which is characterized by a significantly lower content of saturated fatty acids and moderately high content of oleic acid and which contains the DNA sequence, the major endogenous expression of FAD2 in plant cell, the DNA sequence is a recombinant FAD2 sequence comprising a fragment of a FAD2 intron. Another variant implementation of the crust is asego invention relates to a nucleic acid molecule, containing the sequence of intron FAD2-1A in length from about 60 to about 320 consecutive nucleotides. An alternative implementation of the present invention also relates to seed of soybean containing the first sequence of recombinant DNA, which inhibits expression of the endogenous gene FAD2-1 soybean, including the FAD2 intron-1 of soybean, and the second sequence of recombinant DNA which expresses elevated levels of a gene selected from the group containing the gene KAS I, Delta-9-desaturase, KAS IV, and combinations thereof.

The present invention relates to a plant cell, seed soybean, characterized by the fatty acid composition of oils from seeds, in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total content of fatty acids and saturated fatty acids is less than 8 wt.% of the total content of fatty acids. The present invention relates to a plant cell, seed soybean, characterized by the composition of the oil, in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total content of fatty acids and the content of linolenic acid is less than about 3 wt.% of the total content of fatty acids.

The present invention relates also to a molecule nucleic kislota sequence of the FAD2 intron-1 in length from about 60 to about 320 consecutive nucleotides. In the scope of the present invention also includes the construction of recombinant DNA comprising a fragment of a FAD2 intron-1 of soybean in length from about 20 to about 420 consecutive nucleotides and a fragment of a gene of soybean FATB length from about 40 to about 450 consecutive nucleotides. Another variant implementation of the invention refers to a recombinant molecule of nucleic acid containing a first DNA sequence, suppressing the endogenous expression of FAD2-1 and FATB soy, which includes a fragment of a FAD2 intron-1 in length from about 20 to about 420 consecutive nucleotides of the 3'-UTR of soybean FATB, 5'-UTR of soybean FATB or coding region P, and the second sequence of recombinant DNA, which increases the expression of at least one of the genes selected from the group comprising beta-ketoacyl-ACP synthase IV and Delta-9-desaturase.

The present invention relates also to a pure soybean oil, in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total content of fatty acids and saturated fatty acids is from about 1.5 wt.% to about 8 wt.% of the total content of fatty acids; mixed soybean oil, in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total content of fatty acids and saturated fatty acids is about 8 wt.% or m is niche of the total content of fatty acids; to unmixed soybean oil, in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total content of fatty acids and the content of linolenic acid is less than 3 wt.% of the total fatty acids; and non-mixed soybean oil, in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total content of fatty acids, saturated fatty acids is about 8 wt.% or less of the total content of fatty acids and the content of linolenic acid is about 1.5 wt.% or less of the total content of fatty acids.

The present invention relates also to the soy flour obtained from the seed of soybean, characterized by the composition of fatty acids in the oil from the seeds, in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total content of fatty acids and saturated fatty acids is less than 8 wt.% of the total content of fatty acids. In the scope of the present invention also includes soy flour obtained from the seed of soybean, characterized by the composition of fatty acids in the oil from the seeds, in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total content of fatty acids and the content of linolenic acid is less than about 3 wt.% of the total content of the fatty acids.

The present invention relates also to a method of reducing the magnitude of the suppression of the FAD2 gene in comparison with the magnitude of the suppression of the FAD2 gene reached in the result of the expression constructs crnci containing heterologous FAD2 sequence, including all of the FAD2 intron or the entire FAD2 UTR, by: (i) expression of a heterologous FAD2 sequence in a plant cell, with heterologous FAD2 sequence allocated from the endogenous FAD2 gene plant cell, consists of a fragment of a FAD2 intron or fragment FAD2 UTR, and (ii) suppression of endogenous FAD2 gene heterologous FAD2 sequence, the value of the suppression of the FAD2 gene of magnitude less than the expression of the gene is reached in the result of expression of a heterologous FAD2 sequence, including all of the FAD2 intron or the entire FAD2 UTR.

The present invention relates also to a method of changing the composition of the oil plant cells by transformation of the plant cell a heterologous FAD2 sequence, selected from a portion of the endogenous FAD2 gene, which includes a fragment of a FAD2 intron or fragment FAD2 UTR, and growing the plant cell under conditions to initiate transcription of a heterologous FAD2 sequence, resulting in a change in the composition of the oil compared with plant cell with a similar genetic environment, but does not contain Asa heterologous FAD2 sequence.

The present invention relates also to a method of increasing the content of oleic acid and reduce the content of saturated fatty acids in the seed plants, which includes: (i) shortening the length of the first heterologous FAD2 sequence until at least partial reduction of the magnitude of the suppression of the FAD2 gene in plants transformed by the first heterologous FAD2 sequence, compared with the magnitude of the suppression of the FAD2 gene in the plant cell with a similar genetic environment and the second heterologous FAD2 sequence, which consists of more endogenous FAD2 sequence than the first heterologous FAD2 sequence, ii) the expression of heterologous FATB sequence capable of at least partially reduce gene expression FATB in the plant cell compared with the suppression of FATB in plant cell with a similar genetic environment, but does not contain the heterologous FATB sequence, iii) the cultivation of plants, including gene with a first heterologous FAD2 sequence and heterologous FATB sequence, and (iv) the cultivation of plants, forming a seed with a reduced saturated fatty acids compared with the seed of a plant having a similar genetic environment, but not containing a first heterologous posledovatelno the ü FAD2 and heterologous FATB sequence.

The present invention relates also to method of modulation of fatty acid composition in the oil from the seeds of oil crops of the temperate zone, marquee genetic element length equal to at least 40 nucleotides, capable of suppressing the expression of the endogenous gene in the pathway of fatty acid synthesis; introduction of specified genetic element in the plant cell oil crops of the temperate zone; the creation of transgenic plants and selecting a seed of transgenic plants containing the specified genetic element, modulating the fatty acid composition in the seed oil.

Another variant of implementation of the present invention relates to a cage seed soybean, characterized by the composition of fatty acids in the oil from the seeds, in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total content of fatty acids and saturated fatty acids is less than 8 wt.% of the total content of fatty acids.

The present invention relates also to a molecule heterologous nucleic acid comprising a fragment of a FAD2 intron-1 of soybean in length from about 20 to about 420 consecutive nucleotides and a fragment of a gene of soybean FATB length from about 40 to about 450 consecutive nucleotides. Another variant of implementation of the present invention refers to a molecule heterologous well Lanovoy acid, including the sequence of a nucleic acid that contains a fragment of a FAD2 intron-1 of soybean in length from about 20 to about 420 nucleotides, a fragment of the gene of soybean FATB length from about 40 to about 450 nucleotides and a nucleic acid sequence that increases expression of beta-ketoacyl-ACP synthase IV or Delta-9-desaturase or both together.

The present invention relates also to a method of reducing the content of linolenic acid in soybean seed by: i) introducing into the cell soybean molecule heterologous nucleic acid containing the nucleic acid sequence of at least two members of the gene family FD3; (ii) the expression of the nucleic acid sequence of the FAD2 gene capable of at least partially reduce the expression of endogenous FAD3 gene in a plant cell; (iii) the growing plant cell comprising a genome with nucleic acid sequence of at least two members of the FAD3 gene family; and (iv) culturing the specified plant cells with a reduced content of linolenic acid compared with plant cell with a similar genetic environment, but does not contain at least two members of the FAD3 gene family. The present invention relates also to the construction of recombinant DNA with DNA fragments of at least two members of the gene family is in FAD3.

The present invention relates also to a pure soybean oil, characterized by the composition of fatty acids in which the oleic acid content is from about 42 wt.% to about 85 wt.% of the total content of fatty acids, saturated fatty acids is about 8 wt.% or less of the total content of fatty acids and the content of linolenic acid is about 1.5 wt.% or less of the total content of fatty acids.

Brief description of figures

Figure 1-4 shows a typical configuration of a molecule of nucleic acid.

Figure 5(a)-(d) and 6(a)-(C) shows an illustrative configuration of the first set of DNA sequences.

7-20 shows the nucleic acid molecules of the present invention.

On Fig depicted design pMON68537.

On Fig depicted design pMON68539.

Detailed description of the invention

Description of the sequences of nucleic acids

SEQ ID NO:1 is the nucleic acid sequence of intron 1 FAD2-1A.

SEQ ID NO:2 is the nucleic acid sequence of intron 1 FAD2-1B.

SEQ ID NO:3 is the nucleic acid sequence of the promoter FAD2-1B.

SEQ ID NO:4 is the nucleic acid sequence of the genomic clone of the FAD2-1A.

SEQ ID NO:5 and 6 are sequences of nucleic acid to the slots respectively, the 3'-UTR and 5'-UTR FAD2-1A.

SEQ ID NO:7-13 are nucleic acid sequences respectively of introns 1, 2, 3A, 4, 5, 3B and 3C FAD3-1A.

SEQ ID NO:14 is the nucleic acid sequence of intron 4 FAD3-1C.

SEQ ID NO:15 is the nucleic acid sequence of incomplete genomic clone FAD3-1A.

SEQ ID NO:16 and 17 are sequences of nucleic acids, respectively 3'-UTR and 5'-UTR FAD3-1A.

SEQ ID NO:18 is the nucleic acid sequence of incomplete genomic clone FAD3-1B.

SEQ ID NO:19-25 are nucleic acid sequences respectively of introns 1, 2, 3A, 3B, 3C, 4 and 5 FAD3-1B.

SEQ ID NO:26 and 27 are sequences of nucleic acids, respectively 3'-UTR and 5'-UTR FAD3-1B.

SEQ ID NO:28 is the nucleic acid sequence of the genomic clone FATB-1.

SEQ ID NO:29-35 are sequences of nucleic acids, respectively introns I, II, III, IV, V, VI and VII FATB-1.

SEQ ID NO:36 and 37 are sequences of nucleic acids, respectively 3'-UTR and 5'-UTR FATB-1.

SEQ ID NO:38 is the nucleic acid sequence of the gene KAS I Cuphea pulcherrima.

SEQ ID NO:39 is the nucleic acid sequence of the gene KAS IV Cuphea pulcherrima.

SEQ ID NO:40 and 41 are nucleic acid sequences of genes Delta-9-desaturase respectively Ricinus communis and Simmondsia chinensis.

SEQ ID NO:42 is a sequence n is Cleanaway acid FATB cDNA-2.

SEQ ID NO:43 is the nucleic acid sequence of the genomic clone FATB-2.

SEQ ID NO:44-47 are sequences of nucleic acids, respectively introns I, II, III and IV FATB-2.

SEQ ID NO:48-60 are sequences of nucleic acid primers for polymerase chain reaction (PCR).

SEQ ID NO:61 and 62 are sequences of nucleic acids, respectively 3'-UTR and 5'-UTR FAD3-1 soy.

Definitions

“ACP” means allerease protein. “Changed the composition of the oil from the seeds” means the composition of the oil from the seeds of transgenic or transgenic plants of the present invention with altered or modified levels of fatty acids in comparison with the oil from the seeds of a plant having a similar genetic environment, but not further transformation.

“Suppression " antisense sequence” means especificly silencing induced by the introduction of a molecule antisense RNA.

“Coexpressed more than one agent, such as mRNA or protein” means the simultaneous expression of the agent in overlapping time frames and in the same cell or tissue with another agent. Coordinated expression of more than one agent” means coexpression several agents that produce transcripts and proteins using about the his or the same promoter.

“Complement” nucleic acid sequence indicates the complement of the sequence throughout its length.

“Compresse” means the reduction of expression levels, usually at the level of RNA, a specific endogenous gene or family of genes in the expression of homologous semantic structure capable of transcribing an mRNA with the same number of circuits as the transcript of the endogenous gene. Napoli et al., Plant Cell 2:279-289 (1990); van der Krol et al., Plant Cell 2:291-299 (1990).

“Crude soybean oil” means soybean oil extracted from the seeds of soybean, which was not purified, processed or mixed, although such oils can be removed with a resinous substance.

“P” means the transit peptide of the chloroplast-encoded “coding sequence of the transit peptide chloroplast”.

With respect to proteins and nucleic acids, the term “isolated” means direct (e.g., determining the sequence of a known protein or nucleic acid and the creation of a protein or nucleic acid with a sequence that is similar to at least part of the sequence of the known protein or nucleic acid) or indirect (for example, obtaining a protein or nucleic acid from the body, akin to a known protein or nucleic acid) obtaining a protein or nucleic acid from zvezdnogo protein or nucleic acid. The specialist in this area should be known to other methods of “selection” of a protein or nucleic acid of known protein or nucleic acid.

Double-stranded RNA (“dsrnas”), interfering double-stranded RNA (“crnci”) and interfering RNA (“MKI”) are used to determine especifismo silencing caused by the introduction of a design capable of transcribing the molecule at least partially double-stranded RNA. “Molecule dsrnas” and “molecule of Rnci” means the area of RNA molecules containing segments with complementary nucleotide sequences, which can hybridisierung with each other and form a double-stranded RNA. Such molecules are double-stranded RNA, when introduced into a cell or organism capable of at least partially reducing the level of mRNA present in the cell or the cell body. In addition, dsrnas can be created by the Assembly in vivo of the respective DNA fragments by illegitimate recombination and site-specific recombination, described in international patent application number PCT/US2005/004681, filed February 11, 2005, which is fully incorporated into the present description by reference.

“Exon” refers to the segment of molecules of nucleic acid, usually DNA that encodes a part or the whole of the expressed protein.

“Fatty key is lot” means free fatty acids and acyl groups of fatty acids.

“Gene” means a nucleic acid sequence that includes the 5'-end promoter region associated with a gene expression product, any region of intron and exon, 3'- or 5'-terminal untranslated region associated with the expression of the gene product.

“Gene silencing” refers to the suppression of gene expression or decrease in gene expression.

“A family of genes” means two or more genes in the body that encode proteins with similar functional properties, and “member of the family gene” means any gene family of genes found in the genetic material of a plant, such as a family member FAD2 gene” is any gene FAD2 found in the genetic material of plants. Example two members of the gene family are FAD2-1 and FAD2-2. Family genes can be further classified according to similarity of nucleic acid sequences. Gene FAD2, for example, includes alleles in this locus. Member of the gene family preferably characterized by at least 60%, more preferably at least 70%, more preferably at least 80% identity nucleic acid sequence in the coding sequence of a gene.

“Heterologous” means not existing together in natural conditions.

The nucleic acid molecule to the slots is considered to be “entered”, if it is introduced into the cell or organism as a result of manipulation by the person regardless of the method of administration. Examples of the introduced nucleic acid molecules include, but are not limited to, nucleic acids that have been introduced into cells by transformation, transfection, injection and projection, and nucleic acids are introduced into the body by methods that include, but are not limited to, conjugation, endocytosis and phagocytosis.

“Intron” refers to the segment of molecules of nucleic acid, usually DNA that does not encode a portion of the expressed protein and in which the endogenous conditions transcribed into RNA molecules, but spiceroads of endogenous RNA before RNA is translated into protein. “Molecule dsrnas intron” and “molecule of Rnci intron” refers to a molecule of double-stranded RNA, which when introduced into a cell or organism capable of at least partially reducing the level of mRNA present in the cell or the cell body, while a molecule of double-stranded RNA sufficiently identical to the intron of a gene present in a cell or organism, to reduce the level of mRNA that contains the sequence of an intron.

The composition of the oil with low saturated fatty acids” includes from 3.6% to 8% saturated fatty acids.

The seed of soybean with an average oleic acid content is the means seed, containing from 50% to 85% oleic acid in the oil of the seed.

The composition of the oil with low content of linolenic acid contains less than about 3 wt.% linolenic acid of the total fatty acids.

The term “non-coding” is used to define sequences of nucleic acid molecules that do not encode a portion of the expressed protein. Non-coding sequences include, but are not limited to, introns, promoter region, 3'end untranslated region (3'-UTR) and 5'-terminal untranslated region (5'-UTR).

The term “composition of the oil is used for determining the content of fatty acids.

The promoter, which is functionally linked one or more nucleic acid sequences capable of causing the expression of one or more nucleic acid sequences, including many coding or non-coding nucleic acid sequence having a polycistronic configuration.

“Physically linked nucleic acid sequence are sequences of nucleic acids that are present in one molecule of nucleic acid.

“Plant” means whole plants, plant organs (e.g. leaves, stems, roots etc), seeds, plant cells and their progeny.

The term “plant cells is a” means not limited to, suspension cultures of seeds, embryos, meristematic region of callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspora.

“Plant promoter” refers not limited to, viral promoters plants, promoters isolated from plants, and synthetic promoters capable of functioning in a plant cell, stimulating the expression of mRNA.

“Polycistronic gene” or “a polycistronic mRNA” refers to any gene or mRNA containing the transcribed nucleic acid sequence that correspond to the nucleic acid sequences of more than one gene being directed impact to suppress or expression. It is known that such a polycistronic genes or mRNA can contain a sequence corresponding to introns, 5'-UTR, 3'-UTR, coding sequence of the transit peptide, exons or their combinations, and that recombinant polycistronic gene or mRNA can contain, without limitation, the sequence corresponding to one or more UTR of a gene and one or more introns of the second gene.

“Semispecific promoter” means a promoter that preferentially or exclusively active in the seed. “Preferred activity” means the activity is of promotora, which is much higher in the seed than in other tissues, organs or organelles of the plant. The term “semispecific” means, without limitation, the activity in the aleurone layer, endosperm and/or embryo of a seed.

“Suppression of semantic intron” refers to the silencing of a gene caused by the introduction of semantic intron or fragment. Suppression of semantic intron is described, for example, Fillatti in PCT publication WO 01/14538 A2.

“Simultaneous expression of multiple agents, such as mRNA or protein, means the expression of the agent concurrently with another agent. This expression may overlap only partially, and may also occur in different tissues or at different levels.

“The total content in oil” means the total content of fatty acids regardless of the type of fatty acids. Used here is in the definition of “the total content in oil is not included glycerol backbone.

“Transgene” means a nucleic acid sequence that is associated with the expression of a gene introduced into the body. The transgene includes, but is not limited to, the endogenous gene or a gene missing in the body in vivo. “Transgenic plant” is any plant stably containing the transgene, with the possibility of its transmission plant by sexual or vegetative reproduction.

the remaining oil with zero saturated fatty acids” includes not less than 3.6% of saturated fatty acids.

With respect to proteins and nucleic acids in the present description of the invention the usual uppercase letters, such as “FAD2”, denote enzyme, protein, polypeptide or peptide, and capital letters, printed in italics, for example“FAD2”, are used to refer to nucleic acids, including, without limitation, genes, cDNA and mRNA. The cell or organism can contain a collection of several genes encoding a specific enzyme, and the capital letter following the designation of the gene (a, b, C), means a family member, that is, FAD2-1A is a member of a family of genes that is different from the FAD2-1B.

Used here, the value at any specified range are the end values of this range except where otherwise noted.

A. Agents

The agents according to the present invention preferably are “biologically active” in relation to the structural characteristic, such as the ability of a molecule of nucleic acid to hybridisierung with another nucleic acid molecule, or the ability of the protein to contact an antibody (or to compete with another molecule for such binding). Alternative such sign may be defined as catalytically active and, thus, may include the ability of the agent to mediate a chemical reaction or response. These agents prefer is Ino are “essentially pure”. The term “essentially pure” is used herein is meant a molecule that is separated essentially from all other molecules associated with it in natural environments. More preferably essentially pure molecule is the predominant type present in the drug. Essentially pure molecule may be more than 60%, more than 75%, preferably more than 90% and most preferably more than 95% purified from other molecules (excluding solvent)present in the natural mixture. In the definition of the term “essentially pure” is not composed of molecules found in natural environments.

The agents according to the present invention can also be recombinant. Used here is the term “recombinant” refers to any agent (e.g., including, without limitation, DNA or peptide), which is obtained, however, by an indirect method, as a result of manipulation of the nucleic acid molecule man. In addition, the agents according to the present invention may be labeled with reagents that facilitate detection of the agent, such as fluorescent labels, chemical labels, and/or modified bases.

The agents according to the present invention include DNA molecules containing a nucleotide sequence that can is t to be transcribed in sense or antisense orientation, resulting in at least one RNA molecule, which at least partly is double-stranded. In a preferred embodiment of the invention, the agent of the present invention is a molecule of double-stranded RNA containing a nucleotide sequence that is a fragment of FAD2, FATB or FAD2 and FATB. In another embodiment of the invention, the agent of the present invention is a DNA molecule that can be transcribed with the formation of the nucleotide sequence in sense or antisense orientation in the cell host. In another embodiment of the invention the nucleic acid molecule can contain the nucleotide sequence in sense and antisense orientation, or in another embodiment of the invention the nucleic acid molecule can contain the nucleotide sequence in sense or antisense orientation. Such nucleotide sequences may be functionally linked to the same promoter, different promoters, one of the promoters or multiple promoters. Such nucleotide sequences can be in the same DNA molecule or a few molecules of DNA.

The agents according to the present invention include nucleic acid molecules containing a sequence is lnost DNA which throughout the length of at least 50%, 60% or 70% identical to the coding or non-coding region of a plant of any nucleic acid sequence complementary to the coding or non-coding region of a plant. More preferred are DNA sequences that throughout the length of at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to the coding or non-coding region of a plant, or a nucleic acid sequence complementary to the coding or non-coding region of a plant.

The term “identity”, as is well known in this area, means the relationship between two or more polypeptide sequences or between two or more sequences of nucleic acid molecules, determined by comparing these two sequences. In this area the term “identity” also means the degree of relatedness between polypeptide sequences and the sequences of the nucleic acid molecules defined when comparing circuits such sequences. “Identity” can be easily calculated by the known methods which include, but are not limited to, the methods described in the publications byComputatinal Molecular Biology , Lesk, ed., Oxford University Press, New York 1988;Biocoinputing: Informatics and Genome Projects, Smith, ed., Academic Press, New York 1993;Computer Analysis of Sequence Data, Part I, Griffin and Griffin, eds., Humana Press, New Jersey 1994;Sequence Analysis in Molecular Biologyvon Heinje, Academic Press 1987;Sequence Analysis Primer, Gribskov and Devereux, cds., Stockton Press, New York 1991; and Carillo and Lipman, SIAMJ Applied Math, 48:1073 1988.

Methods to determine identity are designed to identify the best fit between the analyzed sequences. In addition, methods for determining the identity codified in public programs. Computer programs that can be used to determine the identity of two sequences include, but are not limited to, the GCG; package of five BLAST programs, of which three programs are designed to query the nucleotide sequences (BLASTN, BLASTX, and TBLASTX) and two are for a query protein sequences (BLASTP and TBLASTN). The BLASTX program can be purchased at NCBI and other sources, such as BLAST Manual, Altschul et al., NCBI NLM NIH, Bethesda, MD 20894; Altschul et al., J. Mol. Biol. 215:403-410 (1990). Identity can also use a well-known algorithm of Smith-Waterman.

When comparing the polypeptide sequences of usually the parameters are the following: algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); matrix comparison: BLOSSUM62 from the publication Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA 89:10915-10919 (1992) the penalty for gap: 12; the penalty for a gap length: 4. The program, which can be used with the above parameters is publicly available program known as the program “breaks” the company Genetics Computer Group (“GCG”), Madison, Wisconsin. The above parameters along with no penalty for end gap are the default settings for comparison of peptides.

When comparing the sequences of the nucleic acid molecules are used in the following: algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); matrix comparison: matches - +10; mismatch = 0; penalty for gap: 50; the penalty for the length of the gap: 3. Used here, the value “% identity” is defined using the above settings as the default settings for the comparison of sequences of nucleic acid molecules and the program “breaks” the company's GCG, version 10.2.

Subsets of the sequences of the nucleic acids of the present invention include the fragmented nucleic acid molecules. “The fragmented nucleic acid molecule” means a portion of a larger nucleic acid molecule and may consist of part or most part of a larger nucleic acid molecule. The fragmented nucleic acid molecule can include oligonucleotide smaller length from about 15 to about 400 serial is nucleotides and more preferably from about 15 to about 45 consecutive nucleotides, from about 20 to about 45 consecutive nucleotides, from about 15 to about 30 consecutive nucleotides, from about 21 to about 30 consecutive nucleotides, from about 21 to about 25 consecutive nucleotides, from about 21 to about 24 consecutive nucleotides, from about 19 to about 25 consecutive nucleotides, or about 21 consecutive nucleotides. The fragmented nucleic acid molecule can comprise a significant portion or the greatest part of the coding or noncoding region of a plant or alternatively can include oligonucleotides shorter length. In a preferred embodiment of the invention the fragment is characterized by a 100% identity with the coding or non-coding region of a plant. In another preferred embodiment of the invention, the fragment includes part of a larger nucleic acid sequence. In another embodiment of the invention fragmented nucleic acid molecule contains a nucleic acid sequence that includes at least 15, 25, 50, 100, 200, 300 or 400 consecutive nucleotides of the nucleic acid molecules of the present invention. In a preferred embodiment of the invention the nucleic acid molecule contains a sequence of nucleic acid, which includes graynamore 15, 25, 50, 100, 200, 300, or 400 consecutive nucleotides of the coding or noncoding region of a plant. In the most preferred embodiment of the invention the nucleic acid molecule contains a sequence of nucleic acid, which includes approximately 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80 or 90% consecutive nucleotides of the entire coding or non-coding region. In a preferred embodiment of the invention, the entire coding or non-coding region may be a genetic element selected from the entire gene, one exon, one intron, signal sequence or untranslated region (UTR). A genetic element that does not contain the full sequence of all the genetic element may be a fragment of the genetic element. In a preferred embodiment of the present invention is a genetic element has a length equal to at least 40 nucleotides. In one embodiment of the present invention, the gene fragment is part of the genetic element, this fragment contains a sequential nucleotides to about 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80 or 90% of the total genetic element. In one embodiment, the present invention fragmented nucleic acid molecule corresponds to about 5%-80%, about 10%-70%, about 10%-60%, PR is about 10%-50%, approximately 25%-60%, about 25%-50%, about 40%-60%, about 40%-80%, about 50%-90% of the length of the genetic element.

In a preferred embodiment of the invention, a fragment of intron FAD2-1 comprising from about 20 to about 420, from about 30 to about 420, from about 40 to about 320, from about 50 to about 200, from about 50 to about 400, from about 50 to about 420,from about 60 to about 320, from about 70 to about 220, from about 100 to about 200, from about 100 to about 320, from about 150 to about 200, from about 150 to about 220, from about 150 to about 400, from about 200 to about 300 or from about 300 to about 400 consecutive nucleotides. In another preferred embodiment of the invention, a fragment of intron FAD2-1 has a length equal to about 100, about 150, about 200, about 220, about 250, about 300, about 320 or 350 consecutive nucleotides. In another preferred embodiment of the invention the length of the fragment of intron FAD2-1 is reduced by about 20, about 40, about 60, about 80, about 100, about 120, about 140, about 160, about 180, about 200, about 220, about 240, about 260, about 280, about 290, about 300, about 320, about 340, about 360, about 380, about 400 consecutive nucleotides compared with a length of SEQ ID NO:1. In all of these fragments of intron FAD2-1, all the giving or deletion can be initiated at the 5'-end, 3'-end, or inside of a FAD2 intron-1. In all of these fragments of FAD2 intron-1 sequence of the FAD2 intron-1 can be represented as SEQ ID NO:1.

In a preferred embodiment of the invention a fragment of the FATB gene comprises from about 80 to about 450, from about 100 to about 500, from about 70 to about 500, from about 200 to about 400, from about 150 to about 300, from about 250 to about 350, from about 200 to about 350 consecutive nucleotides FATB gene. In a preferred embodiment of the invention the fragment FATB allocate half of all nucleotides FATB, starting with the 5'-end. In all of these fragments FATB truncation or deletion can be initiated at the 5'-end 3'-end or inside FATB. In a preferred embodiment of the invention the fragment FATB allocate half of all nucleotides FATB, starting with the 5'-end FATB, of the third part all of the nucleotides FATB closest to the 5'-end. In a particularly preferred embodiment of the invention the fragment FATB contains the coding sequence of the transit peptide, which preferably encodes the transit peptide of the chloroplast. In a particularly preferred embodiment of the invention the fragment FATB is a fragment of the coding sequence of the transit peptide, which preferably encodes the transit peptide of the chloroplast. In another, especially predpochtitel the nom, the embodiment of the invention the fragment FATB additionally includes about 20, about 25, about 30, about 35, 38, 39, 40, 41, 42, 43, about 45, about 50, about 55, or about 60 consecutive nucleotides of the 5'-UTR FATB. In the most preferred embodiment of the invention, the fragment includes a combination of two or more non-contiguous fragments or separate genetic elements, such as 3'-UTR FATB, fused to the 5'-UTR FATB. The agents according to the present invention include nucleic acid molecules. For example, in one embodiment of the invention the nucleic acid molecule of the present invention includes, but is not limited to, the sequence of intron SEQ ID NO:19, 20, 21, 22, 23, 25, 32, 33, 34, 35, 44, 45, 46 or 47 or their fragments or complements. In another embodiment of the invention the nucleic acid molecule includes a nucleic acid sequence which, when introduced into the cell or organism is able to suppress the production of RNA or protein while expression, co-expression or co-ordinated expression of other RNA or protein. In one embodiment of the invention the nucleic acid molecule includes the nucleic acid sequence, which when introduced into a cell or organism capable of inhibiting, at least partially reduce, reduce, significantly reduced the ü or effectively eliminate the expression of endogenous RNA FAD2, FAD3 and/or FATB while expression, co-expression or co-ordinated expression of at least one product RNA or protein beta-ketoacyl-ACP synthase I, β-ketoacyl-ACP synthase IV, Delta-9-desaturase and/or CP4 EPSPS protein.

As a result of repression, at least partially reduce, reduce, significantly reduce or effectively eliminate the expression of at least one or more endogenous genes in plant cell decreases the amount of FAD2 and/or FAD3, i.e. reduced levels of the protein in a stable state, and can be reduced percentage of polyunsaturated fatty acids, such as linoleic (C18:2) and linolenic (C18:3). Modification of fatty acid composition, suitable for inclusion in triacylglyceride may influence the composition of the oils in the plant cell. Thus, reduced expression of FAD2 and/or FAD3 can cause an increase in the proportion of monounsaturated fatty acids, such as oleate (C18:1). When reducing the number of FATB in plant cell is the reduction of saturated fatty acids such as palmitate and stearate. Thus, reduced expression of FATB may cause an increase in the proportion of unsaturated fatty acids such as oleate (18:1). The simultaneous suppression of the expression of FAD2, FAD3, and FATB directs the FAS path in the direction of increasing monounsaturated fatty acids, with whom containing a series of 18 carbon atoms, such as oleate (C18:1). Cm. U.S. patent No. 5955650.

By increasing the number of beta-ketoacyl-ACP synthase I (KAS I) and/or beta-ketoacyl-ACP synthase III (KAS IV) in plant cell can be reduced, the percentage of 16:0-ACP, which causes an increase in the percentage of 18:0-ACP. A greater amount of 18:0-ACP in conjunction with simultaneous suppression of one or more genes FAD2, FAD3, and FATB allows to increase the content of oleate (C18:1) in the oil. By increasing the number of Delta-9-desaturase in plant cell can be increased, the percentage of unsaturated fatty acids, which causes the decrease of the stearate and the total content of saturated fatty acids.

These combinations of high or low expression of enzymes can be manipulated to obtain oil compositions comprising fatty acids, with a high level oleate, low levels of linoleate, linolenate, stearate and/or palmitate and low total saturated fatty acids. Gene expression in plants can be enhanced by introducing additional copies of the coding sequences of genes into the plant cell or preferably by introduction of additional copies of the coding sequences of the gene into the genome of plants. Overexpression can be achieved in financial p is either increased activity of regulatory mechanisms, which regulate the expression of genes, that is, increase gene expression.

The production of the CP4 EPSPS protein in plant cell reports plant cell resistance or tolerance to glyphosate, which is a convenient method of identifying successful transformants on the basis of resistance to glyphosate.

Suppression of gene expression in plants, also known as gene silencing occurs on the transcriptional level and at the post transcriptional level. There are different methods of suppressing the expression of endogenous sequences in the cell host, which include, but are not limited to, suppression of the antisense sequence, cosuppression, ribozymes, combinations of sense and antisense double-stranded interfering RNA silencing by promoter and DNA-binding proteins, such as proteins are zinc finger region. (See, for example, WO 98/53083, WO 01/14538 and U.S. patent No. 5759829 (Shewmaker)). Some of these mechanisms are associated with the homology of nucleic acids at the level of DNA or RNA. This homology indicates the similarity in DNA or protein sequences in the same form or in different forms. Silencing of the gene occurs, if the DNA sequence introduced into the cell host, so the homologous endogenous gene, the transcription of the input sequence D Is To cause transcriptional or posttranscriptional silencing of the endogenous gene. Homology sufficient to suppress expression at steady state may correspond to at least 50%, about 60% or about 70% identity to the entire DNA sequence of the coding or noncoding region of a plant of any nucleic acid sequence complementary to the coding or non-coding region of a plant. More preferred are DNA sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to the coding or non-coding region of a plant, or a nucleic acid sequence complementary to the coding or non-coding region of a plant. In the plant-specific sequence silencing can cause molecules of double-stranded RNA. Silencing of the gene is often defined as the interference double-stranded RNA (“crnci”) in plants, RNA interference or Rnci in Caenorhabditis elegans and animals as suppression of mushrooms.

In a preferred embodiment of the invention the nucleic acid molecule of the present invention includes the first set of DNA sequences, each of which has sufficient homology with one or more coding or non-coding serial what inotai gene plants, so in the case of the expression of this sequence can effectively remove, significantly reduce, or at least partially reduce the level of transcript or protein mRNA, encoded gene, which was isolated coding or non-coding sequence, or any gene, homologous to the coding or non-coding sequence of the target.

In a preferred embodiment of the invention the nucleic acid molecule of the present invention includes: a first set of DNA sequences, each of which has sufficient homology with one or more coding or non-coding sequences of a gene of a plant, so in the case of the expression of this sequence can effectively remove, significantly reduce, or at least partially reduce the level of transcript or protein mRNA, encoded gene, which was isolated coding or non-coding sequence, or any gene, homologous non-coding target sequence, and (b) a second set of DNA sequences, each of which has sufficient homology with the genome of the plant, so in the case of the expression of this sequence can at least partially enhance, increase or significantly increase ur the level of transcript or protein mRNA, the encoded data of the genome.

Used here is the “totality” of DNA sequences can represent one or more sequences coding or not coding for protein. For example, the first set of DNA sequences may include only the promoter, coding region and terminator. The second set of DNA sequences may or may not be present after or before the first set of DNA sequences.

Used here has the meaning of “reduction” of the level or quantity of an agent, such as a protein or mRNA that means reducing the level or quantity compared with the cell or organism in which there is no DNA sequence capable of reducing the content of this agent. For example, “at least a partial reduction” means a reduction by at least 25%, “significant reduction” means a reduction of at least 75%, and “effective removal” shall mean reduction of more than 95%, all of which reduce the levels or amounts of the agent are determined in comparison with the cell or organism in which there is no DNA sequence capable of reducing the content of this agent.

Used here is “increased” or “increased” level or amount agent such as a protein or mRNA, oz ACHAT, the level or number above level or amount of agent present in the cell, tissue or plant with a similar genetic environment, but in the absence of the introduced nucleic acid molecule that encodes the protein or mRNA. For example, “at least in part to higher level means an increase of at least 25%, “significantly elevated” level means an increase of at least 100%, at all zoom levels or quantity of the agent is determined by comparison with the level or amount of agent present in the cell, tissue or plant with a similar genetic environment, but in the absence of the introduced nucleic acid molecule that encodes the protein or mRNA. In a preferred embodiment of the invention, increased expression can be any expression, when the protein is heterologous to the system. For example, the expression of the CP4 EPSPS protein may be an increase in the expression if the plant was absent expression prior to the introduction of a nucleic acid molecule that encodes this protein.

Comparison of the levels of the agent are preferably performed in organisms with similar genetic environment. Such genetic environment preferably takes place in the case when the compared organisms sequences are characterized by 50% or more, more preferred is equipment 75% or more and more preferably 90% or greater identity to the nuclear genetic material. In another preferred embodiment of the invention similar genetic environment takes place in the case when the compared organisms are plants and these plants are isogenic except for any genetic material originally introduced methods of transforming plants. The level or amount of the agent can be measured by any acceptable method, non-limiting examples of which include a comparison of the levels of mRNA transcript levels, protein or peptide and/or phenotype, especially the composition of the oil. Used here is the mRNA transcripts include versions and reprezentirovanii mRNA transcripts, and proteins or peptides include proteins or peptides with posttranslational or without modification.

The DNA sequence of a first set of DNA sequences can be coded sequences, sequences of introns, sequences 3'-UTR, sequences 5'-UTR, promoter sequences, other non-coding sequences, or any combination of these sequences. The first set of DNA sequences encodes one or more sequences, in which case the expression is capable of selectively reducing the level of protein or transcript or protein and the transcript is, encoded by a gene selected from the group comprising FAD2, FAD3, and FATB. In a preferred embodiment of the invention the first set of DNA sequences able to Express antisense RNA, in which a separate antisense sequences can be linked in a single transcript or they can be unrelated individual transcripts. In another preferred embodiment of the invention the first set of DNA sequences is physically associated sequence that can Express one molecule of dsrnas. In another preferred embodiment of the invention the first set of DNA sequences able to Express the semantic kompressornoy RNA, in which a separate semantic sequences can be linked in a single transcript or they can be unrelated individual transcripts. Typical variants of the first set of DNA sequences found in part In the detailed description of the invention and in the examples.

The second set of DNA sequences encodes one or more sequences, in which case the expression can increase the level of protein or transcript or protein and transcript encoded by a gene selected from the group including Beth is-ketoacyl-ACP synthase I (KAS I), beta ketoacyl-ACP synthase III (KAS IV), Delta-9-desaturase and SP4 EPSPS protein. The DNA sequence of the second set of DNA sequences can be physically related sequences. Typical variants of the second set of DNA sequences below in parts C and D for detailed description of the invention.

Thus, the present invention relates to a method of modifying fatty acid composition and compounds containing such fatty acids, such as oils, waxes and fats. The present invention relates also to a method of production of certain fatty acids in plant cells-hosts. Such methods involve the use of polygenic expressing clusters presented in this description of the invention, for modifying the path of FAS in plant cell host.

C. the First set of DNA sequences

In one embodiment of the present invention the nucleic acid molecule includes a first set of DNA sequences, which when introduced into a cell or organism expresses one or more sequences capable of effectively eliminating, substantially reducing, or at least partially reduce the levels of transcripts of mRNA or protein encoded by one or more genes. Preferred options Khujand is the implementation of the invention include as a target endogenous gene, gene plants and non-viral gene. In one embodiment of the present invention, the gene is a gene FAD2, FAD3, or FATB.

In one embodiment of the invention the nucleic acid molecule of the present invention includes a DNA sequence having substantial homology with one or more coding or non-coding sequences of a gene of a plant, which, with the introduction and expression in a plant cell or plant can effectively remove, significantly reduce, or at least partially reduce the level of transcript or protein mRNA, encoded gene, which was isolated coding or non-coding sequence. DNA sequences in the first set of DNA sequences transcribers sequence RNA or RNA fragments that are at least 90%, preferably at least 95%, more preferably at least 98% and most preferably 100% identical to the coding or non-coding region isolated from the suppressed gene. Such a percent identity might be compared with another fragment of the nucleic acid.

Non-coding sequence is preferably the 3'-UTR, the 5'-UTR, part of a sequence that encodes a protein or intron from the gene in plants. More preferably nicodemous the I sequence is a promoter sequence, 3'-UTR, the 5'-UTR or intron from the gene in plants. The intron may be localized between exons in the 5'-UTR or the 3'UTR of the gene of the plant. The coding sequence preferably is part of the protein coding framework.

One or more sequences in the first set of DNA sequences can be designed to produce dsrnas, semantic suppressor RNA, antisense RNA, or any other suppressor transcript to achieve the desired effect when introduced into the plant cell or plant. This sequence DNA can be fragmented by the nucleic acid molecule.

Plant introns can be any plant intron of the endogenous or introduced gene. Nucleic acid sequence such introns of organisms can be obtained or isolated from many sources, which include, but are not limited to, databases such as EMBL and Genbank gene Bank, which can be found on the Internet at the addresses ebi.ac.uk/swisprot/; expasy.ch/; embl-heidelberg.de/ and ncbi.nlm.nih.gov. Nucleic acid sequence such introns can also be obtained without any restrictions from sources such as the program GENSCAN, which can be found on the Internet at the address genes.mit.edu/GENSCAN.html.

Additional introns can also be obtained by methods that include, but are not graniteware them screening of the genomic library with a probe sequences of known exon or intron, comparison of the genomic sequences with the corresponding cDNA sequence, or cloning intron, such as soybean cDNA, by the comparative analysis of genomic sequence from another organism, such as, for example, Arabidopsis. In addition, the specialist in this field must be known to the other nucleic acid sequence of the introns. The above-described methods can also be used for isolation and other non-coding sequences, which include, but are not limited to, promoter sequences, the sequence 3'-UTR and the sequence 5'-UTR.

Gene “FAD2”, “Δ12 desaturase” or “omega-6-desaturase” encodes the enzyme (FAD2), capable of catalyzing the introduction of double bonds in the acyl portion of the fatty acids in the twelfth position from the carboxyl end. The term “FAD2-1” is used to denote the FAD2 gene, which is specific downregulation in vivo in the tissue of the seed, and the term “FAD2-2” is used to denote the FAD2 gene, which: (a) differs from the gene FAD2-1 and (b) expressed in natural conditions in many tissues, including the seed. Typical sequence of FAD2 include, but are not limited to, the sequence represented in the application for U.S. patent No. 10/176149, filed June 21, 2002, and in SEQ ID NO:1-6.

Gene “FAD3”, “Δ15 desaturase” or “omega-3-desaturase” encodes the enzyme (FAD3), capable of catalyzing the introduction of double bonds in the acyl portion of the fatty acids in the fifteenth position from the carboxyl end. The terms “FAD3-1, FAD3-A, FAD3-B and FAD3-C” are used to denote members of the FAD3 gene family that are expressed in vivo in many tissues, including the seed. Typical FAD3 sequences include, but are not limited to, the sequence represented in the application for U.S. patent No. 10/176149, filed June 21, 2002, and in SEQ ID NO:7-27.

Gene “FATB” or “Palmitoyl-ACP-thioesterase” encodes the enzyme (FATB), able to catalyze the hydrolytic cleavage of the thioester complex carbon-sulfur pentacerotidae group, Palmitoyl-ACP as the preferred response. The specified enzyme can also catalyze the hydrolysis of other complex ACP thioesters of fatty acids. Typical sequence of FATB-1 include, but are not limited to, the sequence represented in the provisional application for U.S. patent No. 60/390185, filed June 21, 2002; U.S. patent No. 5955329, 5723761, 5955650 and 6331664 and SEQ ID NO:28-37. Typical sequence of FATB-2 include, but are not limited to, the sequences shown in SEQ ID nos:42-47.

C. a Second set of DNA sequences

In one embodiment of the present invention the nucleic acid molecule contains a second set of DNA sequences, which when introduced into a cell or organism is able to partially increase, increase, increase or significantly increase the levels of transcripts of mRNA or protein encoded by one or more genes. In one embodiment of the present invention, the gene is an endogenous gene. In another embodiment of the present invention the gene may be a heterologous gene. In a preferred variant of the invention, the heterologous and endogenous genes may be present in the same nucleic acid molecule. In one embodiment of the present invention, the gene is a gene of a plant. In another embodiment of the present invention, the gene is truncated gene, while the truncated gene capable of catalyzing a reaction catalyzed by the complete genome. In one embodiment of the present invention, the gene is a gene beta-ketoacyl-ACP synthase I gene beta-ketoacyl-ACP synthase IV gene Delta-9-desaturase, gene CP4 EPSPS protein, or a combination of these genes.

The gene of the present invention can be any gene, an endogenous or introduced. Nucleic acid sequence of such genes can be obtained from the many sources, which include, but are not limited to, a database such as EMBL and Genbank, which can be found on the Internet at the addresses ebi.ac.uk/swisprot/; expasy.ch/; embl-heidelberg.de/ and ncbi.nlm.nih.gov. Nucleic acid sequence of such genes can also be obtained from sources such as the program GENSCAN, which can be found on the Internet at the address genes.mit.edu/GENSCAN.html.

Additional genes can also be obtained by methods that include, but are not limited to, the screening of the genomic library or cDNA library with a probe sequences of known genes, cloning of the gene by comparative analysis with the gene or probe from another organism, such as, for example, Arabidopsis. In addition, the specialist in this field must be known to the other nucleic acid sequence genes. Additional genes can be, for example, amplified using polymerase chain reaction (PCR) and used in one embodiment of the present invention. In addition, the specialist in this field must be known to the other nucleic acid sequence genes.

Automated nucleic acid synthesizers can be used for this purpose, and also for the creation of a molecule of nucleic acid having the sequence found in the cell or organism. In addition to this synthesis of molecules of the nucleic acid can be used to identify primer pairs, which can be used when performing PCR amplification, and obtain any desired nucleic acid molecule or fragment of the first gene.

Gene “KAS I” or “beta ketoacyl-ACP synthase I” encodes the enzyme (KAS I)capable of catalyzing the elongation of the acyl part of the fatty acid to the formation of Palmitoyl-ACP (C16:0). Typical sequence of KAS I include, but are not limited to, the sequences shown in U.S. patent No. 5475099, PCT publication WO 94/10189 and SEQ ID NO:38.

Gene “KAS IV” or “beta ketoacyl-ACP synthase IV encodes the enzyme (KAS IV)capable of catalyzing the condensation of acyl-ACP with an average chain length and increase the production of 18:0-ACP. Typical sequence of KAS IV include, but are not limited to, the sequences shown in PCT publication WO 98/46776 and SEQ ID NO:39.

Gene Delta-9-desaturase”, “stearoyl-ASR-desaturase or omega-9-desaturase” encodes an enzyme capable of catalyzing the introduction of double bonds in the acyl portion of the fatty acids in the ninth position from the carboxyl end. Preferred Delta-9-desaturase of the present invention is a plant or bacterial Delta-9-desaturase and more preferably Delta-9-desaturase, which is also found in an organism selected from the group comprising Cartharmus tinctorius, Ricinus communis, Simmonsia chinensi and Brassica campestris. Typical sequence of Delta-9-desaturase include, but are not limited to, the sequences shown in U.S. patent No. 5723595 and SEQ ID NO:40-41.

Gene CP4 EPSPS protein” or “CP4 5-enolpyruvylshikimate-3-phosphadites” encodes the enzyme (CP4 EPSPS protein), is able to report a considerable degree of resistance to glyphosate received plant cell or plant. The sequence of the CP4 EPSPS protein may be a sequence of CP4 EPSPS protein derived from Agrobacterium tumefaciens CP4 sp., her option or synthetic form, is described in U.S. patent No. 5633435. Typical sequence of CP4 EPSPS protein include, but are not limited to, the sequences shown in U.S. patents No. 5627061 and 5633435.

D. Recombinant vectors and design

For the transformation or transfection of plants can be used one or more structures of nucleic acids of the present invention. Levels of products such as transcipt or proteins, can be raised or lowered in this organism, as a plant, or such products may be localized in one or more specific organs or tissues of the body. For example, levels of products can be raised or lowered in one or more tissues and organs of plants, which include, but are not limited to, roots, tubers, stems, leaves, shoots, fruits, berries, nuts, bark, pods, seeds of the flowers. The preferred body is the seed. For example, the exogenous genetic material may be transferred into the plant cell, which regenerates with the formation of solid, fertile or sterile plant or plant part.

“Exogenous genetic material” can be any genetic material, naturally occurring or obtained from any source, suitable for administration in any organism. Such exogenous genetic material includes, but is not limited to, molecules and structures of the nucleic acids of the present invention. Exogenous genetic material may be transferred into the cell host with a vector DNA-based or design, created for this purpose. Similarly, the exogenous genetic material may be transferred into the cell host with a virus. Exogenous genetic material may contain a sequence of DNA that is identical to the endogenous gene, but re-introduced into the cell host with a vector DNA-based or design intended to suppress the expression of endogenous gene. The creation of such a vector is described in this area (see, for example, Plant Molecular Biology: A Laboratory Manual, Clark (ed.), Springer, New York (1997)). In a preferred embodiment of the invention the exogenous genetic material is p is combinatii DNA.

The construct or vector may include a promoter that functions in plant cell, or plant promoter for expression of the selected nucleic acid molecule. In the scientific literature describes a number of promoters which are active in plant cells, and plants preferably used promoters CaMV 35S and FMV. Other examples of preferred promoters include arcelin beans and 7S alpha. Additional preferred promoters are reinforced or duplicated versions of the promoters of CaMV 35S and FMV 35S. Odell et al., Nature 313:810-812 (1985); U.S. patent No. 5378619. Additional promoters suitable for use as described, for example, in U.S. patents№ 5378619, 5391725, 5428147, 5447858, 5608144, 5614399, 5633441, 5633435 and 4633436. In addition, can be used for tissue-specific enhancer.

Particularly preferred promoters can also be used for expression of the nucleic acid molecules of the present invention in seeds or fruits. In a preferred embodiment of the invention used by the promoter is semispecific promoter. Examples of such promoters include the 5'-terminal regulatory region of these genes, as napin (Kridl et al., Seed Sci. Res. 1:209-219 (1991)), phaseolin, stearoyl-ASR-desaturase, 7Sα, 7Sα' (Chen et al., Proc. Natl. Acad. Sci., 83:8560-8564 (1986), USP, arcelin and oleosin. Preferred promoters for the former is ressie in the seed are the 7Sα promoter, 7Sα', napin and FAD2-1A.

Constructs or vectors may also contain other genetic elements, which include, but are not limited to, the 3'end transcription terminators, 3'-end polyadenylation signals, other noncoding nucleic acid sequence, the sequence of transfer or directional effects, breeding or selected markers, promoters, enhancers, and operators. Constructs or vectors may also contain a gene without promoter, which after the introduction can use endogenous promoter.

Molecules of nucleic acid, which can be used for transformation or transfection of plants, can be any nucleic acid molecules of the present invention. The present invention is not limited to the illustrated implementation options. Typical nucleic acid molecules described in part a detailed description of the invention, and others do not limit the invention a typical molecule of nucleic acids are described below and illustrated in figures 1 to 4 and examples.

Variants of the nucleic acid molecules of the present invention shown in Fig.1-4. As indicated above, the nucleic acid molecule contains a first set of DNA sequences and (b) a second set of DNA sequences that l is kalasaviny in one or more areas of the T-DNA, each of which is flanked by the right edge and the left edge. The direction of transcription in the areas of T-DNA is shown by arrows. The described nucleic acid molecules can contain DNA sequences that are located with the formation of monocistronic or polycistronic configuration. The preferred configuration includes the configuration in which the first set of DNA sequences and the second set of DNA sequences located in one area of the T-DNA.

In each illustrated embodiment of the invention the first set of DNA sequences comprises one or more sequences, in which case the expression is able to selectively reduce the content of one, two, or all proteins and transcripts encoded by a gene selected from the group comprising FAD2, FAD3, and FATB. Each sequence in the first set of DNA sequences preferably are capable of if expression to suppress the expression of another gene, including, without limitation, other members of the gene family. These sequences can include coding sequences, sequences, introns, sequences 3'-UTR, the sequence 5'-UTR, other non-coding sequences and any combination of these sequences. First of savecommentaryvotelist DNA may be expressed in any appropriate form, for example in the form of construction of dsrnas semantic kompressornoy constructs or antisense constructs. The first set of DNA sequences is functionally connected to at least one promoter that causes expression of sequences and can be any promoter that functions in the plant, or any plant promoter. Preferred promoters include, but are not limited to, the promoter napina, 7Sα promoter, the promoter 7Sα'promoter of urzelina or promoter FAD2-1A.

The second set of DNA sequences comprises coding sequences, each of which is a DNA sequence, coding sequence, in which case the expression can increase the protein or transcript either as protein or transcript encoded by a gene selected from the group comprising KAS I, KAS IV, Delta-9-desaturase and CP4 EPSPS protein. Each coding sequence is associated with a promoter, which may be any promoter that functions in the plant, or any plant promoter. Preferred promoters suitable for use in the second set of DNA sequences, are the FMV promoter and/or semispecific promoters. Especially preferred semispecific promoters include, but are not limited to, the promoter for the ina, the 7Sα promoter, the promoter 7Sα'promoter of urzelina, the promoter of Delta-9-desaturase or promoter FAD2-1A.

In embodiments of the invention, shown in figures 1 and 2, the first set of DNA sequences in the case expression can form a molecule dsrnas, are able to suppress the expression of a protein or transcript either as protein or transcript encoded by a gene or transcribed from a gene selected from the group comprising FAD2, FAD3, and FATB. The first set of DNA sequences, shown in figure 1, consists of three non-coding sequences, each of which expresses a sequence of RNA (not shown), identical to the non-coding region of a gene selected from the group comprising the genes of FAD2, FAD3, and FATB. Non-coding sequences Express the RNA sequence which is at least 90% identical to the non-coding region of a gene selected from the group comprising the genes of FAD2, FAD3, and FATB. The first set of DNA sequences also includes three antisense sequences, each of which expresses the antisense RNA sequence (not shown)that can form a molecule of double-stranded RNA with the corresponding RNA sequence (expressed non-coding sequences).

Non-coding sequences can be separated from Tomislava sequences spacer elements sequence, preferably the sequence that stimulates the formation of molecules dsrnas. Examples of such spacer elements sequences include the sequence presented in the publications Wesley et al., Plant J., 27(6):581-90 (2001) and Hamilton et al., Plant J., 15:737-746 (1988). In a preferred variant of the invention, the spacer elements of the sequence are capable of forming spillovers structures described in the above publication Wesley et al. Particularly preferred spacer elements sequences in this context are of plant introns or parts thereof. Particularly preferred plant intron is splitarray intron. Playervalue introns include, but are not limited to, the intron is selected from the group including the PDK intron, intron No. 5 FAD3-1A or FAD3-IB, intron No. 1 FAD3, intron No. 3A FAD3, intron No. 3B FAD3, intron No. 3C FAD3, intron No. 4 FAD3, intron No. 5 FAD3, intron No. 1 FAD2 and FAD2 intron-2. Preferred playervalue introns include, but are not limited to, the intron is selected from the group comprising intron No. 1 FAD3, intron No. 3A FAD3, intron No. 3B FAD3, intron No. 3C and FAD3 intron No. 5 FAD3. Other preferred playervalue introns include, but are not limited to, splitarray intron length from about 0.75 KBP to about 1.1 TPA that can facilitate the formation of spillovers RNA structure. One non-limiting example of a CCA is i.i.d. preferred spliceimage intron is intron No. 5 FAD3.

Non-coding molecules with the semantic orientation can be optionally separated from the respective molecules with antisense orientation of the spacer elements segment of DNA. Spacer elements segment may be a gene fragment or synthetic DNA. Spacer elements segment can be short to facilitate education spillovers patterns or long dsrnas to facilitate the formation of dsrnas without spillovers patterns. The spacer can be obtained by chain-extending one of the sense or antisense molecules described in application for U.S. patent 2005/0176670 A1. An alternative may be generated sequence with the orientation of the right edge right edge (“RB-RB”) after insertion into the genome of a plant, as described in application for U.S. patent 2005/0183170.

As shown in figure 1, the nucleic acid molecule includes two areas of the T-DNA, each of which is flanked by the right edge and the left edge. The first area of the T-DNA includes the first set of DNA sequences that are functionally associated with the promoter, the first region of the T-DNA further includes the first part of the second set of DNA sequences, which contains the first promoter is functionally associated with the first coding sequence, and the second promoter is functionally associated with the second coding sequence. The second area of the T-DNA in the cancel the second part of the second set of DNA sequences, which includes a third promoter functionally linked to a third coding sequence. In a preferred embodiment of the invention shown in figure 2, the nucleic acid molecule includes a first region of the T-DNA, which flanked the right edge and the left edge. The first and second set of DNA sequences located in one area of the T-DNA.

In embodiments of the invention with the expression of dsrnas shown in figures 1 and 2, the order of the sequences can be modified in comparison with the illustrated and described order, but non-coding sequence and the antisense sequence is preferably located around the spacer elements of the sequence in such a way that in the case of expression of the first coding sequence can hybridisierung with the first antisense sequence, the second non-coding sequence can hybridisierung with the second antisense sequence and the third non-coding sequence can hybridisierung with a third antisense sequence so that may be formed by one molecule of dsrnas. Non-coding sequences preferably have a sense orientation and antisense sequences are antisense orientation relative what about the promoter. The number of non-coding, and antisense of coding sequences and their relative positions in one or more areas of the T-DNA can be altered in any way acceptable to achieve the objectives of the present invention.

As shown in figure 3 and 4, the illustrated nucleic acid molecule includes the region of the T-DNA flanked by the right edge and the left edge, which are the first and the second set of DNA sequences. The first set of DNA sequences functionally linked to the promoter and the signal termination of transcription. The second set of DNA sequences comprises a first promoter, functionally associated with the first coding sequence, the second promoter functionally linked to a second coding sequence, and the third promoter is functionally linked with a third coding sequence. Signal termination of transcription may be any signal termination of transcription, functioning in the plant, or any plant signal termination of transcription. Preferred signals termination of transcription include, but are not limited to, the 3'-end sequence of the pea Rubisco e, 3'-end sequence napina Brassica, 3'-end sequence of tml and 3'-end sequence nos.

In a variant of the embodiment of the invention, shown in figure 3, the first set of DNA sequences in the case expression can form meaningful kompressornoy designed to suppress the expression of one or more proteins or transcripts, coded or isolated from a gene selected from the group comprising FAD2, FAD3, and FATB. The first set of DNA sequences comprises three non-coding sequences, each of which expresses a sequence of RNA (not shown)identical to one or more non-coding regions of a gene selected from the group comprising the genes of FAD2, FAD3, and FATB. Non-coding sequences Express the RNA sequence which is at least 90% identical to one or more non-coding regions of a gene selected from the group comprising the genes of FAD2, FAD3, and FATB. The order of non-coding sequences in the first set of DNA sequences can be modified in comparison with the illustrated and described in the present description of the invention, but non-coding sequences have the sense orientation relative to the promoter.

Figure 4 shows a variant embodiment of the invention, in which the first set of DNA sequences in the case expression can produce antisense construction that can suppress the expression of the underwater or more proteins or transcripts coded or isolated from a gene selected from the group comprising FAD2, FAD3, and FATB. The first set of DNA sequences comprises three antisense sequences, each of which expresses the antisense RNA sequence (not shown), identical to one or more non-coding regions of a gene selected from the group comprising the genes of FAD2, FAD3, and FATB. Antisense sequences Express the antisense RNA sequence which is at least 90% identical to one or more non-coding regions of a gene selected from the group comprising the genes of FAD2, FAD3, and FATB. The order of antisense sequences in the first set of DNA sequences can be modified in comparison with the illustrated and described in the present description of the invention, but antisense sequences are antisense orientation relative to the promoter.

The above-described nucleic acid molecules are preferred, as they provide the achievement of the goals have distinctive features and advantages of the present invention. One should not assume that the present invention limited to the illustrated variant embodiment of the invention. The location of the sequences in the first and second populations of DNA sequences in which molecule nucleic acid is not limited to the illustrated and described locations and can be changed in any way, acceptable to achieve the objectives and ensure the distinctive features and advantages of the present invention described in the present description of the invention and illustrated in the accompanying drawings.

E. Transgenic organisms and methods for their preparation

Any molecules and structures of the nucleic acids of the present invention may be permanently or temporarily introduced into a plant or plant cell. Preferred molecules and structures of the nucleic acids of the present invention described above in parts A-D detailed description of the invention and in the examples. Another variant of implementation of the present invention relates to a method for producing transgenic plants, which typically includes the stage of selection of acceptable plants or plant cells, transformation of a plant or plant cell with the recombinant vector and obtaining transformed host cell.

In a preferred embodiment of the invention a plant, or a cell isolated from plants that produce vegetable oil for food and industrial applications. Especially preferred are oil crops of the temperate zone. Interest in plants include, but are not limited to, rapeseed (canola and varieties with a high content of erucic acid), corn, soy, crab, mustard, the tick is in the ordinary, peanuts, sesame, cotton, flax, safflower, oil palm, lnjanka, sunflower and coconut palm. The present invention equally relates to a monocotyledonous or dicotyledonous species and applies to new and/or improved methods of transformation and regulation.

Ways and methods of introducing DNA into plant cells is well known to specialists in this field, and in the present invention can be used virtually any methods of introducing nucleic acid molecules into the cell. Non-limiting examples of acceptable methods include chemical methods; physical methods such as microinjection, electroporation, shot genes, bombardment by particles and vacuum infiltration; viral vectors and mediated by receptor mechanisms. Can be used with other methods of transformation of cells, which include, but are not limited to, the introduction of DNA into plants by direct DNA transfer into pollen, direct injection of DNA into reproductive organs of a plant or direct injection of DNA into the cells of immature embryos followed by the rehydration of the dried embryos.

Widely applicable system for introducing genes into plant cells is the transfer mediated by Agrobacterium. See, for example, the publication Fraley et al., Bio/Technology 3:629-635 (1985); Rogers et al., Methods Enzymol. 153:253-277 (1987). Portable sphere of the DNA is determined by the boundary sequences, in the genome of plants is usually injected penetrating DNA. Spielmann et al., Mol. Gen. Genet. 205:34 (1986). Modern transforming vectors based on Agrobacterium can replicate in E. coli and in Agrobacterium, allowing for convenient manipulation. Klee et al., In: Plant DNA Infectious Agents, clear Hohn and Schell (eds.), Springer-Verlag, New York, pp. 179-203 (1985).

The regeneration, development and cultivation of plants from single transformants of protoplast plants and from various transformed explants is well known in this field. Cm. publication Maliga et al., Methods in Plant Molecular Biology, Cold Spring Harbor Press (1995); Weissbach and Weissbach, In: Methods for Plant Molecular Biology, Academic Press, San Diego, CA (1988). Plants of the present invention can be part of breeding programmes and can also be reproduced by apomixis. Methods of obtaining apodictically plants are well known in this field. See, for example, U.S. patent No. 5811636.

In a preferred embodiment of the invention, the plant of the present invention containing a nucleic acid sequence, in which case the expression is able to selectively reduce the levels of protein FAD2, FAD3, and/or FATB and/or transcript of FAD2, FAD3, and/or FATB, crossed with another plant of the present invention containing a nucleic acid sequence, in which case the expression can sverkhekspressiya another enzyme. Above another parentpagetitle selected from the group including beta-ketoacyl-ACP synthase I, β-ketoacyl-ACP synthase IV, Delta-9-desaturase and CP4 EPSPS protein.

In another embodiment of the invention, the plant according to the present invention can be crossed with other transgenic or nereshennymi plant. The plant according to the present invention can be crossed with another plant, in which the composition of the oil is characterized by a modified levels of fatty acids, for example, as a non-limiting example, the cultivar with reduced levels of linolenic acid in the oil. In a preferred embodiment of the invention, the plant according to the present invention is crossed with a strain containing less than 3 wt.% linolenic acid, or in another embodiment of the invention, the plant according to the present invention is crossed with another plant containing more than 20 wt.% stearic acid. Plants with modified levels of fatty acids known in this field and are described, for example, Hawkins and Kridl (1998) Plant Journal 13(6):743-752 and in U.S. patent No. 6365802.

F. the Products of the present invention

Plants of the present invention can be partially or fully used. Preferred parts of the plant include reproductive or stockpiling parts. The term “plant part” used here includes, not the Ogre is nicias them seed, endosperm, ovule, pollen, roots, tubers, stems, leaves, shoots, fruits, berries, nuts, bark, pods, seeds and flowers. In a particularly preferred embodiment of the present invention, the plant part is a seed.

Any plants or parts thereof of the present invention can be processed to obtain their food, flour, protein or oil products. In a preferred embodiment of the present invention use a plant according to the present invention containing oil with a fatty acid composition according to the present invention. Especially preferred part of the plant for this purpose is the seed. In a preferred embodiment of the invention the feed, flour, protein or oil product designed for feeding livestock, fish or humans. In this area known methods of obtaining food, flour, protein and oil products. See, for example, U.S. patents№ 4957748, 5100679, 5219596, 5936069, 6005076, 6146669 and 6156227. In a preferred embodiment of the invention the protein product is a product with high protein content. This product is high in protein preferably contains protein in an amount of over 5% wt./about., more preferably in an amount of 10% wt./about. and more preferably in the amount of 15% wt./about.

In a preferred embodiment, izopet is of the oil product is a product with high oil content, in which the content of the oil obtained from the plant or part thereof according to the present invention, more than 5% wt./about., more preferably 10% wt./about. and more preferably 15% wt./about. In a preferred embodiment of the invention the oil product is a liquid with a volume of more than 1, 5, 10, or 50 liters. The present invention relates to the oil obtained from plants of the present invention or the method according to the present invention. Such oil may be characterized by high resistance to oxidation. In addition, this oil can be minor or major component of any resulting product.

In addition, this oil can be mixed with other oils. In a preferred embodiment of the invention the oil obtained from plants of the present invention or the method according to the present invention, is more 0,5%, 1%, 5%, 10%, 25%, 50%, 75% or 90% of the volume or weight of the oil component of any product. In another embodiment of the invention the oil product can be mixed and may be more 10%, 25%, 35%, 50% or 75% of the volume of the mixture. The oil obtained from plants of the present invention, may be mixed with one or more organic solvents or petroleum distillates.

Plant seeds can be placed in the container. Used C is the return value of a container is any object, suitable for the storage of these seeds. The container preferably contains more than about 500, 1,000, 5,000, or 25,000 seed, of which at least about 10%, 25%, 50%, 75% or 100% of seeds obtained from a plant of the present invention. The present invention relates also to the container for more than about 10000, more preferably about 20,000 and more preferably about 40,000 seeds, of which more than about 10%, more preferably about 25%, more preferably 50% and more preferably about 75% or 90% of the seeds are seeds obtained from a plant of the present invention. The present invention relates also to a container containing more than about 10 kg, more preferably about 25 kg and more preferably about 50 kg of seeds, with more than about 10%, more preferably about 25%, more preferably about 50%, and more preferably about 75% or 90% of the seeds are seeds obtained from a plant of the present invention.

G. Compounds oil

For many applications the oil content of saturated fatty acids is preferably less than 8 wt.% and more preferably about 2-3 wt.%. Saturated fatty acids have high melting temperature, which is undesirable in many applications. When used as food or Topley is and saturated fatty acids cause clouding at low temperatures and communicated to the fuel poor properties of fluidity in the cold, such as loss of fluidity and clogging of the filter in cold condition. Oil products with low content of saturated fatty acids are more preferable for consumers and the food industry, because they are considered more useful and/or can be marked as “products without saturated fat” in accordance with FDA regulations. In addition, oil low in saturated fatty acids reduce or eliminate the need for removal of solids from the oil by cooling for use in food, such as oil for salads. In applications related to biological diesel fuel and lubricating oils, oil low in saturated fatty acids reported improved the flow properties of the cold and not cloudy at low temperatures.

Factors determining the physical properties of specific oils are complex. Palmitic, stearic and other saturated fatty acids are usually solid at room temperature, unlike unsaturated fatty acids, which remain liquid. Because saturated fatty acids have no double bonds in the acyl chains, they remain resistant to oxidation at elevated temperatures. Saturated fatty acids are important components in the composition of margarine and chocolate is, but for many applications in the food industry prefers lower levels of saturated fatty acids.

Oleic acid has one double bond, but remains relatively stable at high temperatures, and oils with high levels of oleic acid are suitable for cooking and other applications requiring heat. It was recently recommended to use more oil with a high content of oleic acid, as oleic acid, apparently, reduces blood levels of low-density lipoprotein (“LDL”), without affecting the levels of high-density lipoprotein (“HDL”). However, it is desirable to somewhat limit the content of oleic acid, as, decomposing at high temperatures, oleic acid forms compounds with unpleasant odors and reduces the number of connections with pleasant odors resulting from the oxidation of linoleic acid. Neff et al., JAOCS, 77:1303-1313 (2000); Warner et al., J. Agric. Food Chem. 49:899-905 (2001). Preferred oils contain oleic acid in the amount of 65 to 85 wt.% or less, which limits the formation of unpleasant odors when cooking, for example oil for frying and fried foods. Other preferred oils contain oleic acid in the amount of more than 55 wt.% to improve the stability of the oxidation.

Linoleic acid is CH the main polyunsaturated fatty acid in food products and essential nutrient for humans. Linoleic acid is a desirable component in many applications related to cooking, being the main precursor substances that cause the smell of fried foods, such as 2,4-decadienal, which give a good taste of fried products. However, linoleic acid is characterized by poor stability when heated. In a preferred food oils linoleic acid content is 10 wt.% or more to enhance the formation of substances that give the smell of fried food, and 25 wt.% or less for decreasing the formation of unpleasant odors. Linoleic acid has properties that lower cholesterol, although an excess of linoleic acid in the diet can reduce the ability of human cells to protect itself from oxidation, resulting in increased risk of cardiovascular disease. Toborek et al., Am. J. Clin. J. 75:119-125 (2002). Cm. the publishing Flavor Chemistry of Lipid Foods, editors D.B. Min & T.H. Smouse, Am. Oil Chem. Soc., Champaign, IL (1989).

Linoleic acid, which has a lower melting point than oleic acid, further improves the fluidity at cold temperatures required in applications related to biological diesel and biological lubricating oils. The preferred oil for most applications are characterized by a content of linoleic acid, R is ate 30 wt.% or less, because the oxidation of linoleic acid limits the storage time and the use of oil for frying, feed, food, fuel and lubricating oils. Cm. publication Physical Properties of Fats, Oils, and Emulsifiers, ed. N. Widlak, AOCS Press (1999); Erhan's series & Asadauskas, Lubricant Basestocks from Vegetable Oils, Industrial Crops and Products 11:277-282 (2000). In addition, high content of linoleic oil in the feed for livestock may cause undesirable high content of linoleic acid in milk of dairy cattle and, consequently, poor resistance to oxidation and odor. Timmons et al., J. Dairy Sci. 84:2440-2449 (2001). The widely used, the oil content of linoleic acid are 10-25 wt.%.

Linolenic acid is also an important component of human nutrition. This acid is used for the synthesis of long-chain fatty acids family of ω-3 and the allocation of these prostaglandins. However, the double bond of the specified acids are very susceptible to oxidation, so oil with a high content of linoleic acid rapidly deteriorate under the influence of air, especially at high temperatures. It is often necessary partial hydrogenation of such oils before they are used in foods to slow down the formation of unpleasant odors and rancidity during heating oil, but the hydrogenation causes the formation of harmful TRANS fatty acids, which may contribute to the nicknaming cardiovascular disease. To improve resistance to oxidation and reduction needs in the hydrogenation of the oil is the preferred oil contains linolenic acid in the amount of 8 wt.% or less, 6% or less, 4% or less, less than about 3% and more preferably in quantities of 0.5-2 wt.% of the total content of fatty acids in the oil of the present invention.

The oil from the soybeans of the present invention can also be used as the source mix for the manufacture of mixed oil product. Source mixing means that the oil from soybeans according to the present invention can be mixed with other vegetable oils to improve characteristics such as the composition of the fatty acids, the smell and the resistance to oxidation of other oils. The used amount of oil from soybeans according to the present invention depends on the desired properties, which must be received in final consumption of oil product. Examples of mixed oil products include, but are not limited to, Margarines, shortening, oil for frying, oils for salads etc. Oil from soybeans according to the present invention can be mixed with oil, a synthetic oil, or in a preferred embodiment of the invention the oil extracted from oilseeds with the corresponding composition of the oil. The oil obtained directly from olives Kul is URS, is unmixed oil. In another embodiment of the invention the oil is obtained directly from the ripe oilseeds. In one embodiment of the invention ripe olive culture is defined as the culture, which is collected on the field for commercial agricultural purposes, such as selling to food preparation. In a preferred embodiment of the invention, the oil is soybean oil. The oil may be a crude oil, such as crude soybean oil, or can be recycled oil, as oil may be refined, bleached, deodorized and/or subjected to removal of solid components by cooling. Used here is the term “cleaning” means the process of natural or processed fat or oil to remove contaminants by which the fat or oil treated with caustic, then centrifuged, washed with water and heated in a vacuum. “Discoloration” means the process of fat or oil to remove or reduce the content in the fat or oil staining substances. Bleaching can be done by processing the fat or oil, activated carbon or diatomaceous earth. “Deodorization” means the removal of fat or oil component,indicating the final product odors, which can be performed using high vacuum and flushing with superheated steam. “The removal of solid components by cooling” means the removal of oil saturated glycerides, which can be accomplished by cooling the oil and remove the hardened parts of fat.

The preferred oil of the present invention is characterized by a low content of saturated fatty acids or absence of saturated fatty acids. In other preferred versions of the invention, the oil of the present invention are characterized by a high content of oleic acid, low in saturated fatty acids and a low content of polyunsaturated fatty acids. In other preferred versions of the invention, the oil of the present invention are characterized by a high content of oleic acid and low content of saturated fatty acids. In a preferred embodiment of the invention, the oil is soybean oil. The percentage of fatty acids or the levels of fatty acids expressed in mass percent.

In the first embodiment of the invention the oil according to the present invention preferably contains 55-80% oleic acid, about 12-43% of polyunsaturated fatty acids and 2-8% saturated fatty acids; more is preferably oil contains 55-80% of oleic acid, about 14-42% of polyunsaturated fatty acids and 3-6% saturated fatty acids; and more preferably the oil contains 55-80% oleic acid, about 16.5-43% polyunsaturated fatty acids and 2-3,6% saturated fatty acids.

In the second embodiment of the invention the oil according to the present invention preferably contains 65-80% oleic acid, about 12-33% of polyunsaturated fatty acids and 2-8% saturated fatty acids; more preferably the oil contains 65-80% oleic acid, about 14-32% polyunsaturated fatty acids and 3-6% saturated fatty acids; more preferably the oil contains 65-80% oleic acid, about 16.5-33% polyunsaturated fatty acids and 2-3,6% saturated fatty acids.

In the third embodiment of the invention the oil according to the present invention preferably contains from about 42% to about 85% oleic acid and from about 8% to about 1.5% saturated fatty acids; more preferably the oil contains a combined quantity of oleic acid and linolenic acid is from about 65% to about 95 wt.% of the total composition of the oil. More preferably the oil of the present invention contains a combined quantity of oleic acid and linolenic acid is from about 75% to about 90%, from about 75% to about 95%, from about 75% to about 85%, from about 65% to about 90%, from about 70% to about 90 wt.% of the total who had oil.

In the fourth embodiment of the invention the oil according to the present invention contains from about 42% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, from about 6% to about 15 wt.% linolenic acid; more preferably the oil contains from about 42% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, less than 35 wt.% linolenic acid; more preferably the oil contains from about 42% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, about 9 wt.% linolenic acid.

In the fifth embodiment of the invention the oil according to the present invention contains from about 50% to about 85% oleic acid and from about 8% to about 1.5% saturated fatty acids; more preferably from about 50% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, from about 4% to about 14 wt.% linolenic acid; more preferably the oil contains from about 50% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, less than 35 wt.% linolenic acid; more preferably the oil contains from about 42% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids, from about 2% to about 45 wt.% linolenic acid.

In another embodiment of the invention, the oil of the present invention soda is separated by approximately 65-80% of oleic acid, about 3-8% of saturated fatty acids and about 12-32% polyunsaturated fatty acids. In another embodiment of the invention the oil according to the present invention contains about 65-80% oleic acid, about 2-3,5% saturated fatty acids and about 16.5-33% polyunsaturated fatty acids.

In a particularly preferred variant of the invention, the oil of the present invention contains about 47-83% oleic acid and about 5% saturated fatty acids; about 60-80% oleic acid and about 5% saturated fatty acids; about 50-85% oleic acid and about 2-7% saturated fatty acids; about 55-85% oleic acid and about 2.5-7% saturated fatty acids; about 47-88% oleic acid and about 3-7% saturated fatty acids; about 43-85% oleic acid and about 5-7% saturated fatty acids; about 81-85% oleic acid and about 5% saturated fatty acids; about 74-83% oleic acid and about 6% saturated fatty acids; about 65-87% oleic acid and about 6% saturated fatty acids; about 66-80% oleic acid and about 6% saturated fatty acids; about 42-77% of oleic acid with about 5-8% saturated fatty acids; about 60-77% oleic acid and about 6% saturated fatty acids; about 70-81% oleic acid and about 5-7% saturated fatty acids; about 52-71% oleic acid and about 5-7% saturated fatty acids; about 44-71% reinvestigate and about 6% saturated fatty acids; about 61-71% oleic acid and about 8% saturated fatty acids; about 57-71% oleic acid and about 7% saturated fatty acids; about 23-58% oleic acid and about 8-14% saturated fatty acids; about 20-70% oleic acid and about 6% saturated fatty acids; about 21-35% oleic acid and about 5-6% of saturated fatty acids, or about 19-28% oleic acid and about 5% saturated fatty acids.

In other embodiments of the invention, the percentage of oleic acid is 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more or 80% or more, or is in the range from 50% to 80%, from 55% to 80%, from 55% to 75%, from 55% to 65%, from 60% to 85%, from 60% to 80%, from 60% to 75%from 60% up to 70%, from 65% to 85%, from 65% to 80%, from 65% to 75%, from 65% to 70% and from 69% to 73%. The acceptable ranges of the percentage of oleic acid in the oils of the present invention also include the ranges in which the lower limit is chosen from the following percentages: 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or 80%; and an upper limit selected from the following percentages: 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 or 90%.

In these other embodiments of the invention, the percentage of linoleic acid in the oil of the present invention is in the range is from 10% to 40%, from 10% to 39%, from 10% to 30%, from 10% to 29%, from 10% to 28%, from 10% to 25%, from 10% to 21%, from 10% to 20%, from 11% to 30%, from 12% to 30%, from 15% to 25%, from 20% to 25%, from 20% to 30% or from 21% to 24%. The acceptable ranges of the percentage of linoleic acid in the oils of the present invention also include the ranges in which the lower limit is chosen from the following percentages: 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30%; and an upper limit selected from the following percentages: 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40%.

In these other embodiments of the invention, the percentage of linolenic acid in the oil of the present invention is 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, 5% or less of 4.5% or less, 4% or less, about 3.5% or less, 3% or less 2.5% or less, 2% or less; or is in the range from 0.5% to 2%, from 0.5% to 3%, from 0.5% to 4.5%from 0.5% to 6%, from 3% to 5%, from 3% to 6%, from 3% to 8%, from 1% to 2%, from 1% to 3% or from 1% to 4%. In these other embodiments of the invention, the percentage of saturated fatty acids in the oil of the present invention is 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, 5% or less, 4% or less of 3.6% or less, or is in the range from 2% to 3%, from 2% to 3.6, from 2% to 4%from 2% to 8%, from 3% to 15%, from 3% to 10%, from 3% to 8%, from 3% to 6%, from 3.6% to 7%, from 5% to 8%, from 7% to 10% or from 10% to 15%.

In other embodiments the invention, the saturated fatty acids in the oil of the present invention include a combination of palmitic and stearic fatty acids. In one embodiment of the invention, the percentage of saturated fatty acids is about 10% or less, about 9% or less, about 8% or less, about 7% or less, about 6% or less, about 5% or less, about 4.5% or less, about 4% or less, about 3.5% or less, about 3% or less, about 2.5% or less; about 2% or less; or is in the range from 0.5% to 2%, from 0.5% to 3%from 0.5% to 4.5%, from 0.5% to 6%, from 0.5% to 7%, from 0.5% to 8%, from 0.5% to 9%, from 1% to 4%, from 1% to 5%, from 1% to 6%, from 1% to 7%, from 1% to 8%, from 1% to 9%, from 1.5% to 5%, from 1.5% to 6%, from 1.5% to 7%, from 1.5% to 8%, from 1.5% to 9%, from 2% to 5%, from 2% to 6%, from 2% to 7%, from 2% to 8%, from 2% to 9%, from 3% to 5%, from 3% to 6%, from 3% to 7%, from 3% to 8%, from 3% to 9%, from 4% to 7%, from 4% to 8%from 4% to 9%, from 5% to 7%, from 5% to 8% and from 5% to 9%. In these versions of the invention, the acceptable ranges of the percentage of saturated fatty acids in the oils of the present invention also include the ranges in which the lower limit is chosen from the following percentages: 0,5, 1, 1,5, 2, 2,5, 3, 3,5, 4, 4,5, 5, 5,5, 6 or 6.5%; and an upper limit selected from the following percentage value is tions: 11, 10, 9, 8, 7, 6, 5, 4,5, 4, 3,5, 3, 2,5, 2, 1,5, 1 or 0.5%.

In other embodiments of the invention, the percentage of palmitic fatty acid in the oil of the present invention is 6% or less, 5% or less of 4.5% or less, 4% or less, about 3.5% or less, 3% or less 2.5% or less, 2% or less or in the range from 0.5% to 2%, from 0.5% to 3%, from 0.5% to 4.5%, from 0.5% to 6%, from 1% to 3%, from 1% to 4%, from 1% to 5%, from 1% to 6%, from 1.5% to 2%, from 1.5% to 3%, from 1.5% to 4%, from 1.5% to 4.5%, from 1.5% to 5.5%, from 1.5% to 6%, from 1.5% to 6.5%, from 1.5% to 7%, from 2% to 3%, from 2% to 3.5%, from 2% to 4%from 2% to 4.5%, from 2% to 5%, from 2% to 6%, from 2% to 7%, from 2% to 8%, from 3% to 5%, from 3% to 6%, from 3% to 7%, from 3% to 8%, from 3% to 9%. In these versions of the invention, the acceptable ranges of the percentage of linoleic acid in the oils of the present invention also include the ranges in which the lower limit is chosen from the following percentages: 0,5, 1, 1,5, 2, 2,5, 3, 3,5, 4, 4,5, 5, 5,5, 6, 6,5, 7 or 7.5%; and an upper limit selected from the following percentages: 11, 10, 9, 8, 7, 6, 5, 4,5, 4, 3,5, 3 or 2%.

In other embodiments of the invention, the percentage of stearic fatty acids in the oil of the present invention is 3% or less 2.5% or less, 2% or less or in the range from 0.5% to 1%, from 0.5% to 1.5%, from 0.5% to 2%, from 0.5% to 2.5%, from 0.5% to 3%, from 0.5% to 4%, from 1% to 2%, from 1% to 3%, from 1% to 4%, from 1.5% to 2%, from 15% to 3% or from 1.5% to 4%. In these versions of the invention, the acceptable ranges of the percentage of linoleic acid in the oils of the present invention also include the ranges in which the lower limit is chosen from the following percentages: 0,5, 1, 1,5, 2, 2,5, 3 or 3.5%; and an upper limit selected from the following percentages: a 3.5, 3 and 2.5, 2 or 1.5%.

The oil of the present invention is particularly suitable for use as oil for baking or frying. Due to the low content of polyunsaturated fatty acids of the oil according to the present invention does not require lengthy processing required for conventional oils, as specified in the oil is less than the compounds that cause odor or color. In addition, the low content of saturated fatty acids in the oil of the present invention improves the flow properties of the oil in the cold and eliminates the need for heating the stored oil to prevent its crystallization or solidification. Improved fluidity at cold temperatures also increases the runoff of oils and fried products after their removal from the oil for frying, which allows to obtain a product with a lower fat content. Cm. publication Bouchon et al., J. Food Science 66:918-923 (2001). Low content of linolenic acid in the oil of the present invention is particularly favorable PR is frying to reduce unpleasant odors.

The oil of the present invention is well suited for use as oil for salads (the oil that remains transparent when the temperature in the refrigerator is 40-50°F). Improved transparency at temperatures in the refrigerator due to the low content of saturated fatty acids and moderate content of linoleic acid reduces or eliminates the need to remove the oil from the solid components by cooling to use as oil for salads.

In addition, a moderate amount of linoleic acid and low content of linolenic acid in the oil of the present invention makes it suitable for the production of shortening, margarine, and other semi-solid vegetable fats used in food products. The production of these fats usually involves the hydrogenation of unsaturated oils, such as soybean oil, corn oil or canola oil. High stability of the oils of the present invention to oxidation and odor means that the oil does not require hydrogenation to the same extent as regular vegetable oil intended for use as margarine or shortening, which reduces the production costs and obtaining harmful TRANS-isomers.

The oil of the present invention is also suitable for using the Oia as raw material for the production of biodiesel, in particular, due to the fact that biodiesel made from such oils, characterized by improved fluidity in the cold, the best Flammability (cetane number), better resistance to oxidation and less emulsions of nitric oxide. Biodiesel is an alternative diesel fuel, usually containing the methyl ester of saturated, monounsaturated or polyunsaturated16-C22fatty acid. Cetane number is a measure of Flammability is shorter than the delay time of ignition of the fuel in the engine, the higher cetane number. The ASTM standard for biodiesel (D 6751-02) requires a minimum cetane number of 47.

The use of biodiesel in conventional diesel engines significantly reduces the amount of pollutants such as sulfates, carbon monoxide and particles, compared to petroleum diesel fuel, and its use in school buses can significantly reduce the exposure of children to toxic emissions diesel fuel. Limit to apply 100% biodiesel is the high turbidity standard of biodiesel from soybean (2°C) in comparison with diesel fuel number 2 (-16°is). Dunn et al., Recent. Res. Devel. in Oil Chem., 1:31-56 (1997). Biodiesel is made from oil of the present invention, has better (lower) temperature turbidity and clogging of the filter in cold condition and can also be used in mixtures to improve low-temperature properties of biodiesel produced from inexpensive, yet a highly saturated sources of fat, such as animal fats (beef tallow, pork lard, chicken fat and palm oil. Biodiesel can also be blended with petroleum diesel fuel in any proportion.

Biodiesel is usually produced by extraction, filtration and purification of soybean oil to remove free of fats and phospholipids and subsequent transesterification of the oil with methanol for the formation of methyl esters of fatty acids. See, for example, U.S. patent No. 5891203. The obtained methyl ester soybean oil typically defined as “biodiesel”. The oil of the present invention can also be used as diesel fuel without the formation of methyl esters, for example, by mixing acetals with this oil. See, for example, U.S. patent No. 6013114. Thanks to the improved fluidity at cold temperatures and resistance to oxidation of the oil p the present invention can also be used as lubricating oil and diesel fuel additives. See, for example, U.S. patent No. 5888947, 5454842 and 4557734.

Soybeans and oil of the present invention is also suitable for use in various soy products made from whole soy beans, such as soy milk, soy oil, natto and tempeh, and soy products made from processed soybeans and soybean oils, including soy grits, soy flour, soy protein concentrate, extracted from soy protein, textured soy protein concentrate, hydrolyzed soy protein, whipped dressing, butter, baking, oil for salad dressings, shortening, and lecithin. Whole soybeans are also edible and are usually sold to buyers in the raw, fried or as edamame (green soy beans). Soy milk, which is usually obtained by soaking and grinding whole soybeans, can be used as is, spray dried or processed for soy yogurt, soy cheese, tofu or Yuba. Soy or oil of the present invention can be successfully used in these and other soy products with improved oxidation stability, lower content of precursor substances that cause unpleasant odors, and low content of saturated fatty acids.

G. Modulation suppression

Another option assests the ment of the invention relates to a method of modulating levels of gene suppression. Modulation of gene suppression may cause more or less suppression of the gene. Suppression of gene product can be achieved by introducing into the genome of the plant design of the present invention. Similarly, the suppression of a gene can be modulated by introducing into the genome of the plant design of the present invention. Other examples of methods of modulation suppression of a gene include, but are not limited to, methods of suppression antimyeloma sequences, cosuppression, introduction interfering RNA (crnci), the use of transgenic animals, the creation of hybrids and ribozyme using the construction according to the present invention. The following examples are given as illustrations and do not limit the scope of the present invention.

Suppression of the gene can be modulated by changing the length of the transcribed DNA used for suppression, the sequence of which is selected from a gene targeted for suppression. To suppress gene using the mechanisms of posttranscriptional gene silencing can be used many methods. Not limited by theory, it is possible to assume that these methods include the expression of RNA molecules, which hybridizes with another RNA molecule. Very surprising is the fact that favorable results are achieved when used and RNA molecules of a certain length for modulation or moderate suppression of the level of stability of expression of the endogenous gene target.

Suppression of gene FAD2-1 causes increased levels of oleic acid and decreased levels of linoleic acid. If a strong suppression of the FAD2-1 levels of oleic acid can exceed 65%, which causes a decrease in the levels of palmitic acid and linolenic acid. For example, the suppression of FAD2-1 levels of oleic acid can reach 85%, while the combined levels of palmitic and stearic acids are reduced to approximately 10%. Similarly, the suppression of FATB leads to reduced levels of saturated fatty acids, mainly palmitate. During the suppression of the FAD2 and FATB so that the levels of oleic acid equal to about 85%, the content of saturated fatty acids is about 10%. During the suppression of the FAD2 and FATB so that the levels of oleic acid exceeds 85%, the content of saturated fatty acids may be lower than 10%.

In accordance with the present invention, the levels of saturated fatty acids can be reduced to less than 10% without increasing oleic acid above 85%. In one embodiment of the invention, suppression of FAD2 modulate by reducing the length of the FAD2 intron-1, introduced into the plant. Less suppression of FAD2 corresponds to the average levels of oleic acid, approximately 40-85% oleic acid. Suppression of FAD2 decreases with decreasing length of the entered fragment of intron FAD2-1. E.g. the measures the FAD2 intron-1, the length of which is reduced by at least 100 consecutive nucleotides, reduces the suppression of FAD2 and a corresponding increase in the level of oleic acid and decreased levels of linoleic acid.

The relationship between reduction in suppression of endogenous gene and a decrease in the length of homologous DNA can be determined empirically by introducing the DNA of different lengths. For example, a decrease in the suppression achieved through reducing the length entered homologous DNA can be determined by removal of the extension parts of the input homologous DNA and analysis of the expression of the target genes.

In the scope of the present invention includes a method of moderate suppression of FAD2 in a strong reduction of the levels of saturated fatty acids in the plant. In such plants the levels of oleic acid can be 40-85%. Similarly incomplete suppression of FATB occurs when the introduction of the joint 3'-terminal and 5'-terminal untranslated regions compared to introduction into the cell host reprezentirovannoe FATB gene. Similarly, the levels of suppression of FATB reduced by introduction into the cell host 5'end of the open reading frame, which encodes mainly a transit peptide chloroplast. In cells containing FAD2 and FATB, suppressed by the methods of the present invention, the levels of oleic acid can be equal 40-85%, the while the levels of saturated fatty acids can be 1-9%.

One way of implementing the present invention relates to a method of modulation of gene suppression to reduce suppression compared with the suppression of the genetic element, which is the full genome, the complete exon, a complete intron, full signal sequence or full UTR, which includes the creation of a molecule of recombinant nucleic acid containing a fragment of the endogenous sequence of this genetic element, the initiation of expression of the recombinant molecule of nucleic acid in the cell the owner and the suppression of the endogenous gene by a recombinant molecule of nucleic acid. Suppressed gene can be any gene, including FAD2 and FATB. One way of carrying out the invention relates to a method of modulation suppression of FAD2 or FATB, which includes: the expression of a partial sequence of the genetic element FAD2 or FATB in the cell host, this genetic element FAD2 or FATB derived from the endogenous gene FAD2 or FATB in the cell host, the sequence of the genetic element FAD2 or FATB can be gene FAD2 or FATB, exon FAD2 or FATB, intron FAD2 or FATB, the coding region of the transit peptide FAD2 or FATB or UTR FAD2 or FATB, and a partial sequence of the genetic element FAD2 or FATB less than the full sequence of the genetic element FAD2 or FATB; and the suppression of e is degennaro gene FAD2 or FATB incomplete sequence of the genetic element FAD2 or FATB, the level of suppression of the endogenous gene FAD2 or FATB in the cell host fewer levels of suppression of the endogenous gene FAD2 or FATB in the cell host with a similar genetic environment and the second sequence of nucleic acid FAD2 or FATB containing the entire sequence of the genetic element FAD2 or FATB.

Another variant of implementation of the present invention relates to a method for changing the composition of oils of vegetable cells, which includes the transformation of the plant cell a recombinant molecule of nucleic acid containing DNA sequence, which inhibits the endogenous expression of FAD2, FATB or FAD2 and FATB, the DNA sequence comprises the sequence of a nucleic acid FAD2, FATB or FAD2 and FATB, which is shorter than the full sequence of all the genetic element selected from a gene, exon, intron, the coding region of the transit peptide, the 3'-UTR, the 5'-UTR, open reading frame; and growing the plant cell under conditions of transcription initiation specified DNA sequence, resulting in a change in the composition of the oil compared with plant cell with a similar genetic environment, but does not contain the recombinant molecule of nucleic acid. Genetic element FAD2 or FATB may be shorter on 50, 75, 100, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 800, 1000, 2000, 3000 Ely nucleotides. The length of the genetic element FAD2 or FATB may be equal to 50, 75, 100, 150, 175, 200, 220, 250, 300, 320, 350, 400, 420, 450, 500, 550, 600, 800 or 1000 nucleotides.

Another variant of implementation of the present invention relates to a method of increasing the content of oleic acid and reduce the content of saturated fatty acids in the seed plants, which includes: (i) shortening the length of the DNA sequence of an exogenous gene FAD2 in the cell host to at least partially reduce the amount of suppression of the expression of FAD2 in the transformed plant compared to the suppression of expression of FAD2 in the cell host with a similar genetic environment and the complete DNA sequence of an exogenous gene FAD2; and (ii) the cultivation of plants with a nucleic acid molecule comprising a shortened DNA sequence FAD2, with a shortened DNA sequence FAD2 at least partially suppresses endogenous expression of FAD2; and (iii) the cultivation of plants that produce seed with a reduced saturated fatty acids compared with the seed of a plant having a similar genetic environment, but not containing short DNA sequence FAD2. The amount by which should be shortened DNA sequence of an exogenous gene FAD2 to at least partially reduce the suppression of the endogenous FAD2 gene, it is possible to determine the empirical and through the introduction of DNA of different lengths. For example, the value of reduction of suppression achieved by reducing the length of the entered homologous DNA can be determined by removal of the extension parts of the input homologous DNA and analysis of the expression of the target genes. The amount of suppression of the expression of FAD2 can be defined as the average value for three or more, six or more, ten or more, fifteen or more, twenty or more seed plants.

Another variant of implementation of the present invention relates to a method for obtaining transgenic plants containing the seed with a reduced saturated fatty acid, which includes the transformation of the plant cell a recombinant molecule of nucleic acid containing DNA sequence, inhibiting endogenous expression of FAD2 and FATB, the DNA sequence contains a sequence of nucleic acid FAD2, which is shorter than the full sequence of all the genetic element selected from a gene, exon, intron, the coding region of the transit peptide and UTR; and growing the transformed plant produces a seed with a reduced saturated fatty acids compared with the seed of a plant having a similar genetic environment, but not contain the specified molecule of recombinant nucleic acids.

Another option is sushestvennee the present invention relates to a method of modulation of fatty acid composition of the oil, obtained from the seeds of oil crops of the temperate zone, which includes the selection of the genetic element length equal to at least 40 nucleotides, capable of suppressing the expression of the endogenous gene in the pathway of fatty acid synthesis; the creation of several short fragments of the genetic element; the introduction of all short fragments into the plant cell oil crops of the temperate zone with the aim of creating transgenic plants and selecting a transgenic plant containing a shortened fragment of defined length and sequence, causing the desired change in the composition of fatty acids in the seed oil. In a preferred embodiment of the invention, the above method also includes creating a design of recombinant DNA containing at least two truncated fragment of two different endogenous genes causing various required changes in the fatty acid composition of oils from seeds; introduction construction of recombinant DNA into the plant cell oil crops of the temperate zone with the aim of creating transgenic plants and selecting a transgenic plant containing at least two shorter fragment, in which the fatty acid composition in the seed oil has several required changes caused by at least two shorter fragments.

The other variantvalue the present invention relates to the seeds of soybean, in which the composition of the oil is characterized by a significantly lower content of saturated fatty acids and moderately high content of oleic acid and which contains the DNA sequence, the major endogenous expression of FAD2 in the cell host, the DNA sequence has the sequence of a nucleic acid FAD2, which is shorter than the full sequence of all the genetic element selected from a gene, exon, intron, the coding region of the transit peptide and UTR.

The following examples are illustrative and do not limit the scope of the present invention.

All publications, patents and patent applications cited in this description of the invention, incorporated in it by reference as if each individual publication, patent or patent application is specifically incorporated by reference.

EXAMPLES

Example 1. The selection of sequences FATB-2

Leaf tissue taken from Asgrow soybean varieties A, pulverized in liquid nitrogen and stored at -80°C until use. Six ml of sodium dodecylsulfate (SDS) buffer for extraction (650 ml of sterile ddH2O, 100 ml of 1 M Tris-CL pH 8, 100 ml of 0.25 M EDTA, 50 ml 20% SDS, 100 ml of 5 M NaCl, 4 μl of beta-mercaptoethanol) is added to 2 ml of frozen chopped leaf tissue and the mixture is incubated at 65°C for 45 minutes. The sample is shaken out through each of the s 15 minutes. To the sample add 2 ml of cooled with ice to 5 M potassium acetate solution, the sample is shaken and incubated on ice for 20 minutes. To the sample add 3 ml of CHCl3and shaken for 10 minutes.

The sample is centrifuged with a speed of 10000 rpm for 20 minutes and collect the supernatant. To the supernatant add 2 ml of isopropanol and mix. The sample is centrifuged with a speed of 10000 rpm for 20 minutes and the supernatant is drained. Sediment resuspended in 200 ál of RNase and incubated at 65°C for 20 minutes. Add 300 ál of ammonium acetate/isopropanol (1:7) and mix. The sample was then centrifuged with a speed of 10000 rpm for 15 minutes and the supernatant discarded. The precipitate was washed with 500 ál of 80% ethanol and subjected to air drying. The precipitated genomic DNA resuspended 200 ál TE (10 mm Tris:1 mm EDTA).

The cDNA sequence of FATB-2 soybean (SEQ ID NO:42) is used to create thirteen oligonucleotides that constitute this gene: F1 (SEQ ID NO:48), F2 (SEQ ID NO:49), F3 (SEQ ID NO:50), F4 (SEQ ID NO:51), F5 (SEQ ID NO:52), F6 (SEQ ID NO:53), F7 (SEQ ID NO:54), R1 (SEQ ID NO:55), R2 (SEQ ID NO:56), R3 (SEQ ID NO:57), R4 (SEQ ID NO:58), R5 (SEQ ID NO:59) and R6 (SEQ ID NO:60). These oligonucleotides are used in pairs for amplification by PCR of the selected genomic DNA of soybean: 1 pair (F1 + R1), pair 2 (F2 + R1), pair 3 (F3 + R2)pair 4 (F4 + R3), pair 5 (F5 + R4), a pair of 6 (F6 + R5) and a pair of 7 (F7 + R6). Amplification by PCR for the pair 5 will the play as follows: 1 cycle, 95°C for 10 minutes; 30 cycles of 95°C for 15 seconds, 43°C for 30 seconds, 72°C for 45 seconds; 1 cycle, 72°C for 7 minutes. For all other pairs of oligonucleotides amplification by PCR performed as follows: 1 cycle, 95°C for 10 minutes; 30 cycles of 95°C for 15 seconds, 48°C for 30 seconds, 72°C for 45 seconds; 1 cycle, 72°C for 7 minutes. Positive fragments obtained using primer pairs 1, 2, 4, 5, 6 and 7. Each clone fragment in the vector CR2.1 (Invitrogen). Fragments 2, 4, 5 and 6 confirm and is sequenced. Four sequences combine with the formation of the genomic sequence for the gene FATB-2 (SEQ ID NO:43).

When comparing the genomic sequence with the cDNA sequence in the gene FATB-2 soy identified four intron: intron I (SEQ ID NO:44) is located from base 119 to the base 1333 genomic sequence (SEQ ID NO:43) and has a length equal to the 1215 BP; intron II (SEQ ID NO:45) is located from base 2231 before the Foundation of 2568 genomic sequence (SEQ ID NO:43) and has a length of 338 BP; intron III (SEQ ID NO:46) is located from base 2702 before the Foundation of the genomic 3342 sequence (SEQ ID NO:43) and has a length equal to 641 BP; intron IV (SEQ ID NO:47) is located from base 3457 before the Foundation 3823 genomic sequence (SEQ ID NO:43) and has a length equal to 367 BP

Example 2. Suppressor designs

A. Design FAD2-1

Intron No. 1 FAD2-1A (SEQ ID NO:1) clone in polygenic expressing the cluster GN3892 in sense and antisense orientation. Vector pCGN3892 contains the promoter 7S soy and the 3'end of pea rbcS. Both fused gene then separately are ligated with the vector pCGN9372, which contains the gene CP4 EPSPS protein regulated by the FMV promoter. Received expressing design (conceptual design pCGN5469 and antisense design pCGN5471) is used for transformation of soybean.

Intron FAD2-1B (SEQ ID NO:2) merge with the 3'-end of intron No. 1 FAD2-1A plasmid pCGN5468 (contains the promoter 7S soy, merged with the intron FAD2-1A (sense)and 3'end of pea rbcS) or plasmid pCGN5470 (contains the promoter 7S soy, merged with the intron FAD2-1A (antisense), and 3'-end of the rbc peas), respectively, in sense and antisense orientation. The obtained fused combinations of introns then separately are ligated with the vector pCGN9372, which contains the gene CP4 EPSPS protein regulated by the FMV promoter. Received expressing constructs (pCGN5485, semantic intron FAD2-1A, FAD2-1B, and pCGN5486, antisense intron FAD2-1A and FAD2-1B) is used for transformation of soybean.

2B. Design FAD3-1

Introns №1, №2, №4 and №5 (respectively SEQ ID NO:7, 8, 10 and 11), FAD3-1A introns No. 3C (SEQ ID NO:23) and No. 4 (SEQ ID NO:24) FAD3-1B are ligated separately with pCGN3892 in sense or antisense orientation. pCGN3892 contains the promoter 7S soy and the 3'end of pea rbcS. These merged II andstc the us are ligated with the vector pCGN9372, which contains a gene CP4 EPSPS protein regulated by the FMV promoter, for the introduction of soy. Received expressing constructs (pCGN5455, semantic intron No. 4 FAD3-1A; pGN5459, antisense intron No. 4 FAD3-1A; pCGN5456, semantic intron No. 5 FAD3; pCGN5460, antisense intron No. 5 FAD3-1A; pCGN5466, antisense intron No. 2 FAD3-1A; pCGN5473, antisense intron No. 1 FAD3-1A) is used for transformation of soybean.

2C. Design FATB

The sequence of intron II of soybean FATB (SEQ ID NO:30) amplified by PCR, using partial genomic clone of FATB-1 as the matrix. Amplification by PCR performed as follows: 1 cycle, 95°C for 10 minutes; 25 cycles of 95°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds; 1 cycle, 72°C for 7 minutes. As a result of amplification by PCR receive the product 854 BP in length, containing at both ends transformed restriction enzymes cut sites. The PCR product clone directly in polygenic expressing the cluster pCGN3892 in semantic orientation using XhoI sites created at the 5'-ends of primers for PCR, with the formation of pMON70674. Vector pCGN3892 contains the promoter 7S soy and the 3'end of pea rbcS. pMON70674 then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter. Received expressing the gene construct pMON70678 used for transformation of soybean methods using Agrobacterium.

POPs is with two other expressing the design, containing the sequence of intron II FATB-1 soybean (SEQ ID NO:30). Vector pMON70674 cut with NotI and are ligated with the vector pMON70675 containing gene CP4 EPSPS protein regulated by the FMV promoter, and the gene KAS IV, adjustable promoter napina, while receiving pMON70680. Expressing the vector pMON70680 then cut with SnaBI and are ligated with the gene, fused with the gene of Delta-9-desaturase gigiola (SEQ ID NO:41) in the sense orientation, regulated promoter 7S. Expressing design pMON70680 and pMON70681 used for transformation of soybean methods using Agrobacterium.

2D. Composite structures

Create expressing constructs containing different permutatio first set of DNA sequences. The first set of DNA sequences include any of the described sequence, or illustrated on figure 5 and 6, or any other set of DNA sequences containing different combinations of non-coding or coding regions sense, antisense or sense and antisense sequences of FAD2, FAD3, and FATB, capable of forming designs dsrnas, semantic kompressornye constructs, antisense constructs, or different combinations of the above structures.

Figure 5(a)-(C) shows the first few sets of DNA sequences that are able to Express the semantic kompressornye or as timeslave design of the present invention, non-coding sequence of which is presented in the following tables 1 and 2. Non-coding sequences may represent a single sequence, the combination of sequences (for example, 5'-UTR associated with the 3'-UTR) or any combination of the above sequences. For the expression of semantic kompressornoy design all non-coding sequences are meaningful sequences, and for the expression of antisense constructs all non-coding sequences are antimuslim sequences. Figure 5(d) shows the first set of DNA sequences that is capable to Express the sense and antisense constructs of the present invention.

Figure 6(a)-(C) shows the first few sets of DNA sequences that are able to Express the design of the dsrnas of the present invention, non-coding sequence of which is presented in the following tables 1 and 2. The first set of DNA sequences, shown in Fig.6, contains related pairs of sense and antisense sequences, arranged so that, for example, RNA downregulation of the first sense sequence are capable of forming double-stranded RNA with antisense RNA downregulation of the first Antis who iloveu sequence. For example, as shown in Fig.6(a) and illustrative combination No. 1 (table 1), the first set of DNA sequences includes notional sequence of the FAD2-1, notional sequence FAD3-1, the antisense sequence of the FAD2-1 and the antisense sequence FAD3-1. Both antisense sequences correspond to semantic sequences, so the products of expression of the first set of DNA sequences can form with each other double-stranded RNA. Semantic sequences can be separated from the antisense sequences of the spacer elements of the sequence, preferably a sequence that stimulates the formation of molecules dsrnas. Examples of such spacer elements sequences include the sequences shown in the above publication Wesley et al. and in the publication of Hamilton et al., Plant J., 15:737-746 (1988). The promoter is any promoter that functions in the plant, or any plant promoter. Non-limiting examples of acceptable promoters are given in part D of the detailed description of the invention.

The first set of DNA sequences injected into expressing construct in sense or antisense orientation different methods of DNA manipulation. In the presence of DNA sequences of convenient restriction sites which which sites injected in expressing design by cleavage with restriction endonucleases and ligation with the design, split one or more of the available cloning sites. In the absence of the DNA sequences of convenient restriction sites in DNA structure or sequence of the DNA modified in various ways to facilitate the cloning of DNA sequences in the design. Examples of methods of modifying DNA include PCR, ligation with a synthetic linker or adapter, siteprovides mutagenesis in vitro, lengthening or shortening the protruding 5'- or 3'-ends and the like. Specialists in this area is well known for these and other methods of manipulating DNA.

Vector pMON97552 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 140 consecutive nucleotides from the 3'-end, functionally associated with 42 consecutive nucleotides 5'-UTR FATB-1α, followed by the coding region P FATB-1α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of the P FATB-1α in antisense orientation, followed by 42 consecutive nucleotide 5'-UTR FATB-1α in antisense orientation followed by intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 140 consecutive nucleotides from the 3'-end and in antisense orientation, which is functionally linked to the 3'-end polyadenylation segment N6 with the Yong CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco e, with all sequences flanked the right edge (RB) and left border (LB). Received expressing the gene construct used for transformation methods presented in this description.

Vector pMON93758 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 160 consecutive nucleotides from the 5'-end and legirovannym with 3'-UTR FATB-1α, followed by 5'-UTR FATB-1α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally associated with the 5'-UTR FATB-1α in antisense orientation, followed by a 3'-UTR FATB-1α in antisense orientation, followed by intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 160 consecutive nucleotides from the 5'-end and in antisense orientation, which is functionally linked to the 3'-end polyadenylation segment N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco e, with all sequences flanked the right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for transformation methods presented in this description.

Vector pMON97553 contains about otor 7Sα' soy functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced to 200 consecutive nucleotides from the 3'-end and legirovannym with 42 consecutive nucleotides 5'-UTR FATB-1α, followed by the coding region P FATB-1α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of the P FATB-1α in antisense orientation, followed by 42 consecutive nucleotide 5'-UTR FATB-1α in antisense orientation, followed by intron 1 FAD2-1A (SEQ ID NO:1), reduced to 200 consecutive nucleotides from the 3'-end and in antisense orientation, which is functionally linked to the 3'-terminal segment of polyadenine N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco e, with all sequences flanked the right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for transformation methods presented in this description.

Vector pMON93770 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 240 consecutive nucleotides from the 3'-end and legirovannym with 3'-UTR FATB-1α, followed by 5'-UTR FATB-1α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally linked the 5'-UTR FATB-1α in antisense orientation, followed by 3'-UTR FATB-1α in antisense orientation, followed by intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 240 consecutive nucleotides from the 3'-end and in antisense orientation, which is functionally linked to the 3'-end polyadenylation segment N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco e, with all sequences flanked the right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for transformation methods presented in this description.

Vector pMON93759 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 240 consecutive nucleotides from the 5'-end and legirovannym with 3'-UTR FATB-1α, followed by 5'-UTR FATB-1α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally associated with the 5'-UTR FATB-1α in antisense orientation, followed by a 3'-UTR FATB-1α in antisense orientation, followed by intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 240 consecutive nucleotides from the 5'-end and in antisense orientation, which is functionally linked to the 3'-end polyadenylation segment N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end of the terms is yuusei sequence of the pea Rubisco E9, in this case, all sequences are flanked right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for transformation methods presented in this description.

Vector pMON97554 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 260 consecutive nucleotides from the 3'-end and legirovannym with 42 consecutive nucleotides 5'-UTR FATB-1α, followed by the coding region P FATB-1α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of the P FATB-1α in antisense orientation, followed by 42 consecutive nucleotide 5'-UTR FATB-1α in antisense orientation, followed by intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 260 consecutive nucleotides from the 3'-end and in antisense orientation, which is functionally linked to the 3'-end polyadenylation segment N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco e, with all sequences flanked the right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for transformation methods presented in this description.

Ve is Thor pMON93771 contains a 7Sα promoter' soy functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 300 consecutive nucleotides from the 3'-end and legirovannym with 3'-UTR FATB-1α, followed by 5'-UTR FATB-1α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally associated with the 5'-UTR FATB-1α in antisense orientation, followed by a 3'-UTR FATB-1α in antisense orientation, followed by intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 300 consecutive nucleotides from the 3'-end and in antisense orientation, which is functionally linked to the 3'-end polyadenylation segment N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco e, with all sequences flanked the right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for transformation methods presented in this description.

Vector pMON97555 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 320 consecutive nucleotides from the 3'-end and legirovannym with 42 consecutive nucleotides 5'-UTR FATB-1α, followed by the coding region P FATB-1α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of the P FATB-1α in antimyeloma the orientation, followed by 42 consecutive nucleotide 5'-UTR FATB-1α in antisense orientation, followed by intron 1 FAD2-1A (SEQ ID NO:1), reduced by 320 consecutive nucleotides from the 3'-end and in antisense orientation, which is functionally linked to the 3'-end polyadenylation segment N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco e, with all sequences flanked the right edge (RB) and left border (LB) in a single molecule The DNA. Received expressing the gene construct used for transformation methods presented in this description.

Vector pMON93760 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 320 consecutive nucleotides from the 5'-end and legirovannym with 3'-UTR FATB-1α, followed by 5'-UTR FATB-1α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally associated with the 5'-UTR FATB-1α in antisense orientation, followed by a 3'-UTR FATB-1α in antisense orientation, followed by intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 320 consecutive nucleotides from the 5'-end and in antisense orientation, which is functionally linked to the 3'-end polyadenylation segment N6 gene CP4 EPSPS protein, functionally related about what oterom EFMV and the 3'end termination sequences of the pea Rubisco e, in this case, all sequences were flanked by the right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for transformation methods presented in this description.

Vector pMON93772 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 360 consecutive nucleotides from the 3'-end and legirovannym with 3'-UTR FATB-1α, followed by 5'-UTR FATB-1α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally associated with the 5'-UTR FATB-1α in antisense orientation, followed by a 3'-UTR FATB-1α in antisense orientation, followed by intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 360 consecutive nucleotides from the 3'-end and in antisense orientation, which is functionally linked to the 3'-end polyadenylation segment N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco e, with all sequences flanked the right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for transformation methods presented in this description.

Vector pMON97556 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 38 consecutive nucleotides from the 3'-end and legirovannym with 42 consecutive nucleotides 5'-UTR FATB-1α, followed by the coding region P FATB-1α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of the P FATB-1α in antisense orientation, followed by 42 consecutive nucleotide 5'-UTR FATB-1α in antisense orientation, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 380 consecutive nucleotides from the 3'-end and in antisense orientation, which is functionally linked to the 3'-end polyadenylation segment N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco e, with all sequences flanked the right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for transformation methods presented in this description.

Vector pMON93764 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 400 consecutive nucleotides from the 3'-end and legirovannym with the coding region of the P FATB-1α, followed by the coding region P FATB-2α, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of the P FATB-2α in antisense orientation, followed by the coding region P FATB-1α in antimi the business orientation, followed by intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 400 consecutive nucleotides from the 3'-end and in antisense orientation, which is functionally linked to the coding region of the P FATB-2α in antisense orientation, followed by 42 consecutive nucleotide 5'-UTR FATB-2α in antisense orientation, functionally associated with the 3'-end polyadenylation segment N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco e, all sequences are flanked right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for transformation methods presented in this description.

22
Table 1
Illustrative combinationsNon-coding or coding sequences (sense or antisense)
FirstSecondThirdFourth
1FAD2-1A orFAD3-1A or b or C
2FAD3-1A or b or CFAD2-1A or
3FAD2-1A orFAD3-1A or b or Canother sequence FAD3-1A or b or C
4FAD2-1A orFAD3-1A or b or CFATB-1
5FAD2-1A orFATB-1FAD3-1A or b or C
6FAD3-1A or b or CFAD2-1A orFATB-1
7FAD3-1A or b or CFATB-1FAD2-1A or
8FATB-1FAD3-1A or b or CFAD2-1A or
9FATB1 FAD2-1A orFAD3-1A or b or C
10FAD2-1A orFAD3-1A or b or Canother sequence FAD3-1A or b or CFATB-1
11FAD3-1A or b or CFAD2-1A oranother sequence FAD3-1A or b or CFATB-1
12FAD3-1A or b or Canother sequence FAD3-1A or b or CFAD2-1A orFATB-1
13FAD2-1A orFAD3-1A or b or CFATB-1another sequence FAD3-1A or b or C
14FAD3-1A or b or CFAD2-1A orFATB-1another sequence FAD3-1A or b or C
15FAD3-1A or b or Canother sequence FAD3-1A or b or C FATB-1FAD2-1A or
16FAD2-1A orFATB-1FAD3-1A or b or Canother sequence FAD3-1A or b or C
17FAD3-1A or b or CFATB-1FAD2-1A oranother sequence FAD3-1A or b or C
18FAD3-1A or b or CFATB-1another sequence FAD3-1A or b or CFAD2-1A or
19FATB-1FAD2-1A orFAD3-1A or b or Canother sequence FAD3-1A or b or C
20FATB-1FAD3-1A or b or CFAD2-1A oranother sequence FAD3-1A or b or C
21FATB-1FAD3-1A or b or Canother sequence FAD3-1A or b or CFAD2-1A or
FAD2-1A orFAD3-1A or b or CFATB-2
23FAD2-1A orFATB-2FAD3-1A or b or C
24FAD3-1A or b or CFAD2-1A orFATB-2
25FAD3-1A or b or CFATB-2FAD2-1A or
26FATB-2FAD3-1A or b or CFAD2-1A or
27FATB-2FAD2-1A orFAD3-1A or b or C
28FAD2-1A orFAD3-1A or b or Canother sequence FAD3-1A or b or CFATB-2
29FAD3-1A or b or CFAD2-1A or another sequence FAD3-1A or b or CFATB-2
30FAD3-1A or b or Canother sequence FAD3-1A or b or CFAD2-1A orFATB-2
31FAD2-1A orFAD3-1A or b or CFATB-2another sequence FAD3-1A or b or C
32FAD3-1A or b or CFAD2-1A orFATB-2another sequence FAD3-1A or b or C
33FAD3-1A or b or Canother sequence FAD3-1A or b or CFATB-2FAD2-1A or
34FAD2-1A orFATB-2FAD3-1A or b or Canother sequence FAD3-1A or b or C
35FAD3-1A or b or CFATB-2FAD2-1A oranother serial is inost FAD3-1A or b or C
36FAD3-1A or b or CFATB-2another sequence FAD3-1A or b or CFAD2-1A or
37FATB-2FAD2-1A orFAD3-1A or b or Canother sequence FAD3-1A or b or C
38FATB-2FAD3-1A or b or CFAD2-1A oranother sequence FAD3-1A or b or C
39FATB-2FAD3-1A or b or Canother sequence FAD3-1A or b or CFAD2-1A or

Table 2
Correlation SEQ ID NO: sequences of table 1
FAD2-1AFAD2-1BFAD3-1AFAD3-1BFAD3-1CFATB-1 FATB-2
3'-UTRSEQ ID NO:5noSEQ ID NO:16SEQ ID NO:26SEQ ID NO:61SEQ ID NO:36no
5'-UTRSEQ ID NO:6noSEQ ID NO:17SEQ ID NO:27SEQ ID NO:62SEQ ID NO:37no
5' + 3'-UTR (or 3' + 5'-UTR)Related SEQ ID nos:5 and 6noRelated SEQ ID nos:16 and 17Related SEQ ID nos:26 and 27noRelated SEQ ID nos:36 and 37no
Intron No. 1SEQ ID NO:1SEQ ID NO:2SEQ ID NO:7SEQ ID NO:19noSEQ ID NO:29SEQ ID NO:44
Intron No. 2nonoSEQ ID NO:8SEQ ID NO:20no SEQ ID NO:30SEQ ID NO:45
Intron No. 3nonoNononoSEQ ID NO:31SEQ ID NO:46
Intron No. 3AnonoSEQ ID NO:9SEQ ID NO:21nonono
Intron No. 3BnonoSEQ ID NO:12SEQ ID NO:22nonono
Intron No. 3CnonoSEQ ID NO:13SEQ ID NO:23nonono
Intron No. 4nonoSEQ ID NO:10SEQ ID NO:24SEQ ID NO:14SEQ ID NO:32 SEQ ID NO:47
Intron No. 5nonoSEQ ID NO:11SEQ ID NO:25noSEQ ID NO:33no
Intron No. 6nonoNononoSEQ ID NO:34no
Intron No. 7nonoNononoSEQ ID NO:35no

Example 3. Composite structures

7-15 promoters arrows, coding sequences (both coding and non-coding) are shown by pentagons, facing in the direction of transcription, a semantic sequence indicated in plain text and antisense sequences are denoted by inverted text. On these figures used the following abbreviations: 7Sa = 7Sα promoter; 7Sa' = 7Sα promoter'; Br napin = promoter napina Brassica; FMV = the FMV promoter; ARC = the promoter of urzelina; RBC E9 3' = signal terminal and Rubisco e; Nos 3' = signal termination nos; TML 3' = signal termination tml; napin 3'= signal termination napina; 3' (in the same frame that FAD or FAT) = 3'-UTR; 5' (in the same frame that FAD or FAT) = 5'-UTR; Cr = Cuphea pulcherrima; Gm = Glycine max; Rc = Ricinus communis; FAD2 = allele FAD2 gene Delta-9-sterolesters; and Intr or Inr = intron.

3A. Design dsrnas

7-9 shows the nucleic acid molecules of the present invention, in which the first set of DNA sequences can Express the design dsrnas. The first set of DNA sequences shown in Fig.7-9, includes a pair of related sense and antisense sequences that are located in such a way that, for example, RNA downregulation of the first semantic sequence that can form double-stranded RNA with antisense RNA downregulation of the first antisense sequence. Semantic sequences can be located next to antimyeloma sequences or can be separated from the antisense sequences of the spacer elements of the sequence, as shown in Fig.9.

The second set of DNA sequences comprises coding sequences, each of which is a DNA sequence, coding sequence, in which case the expression can increase protein or transcript or as b is Locke, and the transcript encoded a gene selected from the group comprising KAS I, KAS IV, Delta-9-desaturase and CP4 EPSPS protein. Each coding sequence is associated with a promoter, which may be any promoter that functions in the plant, or any plant promoter may be the FMV promoter, the promoter napin, 7S promoter (7Sα or 7Sα'), promoter of arcelin, promoter Delta-9-desaturase or promoter FAD2-1A.

As shown in Fig.7, the sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), 3'-UTR FAD3-1A (SEQ ID NO:16) or 3'-UTR FATB-1 (SEQ ID NO:36) soybean amplified by PCR with the formation of PCR products, which include re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the division splaisiruemym intron 5 FAD3-1A soybean (SEQ ID NO:11) in vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. The vectors containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, and gene Delta-9-desaturase (FAB2) R. communis (SEQ ID NO:40), a regulated promoter FAD2 and the 3'end termination sequences nos, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene construct pMON68539 shown in Fig.7, is used for transformation methods presented in this description.

The sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), intron 4 FAD3-1A (SEQ ID NO:10) and intron II FATB-1 (SEQ ID NO:30) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the division splaisiruemym intron 5 FAD3-1A soybean (SEQ ID NO:11) in vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct pMON68540 shown in Fig.7, is used for transformation methods presented in this description.

The sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), intron 4 FAD3-1A (SEQ ID NO:10) and intron II FATB-1 (SEQ ID NO:30) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The PCR products Cloner the Ute in sense and antisense orientation in the division splaisiruemym intron 5 FAD3-1A soybean (SEQ ID NO:11) with the vector, containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. A vector containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene construct pMON68544 shown in Fig.7, is used for transformation methods presented in this description.

The sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), intron 4 FAD3-1A (SEQ ID NO:10), intron II FATB-1 (SEQ ID NO:30) and intron 4 FAD3-1B (SEQ ID NO:24) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the division splaisiruemym intron 5 FAD3-1A soybean (SEQ ID NO:11) in vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein, adjustable about what oterom FMV and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct pMON68546 shown in Fig.7, is used for transformation methods presented in this description.

As shown in Fig, the sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), 3'-UTR FAD3-1A (SEQ ID NO:16) and 3'-UTR FATB-1 (SEQ ID NO:36) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the division splaisiruemym intron 5 FAD3-1A soybean (SEQ ID NO:11) in vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct pMON68536 shown in Fig use for transformation methods presented in this description.

The sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), 3'-UTR FAD3-1A (SEQ ID NO:16) and 3'-UTR FATB-1 (SEQ ID NO:36) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the division splaisiruemym intron 5 FAD3-AND soybean (SEQ ID NO:11) in the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. The vector containing the gene for Delta-9-desaturase (FA2) R. communis (SEQ ID NO:40), regulated by the promoter of the soybean FAD2 and the 3'end termination sequences nos, cut with appropriate restriction enzymes and are ligated at the top from the 3'end termination sequences tml. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct pMON68537 shown in Fig use for transformation methods presented in this description.

The sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), 3'-UTR FAD3-1A (SEQ ID NO:16) and 3'-UTR FATB-1 (SEQ ID NO:36) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in sense or antisense orientation when splitting splaisiruemym intron 5 FAD3-1A soybean (SEQ ID NO:11) in vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein, the reg is dummy FMV promoter and the 3'end termination sequences of the pea Rubisco e. A vector containing the gene KAS IN C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene construct pMON68538 shown in Fig use for transformation methods presented in this description.

As shown in Fig.9, the sequence 3'-UTR FAD2-1 (SEQ ID NO:5), 3'-UTR FATB-1 (SEQ ID NO:36), 3'-UTR FAD3-1A (SEQ ID NO:16) and 3'-UTR FAD3-1B (SEQ ID NO:26) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the division splaisiruemym intron 5 FAD3-1A soybean (SEQ ID NO:11) in vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein, regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct pMON80622 shown in Fig.9, is used for transformation methods presented in this description.

Sequence 3'-UTR FAD2-1 (SEQ ID NO:5), 3'-UTR FATB-1 (SEQ ID NO:36) and 3'-UTR FAD3-1A (SEQ ID NO:16) of the soybean Ampl liziruut PCR with the formation of PCR products, contains re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the division splaisiruemym intron 5 FAD3-1A soybean (SEQ ID NO:11) in vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein, regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct pMON80623 shown in Fig.9, is used for transformation methods presented in this description.

Sequence 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO:6 and 5, legirovannye with each other), 5'-UTR-3'-UTR FATB-1 (SEQ ID NO:37 and 36, legirovannye with each other), the 3'-UTR FAD3-1A (SEQ ID NO:16) and 5'-UTR-3'-UTR FAD3-1B (SEQ ID NO:27 and 26, legirovannye each other) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and 3-terminal termination sequence of the pea Rubisco e. Received expressing the gene structure A5, shown in Fig.9, is used for transformation methods presented in this description.

Sequence 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO:6 and 5, legirovannye with each other), 5'-UTR-3'-UTR FATB-1 (SEQ ID NO:37 and 36, legirovannye with each other) and 3'-UTR FAD3-1A (SEQ ID NO:16) soybean amplifiercircuit PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein, regulated by the FMV promoter and the 3'end termination sequences peas Rubisc e. A vector containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene construct O6 shown in Fig.9, is used for transformation methods presented in this description.

3V. Semantic kompressornye design

Figure 10-13 and 19-20 shows the nucleic acid molecules by h the present invention, in which the first set of DNA sequences able to Express the semantic kompressornye design. The second set of DNA sequences comprises coding sequences, each of which is a DNA sequence, coding sequence, in which case the expression can increase the level of protein or transcript either as protein or transcript encoded a gene selected from the group comprising KAS I, KAS IV, Delta-9-desaturase and CP4 EPSPS protein. Each coding sequence is associated with a promoter, which is any promoter that functions in the plant, or any plant promoter may be the FMV promoter, the promoter napina, 7S promoter (7Sα or 7Sα'), the promoter of urzelina, promoter Delta-9-desaturase or promoter FAD2-1A.

As shown in figure 10, the sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), intron 4 FAD3-1C (SEQ ID NO:14), intron II FATB-1 (SEQ ID NO:30), intron 4 FAD3-1A (SEQ ID NO:10) and intron 4 FAD3-1B (SEQ ID NO:24) soybean amplificateur PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soy-and 3'-terminal end terminal sequence of the pea Rubisco e using XhoI sites created at the 5'-ends of primers for PCR. This etc is R then cut with NotI and are ligated with the vector pMON41164, containing the gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct pMON68522 shown in figure 10, is used for transformation methods presented in this description.

The sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), intron 4 FAD3-1A (SEQ ID NO:10), intron 4 FAD3-1B (SEQ ID NO:24) and intron II FATB-1 (SEQ ID NO:30) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. The vectors containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, and gene Delta-9-desaturase R. communis (FAB2) (SEQ ID NO:40), regulated by the promoter of the soybean FAD2 and the 3'end termination sequences nos, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene construct pMON80614 shown in figure 10 is used for transformation methods presented in this description of the invention.

The sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), 3'-UTR FAD-1A (SEQ ID NO:16) and 3'-UTR FATB-1 (SEQ ID NO:36) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct pMON68531 shown in figure 10, is used for transformation methods presented in this description.

The sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), 3'-UTR FAD3-1A (SEQ ID NO:16) and 3'-UTR FATB-1 (SEQ ID NO:36) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and 3'-end of the Oh termination sequence of the pea Rubisco e. The vectors containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, and gene Delta-9-desaturase (FAB2) R. communis (SEQ ID NO:40), regulated by the promoter of the soybean FAD2 and the 3'end termination sequences nos, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene construct pMON68534 shown in figure 10, is used for transformation methods presented in this description.

The sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), 3'-UTR FAD3-1A (SEQ ID NO:16) and 3'-UTR FATB-1 (SEQ ID NO:36) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The PCR product clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. The vector containing the gene for Delta-9-desaturase (FAB2) R. communis (SEQ ID NO:40), regulated by the promoter of the soybean FAD2 and the 3'end termination sequences nos, cut with appropriate restriction enzymes and are ligated with age is a PR pMON41164. Received expressing the gene construct pMON68535 shown in figure 10, is used for transformation methods presented in this description.

As shown in figure 11, the sequence 3'-UTR FAD2-1 (SEQ ID NO:5), 3'-UTR FAD3-1A (SEQ ID NO:16) and 3'-UTR FATB-1 (SEQ ID NO:36) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector MON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct pMON80605 shown figure 11, is used for transformation methods presented in this description.

Sequence 3'-UTR FAD2-1 (SEQ ID NO:5), 3'-UTR FAD3-1A (SEQ ID NO:16) and 3'-UTR FATB-1 (SEQ ID NO:36) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. Given the initial vector is then cut with NotI and are ligated with the vector pMON41164, containing the gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. A vector containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene construct pMON80606 shown figure 11, is used for transformation methods presented in this description.

Sequence 3'-UTR FAD2-1 (SEQ ID NO:5), 3'-UTR FAD3-1A (SEQ ID NO:16) and 3'-UTR FATB-1 (SEQ ID NO:36) soybean ampliacion PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. The vector containing the gene for Delta-9-desaturase (FAB2) R. communis (SEQ ID NO:40), regulated by the promoter of the soybean FAD2 and the 3'end termination sequences nos, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received EC is pressious gene structure pMON80607, shown at 11, is used for transformation methods presented in this description.

Sequence 3'-UTR FAD2-1 (SEQ ID NO:5), 3'-UTR FAD3-1A (SEQ ID NO:16) and 3'-UTR FATB-1 (SEQ ID NO:36) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7S' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences Rubisco e. The vectors containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, and gene Delta-9-desaturase R. communis (FAB2) (SEQ ID NO:40), regulated by the promoter of the soybean FAD2 and the 3'end terminating FAD2 sequence, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene construct pMON80614 shown figure 11, is used for transformation methods presented in this description.

As shown in Fig, the sequence 3'-UTR FAD2-1 (SEQ ID NO:5), 3'-UTR FA-1 (SEQ ID NO:36) and 3'-UTR FAD3-1A (SEQ ID NO:16) soybean amplified methodology the PCR with the formation of PCR products, contains re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter of the soybean 7Sα and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct pMON80629 shown in Fig use for transformation methods presented in this description.

The sequence of intron 1 FAD2-1 (SEQ ID NO:1 or 2), intron 4 FAD3-1A (SEQ ID NO:10), intron II FATB-1 (SEQ ID NO:30) and intron 4 FAD3-1A (SEQ ID NO:10), soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter of the soybean 7Sα and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct MON81902 shown in Fig, used for the transformation of the methods of the AMI, presented in this description.

Sequence 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO:6 and 5, legirovannye with each other), 5'-UTR-3'-UTR FAD3-1 (SEQ ID NO:17 and 16, legirovannye with each other, or 27 and 26, legirovannye with each other) and 5'-UTR-3'-UTR FATB-1 (SEQ ID NO:37 and 36, legirovannye each other) soybean amplified by PCR with the formation of PCR products, contains re-created restriction sites at both ends. The PCR product FAD2-1 clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. Similarly, the PCR product FAD3-1 clone in the sense orientation into the vector containing the promoter of the soybean 7Sα and 3'end termination sequences tml using XhoI sites created at the 5'-ends of primers for PCR. The PCR product FATB-1 clone in the sense orientation into the vector containing the promoter of arcelin and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. These vectors cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein, regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct O1 shown in Fig use for transformation methods presented in nastasemarian of the invention.

Sequence 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO:6 and 5, legirovannye with each other), 5'-UR-3'-UTR FAD3-1 (SEQ ID NO:17 and 16, legirovannye with each other, or 27 and 26, legirovannye with each other) and 5'-UTR-3'-UTR FATB-1 (SEQ ID NO:37 and 36, legirovannye each other) soybean amplified by PCR with the formation of PCR products, contains re-created restriction sites at both ends. The PCR product FAD2-1 clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. Similarly, the PCR product FAD3-1 clone in the sense orientation into the vector containing the promoter of the soybean 7Sα and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. The PCR product FATB-1 clone in the sense orientation into the vector containing the promoter of arcelin and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. These vectors cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein, regulated by the FMV promoter and the 3'end termination sequences peas Rubiso e. A vector containing the gene KAS IN C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, cut with appropriate restriction f is rontani and are ligated with the vector pMON41164. Received expressing the gene construct O2, shown in Fig use for transformation methods presented in this description.

As shown in Fig, the sequence 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO:6 and 5, legirovannye with each other), 5'-UTR-3'-UTR FATB-1 (SEQ ID NO:37 and 36, legirovannye with each other), the 3'-UTR FAD3-1A (SEQ ID NO:16) and 5'-UTR-3'-UTR FAD3-1B (SEQ ID NO:27 and 26, legirovannye with each other) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. These vectors are then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. A vector containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, cut with appropriate restriction enzymes and are ligated in the vector pMON41164. Received expressing the gene structure 7 shown in Fig use for transformation methods presented in this description.

Intron 1 FAD2-1 soybean (SEQ ID NO: 1 or 2) amplified methodology the PCR with the formation of PCR products, contains re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. Sequence 5'-UTR-3'-UTR FATB-1 (SEQ ID NO:37 and 36, legirovannye with each other), the 3'-UTR FAD3-1A and (SEQ ID NO:16) and 5'-UTR-3'-UTR FAD3-1B (SEQ ID NO:27 and 26, legirovannye each other) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter of the soybean 7Sα and 3-terminal termination sequence nos using XhoI sites created at the 5'-ends of primers for PCR. These vectors are then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. A vector containing the gene KAS IV C. ulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene structure 9 shown in Fig use for transformation methods presented in this description.

As shown in Fig, some who yousie sequence FATB-2 (SEQ ID NO:44-47), non-coding sequence of the FAD2-1 (SEQ ID NO:1 and 5-6) and non-coding sequences FATB-1 (SEQ ID NO:29-37) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. These vectors are then cut with NotI and are ligated with the vector pMON80612 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene structure, shown in Fig, used for transformation methods presented in this description.

The DNA sequence containing the gene for Delta-9-desaturase regulated promoter 7S and the 3'end termination sequences TML, cut with appropriate restriction enzymes, and are ligated with the above expressing the design. Received expressing the design shown in Fig-In, is used for transformation methods presented in this description.

A vector containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), regulated by the promoter arcelin beans and 3'end termination sequence voltage is on, cut with appropriate restriction enzymes and are ligated with the above expressing the design. Received expressing the gene structure, shown in Fig, used for transformation methods presented in this description.

As shown in Fig, non-coding sequences FATB-2 (SEQ ID NO:44-47), non-coding sequence of the FAD2-1 (SEQ ID NO:1 and 5-6), non-coding sequences FATB-1 (SEQ ID NO:29-37), non-coding sequences FAD3-1A (SEQ ID NO: 7-13 and 16-17) and non-coding sequences FAD3-1B (SEQ ID NO:19-27) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soy-and 3-terminal termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. These vectors are then cut with NotI and are ligated with the vector pMON80612 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene structure, shown in Fig, used for transformation methods presented in this description.

The DNA sequence containing the gene for Delta-9-desaturase regulated promoter 7S and 3'-terminal t is mineralsa sequence TML, cut with appropriate restriction enzymes and are ligated with the above expressing the design. Received expressing the design shown in Fig-In, is used for transformation methods presented in this description.

A vector containing the gene AS IV C. pulcherrima (SEQ ID NO:39), regulated by the promoter arcelin beans Brassica and 3'end termination sequences napina, cut with appropriate restriction enzymes and are ligated with the above expressing the design. Received expressing the gene structure, shown in Fig, used for transformation methods presented in this description.

Vector pMON93501 contains intron 1 FAD2-1A soybean (SEQ ID NO:1), functionally associated with the promoter 7Sα' soy and the 3'end termination sequences N6, gene KAS IV C. pulcherrima (SEQ ID NO:39), functionally associated with the promoter napina Brassica and 3'end termination sequences napina Brassica, gene Delta-9-desaturase Ricinus communis (publication of the patent application U.S. No. 2003/00229918 A1), functionally associated with the promoter 7SA soy and the 3'end termination sequences nos, and gene CP4 EPSPS protein functionally associated with an EFMV promoter (constitutive promoter derived from a virus of the mosaic of norichika) and the 3'end termination sequence is lnasty pea Rubisco, in this case, all sequences were flanked by boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). Received expressing the gene construct used for transformation methods presented in this description.

3C. Antisense constructs

On Fig shows the nucleic acid molecules of the present invention, in which the first set of DNA sequences able to Express antisense constructs, and Fig-18 shows the nucleic acid molecules of the present invention, in which the first set of DNA sequences able to Express the combination of sense and antisense constructs. The second set of DNA sequences comprises coding sequences, each of which is a DNA sequence, coding sequence, in which case the expression can increase the level of protein or transcript either as protein or transcript encoded a gene selected from the group comprising KAS I, KAS IV, Delta-9-desaturase and CP4 EPSPS protein. Each coding sequence is associated with a promoter, which is any promoter that functions in the plant, or any plant promoter may be the FMV promoter, the promoter napina, 7S promoter (7Sα 7Sα'), the promoter of urzelina, promoter Delta-9-desaturase or promoter FAD2-1A.

As shown in Fig, the sequence 3'-UTR FAD2-1 (SEQ ID NO:5), 3'-UTR FATB-1 (SEQ ID NO:36) and 3'-UTR FAD3-1A (SEQ ID NO:16) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in antisense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences peas Rubisc e. Received expressing the gene construct pMON80615 shown in Fig use for transformation methods presented in this description.

Sequence 3'-UTR FAD2-1 (SEQ ID NO:5), 3'-UTR FATB-1 (SEQ ID NO:36) and 3'-UTR FAD3-1A (SEQ ID NO:16) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in antisense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein, R is guirey the FMV promoter and the 3'end termination sequences of the pea Rubisco e. A vector containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene construct pMON80616 shown in Fig use for transformation methods presented in this description.

Sequence 3'-UTR FAD2-1 (SEQ ID NO:5), 3'-UTR FATB-1 (SEQ ID NO:36) and 3'-UTR FAD3-1A (SEQ ID NO:16) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in antisense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. The vector containing the gene for Delta-9-desaturase (FAD2) R. ommunis (SEQ ID NO:40), regulated by the promoter of the soybean FAD2 and the 3'end termination sequences nos, cut with appropriate restriction enzymes and are ligated with the vector pMOB41164. Received expressing the gene construct pMON80617 shown in Fig use for transformation methods, not only nymi in the present description of the invention.

Sequence 3'-UTR FAD2-1 (SEQ ID NO:5), 3'-UTR FATB-1 (SEQ ID NO:36) and 3'-UTR FAD3-1A (SEQ ID NO:16) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in antisense orientation into the vector containing the promoter of the soybean 7Sα and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene construct pMON80630 shown in Fig use for transformation methods presented in this description.

Sequence 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO:6 and 5, legirovannye with each other), 5'-UTR-3'-UTR FATB-1 (SEQ ID NO:37 and 36, legirovannye with each other). 3'-UTR FAD3-1A (SEQ ID NO:16) and 5'-UTR-3'-UTR FAD3-1B (SEQ ID NO:27 and 26, legirovannye each other) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in antimicrobal orientation in the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164, terrasim gene CP4 EPSPS protein, regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. A vector containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'end termination sequences napina Brassica, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene construct A8 shown in Fig use for transformation methods presented in this description.

As shown in Fig, the sequence 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO:6 and 5, legirovannye with each other), 5'-UTR-3'-UTR FAD3-1A (SEQ ID NO:17 and 16, legirovannye with each other) and 5'-UTR-3'-UTR FATB-1 (SEQ ID NO:37 and 36, legirovannye each other) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml, with additional promoter soybean 7Sα between semantic and antimuslim sequences using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received Express the ith gene construction O3, shown in Fig use for transformation methods presented in this description.

Sequence 5'-UTR-3'-UTR FAD2-1 (SEQ ID NO:6 and 5, legirovannye with each other), 5'-UTR-3'-UTR FAD3-1A (SEQ ID NO:27 and 26, legirovannye with each other) and 5'-UTR-3'-UTR FATB-1 (SEQ ID NO:37 and 36, legirovannye each other) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml, with additional promoter soybean 7Sα between semantic and antimuslim sequences using XhoI sites created at the 5'-ends of primers for PCR. This vector is then cut with NotI and are ligated with the vector pMON41164 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. A vector containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), a regulated promoter napina Brassica and 3'-terminal sequence napina Brassica, cut with appropriate restriction enzymes and are ligated with the vector pMON41164. Received expressing the gene construct O4 shown in Fig use for transformation methods presented in this description.

As shown in Fig, nicodemous the e sequence FATB-2 (SEQ ID NO:44-47), non-coding sequence FATB-1 (SEQ ID NO:29-37) and non-coding sequence of the FAD2-1 (SEQ ID NO:1 and 5-6) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml. This vector is then cut with the appropriate restriction endonuclease and are ligated with the vector pMON80612 containing gene CP4 EPSPS protein, regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene structure, shown in Fig, used for transformation methods presented in this description.

The DNA sequence containing the gene for Delta-9-desaturase regulated promoter 7S and the 3'end termination sequences TML, cut with appropriate restriction enzymes and are ligated with the above expressing the design. Received expressing the design shown in Fig-In, is used for transformation methods presented in this description.

A vector containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), regulated by the promoter arcelin beans and 3'end termination sequence voltage is on, cut with appropriate restriction enzymes and are ligated with the above expressing the design. Received expressing the gene structure, shown in Fig, used for transformation methods presented in this description.

As shown in Fig, non-coding sequences FATB-2 (SEQ ID NO:44-47), non-coding sequences FATB-1 (SEQ ID NO:29-37), non-coding sequence of the FAD2-1 (SEQ ID NO:1 and 5-6) and non-coding sequences FAD3-1A (SEQ ID NO:7-13 and 16-17) soybean amplified by PCR with the formation of PCR products containing re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the vector containing the promoter 7Sα' soybean and 3'end termination sequences tml. This vector is then cut with the appropriate restriction endonuclease and are ligated with the vector pMON80612 containing gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco e. Received expressing the gene structure, shown in Fig, used for transformation methods presented in this description.

The DNA sequence containing the gene for Delta-9-desaturase regulated promoter 7S and the 3'end termination sequences TML, cut sootvetstvuyuschimi restriction enzymes and are ligated with the above expressing constructs. Received expressing the design shown in Fig-In, is used for transformation methods presented in this description.

A vector containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), regulated by the promoter arcelin beans and 3'end termination sequences napina, cut with appropriate restriction enzymes and are ligated with the above expressing the design. Received expressing the gene structure, shown in Fig, used for transformation methods presented in this description.

As shown in Fig, non-coding sequences FATB-2 (SEQ ID NO:44-47), non-coding sequences FATB-1 (SEQ ID NO:29-37), non-coding sequence of the FAD2-1 (SEQ ID NO:1 and 5-6), non-coding sequences FAD3-1A (SEQ ID NO:7-13 and 16-17) and non-coding sequences FAD3-1B (SEQ ID NO:19-27) soybean amplified by PCR with the formation of PCR products, including re-created restriction sites at both ends. The products of PCR clone in the sense and antisense orientation in the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml. This vector is then cut with the appropriate restriction endonuclease and are ligated with the vector pMON80612 containing gene CP4 EPSPE regulated by the FMV promoter and the 3'end termination pic what ecovitality pea Rubisco. Received expressing the gene structure, shown in Fig, used for transformation methods presented in this description.

The DNA sequence containing the gene for Delta-9-desaturase regulated promoter 7S and the 3'end termination sequences TML, cut with appropriate restriction enzymes and are ligated with the above expressing the design. Received expressing the design shown in Fig-In, is used for transformation methods presented in this description.

A vector containing the gene KAS IV C. pulcherrima (SEQ ID NO:39), regulated by the promoter arcelin beans and 3'end termination sequences napina, cut with appropriate restriction enzymes and are ligated with the above expressing the design. Received expressing the gene structure, shown in Fig, used for transformation methods presented in the present description of the invention. The above nucleic acid molecules are preferred variant of the invention, to implement the objectives, features and advantages of the present invention. One should not assume that the present invention limited to the illustrated variants of the invention. Whic is agenie sequences in the first and second populations of DNA sequences in the nucleic acid molecule is not limited to the illustrated and described locations and may change in any way, acceptable for the purposes of distinctive features and advantages of the present invention presented in this description of the invention, illustrated in the accompanying drawings and covered by the claims.

3D. Assembly in vivo

One object of the present invention is the construction of DNA used for the Assembly of recombinant transcription unit in the chromosome of a plant in planta, which are capable of forming double-stranded RNA. The Assembly of such structures and methods in vivo recombinant transcription unit for suppressing gene is described in international patent application number PCT/US2005/00681, which is fully incorporated into the present description by reference.

pMON93505 is a structure used to assemble in vivo, which contains two segments of the T-DNA flanked boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). The first segment of T-DNA contains a promoter 7Sα' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 100 consecutive nucleotides from the 3'-end and legirovannym with 3'-UTR FATB-1a, followed by 5'-UTR FATB-1a gene KAS IV C. pulcherrima (SEQ ID NO:39), functionally associated with the promoter napina Brassica and 3'end termination sequences napina Brassica, gene Delta-9-desaturase Ricinus communis (publication of the application on atent U.S. No. 2003/00229918 A1), functionally linked to the promoter 7SA soy and the 3'end termination sequences nos, and CF gene EPSPS protein functionally linked to the promoter FMV and the 3'end termination sequences of the pea Rubisco e, all sequences were flanked by boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). In the same construction in the second segment of T-DNA flanked by another RB and LB, is a 3'end terminating sequence N6, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 100 consecutive nucleotides from the 3'-end and legirovannym with 3'-UTR FATB-1a, followed by 5'-UTR FATB-1a. Received expressing the gene construct used for transformation methods presented in this description.

When two segments of the T-DNA of the above constructions introduced in one locus of the chromosome of the host body in the orientation of the RB-RB, assembled transcription unit contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A and DNA fragments FATB-1a soy in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientation are capable of forming double-stranded RNA, effectively overwhelming FAD2-1 and FATB.

pMON93506 is a structure used is used for Assembly in vivo, which contains two segments of the T-DNA flanked boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). The first T-DNA contains a promoter 7Sα' soy, functionally associated with the intron 1 FAD2-1A (SEQ ID NO:1), reduced by 100 consecutive nucleotides from the 3'-end and legirovannym with 3'-UTR FATB-1a, followed by 5'-UTR FATB-1a gene Delta-9-desaturase Ricinus communis (publication of the patent application U.S. No. 2003/00229918 A1), functionally associated with the promoter 7SA soy and the 3'end termination sequences nos, and gene CP4 EPSPS protein functionally associated with eFMV promoter and the 3'end termination sequences of the pea Rubisco e, with all sequences flanked LB and RB. In the same vector in the second segment of T-DNA located 3'end termination sequence, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 100 consecutive nucleotides from the 3'-end and legirovannym with 3'-UTR FATB-1a, followed by 5'-UTR FATB-1a, flanked another RB and LB. Received expressing the gene construct used for transformation methods presented in this description.

When two segments of the T-DNA of the above constructions introduced in one locus of the chromosome of the host body in the orientation of the RB-RB, assembled transcription unit contains a 7Sα promoter' soy functionally connected the with intron 1 FAD2-1A and DNA fragments FATB-1a soy in sense or antisense orientation. Being transcribed, functionally related RNA sequences in the sense and antimicrobal orientation capable of forming double-stranded RNA, effectively overwhelming FAD2-1 and FATB.

pMON95829 is a structure used to assemble in vivo, which contains two segments of the T-DNA flanked boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). The first T-DNA contains a promoter 7Sα' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 100 consecutive nucleotides from the 3'-end and legirovannym with 42 consecutive nucleotides 5'-UTR FATB-1a, followed by the coding region of the transit peptide chloroplast (“CTP”) FATB-1, and gene SR EPSPS protein functionally associated with an EFMV promoter and the 3'end termination sequences of the pea Rubisco e, all sequences were flanked by boundary elements of the T-DNA of Agrobacterium then there is DNA right edge (RB) and the DNA left edge (LB). In the same vector in the second segment of T-DNA flanked by another RB and LB, is a 3'end terminating sequence N6, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 100 consecutive nucleotides from the 3'-end and legirovannym with 42 consecutive nucleotides 5'-UTR FATB-1a, followed by the coding region of the transit peptide chloroplast is FATB-1 (“CTP”). Received expressing the gene construct used for transformation methods presented in this description.

When two segments of the T-DNA of the above constructions introduced in one locus of the chromosome of the host body in the orientation of the RB-RB, assembled transcription unit contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A and DNA fragments FATB-1a soy in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientation are capable of forming double-stranded RNA, effectively overwhelming FAD2-1 and FATB.

pMON97595 is a structure used to assemble in vivo, which contains two segments of the T-DNA flanked boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). The first segment of T-DNA contains a promoter 7Sα'soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 320 consecutive nucleotides from the 3'-end and legirovannym with 42 consecutive nucleotides 5'-UTR FATB-1a, followed by the coding region of the transit peptide chloroplast (“CTP”) FATB-1a gene CP4 EPSPS protein functionally associated with an EFMV promoter and the 3'end termination sequences of the pea Rubisco e, all sequences were flanked by curved element is mi T DNA that is, DNA right edge (RB) and the DNA left edge (LB). In the second segment of T-DNA flanked by another RB and LB, is a 3'end terminating sequence N6, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 320 consecutive nucleotides from the 3'-end and legirovannym with 42 consecutive nucleotides 5'-UTR FATB-1a, followed by the coding region P FATB-1a. Received expressing the gene construct used for transformation methods presented in this description.

When two segments of the T-DNA of the above constructions introduced in one locus of the chromosome of the host body in the orientation of the RB-RB, assembled transcription unit contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A and DNA fragments FATB-1a soy in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientation are capable of forming double-stranded RNA, effectively overwhelming FAD2-1 and FATB.

pMON97581 is a structure used to assemble in vivo, which contains two segments of the T-DNA flanked boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). The first segment of T-DNA contains a promoter 7Sα' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), Mersenne 320 consecutive nucleotides from the 3'-end and legirovannym with the coding region of the transit peptide chloroplast (“CTP”) FATB-1a, and gene CP4 EPSPS protein functionally associated with an EFMV promoter and the 3'end termination sequences of the pea Rubisco e, all sequences were flanked by boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). In the same construction in the second segment of T-DNA flanked by another RB and LB, is a 3'end terminating sequence N6, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 320 consecutive nucleotides from the 3'-end and legirovannym with the coding region of the P FATB-1a. Received expressing the gene construct used for transformation methods presented in this description.

When two segments of the T-DNA of the above constructions introduced in one locus of the chromosome of the host body in the orientation of the RB-RB, assembled transcription unit contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A and DNA fragments FATB-1a soy in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientation are capable of forming double-stranded RNA, effectively overwhelming FAD2-1 and FATB.

pMON97596 is a structure used to assemble in vivo, which contains two segments of the T-DNA flanked boundary elements of the T-DNA Arobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). The first segment of T-DNA contains a promoter 7Sα' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 320 consecutive nucleotides from the 3'-end and legirovannym with 180 BP 5'-end coding region of the transit peptide chloroplast (“CTP”) FATB-1, and gene CP4 EPSPS protein functionally associated with an EFMV promoter and the 3'end termination sequences of the pea Rubisco e, all sequences were flanked by boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and DNA left edge (LB). In the same construction in the second segment of T-DNA flanked by another RB and LB, is a 3'end terminating sequence N6, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 320 consecutive nucleotides from the 3'-end and legirovannym with 180 BP 5'-end coding region P FATB-1a. Received expressing the gene construct used for transformation methods presented in this description.

When two segments of the T-DNA of the above constructions introduced in one locus of the chromosome of the host body in the orientation of the RB-RB, assembled transcription unit contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A and DNA fragments FATB-1A soy in sense or antisense orientation. Being transcribed, fu is clonale related RNA sequences in sense and antisense orientation are capable of forming double-stranded RNA, effectively overwhelming FAD2-1 and FATB.

MON97597 is a structure used to assemble in vivo, which contains two segments of the T-DNA flanked boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). The first segment of T-DNA contains a promoter 7Sα' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 320 consecutive nucleotides from the 3'-end and legirovannym with 120 BP 5'-end coding region of the transit peptide chloroplast (“CTP”) FATB-1a gene CP4 EPSPS protein functionally associated with an EFMV promoter and the 3'end termination sequences of the pea Rubisco e, all sequences were flanked by boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and DNA left edge (LB). In the same construction in the second segment of T-DNA flanked by another RB and LB, is a 3'end terminating sequence N6, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 320 consecutive nucleotides from the 3'-end and legirovannym with 120 BP 5'-end coding region P FATB-1a. Received expressing the gene construct used for transformation methods presented in this description.

When two segments of the T-DNA of the above constructions introduced in one locus of the chromosome of the host body in the orientation of the RB-RB, sobran what I transcription unit contains a 7Sα promoter' soy functionally associated with the intron 1 FAD2-1A and DNA fragments FATB-1a soy in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientation are capable of forming double-stranded RNA, effectively overwhelming FAD2-1 and FATB.

pMON97598 is a structure used to assemble in vivo, which contains two segments of the T-DNA flanked boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). The first segment of T-DNA contains a promoter 7Sα' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 340 consecutive nucleotides from the 3'-end and legirovannym with the coding region of the transit peptide chloroplast (“CTP”) FATB-1a gene CP4 EPSPS protein functionally associated with an EFMV promoter and the 3'end termination sequences of the pea Rubisco e, all sequences were flanked by boundary elements of the T-DNA of Agrobacterium, that is, DNA right edge (RB) and the DNA left edge (LB). In the same construction in the second segment of T-DNA flanked by another RB and LB, is a 3'end terminating sequence N6, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 340 consecutive nucleotides from the 3'-end and legirovannym with the coding region of the P FATB-1a. Received Express the dominant gene construct used for transformation methods presented in this description.

When two segments of the T-DNA of the above constructions introduced in one locus of the chromosome of the host body in the orientation of the RB-RB, assembled transcription unit contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A and DNA fragments FATB-1a soy in sense or antisense orientation. Being transcribed, functionally related RNA sequences in sense and antisense orientation are capable of forming double-stranded RNA, effectively overwhelming FAD2-1 and FATB.

Example 4. Transformation and plant analysis

Design examples 2 and 3 is stably introduced into soybean (for example, Asgrow varieties A, Asgrow varieties A or Asgrow varieties A) by the above methods, including the methods presented in the publication McCabe et al., Bio/Technology 6:923-926 (1988), or by the method of transformation mediated by Agrobacterium. Transformed soybean plants identified by selection on medium containing glyphosate. The compositions of fatty acids analsouth gas chromatography in the seeds of soybean lines transformed by the above-mentioned structures. In addition, any design can contain other interest sequence, as well as different combinations of promoters.

For some applications the modified compositions of fatty acids determined in razvivaushih the seeds, while in other cases, such as when performing a profile analysis of oils, determining modifications of fatty acids occurring later in the path FAS, or the detection of minor modifications in the composition of fatty acids, preferably using Mature seeds. In addition, it may be desirable to perform the analysis of oils and/or fatty acids in some seeds, especially when determining the modification of the oil in splitting populations of seeds R1. Used here is the generation R0means plants obtained by transformation/regeneration described in the present description of the invention and generation of R1means seeds, obtained by “their” transgenic plants R0. Plants R1grown from seeds R1.

The compositions of fatty acids to determine seed soybean lines transformed with constructs according to example 3. From one to ten seeds of transgenic and control lines of soybeans are crushed separately using a tissue homogenizer (Pro Scientific) for extraction of oil. The oil from the crushed seed of soybean extracted overnight in 1.5 ml of heptane containing trigatron (0.50 mg/ml). From an aliquot of 200 µl of the extracted oil are methyl ester, adding 500 μl of sodium methoxide in absolute methanol. Reaction formation derived link is carried out for 20 minutes at 50°C. The above reaction is terminated as a result of simultaneous add 500 ál of 10% (wt./about.) sodium chloride and 400 μl of heptane. The obtained methyl ester of fatty acids, extracted with hexane, examine by gas chromatography (GC) gas chromatograph model 6890 Hewlett-Packard (Palo Alto, CA). Specified gas chromatograph equipped with a column Supercowax 250 (30 m, inner diameter 0.25 mm, film thickness 0.25 µm) (Supelco, Bellefonte, PA). The temperature of the column during the injection equal to 175°C, with a programmed temperature change from 175°C to 245°C to 175°C at 40°C/min, the temperature of the dispenser and detector, respectively, 250°C and 270°C.

Example 5. The synthesized liquid fuels with improved properties of biodiesel

In the fatty acid composition of the synthesized liquid fuel contains the following mixture of methyl esters of fatty acids: 73,3% oleic acid, 21,4% of linoleic acid, 2,2% palmitic acid, 2.1% of linolenic acid and 1.0% stearic acid (all values expressed in mass percent). Purified methyl ester of fatty acids obtained from Nu-Chek Prep., Ind., Elysian, MN, USA. The cetane number and the ignition delay of the specified composition defined in southwest research Institute using quality analyzer poplasen is based (“IQT”) 613 (Southwest Research Institute, San Antonio, Texas, USA).

The quality analyzer ignition consists of a combustion chamber of constant volume with an electrical heating systems, fuel injection and computer used to monitor the course of an experiment, recording, and interpreting data. The system of injection of fuel includes a fuel nozzle, forming an inlet opening in the combustion chamber. Needle sensor in the fuel injector detects the flow of fuel into the combustion chamber. A pressure sensor attached to the combustion chamber, measures the pressure in the cylinder and the pressure in the combustion chamber. The quality analyzer ignition is used mainly to measure the time from the start of fuel injection into the combustion chamber before combustion. thermodynamic conditions in the combustion chamber is controlled with high accuracy for consistent measurement of time of ignition delay.

To determine the cetane number and the ignition delay test fuel is filtered through a 5 micron filter. Fuel tank, line and injection nozzle blow pressurized with nitrogen. Fuel tank cleaned lint-free cloth. Part of the test fuel used for flushing the fuel tank, lines, injectors and nozzles. The tank fill with test fuel and from the system to remove all air. In rezé is the create storage tank pressure, equal to 3.5 bar (50 psi). This method consists in injecting under high pressure a precisely measured amount of the test fuel in the combustion chamber, which is filled with air to achieve the required pressure and temperature. The measurement consists in determining the time from start of injection to start of combustion, which is often defined as the delay time of ignition. This definition is based on measured lift the needle and the pressure in the combustion chamber. The usual procedure of determination of cetane number requires the creation of a surface temperature equal to 567,5°C, and air pressure, equal to 2.1 MPa.

Fuel with a known delay injection is fed to the combustion chamber IQT in the beginning of the day to ensure that this device is created normal parameters. Then explore the tested synthetic fuel. Then again examine the known fuel to verify correct installation of the system parameters. Immediately after you attach the fuel tank to pump fuel injection controller computer initiates the testing process. The computer controls the entire process, including air supply, fuel injection and removal of combustion products. Combustion is repeated 32 times.

Time ignition delay is the time from start of injection to start of combustion. This item is Ramer determined on the basis of lifting the needle and the pressure in the cylinder. The rise of the needle injection indicates the beginning of the injection. The pressure in the cylinder drops slightly due to the cooling effect of the evaporation of fuel. The start of combustion is defined as the recovery time of the pressure in the cylinder, which increases due to combustion before reaching the pressure prior to the injection of fuel.

The measured delay time of ignition is used to determine the cetane number based on the calibration curve, which is injected into the program of collecting and pre-processing of data. A standard curve by determining the cetane number depending on the time of ignition delay, gain, using a mixture of the reference fuel and control fuel NEG. In the case of the tested fuels that are liquid at room temperature, a calibration curve daily checks using at least one reference fuels of known cetane number (Ryan, "Correlation of Physical and Chemical Ignition Delay to Cetane Number", SAE Paper 852103 (1985); Ryan, "Diesel Fuel Ignition Quality as Determined in a Constant Volume Combustion Bomb", SAE Paper 870586 (1986); Ryan, "Development of a Portable Fuel Cetane Quality Monitor", Belvoir Fuels and Lubricants Research Facility, Report No. 277, May (1992); Ryan, "Engine and Constant Volume Bomb Studies of Diesel Ignition and Combustion", SAE Paper 881616 (1988); and Allard et al. "Diesel Fuel Ignition Quality as Determined in the Ignition Quality Tester ("IQT")", SAE Paper 961182 (1996)). As shown in table 3, the synthesized oil has a cetane number and sachenhausen ignition delay, suitable for use oils with this composition without any restrictions as biodiesel.

0,116
Table 3
Name fuelNumber
test
Cetane numberThe standard deviation of the cetane numberThe ignition delay (MS)The standard deviation of the ignition delay
Check-High1177749,550,5344,0090,044
Check-High177849,330,6114,0280,051
Average49,4as 4.02
Synthesized oil177955,021,8973,622
Synthesized oil178055,651,8073,5830,109
Synthesized oil178155,631,6493,5830,098
Average55,43,60
Check-High178649,20,7274,040,061
1Fuel, referred to as “Check-High”, is the fuel gauge. This fuel should have a cetane number equal to 49.3±0.5 in. The device settings is checked by means of the calibration of the fuel before and after tests synthetic test fuel.

Density (ASTM D-4052), cloud point (ASTM D-2500), pour point (ASTM D-97) and the temperature of the clogging of the filter in cold condition (IP 309/ASTM D 6371) is determined for the synthesized oil in accordance to the protocols of the ASTM test d The protocols of the ASTM test D provided by the American society for testing and materials, 100 Barr Harbor Drive, West Conshohocken, PA, USA. The results of these tests are given in table 4. As shown in table 4, the synthesized oil has performance suitable for use oils with this composition without any restrictions as biodiesel.

Table 4
TestMethodResults
DensityASTM D-40520,8792 g/ml
The cloud pointASTM D-2500-18°C
The pour pointASTM D-97-21°C
The temperature of the clogging of the filter in the coldIP 309 (similar to ASTM D-6371)-21°C

The levels of excretion of nitric oxide evaluate, determining the levels of unsaturation of bio-fuels by measurement of fuel density and calculate the estimated levels of allocation or by a direct measurement. In addition to the CSO, there are standard methods for direct measurement of the levels of excretion of nitric oxide. Based on the assessment of the overall level of unsaturation synthetic oil installed that synthetic oil is characterized by lower levels of excretion of nitric oxide in comparison with difficult methyl esters fatty acids derived from conventional soybean oil. Oils containing a greater number of double bonds, that is, having a higher degree of unsaturation, secrete more nitric oxide. This oil has a total of 123 double bond compared to 153 double bonds of conventional soybean oil, as shown in table 5.

Table 5
Synthetic oil
73% oleic acid (18:1) × 1 double bond =73
22% linoleic acid (18:2) × 2 double bonds =44
2% linolenic acid (18:3) × 3 double bonds =6
The total number of double bonds123
Conventional soybean oil
23% oleic acid (18:1) × 1 double bond =23
53% linoleic acid (18:2) × 2 double bonds =106
8% linolenic acid (18:3) × 3 double bonds =24
The total number of double bonds153

According to the National renewable energy laboratory, contract # ACG-8-17106-02 Final Report, The Effect Of Biodiesel Composition On Engine Emissions From A DDC Series 60 Diesel Engine, (June 2000) isolation of nitric acid biological diesel fuel can be calculated by the formula y = 46,h - 36,388, where y means the selection oxide in grams/braking power in horsepower × hour (g/HP·h); and x means the density of biodiesel. This formula is based on the regression analysis of the data selection nitric acid when tested 16 biological diesel fuels. When performing the specified tests used the calibration engine production series 1991 model 60 Detroit Diesel Corporation.

The density of the synthesized oils identified in the South-West research Institute method ASTM D4052. The result is shown in table 4, are used in the above equation to forecast the financing value allocation of nitric oxide, equal 4,89 g/HP·HR. The result is comparable to the rate control soybean product. In the report of the National renewable energy laboratory the data density and excretion of nitric oxide for the control of biodiesel from soybean (methyl ester of soybean IGT). Density control of biodiesel is equal to 0,8877 g/ml, so the calculated value of the allocation of nitrogen oxide is 5.30 g/HP·HR. The calculated value of the allocation similar to the experimental value allocation of nitric oxide equal to 5.32 g/HP·HR. Synthetic oil has better values compared to control fuel and is suitable for use without any restrictions as biodiesel.

Example 6. The optimal composition of fatty acids required for normal levels of lipids in serum

Determined properties of the compositions of vegetable oils in lowering the cholesterol level to identify the composition of fatty acids that have a more favorable effect on lipids in serum compared to conventional soybean oil (i.e. lower cholesterol LDL and higher cholesterol HDL). To compare the effects on the levels of lipids in human serum new train the oils from seeds with conventional soybean oil used published equations, derived on the basis of 27 clinical trials (Mensink, R.P. and Katan, M.B. Arteriosclerosis and Thrombosis, 12:911-919 (1992)).

The following table 6 presents the results of changes in the content of lipids in the serum when replacing lipids 30% of food energy created by carbohydrates. The results show that soybean oil is already having a beneficial effect on the lipid levels in the serum when you replace the carbohydrates in the diet. Part of the specified oil can be improved by reducing levels of saturated fat and achieve a level of linoleic acid to 10-30% of the total fatty acids, preferably up to about 15-25% of the total content of fatty acids. When the proportion of linoleic acid is less than 10% of the total fatty acids, a new structure increases the level of LDL cholesterol compared with the control soy oil, even if the saturated fat content is 5% of the total content of fatty acids. While the proportion of linoleic acid the ability of the composition to increase the levels of HDL in the serum is reduced. Therefore, the preferred content of linoleic acid in the oil should be equal to approximately 15-25% of the total content of fatty acids.

0,504
Table 6
Fatty acids
C16:0C18:0C18:1C18:2C18:3Other
(C20:1)
Lipids in serum
Control soybean oil (%)11,0004,00023,40053,2007,8000,600
The share of 30% fat (%)3,3001,2007,02015,9602,3400,180
Calculation of LDL (mg/DL)4,2241,5361,6858,7781,2870,043-6,033
Calculation of HDL (mg/DL)1,5510,5642,3874,4690,6550,061 9,687
3% 18:1, <6% saturated fatty acids (%)3,0002,00085,0003,0003,0004,000
The share of 30% fat (%)to 0.9000,60025,500to 0.900to 0.9001,200
Calculation of LDL (mg/DL) compared with the control oil (mg/DL)1,1520,7686,1200,4950,495in 0.288-5,578
0,555
Calculation of HDL (mg/DL) compared with the control oil (mg/DL)0,4230,2828,6700,252 0,2520,40810,287
0,600
10% 18:2, <6% saturated fatty acids (%)3,0002,00072,00010,0003,00010,000
The share of 30% fat (%)to 0.9000,60021,6003,000to 0.9003,000
Calculation of LDL (mg/DL) compared with the control oil (mg/DL)1,1520,7685,1841,6500,495determined as 0.720-6,129
Calculation of HDL (mg/DL) compared with the control oil (mg/DL)0,4230,2827,3440,8400,2521,02010,161
0,474
20% 18:2, <6% saturated fatty acids (%)3,0002,00065,00020,0003,0007,000
The share of 30% fat (%)to 0.9000,60019,5006,000to 0.9002,100
Calculation of LDL (mg/DL) compared with the control oil (mg/DL)1,1520,7684,6803,3000,495-7,059
-1,026
Calculation of HDL (mg/DL) compared with the control oil (mg/DL)0,4230,2826,6301,6800,2520,7149,981
0,294
21% 18:2,<a 3.2% saturated fatty acids (%)2,0001,00072,00021,0001,0003,000
The share of 30% fat (%)0,6000,30021,6006,3000,300to 0.900
Calculation of LDL (mg/DL) compared with the control oil (mg/DL)0,7680,3845,1843,4650,1650,216-7,878
-1,845
Calculation of HDL (mg/DL) compared with the control oil (mg/DL)0,2820,1417,3441,7640,0840,3069,921
0,234
30% 18:2, <6% saturated fatty acids (%)3,0002,00057,00030,0003,0005,000
The share of 30% fat is (%) to 0.9000,60017,1009,000to 0.9001,500
Calculation of LDL (mg/DL) compared with the control oil (mg/DL)1,1520,7684,1044,9500,4950,360-7,989
-1,956
Calculation of HDL (mg/DL) compared with the control oil (mg/DL)0,4230,2825,8142,5200,2520,5109,801
0,114

Example 7

The following fourteen stages illustrated irout creating vector pMON68537, intended for transformation of plants with the aim of suppressing gene FAD2, FAD3, and FATB and overexpression of Delta-9-desaturase in soy. In particular, this design includes a promoter 7S, functionally associated with the intron and 3'-UTR of soy in sense orientation, i.e. intron No. 1 FAD2-1A, 3'-UTR FAD3-1A 3'-UTR FATB-1, spillovers petrobrazi splitarray intron and a complementary series of intron and 3'-UTR of soy in antisense orientation, i.e. the 3'-UTR FATB-1, 3'-UTR FAD3-1A intron # 1 of FAD2-1A and FAD2 promoter soybean, stimulating Delta-9-desaturase.

Stage 1. Intron No. 5 FAD3-1A soy, which is part of spliceimage intron structure crnci, amplified by PCR, using genomic DNA of soybean as a matrix, with the following primers:

5'-terminal primer = 19037 = ACTAGTATATTGAGCTCATATTCCACTGCAGTGGATATT

GTTTAAACATAGCTAGCATATTACGCGTATATTATACAAGCTTATATTCCCGGG

ATATTGTCGACATATTAGCGGTACATTTTATTGCTTATTCAC

the 3'end of primer = 19045 =

ACTAGTATATTGAGCTCATATTCCTGCAGGATATTCTCGAG

ATATTCACGGTAGTAATCTCCAAGAACTGGTTTTGCTGCTTGTGTCTGCAGTGAATC

These primers add sites to clone the 5'- and 3'-ends. To the 5'-end: SleI, SacI, BstXI, PmeI, NheI, MluI, HindIII, XmaI, SmaI, SalI. To 3'-end: SeI, SacI, Sse8387I, XhoI. Intron No. 5 FAD3-1A soy, which is the product of the PCR clone in pCT2.1, creating KAWHIT03.0065. Then KAWHIT03.0065 split SpeI and the ends are filled with Pfu polymerase and pMON68526 (empty vector, resistant to chloramphenicol (hereinafter referred to as CM), split HindIII and the ends filled the Pfu polymerase. KAWHIT03.0065 and pMON68526 are ligated with education pMON68541 (intron No. 5 FAD3-1A soybean with multiple cloning sites in the vector, resistant to amphenicol).

Stage 2. 3'-UTR FATB-1 soybean amplified with the following primers:

18662 = TTTTAATTACAATGAGAATGAGATTTACTGC (add Bsp120I to the 5'-end) and 18661 = GGGCCCGATTTGAAATGGTTAACG. The PCR product are ligated with pCR2.1, generating KAWHIT03.0036.

Stage 3. KAWHIT03.0036 split Bsp120I and EcoRI and clone in KAWHIT03.0032 (empty CM resistant vector with multiple cloning site), creating KAWHIT03.0037 (3'-UTR FATB-1 in the empty CM resistant vector).

Stage 4. 3'-UTR FAD3-1A soy amplified with the following primers:

18639 = GGGCCCGTTTCAAACTTTTTGG (add Bsp120I to the 5'-end) and 18549 = TGAAACTGACAATTCAA. The PCR product are ligated with pCR2.1, generating KAWHIT03.0034.

Stage 5. KAWHIT03.0034 split Bsp120I and EcoRI and are ligated with KAWHIT03.0032 (empty CM resistant vector with multiple cloning site), creating KAWHIT03.0035 (3'-UTR FAD3-1A in the empty CM resistant vector).

Stage 6. Intron No. 1 FAD2-1A soy amplified by PCR using genomic DNA of soybean as a matrix, with the following primers: 5'-terminal primer = 18663 = GGGCCCGGTAAATTAAATTGTGC (add Bsp120I site to the 5'-end); and 3'end primer = 18664 = CTGTGTCAAAGTATAAACAAGTTCAG. The resulting PCR product clone in pCR2.1, generating KAWHIT03.0038.

Stage 7. Intron No. 1 FAD2-1A soy, which is the product of the PCR, in KAWHIT03.0038, clone in KAWHIT03.0032 (blank CM-resistance is the output vector with multiple cloning site), using the restriction enzymes cut sites Bsp120I and EcoRI. The resulting plasmid is a KAWHIT03.0039 (intron No. 1 FAD2-1A in the empty CM resistant vector).

Stage 8. KAWHIT03.0039 split AscI and HindIII and pMON68541 (AMR-resistant base vector with crnci intron No. 5 FAD3-1A) split the MluI and HindIII. Intron No. 1 FAD2-1A soy directionally clone in pMON68541, creating KAWHIT03.0071 (intron No. 1 FAD2-1A soybean intron No. 5 FAD3-1A SDI).

Stage 9. KAWHIT03.0035 (3'-UTR FAD3-1A in CM resistant vector) split AscI and HindIII and KAWHIT03.0071 (AMR-resistant base vector with crnci intron FAD2-1A intron No. 5 FAD3-1A) split the MluI and HindIII. 3'-UTR FAD3-1A soy directionally clone in KAWHIT03.0071, creating KAWHIT03.0072 (intron No. 1 FAD2-1A and 3'-UTR FAD3-1A intron No. 5 FAD3-1A SDI).

Stage 10. KAWHIT03.0037 (3'-UTR FATB-1 CM resistant vector) split AscI and HindIII and KAWHIT03.0072 split MluI and HindIII. 3'-UTR FATB-1 directionally clone in KAWHIT03.0072, creating KAWHIT03.0073 (intron FAD2-1A, 3'-UTR FAD3-1A 3'-UTR FATB-1 soybean intron No. 5 FAD3-1A).

Stage 11. KAWHIT03.0073 split BstXI and SlI and the fragment containing the intron FAD2-1A, 3'-UTR FAD3-1A and 3'-UTR FATB-1, clear gel. In another tube KAWHIT03.0073 split XhoI and Sse83871. A fragment of intron/3'-UTR clone in KAWHIT03.0073 in the opposite orientation in another site of intron No. 5 FAD3-1A soybean, creating KAWHIT03.0074 (semantic intron No. 1 FAD2-1A soy, meaning the 3'-UTR FAD3-1A soy, meaning the 3'-UTR FATB-1 soybean, splitarray intron No. 5 FAD3-1A soy, antisense 3'-UTR FATB-1 soybean, antimicro the traveler 3'-UTR FAD3-1A soy antisense intron No. 1 FAD2-1A SDI).

Stage 12. To link design crnci with promoter 7S and 3'-terminal sequence TML, KAWHIT03.0074 and pMON68527 (cluster 7S'/3'-end sequence TML) split SacI and are ligated with each other, creating pMON68563 (promoter 7S - semantic intron No. 1 FAD2-1A, sense 3'-UTR FAD3-1A soy, meaning the 3'-UTR FATB-1 soybean, splaisiruemym antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soy, antisense intron No. 1 FAD2-1A soya - 3'-terminal sequence TML).

Stage 13. To enter assembled construction crnci in pMON70682, vectors pMON68563 and pMON70682 NotI digested and are ligated with each other, creating pMON68536, including the promoter 7S, functionally associated with forming double-stranded RNA construct semantic intron No. 1 FAD2-1A, sense 3'-UTR FAD3-1A soy, meaning the 3'-UTR FATB-1 soybean, spliceimage intron No. 5 FAD3-1A soy, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soy, antisense intron No. 1 FAD2-1A and soy terminator 3'-terminal sequence TML).

Stage 14. pMON68536 split AscI and RsrII and pMON68529 (which contains breeding marker CP4, merged with the FMV promoter and 3'-end of the RBCS, and the promoter of the soybean FAD2 stimulating Delta-9-desaturase) split SanDI and AscI. Part crnci vector pMON68536 directionally clone in pMON68529, creating pMON68537 (promoter 7S, functionally associated with the generatrix of the TLD is chained RNA structure semantic intron No. 1 FAD2-1a, sense 3'-UTR FAD3-1A soy, meaning the 3'-UTR FATB-1 soybean, spliceimage intron No. 5 FAD3-1A soy, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soy, antisense intron No. 1 FAD2-1A soy and terminator 3'-terminal sequence of TML, the promoter of the soybean FAD2 stimulating Delta-9-desaturase).

Example 8

The following fifteen stages illustrate the creation of vector pMON68539 (Fig)intended for transformation of plants with the aim of suppressing gene FAD2, FAD3, and FATB and overexpression of Delta-9-desaturase and enzyme KAS IV in soy. In particular, this design includes a promoter 7S, functionally associated with the intron and 3'-UTR of soy in sense orientation, i.e. intron No. 1 FAD2-1A, 3'-UTR FAD3-1A 3'-UTR FATB-1, spillovers petrobrazi splitarray intron, a complementary series of intron and 3'-UTR of soy in antisense orientation, i.e. the 3'-UTR FATB-1, 3'-UTR FAD3-1A intron # 1 of FAD2-1A, FAD2 promoter soybean, stimulating Delta-9-desaturase, and the promoter napina stimulating KAS IV.

Stage 1. Intron No. 5 FAD3-1A soy, which is part spliceimage intron in the design crnci, amplified by PCR, using genomic DNA of soybean as a matrix, with the following primers:

5'-terminal primer = 19037 =

ACTAGTATATTGAGCTCATATTCCACTGCAGTGGATATTG

TTTAAACATAGCTAGCATATTACGCGTATATTATACAAGCTTATATTCCCGGGA

TATTGTCGACATATTAGCGGTACATTTTATTGCTTATTCAC

the 3'end of primer = 19045 =

ACTAGTATATTGAGCTCATATTCCTGCAGGATATTCTCGAG

ATATCACGGTAGTAATCTCCAAGAACTGGTTTTGCTGCTTGTGTCTGCAGTGAATC

These primers add sites to clone the 5'- and 3'-ends. To the 5'-end: SpeI, SacI, BstXI, PmeI, NheI, MluI, HindIII, XmaI, SmaI, SalI. To 3'-end: SpeI, SacI, Sse8387I, XhoI. Intron No. 5 FAD3-1A soy, which is the product of the PCR clone in pCR2.1, generating KAWHIT03.0065. Then KAWHIT03.0065 split SpeI and the ends are filled with Pfu polymerase, pMON68526 (empty CM resistant vector) is digested HindIII and the ends are filled with Pfu polymerase. KAWHIT03.0065 and pMON68526 are ligated, creating pMON68541 (intron No. 5 FAD3-1A soybean with multiple cloning sites in AMR-resistant vector).

Stage 2. 3'-UTR FATB-1 soybean amplified with the following primers:

18662 = TTTTAATTACAATGAGAATGAGATTTACTGC (add Bsp120I to the 5'-end) and 18661 = GGGCCCGATTTGAAATGGTTAACG. The PCR product then are ligated with pCR2.1, generating KAWHIT03.0036.

Stage 3. KAWHIT03.0036 split Bsp120I and EcoRI and clone in KAWHIT03.0032 (empty CM resistant vector with multiple cloning site), creating KAWHIT03.0037 (3'-UTR FATB-1 in the empty CM resistant vector).

Stage 4. 3'-UTR FAD3-1A soy amplified with the following primers:

18639 = GGGCCCGTTTCAAACTTTTTGG (add Bsp120I to the 5'-end) and 18549 = TGAAACTGACAATTCAA. The PCR product are ligated with pCR2.1, generating KAWHIT03.0034.

Stage 5. KAWHIT03.0034 split Bsp120I and EcoRI and are ligated with KAWHIT03.0032 (empty CM resistant vector with multiple cloning site), while receiving KAWHIT03.0035 (3'-UTR FAD3-1A in the empty CM resistant vector).

Stage 6. Intron No. 1 FAD2-1A soy amplified methodology the PCR, using genomic DNA of soybean as a matrix, with the following primers: 5'-terminal primer = 18663 = GGGCCCGGTAAATTAAATTGTGC (add website sp120I to the 5'-end); and 3'end primer = 18664 = CTGTGTCAAAGTATAAACAAGTTCAG. The resulting PCR product clone in pCR2.1, generating KAWHIT03.0038.

Stage 7. Intron No. 1 FAD2-1A soy, which is the product of the PCR, in KAWHIT03.0038, clone in KAWHIT03.0032 (empty CM resistant vector with multiple cloning site)using the restriction enzymes cut sites Bsp120I and EcoRI. The resulting plasmid is a KAWHIT03.0039 (intron No. 1 FAD2-1A soy in potom CM resistant vector).

Stage 8. KAWHIT03.0039 split AscI and HindIII and the vector pMON68541 (AMR-resistant base vector with crnci intron No. 5 FAD3-1A) split the MluI and HindIII. Intron No. 1 FAD2-1A soy directionally clone in pMON68541 (intron No. 5 FAD3-1A in AMR-stable vector with multiple cloning sites), creating KAWHIT03.0071 (intron No. 1 FAD2-1A soybean intron No. 5 FAD3-1A SDI).

Stage 9. KAWHIT03.0035 (3'-UTR FAD3-1A in CM resistant vector) split AscI and HindIII and KAWHIT03.0071 (AMR-resistant base vector with crnci intron FAD2-1A intron No. 5 FAD3-1A) split luI and HindIII. 3'-UTR FAD3-1A soy directionally clone in KAWHIT03.0071, creating KAWHIT03.0072 (intron No. 1 FAD2-1A soy-and 3'-UTR FAD3-1A intron No. 5 FAD3-1A SDI).

Stage 10. KAWHIT03.0037 (3'-UTR FATB-1 CM resistant vector) split AscI and HindIII and KAWHIT03.0072 split MluI and HindIII. 3'-UTR FATB-1 directionally clone in KAWHIT03.0072, ostava KAWHIT03.0073 (intron FAD2-1A, 3'-UTR FAD3-1A 3'-UTR FATB-1 soybean intron No. 5 FAD3-1A).

Stage 11. KAWHIT03.0073 split BstXI and SalI and the fragment containing the intron FAD2-1A, 3'-UTR FAD3-1A and 3'-UTR FATB-1, clear gel. In another tube KAWHIT03.0073 split XhoI and Sse83871. A fragment of intron/3'-UTR clone in KAWHIT03.0073 in the opposite orientation in another site of intron No. 5 FAD3-1A soybean, creating KAWHIT03.0074 (semantic intron No. 1 FAD2-1A soy, meaning the 3'-UTR FAD3-1A soy, meaning the 3'-UTR FATB-1 soybean, splitarray intron No. 5 FAD3-1A soy, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soy, antisense intron No. 1 FAD2-1A SDI).

Stage 12. To link design crnci with promoter 7S and 3'-terminal sequence TML, KAWHIT03.0074 and pMON68527 (cluster 7S'/3'-end sequence TML) split SacI and are ligated with each other, creating pMON68563 (promoter 7S - semantic intron No. 1 FAD2-1A, sense 3'-UTR FAD3-1A soy, meaning the 3'-UTR FATB-1 soybean, splaisiruemym antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soy, antisense intron No. 1 FAD2-1A soya - 3'-terminal sequence TML).

Stage 13. To enter assembled construction crnci in pMON70682, vectors pMON68563 and pMON70682 NotI digested and are ligated with each other, creating pMON68536, including the promoter 7S, functionally associated with forming double-stranded RNA construct semantic intron No. 1 FAD2-1A, sense 3'-UTR FAD3-1A soy, meaning the 3'-UTR FATB-1 soybean, spliceimage intron is No. 5 FAD3-1A soy antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soy, antisense intron No. 1 FAD2-1A soy and terminator 3'-terminal sequence TML).

Stage 14. pMON68536 split AscI and RsrII and pMON68529 (which contains breeding marker CP4, merged with the FMV promoter and 3'-end of the RBCS, and the promoter of the soybean FAD2 stimulating Delta-9-desaturase) split SanDI and AscI. Part crnci vector pMON68536 directionally clone in pMON68529, creating pMON68537 (promoter 7S, functionally associated with forming double-stranded RNA construct semantic intron No. 1 FAD2-1A, sense 3'-UTR FAD3-1A soy, meaning the 3'-UTR FATB-1 soybean, spliceimage intron No. 5 FAD3-1A soy, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soy, antisense intron No. 1 FAD2-1A soy and terminator 3'-terminal sequence of TML, the promoter of the soybean FAD2, stimulating Delta-9-desaturase).

Stage 15. MON68537 split SanDI and AscI and pMON70683 (napin stimulating Kas IV) split AscI and RsrII. Fragment napin/Kas IV directionally clone in pMON68537, creating pMON68539 (promoter 7S, functionally associated with forming double-stranded RNA construct semantic intron No. 1 FAD2-1A, sense 3'-UTR FAD3-1A soy, meaning the 3'-UTR FATB-1 soybean, spliceimage intron No. 5 FAD3-1A soy, antisense 3'-UTR FATB-1 soybean, antisense 3'-UTR FAD3-1A soy, antisense intron No. 1 FAD2-1A soy and terminator 3'-terminal sequence TML, FAD2 promoter is OI, stimulating Delta-9-desaturase, and the promoter napin stimulating Kas IV).

Example 9

This example illustrates the transformation of plants to produce soybean plants with suppressed genes.

Transforming the vector pMON68537 obtained in example 7, used for the introduction of soy forming double-stranded RNA constructs of the intron/3'-UTR to suppress genes Δ12 desaturase, Δ15 of desaturase and FATB. Vector pMON68537 also contains genes Delta-9-desaturase (FAB2) and CP4. The specified vector is stably introduced into soybean (Asgrow varieties A)using the abi strain of Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed crnci-expressing constructs with intron/3'-UTR. The composition of the oil in the seed pool R1and individual seed R1indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 7). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid; the suppression of the FAD3 allows to obtain plants with reduced with the holding of the compounds of ester linolenic acid; and suppression of FATB allows to obtain plants with reduced levels of compounds of ester saturated fatty acids, such as palmitate and stearates. The selection can be made from such lines, depending on the relative composition of fatty acids. The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed with constructs.

Example 10

This example illustrates the transformation of plants to produce soybean plants with suppressed genes.

Transforming the vector pMON68539 obtained in example 3, used for the introduction of soy forming double-stranded RNA constructs of the intron/3'-UTR to suppress genes Δ12 desaturase, Δ15 of desaturase and FATB. Vector pMON68539 also contains genes Kas IV and CP4. The specified vector is stably introduced into soybean (Asgrow varieties A)using the abi strain of Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed crnci-expressing constructs with intron/3'-UTR. The composition of the oil in the seed pool R1and individual seed R1indicate changes in the composition of mono - and polyunsaturated fatty acids in wt is e from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 8). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid; the suppression of the FAD3 allows to obtain plants with reduced levels of compounds of ester linolenic acid; and the suppression of FATB allows to obtain plants with reduced levels of compounds of ester saturated fatty acids, such as palmitate and stearates. The selection can be made from such lines, depending on the relative composition of fatty acids. The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed with constructs.

Table 7

The fatty acid composition in individual seeds R1, the resulting transformations pMON68537

Table 8

The fatty acid composition in individual seeds R1, the resulting transformations pMON68539

Example 11

Design pMON95829, similar to that described in example 3D, used for the introduction of soy forming double-stranded RNA constructs of the FAD2 intron-1 for suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow with the mouth A), using the strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate. Then the genomes of transformed plants are examined in relation to simultaneous sequential introduction of the first T-DNA and a second T-DNA, that is build right edge with the right edge”. Research methods perform mapping hybridization using southern blotting. Transgenic soybean plants with the preferred configuration in the genome is transferred into the greenhouse to obtain seeds.

For example, in plants R0transformed design pMON95829, take a fabric sheet and analyzed by the method of southern blotting. Probes and hydrolysates obtained using restriction enzymes are used to identify transformations with the Assembly of both T-DNA with the orientation of the right edge right edge (“RB-RB”). Usually about 25% of all transformants contain properly collected T-DNA with the orientation of the RB-RB.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON95829, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R 1from soybean plants transformed design pMON95829, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 9). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 9

The fatty acid composition in individual seeds R1, the resulting transformations pMON95829

Example 12

Design pMON93505, similar to that described in example 3D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate. ZAT is m genomes of transformed plants are examined in relation to simultaneous sequential insertion of the first T-DNA and a second T-DNA, that is build right edge with the right edge”. Research methods perform mapping hybridization using southern blotting. Transgenic soybean plants with the preferred configuration in the genome is transferred into the greenhouse to obtain seeds.

For example, in plants R0transformed design pMON93505, take a fabric sheet and analyzed by the method of southern blotting. Probes and hydrolysates obtained using restriction enzymes are used to identify transformations with the Assembly of both T-DNA with the orientation of the right edge right edge (“RB-RB”). Usually about 25% of all transformants contain properly collected T-DNA with the orientation of the RB-RB.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON93505, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON93505, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and Srednyaya for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 10). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 10

The fatty acid composition in individual seeds R1, the resulting transformations pMON93505

Example 13

Design pMON93506, similar to that described in example 3D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate. Then the genomes of transformed plants are examined in relation to simultaneous sequential insertion of the first T-DNA and a second T-DNA, that is build right edge with the right edge”. Research methods perform mapping hybridization using southern blotting. Transgenic soybean plants with the preferred configuration in the genome is transferred into t the blitz to get seeds.

For example, in plants R0transformed design pMON93506, take a fabric sheet and analyzed by the method of southern blotting. Probes and hydrolysates obtained using restriction enzymes are used to identify transformations with the Assembly of both T-DNA with the orientation of the right edge right edge (“RB-RB”). Usually about 25% of all transformants contain properly collected T-DNA with the orientation of the RB-RB.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON93506, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON93506, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see tables is 11). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 11

The fatty acid composition in individual seeds R1, the resulting transformations pMON93506

Example 14

Design pMON93501, similar to that described in example 3B, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON93501, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON93501, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants of Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 12). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 12

The fatty acid composition in individual seeds R1, the resulting transformations pMON93501

Example 15

Design pMON97552, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON97552, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON97552, and Radelet the fatty acid composition in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 13). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 13

The fatty acid composition in individual seeds R1, the resulting transformations pMON97552

Example 16

Design pMON93758, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON93758, in the accordance with the description shown in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON93758, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 14). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 14

The fatty acid composition in individual seeds R1, the resulting transformations pMON93758

Example 17

Design pMON97553, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, paten the U.S. No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON97553, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON97553, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 15). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 14

The fatty acid composition in individual seeds R1, the resulting transformations pMON97553

/p>

Example 18

Design pMON93770, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON93770, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON93770, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to oil from seeds netr sformirovannoi soybeans (see table 16). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 16

The fatty acid composition in individual seeds R1, the resulting transformations pMON93770

Example 19

Design pMON93759, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON93759, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON93759, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modifitsirovanniy the options. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 17). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 17

The fatty acid composition in individual seeds R1, the resulting transformations pMON93759

Example 20

Design pMON97554, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON97554, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seed R 1from soybean plants transformed design pMON97554, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 18). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 18

The fatty acid composition in individual seeds R1, the resulting transformations pMON97554

Example 21

Design pMON93771, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

p> The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON93771, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON93771, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 19). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 19

The fatty acid composition in individual seeds R1, the resulting transformations pMON93771

Example 22

Design pMON97555, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA design, the work of the intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON97555, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON97555, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 20). For example, the suppression of FAD2 allows to obtain plants with a high content of compounds of ester of oleic acid.

Table 20

The composition of the IRNA acids in individual seeds R1, the resulting transformations pMON97555

Example 23

Design pMON93760, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON93760, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON93760, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty to the slot in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 21). For example, FAD2 intron-1, reduced by 320 consecutive nucleotides from the 5'-end (SEQ ID NO:1) and able to form dsrnas at least partially suppress FAD2.

Table 21

The fatty acid composition in individual seeds R1, the resulting transformations pMON93760

Example 24

Design pMON93772, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON93772, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON93772, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as usual the composition, and modified versions. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 22). For example, FAD2 intron-1, reduced by 360 consecutive nucleotides from the 3'-end (SEQ ID NO:1) and able to form dsrnas at least partially suppress FAD2 some transformations.

Table 22

The fatty acid composition in individual seeds R1, the resulting transformations pMON93772

Example 25

Design pMON97556, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows the identification of transgenic soybean plants by selection on medium containing the herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON97556, in accordance with the description given in example 4, to identify compounds with which one of the methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON97556, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of mono - and polyunsaturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 23). For example, FAD2 intron-1, reduced to 200 consecutive nucleotides from the 3'-end (SEQ ID NO:1) and able to form dsrnas at least partially suppress FAD2.

Table 23

The fatty acid composition in individual seeds R1, the resulting transformations pMON97556

Example 26

Design pMON93764, similar to that described in example 2D, used for the introduction of soy forming double-stranded RNA constructs intron FAD2-1A aimed at suppression of the FAD2 gene. The specified vector is stably introduced into soybean (Asgrow varieties A), using strain ABI Agrobacterium tumefaciens (Martinell, U.S. patent No. 6384301). Breeding marker CP4 allows identifier is to transgenic soybean plants by selection on the environment, herbicide glyphosate.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed design pMON93764, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed design pMON93764, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of saturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean (see table 24). For example, FAD2 intron-1, reduced by 400 consecutive nucleotides from the 3'-end (SEQ ID NO:1) and able to form dsrnas, essentially does not reduce the expression of FAD2.

Table 24

The fatty acid composition in individual seeds R1, the resulting transformations pMON93764

Example 27

The TaqMan analysis is intended to quantify nuclei the OIC acid by selective amplification and fluorescence measurements in real time (also referred to as real-time PCR). The method used to determine the degree of suppression of transcription of the target in developing transgenic seeds. To determine the absolute levels of mRNA transcript of the target in the sample when performing each experiment TaqMan construct a standard curve. For this purpose different number of cloned sequences of the target genes of soybean and diluted to 20 ng total RNA was extracted from canola, amplified in parallel with samples of unknown quantities of the target. The precision of the number of copies of the transcript, as defined by this method, has a margin of error equal to 25%.

To obtain the matrix material total RNA extracted in an apparatus for producing a nucleic acid ABI 6100 and use 20 ng for each sample TaqMan. Samples analyzed at the device for detecting sequences ABI 700 with the chemicals that get masterbatches by one-step PCR with reverse transcriptase and the ABI prism. Then build a schedule of values counting (Ct) method TaqMan obtained by performing the reaction TaqMan PCR, depending on the amount of synthetic target sequence to calculate a linear regression to determine the number of target DNA FAD2-1 in an unknown sample based on the values counted by the TaqMan method, obtained at the end of each TaqMan PCR reactions.

Plants transformed intercept is ucciani pMON68540, pMON68546 or pMON80623, suppress FAD2-1A (see 3A and 7 to familiarize yourself with the descriptions of the structures).

Total RNA is obtained from a zero and transformed plants, using the device for obtaining a nucleic acid ABI 6100. Transgenic plants are homozygous plants in the third generation and contain oleic acid in the amount of more than 50%. The primers for the FAD2-1A primers for FAD2-1B or primers for FAD2-2A add in a separate TaqMan samples of total RNA from each of the test plants. Samples analyzed at the device for detecting sequences ABI 700 with the chemicals that get masterbatches by one-step PCR with reverse transcriptase and the ABI prism.

All transgenic plants significantly reduce the levels of transcripts of FAD2-1A and FAD2-1B. None of the transgenic plants even partially reduces the levels of FAD2-2A or FAD2-2B.

Comparison of the levels of transcripts of FAD2-1A in the zero plants allows to identify the natural differences between plants. mRNA FAD2-1A in developing seeds analyzed using primers for PCR, which form the sequence of the probe in many plants. Seeds with a mass of wet tissue 0.2 g obtained from four different zero-plants-segregants R2relating to different lines. The test subject pools seeds R2with the same size poluchennyh from four different null segregants. The PCR reactions performed three times and normalize the results, comparing with the amount of 18S RNA in each sample. Biological variability transcripts FAD2-1A from different plants is low. Three of the four samples are normalized count value (Ct) method TaqMan equal to about 65, and one of the samples has the normalized value calculation method TaqMan equal to about 50.

Example 28

A fragment of 200 consecutive nucleotides of the sequence of intron 1 FAD2-1 soybean (SEQ ID NO:1) was amplified by PCR, while receiving the PCR products containing the first 200 nucleotides of SEQ ID NO:1, starting from 5'-end of SEQ ID NO:1. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using sites restrictio created at the 5'-ends of primers for PCR. This vector is then cut with restriction enzymes and are ligated with a vector containing a gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination sequences of the pea Rubisco E9. Received expressing the gene construct used for transformation methods presented in this description.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed with the specified design, in accordance with the description given is example 4, for identification of compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed with the specified design, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of saturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean.

Example 29

A fragment of 180 consecutive nucleotide sequence of intron 1 FAD2-1 soybean (SEQ ID NO:1) was amplified by PCR, while receiving the PCR products containing the first 180 nucleotides of SEQ ID NO:1, starting from 3'-end of SEQ ID NO:1. The products of PCR clone in the sense orientation into the vector containing the promoter 7Sα' soybean and 3'end termination sequence tml using sites restrictio created at the 5'-ends of primers for PCR. This vector is then cut with restriction enzymes and are ligated with a vector containing a gene CP4 EPSPS protein regulated by the FMV promoter and the 3'end termination placenta is the sequence of the pea Rubisco E9. Received expressing the gene construct used for transformation methods presented in this description.

The compositions of the fatty acids analyzed by gas chromatography in seed of soybean lines transformed with the specified design, in accordance with the description given in example 4, to identify compounds methyl esters of fatty acids, extracted from the seeds. First to collect six seeds R1from soybean plants transformed with the specified design, and determine the composition of fatty acids in each individual seed. As plants R1resulting from each transformation, split on transgenes, they give seeds as with the conventional structure, and modified variants. Positive seeds are harvested and average for each transformation. The collected positive average seeds indicate changes in the composition of saturated fatty acids in the oil from the seeds of transgenic lines of soybean compared to the oil from the seeds of untransformed soybean.

Example 30

pMON97562 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), which is reduced by 100 consecutive nucleotides from the 3'-end and is linked to the 5'-UTR FAD3-1A, followed by the 3'-UTR FAD3-1A associated with the 5'-UTR FAD3-1B, followed by the 3'-UTR FAD3-1B, followed by '-UTR FATB-1a, followed by 3'-UTR FATB-1a, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally associated with the 3'-UTR FATB-1a in antisense orientation, followed by 5'-UTR FATB-1a in antisense orientation associated with the 3'-UTR FAD3-1B in antisense orientation, followed by 5'-UTR FAD3-1B in antisense orientation associated with the 3'-UTR FAD3-1A in antisense orientation, followed by 5'-UTR FAD3-1A in antisense orientation, followed by intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 100 consecutive nucleotides from the 3'-end and in antisense orientation, which is functionally linked to the 3'-end polyadenylation segment N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco e, with all sequences flanked the right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for transformation of soybean methods presented in the present description of the invention. The compositions of fatty acids determined by gas chromatography in seed of soybean lines transformed with the specified design, in accordance with the description given in example 4. Table 25 shows the composition of a typical seed. Level 18:3, is reduced by approximately 1%.

Table 25

The fatty acid composition in individual seeds R1, recip is the R in the transformation pMON97562

Example 31

pMON97563 contains a 7Sα promoter' soy, functionally associated with the intron 1 FAD2-1A soybean (SEQ ID NO:1), which is reduced by 100 consecutive nucleotides from the 3'-end and is linked to the 5'-UTR FAD3-1A, followed by the 3'-UTR FAD3-1A associated with the 5'-UTR FAD3-1B, followed by the 3'-UTR FAD3-1B associated with the 5'-UTR FAD3-1C, followed by 3'-UTR FAD3-1C, followed by the coding region P FATB-1a, followed by the coding region P FATB-2a, functionally associated with 70 nucleotides of intron 4 FAD3-1A, functionally linked to the coding region of the P FATB-2a in antisense orientation, followed by the coding region P FATB-1a in antisense orientation associated with the 3'-UTR FAD3-1C in antisense orientation, followed by 5'-UTR FAD3-1C in antisense orientation associated with the 3'-UTR FAD3-1B in antisense orientation, followed by 5'-UTR FAD3-1B in antisense orientation associated with the 3'-UTR FAD3-1A in antisense orientation, followed by 5'-UTR FAD3-1A in antisense orientation, followed by intron 1 FAD2-1A soybean (SEQ ID NO:1), reduced by 100 consecutive nucleotides from the 3'-end and in antisense orientation, which is functionally associated with a 3-terminal segment polyadenylation N6 gene CP4 EPSPS protein, functionally related EFMV promoter and the 3'end termination sequences of the pea Rubisco E9, n and all sequences flanked the right edge (RB) and left border (LB) in a single molecule of DNA. Received expressing the gene construct used for plant transformation methods presented in the present description of the invention. The compositions of fatty acids determined by gas chromatography in seed of soybean lines transformed with the specified design, in accordance with the description given in example 4. Table 26 shows the composition of a typical seed. Level 18:3, is reduced by approximately 1%.

Table 26

The fatty acid composition in individual seeds R1, the resulting transformations pMON97563

All the formulations presented in this description and the claims, may be obtained and/or methods of obtaining these compositions can be made without undue experimentation given the present description of the invention. Although the compositions of the present invention and methods for their preparation are described as preferred embodiments of the invention, the experts in this field should be obvious that the compositions and/or methods and in the steps or sequence of steps of methods according to the present invention can be modified, not beyond the scope and substance of the invention. In particular, it is obvious that instead of agents described in the present description of the invention, can be used as the coefficients, related in chemical and physiological relation, while achieving the same or similar results. All such substitutions and modifications are obvious to experts in this field, both within beings, scope and idea of the invention defined in the attached claims.

1. The seed of soybean, characterized by the composition of fatty acids in seed oil, inwhich the oleic acid content is from about 42 to about 85 wt.% of the total content of fatty acids and saturated fatty acids is less than 8 wt.% of the total fatty acids, where this plant further comprises a genome, including:
(i) a first nucleic acid sequence at least 90% identical to a fragment of intron FAD2-1A soy length between 20 and 420 consecutive nucleotides, and
(ii) a second nucleic acid sequence at least 90% identical to a fragment of the gene FADB soy length of between 40 and 450 consecutive nucleotides.

2. A soybean seed according to claim 1, where the specified genome further includes a nucleic acid sequence that increases expression of beta-ketoacyl-ACP synthase IV or Delta-9-desaturase or both together.

3. The soybean seed of claim 1, wherein the specified portion of the specified FAD2 intron-1 of soybean and the specified portion of the specified gene of soybean FATB transcribed in sense and antisense orientation with the formation of RNA, which at least partly is double-stranded.

4. The soybean seed of claim 1, wherein the specified sequence of nucleic acid that inhibits expression of the endogenous gene FAD2-1 and FATB gene of soybean, is collected in the form of a functional transcription unit after insertion into the chromosome of a plant.

5. A soybean seed according to claim 4, wherein said fragment specified FAD2 intron-1 of soybean and the specified portion of the specified gene of soybean FATB transcribed in sense and antisense orientation with the formation of RNA, which at least casticin who is double-stranded.

6. A soybean seed according to claim 1, where the first nucleic acid sequence at least 90% identical to a fragment of intron FAD2-1A soy length between 20 and 420 consecutive nucleotides, inhibits expression of the endogenous FAD2-1 soybean and the specified genome further comprises a nucleic acid sequence that increases expression of beta-ketoacyl-ACP synthase IV or Delta-9-desaturase or both together.

7. Cell seed soybean, characterized by the composition of fatty acids in the oil from the seeds, in which the oleic acid content is from about 42 to about 85 wt.% of the total content of fatty acids and saturated fatty acids is less than 8 wt.% of the total content of fatty acids, where the specified seed contains:
(i) a nucleic acid sequence at least 95% identical to a fragment of intron FAD2-1A soy length between 20 and 420 consecutive nucleotides, and
(ii) a nucleic acid sequence at least 95% identical to a fragment of the gene FADB soy length of between 40 and 450 consecutive nucleotides.

8. Unmixed soybean oil obtained from the seed, characterized by the composition of fatty acids in which the oleic acid content is from about 42 to about 85 wt.% of the total content of fatty acids and saturated fatty acids is about 8 wt.% or is else of the total fatty acids, where the specified seed further comprises a genome, including:
(i) a nucleic acid sequence at least 90% identical to a fragment of intron FAD2-1A soy length between 20 and 420 consecutive nucleotides, and
(ii) a nucleic acid sequence at least 90% identical to a fragment of the gene FADB soy length of between 40 and 450 consecutive nucleotides.

9. Soy flour obtained from the seed of soybean, characterized by the composition of fatty acids in the oil from the seeds, in which the oleic acid content is from about 42 to about 85 wt.% of the total content of fatty acids and saturated fatty acids is less than 8 wt.% of the total content of fatty acids, where the specified seed further comprises a genome, including:
(i) a nucleic acid sequence at least 95% identical to a fragment of intron FAD2-1A soy length between 20 and 420 consecutive nucleotides, and
(ii) a nucleic acid sequence at least 95% identical to a fragment of the gene FADB soy length of between 40 and 450 consecutive nucleotides.

10. Unmixed soybean oil, characterized by the composition of fatty acids in which the oleic acid content is from about 42 to about 85 wt.% of the total content of fatty acids, saturated fatty acids is about 8 wt.% or m is niche of the total content of fatty acids and the content of linolenic acid is about 1.5 wt.% or less of the total content of fatty acids.

11. A soybean seed according to claim 1, where the oleic acid content is from about 50 to about 80 wt.% of the total content of fatty acids.

12. A soybean seed according to claim 1, where the oleic acid content is from about 46 to about 75 wt.% of the total content of fatty acids.

13. The soybean seed of claim 2, where the oleic acid content is from about 50 to about 80 wt.% of the total content of fatty acids.

14. The soybean seed of claim 2, where the oleic acid content is from about 46 to about 75 wt.% of the total content of fatty acids.

15. The soybean seed of claim 6, where the oleic acid content is from about 50 to about 80 wt.% of the total content of fatty acids.

16. The soybean seed of claim 6, where the oleic acid content is from about 46 to about 75 wt.% of the total content of fatty acids.

17. A soybean seed according to claim 1, where the specified first nucleic acid sequence at least 95% identical to a fragment of intron FAD2-1A soybean ranges from approximately 100 to approximately 320 nucleotides in length, and specified combination of two sequences of nucleic acid contains a fragment of FATB-1 5' UTR.

18. A soybean seed according to claim 1, where the specified first nucleic acid sequence at least 95% identical to a fragment of intron FAD2-1A soybean selected from the group consisting of: from about 30 to about 420, adapted from the sustained fashion 40 to about 320, from about 50 to about 200, from about 50 to about 400, from about 50 to about 420, from about 60 to about 320, from about 70 to about 220, from about 100 to about 200, from about 150 to about 200, from about 150 to about 220, from about 150 to about 400, from about 200 to about 300 or from about 300 to about 400 nucleotides in length.

19. The soybean seed of claim 2, where the specified first nucleic acid sequence at least 95% identical to a fragment of intron FAD2-1A soybean ranges from approximately 100 to approximately 320 nucleotides in length.

20. The soybean seed of claim 2, where the specified first nucleic acid sequence at least 95% identical to a fragment of intron FAD2-1A soybean selected from the group consisting of: from about 30 to about 420, from about 40 to about 320, from about 50 to about 200, from about 50 to about 400, from about 50 to about 420, from about 60 to about 320, from about 70 to about 220, from about 100 to about 200, from about 150 to about 200, from about 150 to about 220, from about 50 to about 400, from about 200 to about 300 or from about 300 to about 400 nucleotides in length.

21. The soybean seed of claim 6, where this first nucleic acid sequence at least 95% identical to a fragment of intron FAD2-1A soybean ranges from approximately 100 to approximately 320 nucleotides in length.

22. The soybean seed of claim 6, where this first nucleic acid sequence at least 95% identical to a fragment of intron FAD2-1A soybean selected from the group consisting of: from about 30 to about 420, from about 40 to about 320, from about 50 to about 200, from about 50 to about 400, from about 50 to about 420, from about 60 to about 320, from about 70 to about 220, from about 100 to about 200, from about 150 to about 200, from about 150 to about 220, from about 150 to about 400, from about 200 to about 300 or from about 300 to about 400 nucleotides in length.

23. A soybean seed according to claim 1, where the specified first sequence of nucleic acid contains a fragment that is 100% identical to a fragment of intron FAD2-1A soy length between 20 and 420 consecutive nucleotides, and the specified combination of two sequences of n is 100% identical FATB-1 of soybean and is from about 40 to about 450 nucleotides in length, and the specified genome further comprises a nucleic acid sequence that increases expression of beta-ketoacyl-ACP synthase IV or Delta-9-desaturase, or both together.

24. The soybean seed of claim 2, where this first sequence of nucleic acid contains a fragment that is 100% identical to a fragment of intron FAD2-1A soy length of between about 20 and about 420 nucleotides and sequence FATB-1 soybean in length from about 40 to about 450 nucleotides in length, where the specified sequence FATB-1 contains the UTR fragment.

25. The soybean seed of claim 6, where said nucleic acid sequence that reduces expression of the endogenous FAD2-1 soybean, contains a fragment is 100% identical to a fragment of intron FAD2-1A soy length of between about 20 and about 420 nucleotides.

26. A soybean seed according to claim 1, where the first nucleic acid sequence at least 95% identical to a fragment of intron FAD2-1A soy, and a second nucleic acid sequence at least 95% identical to a fragment of the FADB gene of soybean.

27. A soybean seed according to claim 1, where the specified fragment of the gene of soybean FATB represents the coding sequence of the transit peptide of soybean FATB and approximately 45 consecutive nucleotides specified FATB-1 5' UTR of soy.

28. A soybean seed according to claim 1, where the specified fragment of the gene of soybean FATB is the way the th coding sequence of the transit peptide of soybean FATB and approximately 42 consecutive nucleotides specified FATB-1 5' UTR of soy.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: agrobacterium-mediated transformation with application of meristematic cells of primary or higher leaf nodes as target tissue and further regeneration of whole plant from transformed cells provides for improved incorporation of DNA into genome of soya plant (Glycine max).

EFFECT: improved transformation of soya.

13 cl, 40 dwg, 11 tbl, 14 ex

FIELD: agriculture.

SUBSTANCE: method is described for improvement of crop capacity in plant parts that provide for crops versus according plants of wild type, including introduction of nucleic acid into plant, which codes cyclin-dependent kinase of D-type (CDKD), containing NXTALRE link, where X stands for any amino acid. Method is disclosed for production of transgenic plant with higher crop capacity, including introduction of CDKD coding nucleic acid into plant or vegetable cell, which contains NXTALRE link, where X stands for any amino acid, and cultivation of vegetable cells in conditions that promote regeneration and growth of mature plant.

EFFECT: invention makes it possible to improve crop capacity of plants.

14 cl, 3 dwg, 5 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: there is described a promoter region to control specific detection of transgenes in the plant epidermis. There is disclosed a recombinant molecule of nucleic acid which contains the described promoters is opened. There are presented transgene plants and plant cells that have been transformed by means of the disclosed molecule of nucleic acid. There is offered the method for producing the presented plants and cells.

EFFECT: invention allows producing pathogen resistant plants.

10 cl, 20 dwg, 8 ex

FIELD: biotechnologies.

SUBSTANCE: plants are transformed with application of nucleic-acid constructs, which contain the first nucleotide sequence that codes γ-sein, or its fragment, which is able to direct and retain protein in endoplasmic reticulum of plant cell, the second sequence of nucleic acid, which codes aminoacid sequence, which is specifically split by ferment or chemical compounds, and the third sequence of nucleic acid, which codes target peptide or protein.

EFFECT: transformation of plant by such constructs makes it possible to produce fused proteins accumulated in endoplasmic reticulum of cells in the form of protein bodies, from which target proteins may be extracted, in particular calcitonin.

47 cl, 19 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: plant is transformed with a genetic make-up that incorporates DNA sequence coding a receptor for systemic signal compound chosen from the group consisting of salicylic acid, jasmine acid and brassinosteroids. Preferentially, the receptor represents a RKS-receptor. The combinations of receptors and/or chimeric receptors also can be used.

EFFECT: improved resistance to pathogenic germs.

13 cl, 26 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: membrane pyrophosphatase gene of bacterium Rhodospirillum rubrum is introduced in a plant genome that enables synthesis of the related protein in plant cells. Particularly, there are designed transgene tobacco plants expressing a membrane H+ -pyrophosphatase gene from bacterium Rhodospirillum rubrum. As a result of transformation, when grown in vivo, the transgene plants exceed the reference length of root system and the reference weight of leaves. The average number of seed capsule of the transgene plants is more than in the reference, while the average amount and weight of seed material of the transgene plants is more as well. The chlorophyll content in leaves of the transgene plants exceeds that of the reference plants. The transgene plants considerably overtake the reference plants in growth.

EFFECT: plants with improved economic-valued indicators, such as accelerated growth, higher length and weight of the roots, increased weight of the leaves, improved biological efficiency and plant resistance to salinisation.

7 cl, 13 dwg, 6 tbl, 9 ex

FIELD: agriculture.

SUBSTANCE: in plant nucleic acid is introduced, which codes protein of cyclin A2, engaged to promoter, specific to seed genes. Produced plants have increase crop capacity both compared to according wild types of plants and relative to transgenic plants, which constitutively express cyclin A.

EFFECT: increased crop capacity of plant in optimal and suboptimal conditions.

19 cl, 4 dwg, 16 tbl, 4 ex

FIELD: agriculture.

SUBSTANCE: genetic modification of wheat in the form of mutation in gene SBEIIa with reduction of level of its activity.

EFFECT: grain with high content of amylose in its starch; wheat with reduced level of SBEIIb-activity with grain with non-wrinkled phenotype, with relatively high content of amylose.

62 cl, 28 dwg, 12 tbl, 16 ex

FIELD: genetic engineering.

SUBSTANCE: in a genetically transformed plant, activity of protein Rpi-blb2 is increased.

EFFECT: resistance of the plant to Oomycetes pathogens.

13 cl, 31 dwg, 8 tbl, 17 ex

FIELD: agriculture.

SUBSTANCE: stress-tolerant wheat plant is described, where specified wheat plant is transformed with molecule of nucleic acid, which codes ornithineaminotransferase (OAT). Method is disclosed for protection of wheat plant against stress, which includes stage of nucleic acid molecule introduction into wheat plant, where molecule of nucleic acid codes ornithineaminotransferase (OAT). Structure of nucleic acid is presented, including activating agent extracted from plant and gene of ornithineaminotransferase (OAT), where specified structure is able to transform wheat plant so that specified plant of wheat becomes tolerant to stress. Method is disclosed for production of transgenic wheat plant with induced or increased tolerance to salt, including transformation of vegetable tissue or cell of wheat plant with molecule of nucleic acid, which codes ornithineaminotransferase (OAT), regeneration of tissue or cell into whole plant, and expression of OAT in regenerated plant for time and under conditions sufficient for induction or increase of plant tolerance to concentration of salt of more than 100 mM.

EFFECT: invention makes it possible to obtain stress-resistant plant.

13 cl, 5 dwg, 1 tbl, 7 ex

FIELD: agriculture.

SUBSTANCE: sunflower seeds have been genetically modified with the help of two cycles of artificial induction of mutations, in each case with further identification of mutant species, which bore required criterion. Modified seeds are characterised by the fact that 26-80% of tocopherols are present in them in the form of delta-tocopherols. This level of delta-tocopherols is determined by genotype of seeds modified by this criterion and is independent on conditions of cultivation. From seeds they grow genetically modified plants of sunflower, which produce seeds with high levels of delta-tocopherol as a result of self-fertilisation.

EFFECT: oil is extracted from seeds with high concentration of delta-tocopherol.

8 cl, 1 tbl

FIELD: agriculture.

SUBSTANCE: genetic modification of wheat in the form of mutation in gene SBEIIa with reduction of level of its activity.

EFFECT: grain with high content of amylose in its starch; wheat with reduced level of SBEIIb-activity with grain with non-wrinkled phenotype, with relatively high content of amylose.

62 cl, 28 dwg, 12 tbl, 16 ex

FIELD: agriculture.

SUBSTANCE: into plant or its part it is introduced nucleic acid, which encodes product, capable to support plant of family Solanaceae and its posterity by stability against injury by oomycetes fungus Phytophthora infestans.

EFFECT: ability to potato and tomato kinds steady against buck eye rot.

28 cl, 26 dwg, 4 tbl, 7 ex

FIELD: agriculture; biotechnology.

SUBSTANCE: to identify MON863 maize transformants, diagnosis is carried out of the presence of DNA-sequence, built in the gene of the maize, through transformation of the recombinant structure, containing the Cry3Bb gene and genome sequences, flanking the insertion site.

EFFECT: maize plants, regenerated from MON863 transformants, are resistant to beetle insects.

20 cl, 2 dwg, 2 ex

FIELD: agriculture.

SUBSTANCE: plant seeds are treated with ethylmethanesulphonate during 16 hours, then dried or greensprouted. The resulting plants M1 are self-pollinated and their seeds are obtained, which are used for growing the M2 wheat plants. The M2 plants are treated with imazamox, and plants with higher resistance to that as compared to the wild type plants are selected. The other version implies the transformation of plants with an expression vector containing one or more nucleic acids IMI.

EFFECT: higher resistance of plants to imidazolinone and possibility to use them when controlling weeds using herbicide.

44 cl, 8 dwg, 4 ex

FIELD: agriculture.

SUBSTANCE: plant seeds are treated with ethylmethanesulphonate during 6 hours, then dried or greensprouted. The resulting plants M1 are self-pollinated and their seeds are obtained, which are used for growing the M2 wheat plants. The M2 plants are treated with imazamox, and plants with higher resistance to that as compared to the wild type plants are selected. The other version implies the transformation of plants with an expression vector containing one or more nucleic acids IMI. The said nucleic acids are preferably located in different genomes or obtained from different genomes.

EFFECT: resulting plants have higher resistance to imidazolinone and may be used when controlling weeds using herbicide.

47 cl, 13 dwg, 5 ex

FIELD: molecular biology, genetic engineering, biochemistry.

SUBSTANCE: invention relates to polynucleotides optimized for expression in plants and encoding processing enzymes. Polynucleotides encode mesophilic, thermophilic or hyperthermophilic enzymes that are activated under conditions suitable for interaction with a necessary substrate. Incorporation of these polynucleotides into the plant genome results to preparing "self-processing" transgenic plants wherein their parts, for example, grain, fruit or seed express one or more indicated enzymes and have the varied composition. Autoprocessing plants can be used, for example, for preparing foodstuffs eliciting improved taste.

EFFECT: improved and valuable biological properties of plants.

29 cl, 23 dwg, 6 tbl, 41 ex

FIELD: agriculture.

SUBSTANCE: barley plant including mutation in gene SBE11a, or transgene which codes activity inhibitor of SBE11a, has low level of activity of enzyme SBE11a. Starch produced from grain of such plant may have amylase content of at least 40% (weight/weight). Also, barley of such kind may have lowered levels of activity of SBE11b. Barley grain may have non-rugose phenotype despite damaged amylopectin synthesis path.

EFFECT: lower levels of activity of branching enzyme and increased amylase content of starch-containing products.

46 cl, 19 dwg, 7 tbl, 11 ex

FIELD: plant gene engineering and food processing industry.

SUBSTANCE: glutamate-glyoxilate-aminotransferase activity is inhibited in plant by disruption of gene functionality encoding thereof. Due to inhibition of said enzyme activity glutamate levels in modified plant is higher in contrast to corresponding wild-type plants cultivated under the same conditions, including seeds thereof. Seeds and other plant parts are useful in foodstuff productions.

EFFECT: new method for elevation of glutamate content in plants.

31 cl, 12 dwg, 3 tbl, 2 ex

FIELD: biotechnology, food processing industry.

SUBSTANCE: barley plants are mutated in SSII gene to reduce SSII activity. Such barley corn has starch structure with. Moreover said corn optionally has relatively high β-glucan content. Starch is characterized with decreased gelatinization viscosity, low crystallinity, and high levels of lipid-bonded starch of V-form crystallinity.

EFFECT: barley plants having reduced amylopectin content and relatively high amylose content.

33 cl, 39 dwg, 10 tbl, 2 ex

FIELD: biotechnology, in particular production of genetically modified plants with altered level of one metabolite secondary product.

SUBSTANCE: claimed method includes selection of nuclear acid sequence encoding enzyme, which is absent in secondary metabolite process, but is capable to modify utilization of intermediate substrate in secondary metabolite process connected with plant nutrient profile. Then recombinant molecule is constructed, which contains abovementioned sequence, to transform plant cell. From this cell genetically modified plant is regenerated. Obtained plant is useful in animal feed preparation.

EFFECT: plants with high nutrient value and improved quality.

35 cl, 33 dwg, 22 ex

Up!