Differential diagnostcs of purulent cholangitis method

FIELD: medicine.

SUBSTANCE: invention belongs to medicine, notably to laboratory method of diagnostics. Principle of the method is isolation and identification of pathogenic and opportunistic microorganisms from biopsic material of common bile duct and assessment of antilysozim activity of isolated microorganisms. Antilysozim activity index 5.5±0.5 mcg/ml confirms acute purulent cholangitis diagnosis, 3.7±0.6 mcg/ml characterises acute recurrent purulent cholangitis, while index 1.1±0.4 mcg/ml supposes chronic purulent cholangitis.

EFFECT: method allows differential diagnostics of purulent cholangitis.

2 ex, 2 tbl

 

The invention relates to medicine, namely to laboratory diagnosis, and can be used to identify different forms of suppurative cholangitis.

Cholangitis is one of the most dangerous complications of diseases of the biliary system. The reason for its occurrence is the violation of the passage of bile in the result of choledocholithiasis, the structure of the bile ducts, stenosis of major duodenal papilla, patterns Galeotti anastomoses, tumors of the bile duct and the pancreatic head, cystic formations in the bile ducts. Prolonged stagnation of bile in the mechanical obstacles to its outflow leads not only to jaundice and hypertension in them, hyperextension bile ducts and capillaries, activate and spread of infection, the formation of microabscesses in the liver and sepsis. In bile capillaries are formed separate clusters of pus that are inadequately or not at all drained in the bile ducts and occurs dissecting suppurative cholangitis (Eigenperiod, Navakavu "Diseases of the biliary tract after cholecystectomy" - M.: Medicine. - 1988. - S-246).

Classification Halperin AI there are three forms of purulent cholangitis depending on the features of its clinical course: acute suppurative cholangitis; recurrent acute suppurative cholangitis, chronic suppurative cholangitis.

Od is ako currently the individual characteristics of each person impose significant differences in disease pathogenesis, its magnitude and timing. Standard methods of diagnosis and treatment used in hospitals and clinics, do not take into account the individual characteristics of the overall resistance of the person. Accordingly, the disease can be delayed individually, be complicated by suppuration, move in chronic or end lethal, despite the high efficiency of modern medical technologies. Therefore, differential diagnosis of various forms of purulent-inflammatory diseases (in particular, cholangitis) may significantly influence the tactics and methods of treatment, which ultimately leads to the reduction of treatment time.

The invention is directed to solving the problem of increasing the specificity of diagnosis - differential identification of the various forms of suppurative cholangitis.

A known method for the diagnosis of cholangitis caused reasobable microorganisms (EN 2125729, 27.01.1999). However, this method has some significant drawbacks, as applicable for the detection of cholangitis caused by bacteria that produce urease. At the same time, the most common cause of cholangitis is E.coli (Brook I. Microbiology and management of abdominal infections // Dig. Dis. Sci. - 2008.- 53(10). - P.2585-2591; M.C. Wang, C.C. Tseng, C.Y. Chen, J.J. Wu, Huang J.J. The role of bacterial virulence and host factors in patients with Escherichia coli bacteremia who have acute cholangitis or upper urinary tract infection // Clin. Infect. Dis. -2002. - Vol.35(10). - P.1161-1166; Mandryka Y., J. Klimczak, Duszewski M., Kondras M., Modzelewski B. Bile duct infections as a late complication after endoscopic sphincterotomy // Pol. Merkur. Lekarski. - 2006. - Vol.21(126). - P.525-527). Because E. coli is a bacterium that does not produce urease (Mikro-La-Test. Instructions for use of ENTEROtest 24. cat. Number: 10003391. Available at http://www.lachema.ru/MIKRO-LA-TEST.htm), the use of this method is severely limited.

Closest to the claimed method is a method based on bacteriological examination of bile (order of the Ministry of health of the USSR No. 535 of April 22, 1985, "On the unification of microbiologic methods used in clinical diagnostic laboratories medical institutions").

However, this diagnostic method is not accurate because when classical bacteriological examination is difficult to differentiate the cause of cholangitis from contaminants, in addition, this method does not allow for differential diagnosis of various forms of suppurative cholangitis.

The inventive method solves the problem of increasing accuracy in the differential diagnosis of suppurative cholangitis.

To solve this problem in the present method the differential diagnosis of suppurative cholangitis taking the investigated material, emit pure cultures of pathogenic and/or conditionally-p is togeny microorganisms, determine the antilysocyme activity of selected microorganisms and the rate of 5.5±0.5 μg/ml, diagnosed with acute suppurative cholangitis, when the score of 3.7±0.6 ág/ml, diagnose recurrent acute suppurative cholangitis, when the score was 1.1±0.4 µ g/ml, diagnosed chronic suppurative cholangitis.

New in the claimed method of differential diagnosis of suppurative cholangitis is that as the study material used sampling choledochus wall, determine the antilysocyme activity of selected microorganisms and the rate of 5.5±0.5 μg/ml, diagnosed with acute suppurative cholangitis, when the score of 3.7±0.6 ág/ml, diagnose recurrent acute suppurative cholangitis, when the score was 1.1±0.4 µ g/ml, diagnosed chronic suppurative cholangitis.

Achieved in the implementation of the technical result consists in the fact that the new method of differential diagnosis of suppurative cholangitis can improve diagnostic accuracy and to improve the efficiency of selection of optimal treatment regimens.

The authors experimentally found that of the various tissues of the hepatobiliary system for the differential diagnosis of suppurative cholangitis is the most informative in the investigated material is a sampling of the choledochus wall.

Table 1
The allocation rate of microorganisms in patients with various forms of purulent cholangitis
The study materialThe frequency of selection of microorganisms, % (M±m)
Acute suppurative cholangitisAcute recurrent pyogenic cholangitisChronic suppurative cholangitis
Bile73,6±11,490,9±9,153,3±13,3
The liver tissue (sampling)10,0±10,042,9±20,245,5±15,7
Fabric choledochus (sampling)40,0±16,385,7±14,363,6±15,2
Fabric pericholedochal lymph nodes (sampling)30,0±15,357,1±20,245,5±15,7

Was conducted the following study. During surgery in patients using sterile disposable syringes were made fence ductal bile to further ektornet sowing on a nutrient medium (medium Endo, 5% blood agar, the agar of Schedler with the addition of 10% sheep blood and incubated in anaerobic and microaerophilic conditions 48-72 hours at 37°C. in Addition, during the operation was carried out by the fence fabric choledochus, liver tissue and tissue pericholedochal lymph nodes. The biopsy tissue was placed in a sterile vial with medium 199, used as a transport medium, followed by homogenization and sowing on a selective nutrient medium for 1 hour. Crops were incubated in anaerobic and microaerophilic conditions 48-72 hours at 37°C. the Results are presented in table 1. As can be seen from table 1, the most common microorganisms are allocated from the bile and the choledochus wall, with no significant differences in the frequency of the separation of microorganisms from the bile and the choledochus wall with recurrent acute suppurative cholangitis and chronic suppurative cholangitis, which complicates the differential diagnosis between these forms of suppurative cholangitis.

In this regard, the authors suggested the possibility of differentiation of various forms of cholangitis based on the definition of the biological properties of microorganisms responsible for the development and chronic infectious-inflammatory process and aimed at inactivation of factors of innate immunity (Bukharin O.V. Persistence of pathogenic bacteria.- M.: Medicine, 1999. - P.100-109), in particular antilysozyme activity.

Know the definition of the antilysocyme activity of microorganisms to determine the flow of pyodermia (EN 2258220, 10.08.2005), predict the occurrence of postoperative complications of cholecystitis (Shvetsov S.A. Clinical significance of persistent characteristics of aerobic conditionally pathogenic microflora in patients with cholecystitis: author. Diss. Kida. the honey. Sciences. Perm, 1994), the development of chronic infectious and inflammatory diseases of different localization (Bukharin O.V. Persistence of pathogenic bacteria.- M: Medicine. - 1999. - S-248).

The authors experimentally determined differences in the antilysocyme activity of strains of Enterobacteriaceae isolated from ductal bile and tissues of the choledochus wall during the operation, the various forms of suppurative cholangitis. The antilysocyme activity was determined in a known manner (Bukharin O.V. Persistence of pathogenic bacteria. - M.: Medicine. - 1999. - P.88).

As can be seen from table 2, strains of Enterobacteriaceae isolated from ductal bile from patients with different forms of cholangitis did not significantly differ on the level of the antilysocyme activity between groups. While the strains isolated from the tissue of the wall of the choledochus in different groups, the level of the antilysocyme activity significantly differed. On what basis can you conclude about the potential applications antilysozyme test for dif is erentially diagnosis of various forms of suppurative cholangitis.

Table 2
Antilysocyme activity of strains of Enterobacteriaceae isolated from ductal bile and tissue wall of the choledochus patients with different forms of suppurative cholangitis
The group of patientsAntilysocyme activity, ug/ml (M±m)
Strains of ductal bile (n=102)The strains of the tissue wall of the choledochus (n=60)
Acute suppurative cholangitis4,2±0,65,5±0,5***
Acute recurrent pyogenic cholangitis5,0±0,83,7±0,6*
Chronic suppurative cholangitis3,5±0,51,1±0,4**
* - p<0.05 compared with chronic suppurative cholangitis
** p<0.05 compared with recurrent acute suppurative cholangitis

The method is as follows.

During surgery in patients with sterile exercise fence fabric choledochus, the analyzed material inoculated on selective nutrient from the food, incubated, isolate and identify pathogenic and/or opportunistic pathogens. Determine the antilysocyme activity of selected microorganisms and the rate of 5.5±0.5 μg/ml, diagnosed with acute suppurative cholangitis, when the score of 3.7±0.6 ág/ml, diagnose recurrent acute suppurative cholangitis, when the score was 1.1±0.4 µ g/ml, diagnosed chronic suppurative cholangitis.

Examples of specific implementation method.

Example 1.

Patient K., aged 52. Was admitted with complaints of colicky pain in the right hypochondrium with irradiation under the right shoulder, nausea. The body temperature of 38.2°C. the Diagnosis of cholecystitis. When the operation is performed transduodenal papillosphincterotomy, drainage choledochus by Halstead - Pikovsky, drainage of the abdominal cavity. During the operation was taken sampling choledochus, gomogenizirovannom, planted on a selective nutrient medium (medium Endo, 5% blood agar, the agar of Schedler with the addition of 10% sheep blood), after 72 hours of incubation in anaerobic and microaerophilic conditions 48-72 hours at 37°C was selected monoculture of microorganisms, which in the aggregate tinctorially and biochemical properties was identified as E. coli (SW - 105CFU/ml). The cultures of E. coli was determined antilysocyme activity, the level of which was 6 µg/ml on the basis of which the patient was additionally diagnosed with acute suppurative cholangitis. Conducting causal and symptomatic therapy helped to arrest the symptoms of the disease. The patient was discharged in satisfactory condition.

Example 2.

Patient M., aged 57. Diagnosis: cholelithiasis. Chronic calculous cholecystitis, acute stage. Choledocholithiasis. In the course of the operation performed cholecystectomy, choledocholithotomy, transduodenal papillosphincterotomy, drainage choledochus by Halstead - Pikovsky. During the revision of the common bile duct up to 15 mm in diameter, terminal division is palpated few concretions. When supraduodenal choledochotomy removed 3 of stone up to 15 mm in diameter. By the above method was made by biopsy of the choledochus and researched material selected culture of Proteus mirabilis (SW - 104CFU/ml). This culture was determined antilysocyme activity, the level of which was 1 µg/ml, based on which the patient was delivered additional diagnosis of chronic suppurative cholangitis. Conducting causal and symptomatic therapy helped to arrest the symptoms of the disease. The patient was discharged in good condition.

Thus, the inventive method allows to differentiate various forms of suppurative cholangitis and conduct effective individual therapy.

The method of differential diagnosis of pus is on cholangitis, including the intake of the studied material, planting it on a selective nutrient medium, incubation, separation and identification of selected pathogenic and/or opportunistic microorganisms, characterized in that as the study material take a sampling of the choledochus wall, selected pathogenic and/or opportunistic microorganisms determine the antilysocyme activity and when the indicator is equal to 5.5±0.5 μg/ml, diagnosed with acute suppurative cholangitis, when the score of 3.7±0.6 ág/ml, diagnose recurrent acute suppurative cholangitis, when the score was 1.1±0.4 µ g/ml, diagnosed chronic suppurative cholangitis.



 

Same patents:

FIELD: medicine.

SUBSTANCE: method of determining sensitivity of horses to antigens of microorganisms of various taxonomic keys, which includes carrying out reaction of leukocytolysis with blood leucocytes using antigen, calculation of leukocytes in Goryaev's chamber before and after incubation and further determination of organism sensitivity by leukocytolysis index, different in the fact that in setting of reaction, first, solution of acidin-pepsin is introduced into samples, calculation of leukocytes before incubation is carried out only in control sample, and leukocytolysis index (LCI) is determined after incubation of experimental and control samples with further deduction of percent of spontaneous leukocytolysis (SLC) in control sample and is final value of LCI (3) is to 20%, organism sensitivity is considered to be low, 20-40% - medium, 40% and higher -high.

EFFECT: increase of determination accuracy.

5 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention aims at treatment, diagnostics or prevention of parasitic disease. There is used combination histone proteins H2A, H2B, H3 and H4 recovered from Leishmania infantum for making a pharmaceutical composition and a diagnostic aid. It involves applying a vector containing nucleotides coding specified histones.

EFFECT: invention allows treating and preventing the parasitic disease caused by one type with using histones originated from the other type.

13 cl, 4 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: to detect or chrysanthemum virus B in plants, a diagnostic set containing polyclonal antibodies to protein of Chrysanthemum virus B shell, a conjugate marked with alkaline phosphatase, a fixing buffer; an extraction buffer, ECI-buffer and PNP-buffer is used. Protein of viral shell is produced by amplification of the purified gene of said protein with using a nonsynonymous primer ATGCCTCCCAAACCGGCACCAGGTGAT and synonymous primer TTTATAATGTCTTATTATTCGCAT.

EFFECT: improved antiviral action of the compound.

15 cl, 2 ex

FIELD: medicine.

SUBSTANCE: there is used for diagnostics of transient and persistent latent papilloma virus infection. The diagnostic technique for papilloma virus infection is ensured by history taking and integrated clinical-laboratory examination. As anamnestic signs, there are assumed compromised oncologic characteristics inheritance, early sexual life, age younger than 20 years old and promiscuity; as clinical - anogenital warts, erosion and ectopic neck of uterus, contact hemorrhagic diathesis, Ovuli nabotti, inflammatory diseases of small pelvis organs and intrauterine spiral. Herewith the laboratory signs are sexually transmitted diseases, mixtinfection, deficient lactic acid bacilli, vaginal disbiosis caused by conditional-pathogenic flora, bacterial vaginosis, virus-virus associations, urogenital herpes, urogenital mycoplasma infection, urogenital ureaplasma infection, urogenital candidiasis, urogenital Chlamidia infection and infection with various genotypes of human papilloma virus. Each sign is scored, and depending the number of points, persistent or transient clinical course of papilloma virus infections, or follow-up examination is performed.

EFFECT: determining tactics of the following management of the patient, forming group of potential risk for development of focal dysontogenetic and malignant transformations of urogenital epithelium.

1 dwg, 2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, particularly to laboratory examinations and can be used in selection of therapeutic approach to tonsillitis. The method involves microbiological study of tonsil lacunae contents. It involves detection of microorganism types and concentration. And if the association shows one or more microorganisms which are not normal tonsil lacuna inhabitants in concentration ≥105 CFU/ml, photodynamic therapy is predicted to be inefficient. The fact that test object is microflora enables to determine an etiological agent, as well as degree of activity of inflammatory process whereat photodynamic therapy aims.

EFFECT: method allows determining objective indications for photodynamic therapy in chronic tonsillitis that ensures more effective treatment of the patients.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine and can be used for express-estimation of severity of state of patient with burn disease. Laboratory analysis is carried out, degree of natural colonisation of buccal epithelium cells with bacteria Streptococcus salivarius, average number of bacteria Streptococcus salivarius adhesed on one buccal epithelium cell - index of natural colonisation of buccal epithelim cells (INCBEC), and if INCBEC value is greater than 10, conclusion about light degree of severity of patient's with burn disease state is made, of INCBEC value is from 5 to 10 - about medium degree of severity of patient's with burn disease state is made, and if INCBEC value is lower than 5 - about severe degree of severity of patient's with burn disease state.

EFFECT: method is simple in realisation, takes little time, non-traumatic, eliminates risk of infection.

3 ex

FIELD: chemistry.

SUBSTANCE: description is given of polyaniline in form of an emaraldine base of formula [(-C6 H4-NH)2-(NH=C6·H4=NH-)]n n=20 to 10000 or interpolymer of a complex of polyaniline with poly-(2-acrylamido-2-methyl-1-propane-sulphonic acid), i.e. salt of emaraldine with poly-2-acryloamido-2-methyl-1-propane sulphonic acid of formula , n=50 to 50000 as a sorbent for removing viruses, non-viral proteins and for making an immunoasorbent based on said sorbent for isolating antiviral antibodies.

EFFECT: following methods are also described: method of removing viruses through immobilisation on a sorbent; immunoadsorption method; method of sorption of non-viral proteins from complex mixtures using sorbent.

20 cl, 2 ex, 4 tbl, 2 dwg

FIELD: veterinary.

SUBSTANCE: claimed is test-system of immuno-enzyme analysis, which allows to determine antibodies to viruses of infectious rhinotracheitis (IRT), viral diarrhea-disease of mucous membranes (VD-DMM), parainfluenza viruses -3 (PIV-3), respiratory syncytial (RS) and adenoviral (AVI) infections of livestock. Serological examination of animals allows to detect zones of infection spreading and estimate post-vaccination immunity.

EFFECT: application of claimed test-system IEA will allow to carry out simultaneously epizootological monitoring of five important infections of livestock, retrospective diagnostics of respiratory infections, and estimation of immunity stress in animals resulting from application of vaccines, determination of level of colostral antibodies in young animals in the first weeks or days of life, estimation of therapeutic medicine quality.

10 tbl

FIELD: medicine.

SUBSTANCE: invention concerns medicine, namely to laboratory diagnostics of human tularemia and concerns differentiation of infectious and postvaccinal antibody response at human tularemia. The essence of the invention consists that as an antigenic preparation in addition to LPS Fransicella tularensis in a dot blotting in parallel LPS Fransicella novicida is used. For this purpose LPS preparations are preliminary allocated from corresponding strains which are dissolved in the distilled water and applied on a nitrocellulose membrane in volume 1 mcl from the 1-5 mg/ml solution, with the subsequent processing by a buffering normal saline solution at pH 7.0-7.1 with 1% bull seralbumin and 0.5% twin 20 within one hour. After that the filters are washed out and incubated in the investigated serum dissolved not less than 1:100, within an hour at temperature of 37°C, then the samples are washed three times, also presence of complexes an antigen-antibody is revealed by a withstanding within 1 hour at a room temperature in a working solution of protein A, labelled with horse-radish peroxidase, with the subsequent washing up and placing in a painting solution, thus the account and an estimation of results are spent on presence of two brown maculae on a place of drawing of LPS F.tularensis and LPS F.novicida preparations which presence testifies to infectious process at the investigated patient, and at vaccinal process one maculae on a drawing place only LPS F.tularensis is observed.

EFFECT: advantage of the invention consists in simultaneous revealing infectious and postvaccinal antibody responses.

3 ex

FIELD: medicine.

SUBSTANCE: invention refers to mycoplasmoses laboratory diagnostic techniques and can be used in veterinary medicine. Method for making erythrocytic disgnosticum for indirect hemagglutination reaction (IHR) in pig's mycoplasmosis consists from fractional formalinisation of sheep's erythrocytes and sensitisation with mycoplasmosis antigen at 70°C within 30 minutes. And for sensitisation, erythrocytes are used being loaded with sensitine made of mixed mycoplasma cultures (M.hyosynoviae, M.hyorhinis and Ureaplasma sp.) taken in equal proportions and heated on water bath at 70°C within 30 minutes. Thereafter the diagnosticum is triply washed with a phosphate-buffer salt solution with PH-7.2.

EFFECT: higher specificity and activity of erythrocytic disgnosticum in indirect hemagglutination reaction (IHR) in pig's mycoplasmosis.

3 tbl

FIELD: medicine, medicinal microbiology.

SUBSTANCE: invention relates to a method for preparing species-specific antigen C. trachomatis used for enzyme immunoassay. Chlamydia bodies are treated with amino acid chelate before treatment with detergent N-lauryl sarcosine and treatment with monosaccharide simple ether is carried out before treatment with detergent dodecyl sulfate sodium. The advantage of invention involves enhancement of species-specific activity of antigen. Invention can be used for serological diagnosis of urogenital chlamydiosis.

EFFECT: improved preparing method.

1 tbl, 3 ex

FIELD: medicine, laboratory diagnosis.

SUBSTANCE: study is carried out in brush-bioptate taken from pharynx posterior wall mucosa using reaction of indirect immunofluorescence and the presence of whooping cough bacillus antigen and specific secretory immunoglobulin A (Ig A) are determined. Whooping cough is diagnosed in simultaneous detection of whooping cough bacillus antigen and specific secretory Ig A in analyzed material. Method provides enhancing precision of diagnosis and reducing time for carrying out the diagnosis. Invention can be used for carrying out the early etiological diagnosis.

EFFECT: improved method for diagnosis.

3 ex

FIELD: medicine.

SUBSTANCE: the suggested preparation is being a 2%-coagglutinating reagent obtained due to adding equal amount of 0.1%-highly purified and high-avidity immunoglobulin against tick-borne encephalitis to 10%-staphylococcal reagent dissolved in distilled deionized water followed by sensitization for 1-1.5 h at 25-30 C, resuspending the residue in 0.15 M sodium chloride solution at pH 5.4-5.5 to obtain coagglutinating reagent up to 2%-content value. Method for quick test diagnostics deals with applying 15-20 mcl tested material onto a slide, adding equal amount of a certain preparation necessary for express diagnostics followed by thorough mixing by shaking a slide to visually determine the presence of antigen to tick-borne encephalitis virus in 2-7 min due to coagglutination phenomenon.

EFFECT: higher efficiency.

6 cl, 3 tbl

FIELD: medicine.

SUBSTANCE: method involves mixing heparinized blood with chlamydia antigen diagnosticum in test glass tube containing physiologic saline in control test tube. Leukocyte number is determined and the leukocytes are incubated and repeatedly counted 2 h later and leukocyte fracture index is calculated. The value being greater than 0.2, clamidiosis is diagnosed.

EFFECT: high accuracy of diagnosis method.

5 tbl

FIELD: molecular biology, biotechnology, gene engineering, in particular diagnosis of atypical pneumonias.

SUBSTANCE: invention relates to DNA based on identified protein antigen epitope SARS-CoV. Particularly disclosed are nucleotide sequences of synthetic genes encoding recombinant protein fragments containing coronavirus protein antigen determinants SARS-CoV, represented in SEQ ID NO:1 - SEQ ID NO:8; as well as SARS-CoV virus protein fragments encoded by DNA sequences with amino acid sequences represented in SEQ ID NO:10 - SEQ ID NO:17. Said fragments are isolated by using preliminary obtained fusion protein by attachment to its N-terminal end GST-S-transferase protein with sequence represented in SEQ ID NO:9. Fusion proteins are useful in manufacturing of preparations for diagnosis of acute respiratory virus SARS-CoV.

EFFECT: new diagnostic agents for diagnosis of atypical pneumonias.

2 cl

FIELD: virology, veterinary, in particular method for titration of virus-neutralizing antibodies to rhabdovirus in blood serum of vaccinated animals.

SUBSTANCE: claimed method includes interaction of vaccine rhabdovirus of specific strain with target sera; incubation of obtained mixture containing virus and serum for 60 min at 37°C; daily intact culture of saiga kidney is introduced, mixture is fed into CO2-incubator and is hold for 5-7 days. Then virus-neutralizing antibodies is determined based on limit serum dilution wherein 50 % of virus cytopathicitic action on cell culture is suppressed.

EFFECT: more sensitive and economical method antirabic virus-neutralizing antibody titration.

2 tbl, 2 ex

FIELD: medicine, obstetrics.

SUBSTANCE: one should detect ratio coefficients for the content of lactobacilli to conditionally pathogenic flora in scraped off samples obtained after mucus removal from the surface of posterior vaginal arch and cervical canal, and at their 2-fold decrease against the norm it is possible to conclude upon the risk of abortion. The method enables to perform efficient prediction before manifestation of clinical signs that makes it possible to carry out due therapy.

EFFECT: higher accuracy of prediction.

3 ex, 3 tbl

FIELD: biology, hybridoma technology.

SUBSTANCE: invention represents a new strain of mammalian hybrid cells C3/S-3E5 of Mus musculus L. producing monoclonal antibodies (MCAb) to Bernet's coxiellas (strain "Grita") in cell cultures and abdominal cavity of syngenic animals. Hybridoma C3/S-3E5 producing MCAb to this pathogen is obtained by fusion of murine myeloma of strain Sp-2/0 and murine splenocytes of strain BALB/c immunized with the concentrated and purified Bernet's coxiella preparation (strain "Grita) inactivated with formalin using polyethylene glycol of molecular mass 1000 Da as a fusing agent and the following cloning by method of maximal dilutions. Specificity of prepared MCAb: absence of cross-reactions in IFA with Provacheck's rickettsia antigen and with the non-infected accumulation substrate. Using prepared MCAb it is possible to carry out specific detection of Bernet's coxiellas by method IFA (direct and indirect variants). IFA sensitivity based on these MCAb is 2.0 x 103 ID50 x cm-3 for white rats. Applying the present invention allows detecting and identifying pathogens of rickettsial etiology.

EFFECT: improved method preparing, valuable properties of strain.

3 tbl, 1 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: method involves applying chromato-mass-spetrometric techniques for determining small and large intestine bioptate fatty acids content. The number of microbial cells is determined from chromato-mass-spetrogram peak areas. The calculated proportions are interpreted for diagnosing irritated intestine syndrome.

EFFECT: high accuracy of diagnosis.

1 tbl

FIELD: medicine.

SUBSTANCE: method involves carrying out bacteriological examination of feces with following intestine microflora composition being determined. Mean degree of fat, protein and d-xylose excretion in 5 g version is to be determined. Mean fat excretion degree being equal to 2.71±0.04, mean J131 albumin excretion degree being equal to 2.66±0.03, mean d-xylose excretion degree being equal to 1.77±0.04, dysbacteriosis of mild severity degree is to be predicted. Mean fat excretion degree being equal to 4.37±0.28, mean J131 albumin excretion degree being equal to 3.57±0.14, mean d-xylose excretion degree being equal to 1.45±0.14, dysbacteriosis of moderate severity degree is to be predicted. Mean fat excretion degree being equal to 5.22±0.18, mean J131 albumin excretion degree being equal to 4.26±0.12, mean d-xylose excretion degree being equal to 1.11±0.04, severe dysbacteriosis is to be predicted.

EFFECT: high accuracy of prognosis.

1 tbl

Up!