Concerned sequences linkage method

FIELD: medicine.

SUBSTANCE: method facilitates linkage of sequences, coding immunoglobulin variable regions, T-cells receptors or B-cells receptors. Method is instrument of higher effectivity for making sequence data libraries. Capability of multiple RT-PCR with chain extension by interruption with employment of matrix, derived from single cell, provides highly effective creation of sister pairs libraries.

EFFECT: method is effective for linkage of two or few nucleotide sequences, coding domens or subunits of heteromeric protein as a result of single reaction performance.

51 cl, 25 dwg, 27 tbl, 14 ex

 

The technical field to which the invention relates

The present invention relates to a method of multiple molecular amplification, capable of binding to nucleotide sequences of interest using amplification, in particular by means of polymerase chain reaction (multiplex PCR). The method is particularly effective for creating libraries of related pairs, as well as combinatorial libraries of sequences coding for variable regions of immunoglobulins, T-cell receptor or b-cell receptor.

The level of technology

Antigennegative proteins involved in the immune response, are present in mammals as large polyclonal set representing a wide variety of specificdate binding. This diversity is created by rearrangeable gene sequences coding for variable regions of these binding proteins. Such binding proteins with variable regions include soluble and membrane-bound forms of b-cell receptor (also known as immunoglobulins or antibodies) and membrane-bound T-cell receptors (TcR). As immunoglobulins, their affinity is enhanced after recognition of antigen by the antigen receptor of b cells due to a process called“affinity maturation”, involving cycles of somatic spermatazoa these gene variable regions.

In addition, the immunoglobulins or fragments thereof, such as Fab fragments, Fv fragments and single-chain Fv fragments (scFv)are the subject of cloning and recombinant expression. However, all other binding proteins, which have variable regions, in principle, can be cloned and expressed as antibodies.

Known methods for selection of antibodies with the desired binding specificity often include obtaining a hybrid in immunized hosts, followed by the screening of specific clones or the creation of combinatorial libraries of expressed sequences in E. coli, consisting of the variable domains of immunoglobulins, which are then enriched using methods such as, for example, phage display.

The main limitation associated with the use of hybrid technology to obtain therapeutic antibodies, is the lack of lymphoma person, which can be used as merging cells In human lymphocytes. Heterohybridomas (i.e. In-human cells are fused with mouse lymphoma) are, as is well known, unstable and, thus, rarely allow to obtain suitable cell line for the purposes of the production of antibodies. In human cells, an immortalized in the result is the virus infection Epstein - Barra, are characterized by the same signs of instability. The lack of reliable cell methods for obtaining human antibodies for therapeutic purposes can be compensated by the latest achievements in the field of molecular biology.

The use of combinatorial libraries and phage display allows you to create a wide range of clones of antibodies with the potential variety in excess of 1010. From the above-mentioned range, you can choose the type of binding with a specific target, thus forming medbibliotekoy. This medbibliotekoy can be used to generate polyclonal or monoclonal antibodies. Sequences encoding the variable regions (for example, the sequence encoding the variable region of the heavy chain and the variable region light chain immunoglobulin), which form a library, it is possible to amplify from lymphocytes, plasma cells, hybrid or any other population of cells expressing immunoglobulin. Modern methods of creating combinatorial libraries provide separate allocation from the population of cells of the sequences encoding the variable regions. Thus forfeited the initial mating sequence encoding the variable region of the heavy chain and the variable region of the light chain of immunoglobulin In combinatorial library specified sequence mate randomly, and original combinations of these variable sequences are formed only by chance. Therefore, for the selection of the sequences encoding the variable regions, which are responsible for the desired binding specificity, it is necessary to perform multi-stage screening. This screening is usually performed in combination with the methods of enrichment of clones having the desired specificity, such as phage or ribosome display. Even after the variety is reached, it may be insufficient for selecting pairs of sequences encoding variable regions, with the aim of obtaining binding proteins with the same high affinity, which can be found in the source cells. In addition, enrichment methods commonly used for screening combinatorial libraries, make a significant standard error, for example, in the case of polypeptides with a particularly low toxicity in E. coli, which affects the efficiency of the packing circuit, slowing the rate of excretion or worsen other parameters, dependent on the system, which further reduces the diversity of the library. In addition, the clones derived from such combinatorial libraries, often produce binding proteins with cross-reactivity against proteins, as these pairs of proteins, in the best of the e from the initial pairs (hereinafter referred to as sibling pairs), not exposed to what is happening in vivo negative selection on the autoantigens, as in the case of receptors b - and T-lymphocytes at certain stages of their development. It is therefore desirable to clone the original pair of sequences coding for variable regions. In addition, it is expected that the occurrence frequency of clones with desired binding specificity, will be significantly higher in the library of cognate pairs than usual combinatorial library, especially if the cells of the source material is taken from a donor with a high frequency of occurrence of cells that encode pairs with specific binding, i.e. immune or immunized donors. From the above it follows that the library of cognate pairs do not have to be as big as a combinatorial library: the library of cognate pairs containing 104-105clones or even 102-103clones obtained from a donor with an appropriate immune response, may be sufficient to obtain binding proteins, representing a wide variety of required specificdate binding.

To create libraries of related pairs, you must associate the sequences encoding the variable regions, which were isolated from a single cell. Currently described on the rather different approach, providing related mating sequences encoding variable regions.

Intracellular PCR is an approach in which ensures permeability fixed cell population and carry out intracellular binding sequences of immunoglobulin encoding the variable region of the heavy chain and the variable region of the light chain. The specified binding can be carried out by the method of RT-PCR with overlapping chain (WO 93/03151) or by recombinant methods (Chapal, N. et al. 1997, Bio Techniques 23, 518-524). The amplification process described in these publications, is a three - or chetyrehstvolnym process involving (i) reverse transcription using primers for the constant region, forming an immunoglobulin cDNA, (ii) amplification by PCR sequences encoding the variable regions of the heavy and light chain, using sets of primers to sites overlapping or recombination, (iii) binding by recombination, if you choose this method, iv) implementation of the nested PCR products that comprise restriction sites for cloning. As the cells are permeable, there is a significant risk of yield of amplification products from the cells, the result may be a permutation of the sequence encoding the variable region thee who Eloy chain and the variable region of light chain, which leads to the loss of sibling mating. Therefore, this method provides a stage of rinsing after each reaction, which makes the process time-consuming and reduces the efficiency of the reactions.

Generally, intracellular PCR is inefficient and leads to a low sensitivity. Therefore, the method of binding using intracellular PCR is not widely spread, and the original study could not be repeated with obtaining reliable results, confirming that inside the cell really is the binding. Meanwhile, this method should be avoided permutation sequences encoding the variable region of the heavy chain and the variable region of light chain, resulting in the destruction of sibling pairs.

Other intracellular method described in WO 01/92291. The method is based on transsplicing RNA and when it is reached the connection VNand VL-coding mRNA within the cell. This approach requires the design of DNA carrying out TRANS-splicing within cells.

Unicellular PCR is another method related mating sequences encoding warbelow region of the heavy chain and the variable region of the light chain (see, for example, publications Coronella, J.A. et al. 2000, Nucleic Acids Res. 28, E85; Wang, X., et al. 2000, J. Immunol. Mthods 20, 217-225). In these publications described method, according to which the population of immunoglobulin-expressing cells was dispensed into test tubes, diluting to a density corresponding to a single cell in a single reaction mixture, resulting in the cloning process eliminates the permutation sequence encoding the variable region of the heavy chain and the variable region of the light chain. The described method consists of three or four stages, including : (i) reverse transcription using oligo-dT primers, random review of the primer or primers for the constant region, forming cDNA, (ii) fractionation of the cDNA product in multiple tubes and amplification using PCR specific sequences coding for variable regions of circuits (in a separate test tubes), using sets of primers containing restriction sites for cloning, iii) implementation of the nested PCR products that comprise restriction sites for cloning (optional), and iv) linking sequences encoding the variable region of the heavy chain and variable the region of the light chain of the individual tubes by cloning them into an appropriate vector, which in itself is a multistage process.

Humans are a light chain of two types: lambda (λ) and Kappa (κ). This trail is no, for cDNA obtained from each individual cell, you must run at least three separate PCR reaction with subsequent analysis and cloning of the corresponding fragments in a single vector to achieve sibling mating. Therefore, the above method unicellular CR requires a large number of manipulations to create a library of cognate pairs. Although the library of cognate pairs do not necessarily have to be as big as a combinatorial library, to obtain binding proteins, representing a wide variety of specificdate link creating library containing, for example, 104-105clones, by the method described above unicellular PCR remains a tedious task. In addition, a large number of manipulations significantly increases the risk of contamination and errors caused by human factor.

To obtain binding proteins with high affinity, corresponding affinity, usually observed in the occurrence of an immune reaction, it is very promising sibling mating sequences encoding variable regions, in combination with their amplification. To create a library with a large variety of clones necessary to develop a highly efficient method of cloning with minimum risk contaminated the I and permutation sequences.

In addition, it is desirable to reduce the number of stages of cloning to achieve highly efficient creation of combinatorial libraries.

The essence improvements

The present invention relates to an efficient method of linking two or more nucleotide sequences of interest, that is, sequences encoding variable regions using multiple molecular amplification, such as multiple RT-PCR with lengthening the chain by overlapping or multiple RT-PCR with subsequent linkage by ligation or recombination. This method can be performed in the format of one cell, which makes possible highly efficient cloning of related pairs.

Brief description of drawings

Figure 1 schematically depicts the various types of end segments of chain elongation by overlapping. The bold lines correspond to the gene-specific part of the primer, and the usual lines correspond to the overlying end segment. Vertical lines illustrate the complementary region. Primers facilitate the linking of two nucleotide sequences of interest. Figure 1 (I) shows two variants of the end segments of chain elongation by overlapping type I, where fully or partially overlap only extending segments; figure 1 (II) shows the end of the s segments of chain elongation by overlapping type II, where some 5'-terminal nucleotide of the extension segment of the first primer complementary to the gene-specific part of the adjacent primer; figure 1 (III) shows the end segments of chain elongation by overlapping type III, where all the extension segments are complementary to the gene-specific region adjacent the primer.

Figure 2 schematically depicts a mixture of multiple primers for elongation of the chain by overlapping, used to link the sequences encoding the variable regions of immunoglobulin. Be binding cDNA encoding the light chain (LC) and the variable region of the heavy chain (VH), depicted in the form of tubes with the designation of the 5'- and 3'-ends of the sense circuits, and the expected size of the amplified product. Multiple sets of primers for elongation of the chain by overlapping used to amplify the coding sequences of the arrows shown. Curved arrows with dashed edges directed towards the 5'-ends, show clone end segments. Leaf segments of chain elongation by overlapping depicted by bold lines. Sites restrictio present in end segments are listed near the end segment. The total number of primers in the mixture of multiple primers for elongation of the chain by overlapping equally is sixteen and is divided into the external primers, including one primer for Ctoand one primer for CH1and primers for elongation of the chain by overlapping, including six primers for VLand eight primers for VN. Primer for CH1's hybrid 5'-end of the constant domain 1 heavy chain. It is assumed that the product resulting from multiple RT-PCR with lengthening the chain by overlapping, equal to about 1070 BP and contains all Kappa light chain comprising a constant region, J-gene V-gene (Cto+ JL+ VL), and the variable region of the heavy chain consisting of a V-gene, D-segment and J-gene (VH+ D + JH). 5'- and 3'-ends indicate the direction of the open reading frame. Only a small part of a sequence that encodes aH1the region amplified multiple mixture of primers for elongation of the chain by overlapping, since the position of hybridization of the primer for CH1located next to J-region of the heavy chain.

Figure 3 shows several diagrams showing different directions of binding of the products depending on what primers are connecting end segment. Black color shows the area of overlap. 5'- and 3'-ends indicate the direction of the open reading frame. On figa shows a diagram illustrating the orientation of the products of the “parent behold the COP - the head segment. On FIGU shows a diagram illustrating the orientation of the products “limit segment end segment. On figs shows a diagram illustrating the orientation of the head segment, the end segment, where the first is a sequence encoding a light chain. On fig.3D shows a diagram illustrating the orientation of the head segment, the end segment, where the first is a sequence encoding a heavy chain.

Figure 4 schematically depicts the expression vector of immunoglobulin pLL113, where the coding sequences are in the orientation of the head segment, the end segment. Shows the vector comprises the following elements: bla = promoter, expression of the gene of resistance to ampicillin. Amp = the gene encoding resistance to ampicillin. pUC ori = replication origin Fig. AdMLP = major late promoter of adenovirus. Human IgG1 = sequence encoding a heavy chain immunoglobulin isotype G1 man. hGH pA = poly-A signal sequence of human growth hormone. bGH polyA = poly-A sequence of growth hormone in cattle. LC Kappa = sequence encoding a Kappa light chain of human immunoglobulin. FRT = site-target recognition Flp. Hygromycin = the gene encoding resistance to hygromycin. SV40 polyA = poly-A signal sequence vacuo siraudeau monkey virus.

On figa shows the gel after electrophoresis showing the results of two-stage multiple RT-PCR with lengthening the chain by overlapping with the subsequent palugaswewa CR. Amplification products obtained from cDNA isolated from individual cells of the Chinese hamster ovary (Cho Flp-In pLL113. Lanes 1-12 represent samples, and the arrows show the correct products multiple nested RT-PCR with lengthening the chain by overlapping length 1076 BP; M1 represents a ladder of length 100 BP W refers to water used as negative control sample. C indicates a positive control sample cDNA isolated from a cell line HB-8501. Separately presents less contrast invention of the same bands W, C, and the ladder's length of 100 BP to separate DNA fragments. On FIGU given a schematic representation of the gel shown in figa, which illustrates the corresponding fragments of the gel.

Figure 6 shows several photos and provides a graphic image of the gels after electrophoresis, which presents the results of single-stage multiple RT-PCR with lengthening the chain by overlapping without additional amplification method CR. All blocks M1 denotes a ladder of length 100 BP, and M2 denotes a ladder of length 500 BP On figa shows the gel after electrophoresis with products amplif the requirements, isolated from the lysate, corresponding to 100, 10, 1 or 0 cells. The arrow shows the product of chain elongation by overlapping. On FIGU given a schematic representation of the gel shown in figa. On figs shows the gel after electrophoresis, confirming the presence of the product obtained by lengthening the chain by overlapping, the bands corresponding to 100 and 1 cage, figa. On fig.6D shows the gel after the electrophoresis, which shows the splitting of the restriction enzymes NheI and NcoI product obtained by lengthening the chain by the overlapping of bands corresponding to 1 cell, figs.

Figure 7 shows the gel after electrophoresis on which you can see the results of single-stage multiple RT-PCR with lengthening the chain by overlapping and subsequent amplification method of palugaswewa PCR. M1 denotes a ladder of length 100 BP, and M2 denotes a ladder of length 500 BP the results obtained when using mixtures of multiple primers for elongation of the chain by overlapping containing primer for CH1WithH2WithH3WithH4orH5as an external primer when performing multiple RT-PCR with lengthening the chain by overlapping. These reactions were performed in cell lysates corresponding to 100, 10, 1 or 0 cells. The size of the product obtained by lengthening the chain by overlapping, dormancy is Zan arrow.

On Fig shows the gel after electrophoresis on which you can see the results of single-stage multiple RT-PCR with lengthening the chain by overlapping and subsequent amplification method of palugaswewa PCR using enriched In human lymphocytes as a matrix. M1 denotes a ladder of length 100 BP Lanes 5 and 6 correspond to the size of the product obtained by lengthening the chain by overlapping.

On figa schematically depicted expressindia vectors mammals (Em465/01P582/Em465/01P581), used to obtain cell lines expressing the lambda chain IgG1, where the coding sequences are in the orientation of the head segment, the parent segment. These vectors include the following elements: Amp = the gene encoding resistance to ampicillin. pUC ori = replication origin Fig. AdMLP = major late promoter of adenovirus. EFP = promoter of the elongation factor. Leader AP = leader sequence of alkaline phosphatase. VH = sequence encoding the variable region of the heavy chain. IgG1 HC = sequence encoding a constant region of the heavy chain of immunoglobulin isotype G1. rBG polyA = poly-A signal sequence of the beta-globulin rabbit. bGH polyA = poly-A sequence of growth hormone in cattle. Leader IgK = sequence encoding a leader sequence is lnost Kappa-chain of the mouse. IgL (1b or 1C) = sequence encoding a lambda light chain immunoglobulin family, 1b or 1C. FRT = site-target recognition Flp. Hygromycin = the gene encoding resistance to hygromycin. SV40 polyA = poly-A signal sequence of the simian vacuolating virus. In figures 9B and 9C shows agarose gels, stained with ethidium bromide containing PCR products isolated from cell lines Cho Flp-In/Em464/01P581 and CHOFlp-In/Em464/01P582 respectively. Lanes 1-4 correspond to the concentrations of the matrix total RNA, 50 PG, 5 PG, or 0 0,5 PG PG that were used to perform multiple RT-PCR with lengthening the chain by overlapping. M denotes a ladder of length 100 BP (New England Biolabs, New England, USA). Arrows indicate the PCR product with the elongation of the chain by overlapping.

Figure 10 depicts a block diagram showing the stage of creating the library of expressed related antibodies, which can be expressed polyclonal or monoclonal antibodies.

Figure 11 schematically depicts a vector JSK301 E.coli used to create a library of vectors for the expression of Fab fragments by introducing the vector fragments of chain elongation by overlapping containing related sequence encoding the variable region, at the indicated restriction sites NotI/XhoI. The specified vector contains the following elements: Amp and Ap pro = the gene for resistance to ampicillin and its promoter. pUC19 Ori = replication origin. SN = sequence encoding domain 1 heavy chain immunoglobulin gamma 1 person. Insert = insert unrelated sequence, which is cut with the introduction of fragments of chain elongation by overlapping. tac P and lac Z = bacterial promoters that can be cut at the restriction sites NheI and AscI.

On Fig shows a diagram illustrating the creation of a library of expression vectors related Fab-fragments. Stage 1 illustrates the insertion of related pairs of sequences coding for variable regions (VH1-VL1- VHX-VLX), the vector JSK301 E.coli by hydrolysis XhoI-NotI. Stage II illustrates the insertion of a cluster of bacterial promoter and leader sequence (leader sequence pelB and P tac-promoter, stimulating the expression of VHx, R. lac-promoter and leader sequence pelB, stimulating the expression of VLx) by hydrolysis AscI-NheI.

On Fig shows the binding of α-, β - and γ-subunits, forming a G-protein, using a single-stage multiple RT-PCR with lengthening the chain by overlapping and additional amplification using PCR. The images show dimensions for separate coding regions, as well as the size of the associated product. For the final product indicated restriction sites introduced by means of limit segments is s primer during amplification.

On Fig shows the scatter graph coloring when performing FACS analysis (A) mononuclear cells of peripheral blood (RVMS), isolated from the blood of the donor; (C) fraction of its CD19-negative cells obtained by the method of magnetic sorting of cells, and (C) fraction of CD19+ cells obtained by the method of magnetic sorting of cells. For each fraction shows a scatterplot, chart CD19/CD38 and chart CD38/CD45.

On Fig shows the fraction of CD19+ cells depicted in figs, which previously was stored in liquid nitrogen, thawed and stained with antibody against CD19, CD38 and CD45. Depicts a scatter plot, shown in the corresponding figs.

On Fig displays graphs of matches used for sorting fractions D19+ cells. Scatter chart and chart fluorescence based CD38 and CD45 were used for the selection of highly productive CD38 cells (CD38hi) and intermediate CD45 cells (CD45in).

On Fig shows the gel after the electrophoresis, which shows the successful execution of multiple RT-PCR with lengthening the chain by overlapping using blood samples obtained from donor T (row a, wells 1-12 of eight 96-well plates). Samples were applied to agarose gel in two rows (a and b) at 48 samples each. The expected fragment size of chain elongation by overlapping approximately 1070 is a The expected fragments of chain elongation by overlapping as indicated by the arrows.

On Fig shows the ELISA periplasmatic extracts from a tablet G060. Tablet for ELISA was senzibilizirani antibody goat against Kappa-chain that captured Fab-fragments were detected using HRP-conjugated antibodies goat against the Fab-fragment of a person.

On Fig shows the ELISA periplasmatic extracts from a tablet G060. Tablet for ELISA was senzibilizirani 10 μg/ml ovalbumin (Sigma A-5503), captured Fab-fragments were detected using HRP-conjugated antibodies goat against the Fab-fragment of a person.

On Fig shows the ELISA periplasmatic extracts from a tablet G060. Tablet for ELISA was senzibilizirani tetanus toxin, while captured Fab-fragments were detected using HRP-conjugated antibodies goat against the Fab-fragment of a person.

On Fig shows one-step competitive ELISA periplasmatic extracts from a tablet G060. The tablet ELISA was senzibilizirani tetanus toxin (TT) and each well was added soluble TT in the amount of 10-7M for competitive binding Fab fragments of bacterial supernatants with immobilized TT. Captured Fab-fragments were detected using HRP-conjugated antibodies goats against Fab-fragm the NTA person.

On Fig shows the comparative analysis of protein sequences of the variable regions of the heavy chain derived from clones that bind TP-antigen, tablet G060. The degree of homology of sequences expressed in different shades; 100%, 80% and 60% homology depicted respectively in black, gray and light gray. CDR1 is comparable provisions 34-41. CDR2 is comparable provisions 55-73. CDR3 is comparable provisions 107-127. Immature termination codons are indicated by an asterisk. The results of the comparative analysis shown in eight separate pieces (a-h), arranged in two rows from left to right, with figa-d are in the top row and five-h are in the bottom row.

On Fig shows the comparative analysis of protein sequences of the variable region of the light chain derived from clones that bind TP-antigen, tablet G060. The degree of homology of sequences expressed in different shades; 100%, 80% and 60% homology depicted respectively in black, gray and light gray. CDR1 is comparable provisions 26-42. CDR2 is comparable provisions 58-64. CDR3 is comparable provisions 97-106. Immature termination codons are indicated by an asterisk. The results of the comparative analysis shown in eight separate pieces (a-h), arranged in two rows on the left is upravo, this figa-d are in the top row and five-h are in the bottom row.

On Fig shown competitive ELISA analysis performed to determine the apparent affinity of selected clones from the tablet G060. Soluble TT diluted to concentrations ranging from 100 nm to 25 PM (four-fold dilution)was added to the Fab-fragments, causing a competitive binding Fab fragment with immobilized TT. The degree of interaction is expressed as the ratio of the observed binding for a given concentration of soluble TT with binding detected without the addition of soluble TT to the reaction mixtures.

On Fig presents double phylogenetic histogram showing nutrigenetics and migrations the relationship between the sequences of the variable domain of the heavy and light chain antibodies. Phylogenetic groups of three VNand VLsequences coupled to the histogram to indicate the actual mating specific V genes. A) Clones that bind TP-antigen derived from a combinatorial library method for the display on the phage. C) Clones that bind TP-antigen obtained from a library of cognate pairs by the method according to the present invention.

Description of the invention

The present invention relates to a method of amplification and linkage of two or several interest of the participating non-contiguous nucleotide sequences, which provides high-efficiency cloning of such sequences. This result is achieved mainly by reducing the number of stages required for amplifying and linking the cloned sequences.

One of the objects of the present invention is a method of linking multiple non-contiguous nucleotide sequences, which involves multiple molecular amplification of nucleotide sequences of interest using a matrix derived from separate cells, a population of isogenic cells or population of genetically different cells, and the subsequent binding of the amplified sequences. If the matrix used in a separate cell or a population of isogenic cells, the binding is formed by a segment of nucleic acid that contains the related linked nucleotide sequence of interest. If the matrix used a population of genetically different cells, the binding is formed a library of segments, where each segment contains arbitrarily related interested nucleic acid sequence; this library is also known as a combinatorial library.

In one of the embodiments of the present from which retene above multiple molecular amplification is an amplification method, multiple PCR, which preferably precedes the stage of reverse transcription. In a preferred variant of the invention, the reverse transcription, amplification and linking is performed in a single stage using multiple RT-PCR with lengthening the chain by overlapping or, alternatively, in two stages using multiple RT-PCR and subsequent linkage by ligation or recombination.

Another variant of implementation of the present invention relates to the creation of libraries of related pairs associated sequence encoding the variable region, in particular the sequences encoding the variable regions of the heavy and light chain, or the sequence encoding the alpha chain and beta-chain T-cell receptor (TcR). This method provides for lymphocytopenia fraction of cells at least one acceptable donor, and, optionally, the enrichment of specific populations of lymphocytes in a specified fraction, such as b-lymphocytes or T-lymphocytes, depending on what sequence encoding the variable region, it is desirable to obtain from an immunoglobulin or TcR. Lymphocytopenia fraction of cells or enriched cell fraction distributed in several vessels, receiving one cell in each vessel. Several individual cells subjected to the Ute reverse transcription (RT) or an alternative procedure for obtaining cDNA, using as matrix nucleic acid selected from the population of individual cells. After the stage of reverse transcription perform multiple molecular amplification and binding pairs obtained from each cell sequences encoding variable regions, one of the methods of the present invention.

Methods cloning described in this invention, avoids time-consuming and inefficient cloning and, in addition, reduce the risk of contamination and loss of diversity during the many stages of the clone.

Another object of the present invention are library related pairs, the resulting multiple molecular amplification and binding. Source library related pairs (primary library)obtained by the method according to the present invention, may be subjected to screening with the creation of medbibliotekoy related pairs encoding the variable domains of the target-specific binding proteins or reprezentirovanii binding proteins.

In another embodiment of the invention the library and medbibliotekoy of the present invention can be used for the expression of recombinant monoclonal or polyclonal protein, which retained the inherent initial donor affinity and specificity is the spine of the binding.

Definitions

The term “sibling pair” refers to the initial a couple of interesting non-contiguous nucleic acids that are located within individual cells or isolated from single cells. In preferred embodiments of the invention related pair contains two sequences encoding the variable regions, which together encode the variable domain binding protein and have gene sequences isolated from the same cells. Thus, when the expression in the form of a fully binding protein or its stable fragment they retain the affinity and specificity of binding of the binding protein, originally expressed in this cell. Related pair, for example, may consist of a sequence that encodes a variable region of the heavy chain of the antibodies associated with a sequence that encodes a variable region light chain from the same cells, or the sequence encoding the α-chain T-cell receptor, related sequence that encodes a β-chain, from the same cells. The library of cognate pairs is a collection of such related pairs.

The term “polymerase, a heat-activated” understand polymerase, which are inactive or have very low activity when temperature is tours, used for reverse transcription. To activate these polymerases need a high temperature (90-95°C). This is an advantage to perform one-step RT-PCR, as it does not enable interference polymerase in a reaction involving reverse transcriptase.

The term “isogenic population of cells” means a population of genetically identical cells. In particular, a special interest in the implementation of the present invention is isogenic population of cells obtained from the clonal expansion of one of the selected cells.

The term “separate cell” means a cell that is physically separated from the cell population and meets the definition of a “one cell in the same vessel.” A separate population of cells obtained when the distribution of the cell population in several vessels. As stated in the section titled “Sources matrix, the number of vessels with a single cell does not have to be in proportion to 100%, so that such a population could be called a population of individual cells.

The terms “associate” or “associate” in relation to the amplification indicate the connection of interest of the amplified sequences to nucleic acids in one segment. With respect to the related pairs segment contains a sequence of nucleic acid is acid, encoding the variable domain, such as the variable region of the heavy chain of the antibodies associated with a sequence that encodes a variable region light chain antibodies derived from the same cells. Linking can occur simultaneously with amplification or stage that is executed immediately after amplification. To the shape or functionality of the segment makes no demands, it can be linear, circular, single-stranded or double-stranded. The specified binding does not have to be constant, one of the interesting sequences of nucleic acids can be isolated from the segment, such as segment related pairs can be allocated to one of the sequences encoding the variable region. However, up until the original variable regions that form a related pair, will not be replaced by any other variable regions, they are still considered a related pair, even without being linked together in one segment. The specified binding preferably represents a linking nucleotides fosfomifira communication. However, the binding may be produced by other chemical methods of cross-stitching.

The term “multiple molecular amplification” refers to the simultaneous amplification of two or more of the backside of the different sequences in a single reaction. Acceptable amplification methods include polymerase chain reaction (PCR) (U.S. patent No. 4683202), ligase chain reaction (LCR) (Wu and Wallace, 1989, Genomics 4, 560-9), amplification with the replacement chain (SDA) (Walker et al., 1992, Nucl. Acids Res. 20, 1691-6), autostacking replication sequence (Guatelli et al., 1990, Proc. Nat. Acad. Sci USA, 87, 1874-8) and amplification of sequence-based nucleic acid (first NASBA) (Compton J., 1991, Nature 350, 91-2). The last two methods of amplification include the implementation of isothermal reactions based on isothermal transcription with education as the single-stranded RNA (ss)and double-stranded DNA (ds).

The term “multiple PCR” refers to a variant of PCR in which there is simultaneous amplification of two or more specific sequences resulting from the introduction into the reaction mixture of several sets of primers, of which, for example, one set of primers is designed to amplify variable regions of the heavy chain, and the other set of primers designed for amplification of variable region Kappa-chain in a single PCR reaction. In addition, with the above sets of primers can be combined in a set of primers designed for amplification of variable regions of lambda chain.

The term “multiple RT-PCR” refers to multiple PCR, which precedes the stage of reverse transcription (RT). Set the state of the RT-PCR can be performed in the form of a two-stage process with a single stage RT, pre multiple PCR, or in the form of a one-stage process in which all components necessary for RT and multiple PCR, combined into one test tube.

The term “multiple PCR elongation of the chain by overlapping and multiple RT-PCR with lengthening the chain by overlapping” means that multiple PCR or multiple RT-PCR performed using a mixture of multiple primers for elongation of the chain by overlapping, designed for amplification of the specified sequences, resulting in the simultaneous amplification and binding defined sequence.

The term “several vessels” refers to any object (or objects)that provide physical separation of single cells from the cell population. Such vessels can be tubes, advance tablets (e.g., 96-well plates, 384-well plates, tetralonia microplates or other advance tablets), matrix, chips, microchips, gels or gel matrix. The specified object is preferably used for amplification by PCR.

The term “polyclonal protein” or “polyclonality” used here is the value refers to a protein which consists of different, but homologous protein molecules, preferably selected snazziest immunoglobulins. Thus, each protein molecule is homologous to the other molecules in the composition, but contains one or more fragments of the variable region polypeptide sequence, which differ in amino acid sequence from other members of the polyclonal protein. Known examples of such polyclonal proteins include molecules are antibodies or immunoglobulins, T-cell receptors and b-cell receptors. Polyclonal protein may consist of a specific subpopulation of protein molecules, which have a common characteristic, such as a common activity of binding to the desired target, such protein can be a polyclonal antibody, characterized by binding specificity of the desired target antigen.

The term “population of genetically different cells” used here, the value represents the population of cells in which individual cells differ from each other on the genome level. A population of genetically different cells is, for example, the population of cells obtained from a donor, or a fraction of such cells, in particular the fraction of cells containing b-lymphocytes or T-lymphocytes.

The term “primer set”, or interchangeably with the term “primer pair”refers to two or more primers, which are able to initiate amplification interest nucleotide placentas the activity (i.e. one of the members of sibling pairs). The primer set of the present invention may be designed to initiate collection of nucleotide sequences containing the sequences encoding the variable regions. Examples of different families are Kappa light-chain antibody lambda light-chain variable regions of the heavy chain and the variable region of the α-, β-, γ - or δ-chain T-cell receptor. A set of primers for amplification of a family of nucleotide sequences comprising sequences encoding variable regions, often consists of several primers, some of which may be degenerate primers.

The term “sequence identity” refers to the identity, expressed as a percentage, which determines the degree of sequence identity of the nucleic acid throughout the length of the shorter of the two sequences. Identity can be calculated as (Nref- Ndif)x100/Nrefwhere Nrefindicates the number of residues in the shorter sequence, Ndifindicates the total number of non-identical residues in the optimally combined the number of residues Nreftwo sequences. Hence, the DNA sequence AGTCAGTC is 75% identical to the sequenceTAATCAATCGG (Ndif= 2 and Nref= 8) (underlined optimally combined astatkie bold two non-identical residue of 8).

The terms “random” or “random” as applied to the binding indicate the binding of the nucleotide sequences isolated from different cells, but cross-linked in a population of genetically different cells. If interested nucleotide sequences are the sequences encoding the variable regions, it will produce a combinatorial library of related sequences. If, on the other hand, are interested in nucleotide sequences encode identical heteromeric protein, arbitrarily associated sequence seems to be similar to sequences related to a single cell.

The term “matrix obtained from separate cells” for reverse transcription refers to a nucleic acid such selected cells. Nucleic acids may represent, for example, RNA, mRNA, DNA or genomic DNA. Nucleic acids can be isolated from cells or present in the cell, which may be intact or lysed.

The method of amplification and binding

One of the distinctive features of the present invention is to reduce the number of tubes necessary to amplify nucleotide sequences of interest, through the implementation of a variant of PCR in which two or the number of given sequences amplified simultaneously in a single tube by introducing multiple sets of primers, for example, all of the primers required for amplification sequences encoding variable regions in a single reaction mixture. Such method is known as multiple polymerase chain reaction (multiplex PCR).

Multiple PCR or multiple PCR prior to performing reverse transcription (multiple RT-PCR) are well known methods in the field of diagnostics used, for example, when performing analysis of mutations, deletions and polymorphisms of DNA, quantitative analysis of the mRNA content and identification of viruses, bacteria and parasites (see publication Markoulatos, P. et al., 2002, J. Clin. Lab. Anal. 16, 47-51). However, there are very few examples of amplification of sequences encoding the variable region of the light chain in a single vessel, as well as sequences encoding the variable regions of the heavy chain of immunoglobulins, using a mixture of multiple primers, consisting of more than four primers and comprising a set of primers for Vtoand/or Vλtogether with a set of primers for VH(Chapal, N. et al., 1997, BioTechniques 23, 518-524; Liu, A.H. et al., 1992, Proc. Natl. Acad. Sci. USA 89, 7610-7614; Embleton, M.J. et al., 1992, Nucleic Acids Res. 20, 3831-3837). The reason for this may be the fact that the sets of primers that can be used to amplify sequences encoding the variable domains of antigen is vyzyvayushih proteins, usually include several degenerate primers to match the diversity of the sequences encoding the variable regions. Thus, the complexity of the reaction CR increases significantly when performing amplification of sequences encoding variable regions, using multiple PCR.

Another distinguishing feature of the present invention is the linking of two more specific sequences amplified using multiple CR, immediately after amplification. In particular, in this way bind the related pairs of sequences encoding variable regions.

One of the embodiments of the present invention relates to the mixing of multiple primers designed for PCR with lengthening the chain by overlapping, resulting in simultaneous amplification and binding nucleotide sequences of interest. Specified multiple PCR elongation of the chain by overlapping reduces the number of reactions required for allocation and binding nucleotide sequences of interest, in particular, related pairs of linked variable regions.

Other embodiments of the present invention relate to the linkage by ligation or is combinatie alternatively, multiple PCR elongation of the chain by overlapping. In these ways linking performed separately from amplification using multiple PCR, but immediately after amplification. However, linking can be performed in the same tube, and multiple PCR.

To perform multiple PCR elongation of the chain by overlapping must have two or more sets of primers (a mixture of multiple primers), in which at least one primer in each set has a terminal segment of chain elongation by overlapping. Leaf segments of chain elongation by overlapping allow linking products formed by each set of primers in the amplification process. This mixture of primers is referred to as multiple mixture of primers for elongation of the chain by overlapping. Multiple PCR elongation of the chain by overlapping differs from conventional PCR with lengthening the chain by overlapping the fact that the associated sequences are formed simultaneously in one test tube, resulting in immediate binding defined sequence during amplification without any intermediate purification. In addition, under normal CR with lengthening the chain by overlapping requires a separate binding assays using PCR using the outer set of primers or nested set of primers for p. the receipt of the associated product (Horton, R. et al., 1989, Gene 77, 61-68). This additional stage of amplification is optional when performing multiple PCR elongation of the chain by the overlapping of the present invention.

Another distinguishing feature of the present invention is a stage of reverse transcription (RT)prior to amplification of multiple PCR or multiple PCR elongation of the chain by overlapping, using a matrix derived from the selected single cell or a population of isogenic cells.

Another distinguishing feature of the present invention is the use of nucleotide sequences derived from the selected single cell or a population of isogenic cells as template for amplification by a method of multiple PCR. RNA from single cells, preferably, subjected to reverse transcription with the formation of cDNA before performing multiple CR. To amplify some interesting sequences of nucleic acids alternatively, mRNA can be used genomic DNA. Using separate cells or a population of isogenic cells resulting from clonal expansion of separate cells, as the source matrix, you can avoid replacing the nucleotide sequences encoding interest heteromeric protein nucleotide sequences received from other cells in the cell population. This is important if you want to get the initial membership of the sequences of interest. For education related pairs of sequences encoding variable regions, as the source of the matrix it is important to use a separate cell or a population of isogenic cells.

Multiple PCR elongation of the chain by the overlapping is rarely used method. In the publication WO 99/16904 described linking exons from genomic sequence when performing the same reaction, in which cDNA is formed without the use of reverse transcription. In the described method is used, one set of primers (consisting of two primers) on one exon to be binding, in which a mixture is formed of multiple primers for elongation of the chain by overlapping. Using each set of primers can be extended chain by overlapping with an adjacent set of primers by means of the complementary end segments of chain elongation by overlapping. cDNA is formed from a matrix of genomic DNA in the implementation of the PCR elongation of the chain by overlapping, using a mixture of multiple primers for elongation of the chain by overlapping and subsequent nested PCR, which is in accordance with the description of the Institute of economy and management is a necessary stage.

Education cDNA from exons of the genomic DNA described in WO 99/16904, has nothing to do with the cloning of sequences encoding heteromera proteins. First of all, heteromera proteins are usually obtained from different genes, while linking exons in accordance with the description given in the publication WO 99/16904, refers to the binding of exons from the same gene. In addition, the present invention facilitates the creation of libraries of interest related sequences of nucleic acids, in particular combinatorial libraries and libraries cognate pairs of variable regions that are completely different from the binding of a series of exons from the same gene, resulting in the formation of one avariablename cDNA. In the present invention used nucleic acid selected from individual cells, preferably in the form of RNA, which does not require separation from the rest of the contents of the cells before it can be used as a matrix.

In several publications described multiple RT-PCR with lengthening the chain by overlapping used for linking sequences encoding variable regions.

The simplest form of multiple RT-PCR with lengthening the chain by overlapping described to highlight the sequence encoding scFv-fragment from the cell line of hybridoma (Thirion, S. et al. 1996, Eur. J.Cancer Prev. 5, 507-511 and Mullinax, R.L. et al. 1992, BioTechniques 12, 864-869). The methods described in the publication Thirion and Mullinax, require completion of reverse transcription of mRNA using oligo-dT-primers in relation to total RNA extracted from cell lines of hybridoma, then a separate stage of binding. Stage linking is carried out using a total of four primers, including two pairs of primers for the amplification of sequences encoding respectively the variable region of the heavy chain and the variable region of the light chain. Basic primer for VLand reverse primer for VNorNcontain complementary end segments of chain elongation by overlapping that allows for simultaneous amplification and binding sequences encoding the variable region of the heavy chain and the variable region of the light chain. In these ways does not apply nested PCR to increase the sensitivity of the method binding.

Another example of multiple RT-PCR with lengthening the chain by overlapping, related to the binding sequences encoding variable regions described in the above publication WO 93/03151, in which is described the cloning of sequences encoding the variable region of the heavy chain and variable oblastiga circuit, which were obtained from a single cell without selecting individual cells before cloning. The method described in WO 93/03151 requires rinsing between stage RT and stage multiple PCR elongation of the chain by overlapping. In addition, one of the specific objectives publication WO 93/03151 is the solution to the problem of selection of individual cells to obtain the related pairs of sequences encoding variable regions.

None of the known methods of multiple RT-PCR with the elongation of the chain by the overlapping is not intended for implementation at the matrix obtained from separate cells. In addition, none of the known methods cannot be performed in the form of a single-stage reaction RT-PCR.

One of the embodiments of the present invention refers to the binding of several interesting non-contiguous nucleotide sequences. This method involves amplification using multiple PCR or multiple RT-PCR nucleotide sequences of interest using a matrix derived from the selected single cell or a population of isogenic cells, and binding interest of the amplified nucleotide sequences. Furthermore, the method provides an optional stage to perform additional amplification related products.

The other is th option of implementing the present invention relates to a method of creating a library of cognate pairs, includes linked sequences encoding the variable regions. The method comprises obtaining from a donor lymphocytopenia fraction of cells, which do not necessarily enrich a specific population of lymphocytes from a specified fraction of the cells. Then get a separate population of cells by distributing cells from lymphocytopenia fractions of cells or enriched fractions of cells in several vessels. Then perform multiple molecular amplification (amplification method multiple RT-PCR) sequences coding for variable regions, which are separate populations of cells, and the binding of pairs of sequences encoding variable regions, with a separate pair produced from a single cell in a population separate cells. In addition, this method provides two optional stages: in the first stage is the division of a single cell, selected from a population of individual cells, before the formation of the population of isogenic cells prior to performing the amplification method of multiple RT-PCR. So get a few vessels with different population of isogenic cells (one population of isogenic cells in the same vessel). The second optional step involves the implementation of additional amplification related posledovatel the values, encoding variable regions.

In preferred embodiments, the implementation of the present invention, one of the members of the specified library related pairs represents a sequence encoding a variable region light chain of immunoglobulin-related sequence that encodes a variable region of the heavy chain of immunoglobulin, which is obtained from a single cell, or a sequence encoding the binding domain of the T-cell receptor consisting of a variable region of the alpha chain is associated with the variable region of the beta chain, or variable region of the gamma chain associated with the variable region of the Delta chain, with associated variable region derived from a single cell.

The amplification method of multiple RT-PCR according to the present invention can be made in the form of the two-stage method, in which reverse transcription (RT) is carried out separately from the amplification method of multiple PCR (or alternative multiple molecular amplification), or in the form of a one-stage method, in which stage RT and amplification method multiple PCR is carried out using the same primers in a single tube.

Reverse transcription (RT) is carried out by means of an enzyme with reverse transcriptase activity, thus obtaining cDNA from total PH is, mRNA or given specific RNA in a separate cage. Primers that can be used for reverse transcription, represents, for example, oligo-dT primers, random hexamers, arbitrary decamera, other random primers or primers specific to interest nucleotide sequences.

The two-stage method of amplification using multiple RT-PCR allows to distribute cDNA, obtained at the stage RT, several vessels for the storage matrix fraction up to perform amplification. In addition, the distribution of cDNA in a few tubes makes it possible to perform multiple amplification method multiple PCR nucleic acid derived from the same matrix. Although this method is characterized by a large number of individual reactions, it allows, if desired, to simplify the mixture of multiple primers. The specified two-stage method, for example, can be used for amplification and binding sequences encoding the variable region of the heavy chain and the variable region of the Kappa light-chain, in one test tube and sequences encoding the variable region of the heavy chain and the variable region of light lambda chain, another tube by using the same matrix. A single cell usually expresser is no only one of the light chains. However, it is often much easier to perform the reaction at the same time, not waiting for the outcome of one of the reactions before starting the execution of another reaction. In addition, the amplification of Kappa chain and lambda chain serves as an internal negative control, as should be expected from the individual cells may be amplified only Kappa-chain or lambda chain.

In one method, multiple RT-PCR reverse transcription and amplification using multiple PCR is performed in a single vessel. In vessels enter all the components necessary to perform both reverse transcription and multiple PCR in one stage, and then carry out the specified reaction. As a rule, it is not necessary to introduce additional components after the start of the reaction. The advantage of the one-stage method of amplification using multiple RT-PCR is the reduction in the number of stages required to obtain related nucleotide sequences of the present invention. This method is particularly effective to perform multiple RT-PCR using a series of individual cells, when the same reaction should be performed in several vessels. One way multiple RT-PCR performed using reverse primers present in the mixture of multiple primers required for amplifica the AI method, multiple PCR, also as primers for reverse transcription. Composition required for one-stage method of multiple RT-PCR, contains a matrix of nucleic acid, an enzyme with reverse transcriptase activity, an enzyme having the activity of a DNA polymerase, a mixture of deoxynucleotides (dNTP mixture containing dATP, dCTP, dGTP and dTTP) and the mixture of multiple primers. The matrix nucleic acid preferably is a total RNA or mRNA obtained from separate cells in purified form, are contained in the lysate of cells or inside intact cells. The exact composition of the reaction mixture usually requires some optimization of each mixture of multiple primers of the present invention. This applies to both two-stage and single-stage method of multiple RT-PCR.

In alternative embodiments, the implementation of the present invention as a matrix, it may be desirable to use genomic DNA instead of RNA. In such cases, the stage of reverse transcription and miss the rest of the stage according to the present invention perform in accordance with the above description.

When certain single-stage multiple RT-PCR during the reaction, it may be desirable to introduce additional components. For example, after completing stage RT, you can add polymerase. Others the further components may include, for example, a dNTP mixture, or a mixture of multiple primers, possibly with a different set of primers. This method can be considered as multiple RT-PCR, performed in a single tube, which has the same advantages as the one way multiple RT-PCR, as it limits the number of tubes required to obtain the required related products.

Interested in nucleotide sequence, amplificatoare using multiple RT-PCR may be connected to each other in different ways, such as multiple RT-PCR with lengthening the chain by overlapping, ligation or recombination, using different mixtures of multiple primers. The amplification method of multiple RT-PCR and linking carry out one-step or two-step method. However, linking can also be done by multi-stage process using, for example, filling of the fragment, which was used for binding are interested in sequences of nucleic acids using PCR, ligation or recombination. This fills a fragment may contain CIS-elements, promoter elements corresponding to the coding sequence or learning sequence. In a preferred embodiment of the invention, the linking is performed in the same vessel, CTO amplification method multiple RT-PCR.

In one of the embodiments of the present invention linking several interesting non-contiguous nucleotide sequences carried out together with the amplification method of multiple CR using a mixture of multiple primers for elongation of the chain by overlapping. This method allows you to combine amplification and binding defined sequence. The composition is required to perform multiple PCR elongation of the chain by overlapping, usually contains a matrix of nucleic acid, an enzyme having the activity of a DNA polymerase, a mixture of deoxynucleotides (dNTP mixture containing dATP, dCTP, dGTP and dTTP) and the mixture of multiple primers for elongation of the chain by overlapping.

In a specific embodiment, the present invention several interesting non-contiguous nucleotide sequences associated with multiple RT-PCR with lengthening the chain by overlapping, using a matrix derived from the selected single cell or a population of isogenic cells. In addition, this method provides an optional stage to perform additional molecular amplification related products. Multiple RT-PCR with lengthening the chain by overlapping preferably carried out in a one-step reaction in a single tube.

A mixture of plural the military primers for elongation of the chain by the overlapping of the present invention includes at least two sets of primers, able to initiate amplification and linking at least two of the sequences encoding the variable regions, such as amplification and binding sequences of the families of the variable regions of the heavy chain of the immunoglobulin family of variable regions of light Kappa - or lambda-chain or amplification and binding sequences of families of α-, β-, γ - or δ-chain T-cell receptor.

In another embodiment, the present invention several interested nucleotide sequences amplified using multiple RT-PCR, connect legirovaniem. For this purpose a mixture of multiple primers used for multiple RT-PCR, create so that amplificatoare sequence can be split appropriate restriction enzymes and produce covalent binding by ligating DNA (primers described in “a Mixture of primers and their creation”). After amplification by the method of multiple RT-PCR using a mixture of multiple primers to the reaction mixture together with ligase add restriction enzymes necessary for the formation of compatible ends of the given sequences. The PCR products before this stage can not be cleaned, although this cleaning can be PR is raised. The reaction temperature for the combined restriction cleavage and ligation is in the range from about 0 to 40°C. However, if the mixture still present in the polymerase used in multiple CR, the preferred incubation temperature below room temperature, most preferred are temperatures from 4 to 16°C.

In another embodiment, the present invention several interested nucleotide sequences amplified by the method of multiple RT-PCR, associated recombination. In this case amplificatoare sequence can be associated with the use of identical recombination sites. The binding is performed by adding recombinase, obligasi recombination. Some acceptable system recombinases include Flp-recombinases with multiple sites, FRT, She-recombinases with multiple sites, lox, the integrase Φ31, which carries out recombination between the attP and attB site, a system of six β-recombinases and Gin-gix. Linking recombination was shown on the example of two nucleotide sequences (binding VHVL) (publication Chapal, N. et al. 1997, Bio Techniques 23, 518-524, included in this description by reference).

In a preferred embodiment of the present invention of interest is the following nucleotide sequences include sequences encoding variable regions, the binding is formed of a related pair of sequences coding for variable regions. This sibling pair may contain one or more sequences encoding the constant region in addition to the variable regions.

In an even more preferred embodiment of the present invention are interested nucleotide sequences include sequences encoding the variable regions of immunoglobulin, the binding is formed of a related pair of sequences encoding the variable region of the light chain and the variable region of the heavy chain. This sibling pair may contain one or more sequences encoding the constant region in addition to the variable regions. In addition, this sibling pair can be extracted from the matrix obtained from a cell line of b-lymphocytes enriched from lymphocytopenia fraction of cells, such as whole blood, mononuclear cells, or leukocytes.

In the same preferred embodiment of the present invention are interested nucleotide sequences include sequences encoding the variable region of the TcR, the binding is formed sibling pair consistently the TEI, encoding the variable region α-chain and the variable region of the β-chain, or sequences encoding the variable region of the γ-chain and the variable region of δ-chain. This sibling pair may contain one or more sequences encoding the constant region in addition to the variable regions. In addition, this sibling pair can be extracted from the matrix obtained from a cell line of T-cells enriched from lymphocytopenia fraction of cells, such as whole blood, mononuclear cells, or leukocytes.

Another object of the present invention is the use of multiple RT-PCR using as the source matrix population of genetically different cells. Most of the sequences encoding heteromera proteins are the same in different cells in contrast to the sequences encoding the variable region of the binding proteins. Thus, when applying the present invention to clone these sequences coding avariablename region heteromeric proteins, it is not necessary to make an initial allocation of individual cells.

In this embodiment of the present invention several interesting non-contiguous nucleotide sequences of arbitrarily bind the method comprising amplification is Ecodom multiple RT-PCR nucleotide sequences of interest with the use of a matrix, obtained from a population of genetically different cells, and binding interest of the amplified nucleotide sequences. In addition, this method provides an optional stage to perform additional amplification related products. As in the case of the method based on individual cells, the binding can be performed using a mixture of multiple primers for elongation of the chain by overlapping used for amplification, or, alternatively, legirovaniem or recombination. The matrix obtained from a population of cells, preferably located inside the cells. The population of cells, for example, can be lysed.

Application of the method is arbitrary binding to a population of cells expressing the variable region binding proteins, allowing easier creation of combinatorial libraries of sequences coding for variable regions. The population of cells, preferably, contains cells expressing the variable region binding proteins, such as b-lymphocytes, T-lymphocytes, cells hybridoma, plasma cells, or a mixture of these cells.

The population of cells in the above embodiment, for example, can be made permeable or lysed without further purification, or matrix nucleic acid can be isolated from cells standard is time methods. Preferred is one way multiple RT-PCR. However, in this embodiment of the invention can also use the two-stage method.

The present invention also relates to a combinatorial library, including related pairs of sequences encoding the variable region of the light chain and the variable region of the heavy chain of immunoglobulin.

An effective way to improve the specificity, sensitivity and yield the execution of multiple RT-PCR and binding is performing advanced molecular amplification associated nucleotide posledovatelnostei resulting from multiple RT-PCR with subsequent linkage by ligation or recombination or by multiple RT-PCR with lengthening the chain by overlapping. Additional amplification, preferably, carried out by means of PCR using a mixture of primers for amplification of interest related sequences of nucleic acids. A mixture of primers may include external primers from a mixture of multiple primers or a mixture of multiple primers for elongation of the chain by overlapping, in particular the primers hybridizers with the 5'-end and 3'-end of the sense circuit connected sequences encoding variable regions, which allows PR is to bombard the amplification of all of the associated product. External primers can also be defined as the primers of a mixture of multiple primers for elongation of the chain by overlapping, not containing terminal segments of chain elongation by overlapping. Alternatively, for further amplification of related nucleotide sequences can be used a set of primers for breeding or palugaswewa PCR. This nested PCR is particularly effective to increase the specificity of the method, and also to increase the number of the associated product. In accordance with the purposes of the present invention palugaswewa PCR (described in the section entitled “Mixtures of primers and their creation”) is as effective as nested PCR. Thus, a desirable, albeit optional, condition for the present invention is the implementation of additional amplification using PCR related products resulting from multiple RT-PCR with lengthening the chain by overlapping or related products by ligation or recombination, using nested-PCR or palugaswewa PCR.

Additional amplification can be performed directly using a fraction or the entire product obtained by multiple RT-PCR with lengthening the chain by overlapping, the product obtained by legirovaniem or recombination fraction of any of these products is tov or partially treated related products resulting from any of these reactions, for example, by agarose gel electrophoresis and cut fragment corresponding to the estimated size of related sequences coding for variable regions. For products associated with multiple RT-PCR with lengthening the chain by overlapping, additional amplification is preferably performed directly in fractions obtained from multiple RT-PCR with lengthening the chain by overlapping, because it contributes to the binding of a separate set of sequences that were not connected during the first reaction.

Interest

Interested nucleotide sequence of the present invention can be selected from sequences encoding different subunits or domains, resulting from the expression form of the protein or part protein. Such proteins consisting of at least two non-identical subunits, known as heterodermia proteins. Heteromera proteins are present in all species. Some classes, which include such proteins include, for example, enzymes, inhibitors, structural proteins, toxins, canalobre proteins, G-proteins, receptor proteins, proteins of the superfamily of immunoglobulins, transport proteins, etc. N amidnye sequence, encoding such heteromera proteins are non-contiguous, from which it follows, for example, that they are formed of different genes or different mRNA molecules. However, the term “non-contiguous” is used in the present invention, can also refer to nucleotide sequences encoding domains of the same protein in which these domains are separated uninteresting nucleotide sequences.

In one of the embodiments of the present invention are interested nucleotide sequences include sequences encoding the variable regions of the immunoglobulin superfamily, such as immunoglobulins (antibodies), b-cell receptors and T-cell receptors (TcR). Especially interesting are the sequences encoding the variable regions of immunoglobulins. Such sequences encoding variable regions include reprezentirovanii antibodies, and Fab, an Fv, scFv fragments and combinations of fragments of the sequences encoding the variable regions, such as the hypervariable sites (CDR), J-genes, or V-genes, or combinations thereof. Generally, the present invention relates to any combination of sequences coding for variable regions, and to the combinations of their parts. In the present application examined the binding of the entire light chain with vari is belnem domain of the heavy chain. However, the present invention also relates to bind only the variable domains of the heavy and light chains forming Fv or scFv-coding sequences, or to bind the entire light chain variable region of the heavy chain constant domain region WithH1and parts of the hinge region, forming a Fab, Fab' or F(ab)2. In addition, to the variable region of the heavy chain can be added to any region domains of the constant region of the heavy chain, the result will be received versions of antitelomerase sequence or reprezentirovanii antitelomerase sequence.

In another embodiment, the present invention sequences encoding variable regions that include a sequence encoding a light chain (Kappa or lambda) immunoglobulin single type and a single sequence encoding the variable region of the heavy chain of immunoglobulin.

Also of interest are the sequences encoding the variable regions, which are derived from the T-cell receptor (TcR). Such TcR coding sequences include coding sequences for reprezentirovanii alpha - and beta-chains or gamma and Delta chains, as well as soluble TcR, or only the variable domains of the specified chain, or chain is cast proteins (for example, single αβ-chain or single γδ-chain).

Sources matrix

One of the distinctive features of the present invention is the ability to bind a nucleotide sequence derived from separate cells, a population of isogenic cells or genetically different populations of cells that have not been allocated to individual vessels. Cells used in the present invention, can be, for example, bacterial cells, yeast cells, fungal cells, insect cells, plant cells, mammalian cells or fractions of such cells. Blood cells of mammals are one example of the fraction of cells that can be used in the present invention.

Preferred hallmark of the present invention is the use of separate cells or a population of isogenic cells as the source matrix, because in this way you can avoid replacing are interested in sequences of nucleic acids, in particular sequences coding for variable regions. This is particularly important in the case, if it is desirable to obtain the initial pair of sequences encoding variable regions.

Other preferred hallmark of the present invention is aluchemie individual cells or populations of individual cells from lymphocytopenia fraction of cells, such as b-lymphocytes, T-lymphocytes, plasma cells and/or lines of these cells at different stages of development. To obtain individual cells you can also use other populations of cells expressing binding proteins of the immunoglobulin superfamily. In the present invention can also be used such cell line as a cell hybridoma, cell line b-lymphocytes or T-lymphocytes, immobilized cell line virus or cells derived from a donor that are involved in the initiation of immune responses. Faction lymphocytapheresis cells obtained from a donor, can be distinguished from natural tissues or fluids with a high content of such cells, for example from blood, bone marrow, lymph nodes, spleen tissue, tonsil tissue, infiltrates in and around tumors or inflammatory infiltrates tissue. Acceptable donor cells according to the present invention can be vertebrates with acquired immune system. Donors may be individuals, not previously subjected to any impact or hyperimmunization against the desired target. To highlight antigenspecific proteins with binding specificity to a specific target, are preferred hyperimmunization donors. Such hyperimmunization donors can be the donor, immunized with the target antigen or fragments, recovering or sick individuals, who have a natural immune response to the antigen target, such as individuals suffering from autoimmune diseases, cancer or infectious diseases, such as HIV-infected individuals, individuals suffering from hepatitis a, b or C, severe acute respiratory syndrome (SARS) and the like, or individuals with chronic diseases.

When using recombinant proteins for therapeutic purposes, it is desirable that they were selected from sequences, characterized by species identity with the subject of the treatment of the individual (for example, for the treatment of people should be used by the human sequence). First of all, because recombinant proteins isolated from an alien sequence (i.e. non-human)will be recognized by the immune system resulting in immune response involving polyclonal antibellum antibodies. These antibully antibodies can block the action of the medicinal product, taking an active website, speed up the excretion of drugs and cause harmful reactions, such as allergic reactions with repeated exposure.

Immunogenicity, however, can also N. blogatize in cases when a recombinant protein selected from the sequence, characterized by species identity. This immunogenicity, for example, can be induced post-translational modifications, which may differ from the observed in vivo. Combinatorial libraries of sequences encoding variable regions can also cause immunogenicity, as they are created in vitro arbitrary pairs of sequences coding for variable regions. Rules governing the formation in vivo of pairs of sequences encoding heavy and light chains of antibodies (or T-cell receptors), have not yet been fully explored. From the above it follows that some educated in vitro pairs can be recognized by the immune system as foreign, even if both sequences, forming a pair, belong to the man. Binding proteins obtained from libraries of related pairs, on the other hand, do not form such anomalous combinations and are therefore potentially less immunogenic than binding proteins derived from combinatorial libraries. This does not mean that the products derived from combinatorial libraries, not suitable for treatment, they just require more careful monitoring in order to detect the above-mentioned side effects.

In accordance with the present invention donors to etoc preferably should refer to the same biological species, as individuals under treatment products derived from the corresponding nucleotide sequences of the present invention. Donor cells is preferably pet, pet, person or transgenic animal. Transgenic animals carrying the loci of human immunoglobulin, as described in U.S. patent No. 6111166 and publishing Kuroiwa, Y. et al. Nature Biotechnology; 2002; 20:889-893. Such transgenic animals can produce human immunoglobulins. Thus, a fully human antibodies against a specific target can be obtained by conventional methods of immunization such transgenic animals. This allows you to create libraries that encode binding proteins having specificity against more difficult targets, such as antigens person in respect of which the person is missing or there is limited natural humoral immune response. Similarly can be generated transgenic animals that produce the T-cell receptors of the man.

In another embodiment, the present invention lymphocytopenia fraction of cells consists of whole blood, bone marrow, mononuclear cells, or leukocytes obtained from a donor. Mononuclear cells can be isolated from blood, bone marrow, lymph nodes, spleen, INF is litrato around cancer cells and inflammatory infiltrates. Mononuclear cells can be isolated by the methods of centrifugation in density gradient, such as gradients ficoll. When selecting mononuclear cells from tissue samples destroy the fabric used to perform centrifugation in a density gradient. Tissue can be destroyed by mechanical methods, such as, for example, grinding, electroporation and/or chemical methods, such as processing enzymes. Leukocytes can be distinguished directly from donors using leukapheresis. In the present invention can also be used as crude drugs bone marrow or tissue that contains lymphocytes. Such drugs must be destroyed, for example, by the methods described above to facilitate the distribution of individual cells.

Another distinguishing feature of the present invention is the enrichment lymphocytopenia fraction of cells, for example, whole blood, mononuclear cells, white blood cells or bone marrow, in relation to a specific population of lymphocytes, such as cell lines of b-lymphocytes or T-lymphocytes. Enrichment of b-lymphocytes can be produced, for example, by sorting cells by the method of magnetic granules or sorting cells with excitation fluorescence (FACS), using specific to this line of marker proteins on the cell surface, such as CD19 or the other markers, specific to the line b-cells. Enrichment of T-lymphocytes can be produced, for example, using the cell surface marker, such as CD3, or other markers that are specific to a line of T-cells.

Preferred hallmark of the present invention is an additional sort of enriched b-lymphocytes to obtain plasma cells prior to the distribution of individual cells in multiple vessels. Plasma cells are usually isolated by sorting by FACS method using surface markers, such as CD38, possibly in combination with CD45. In addition, you can use other surface markers that are specific for plasma cells, or combinations thereof, such as CD138, CD20, CD21, CD40, CD9, HLA-DR or CD62L, and the choice of marker depends on the source plasma cells, such as tonsil, blood, or bone marrow. Plasma cells can also be distinguished from unenriched lymphocytopenia population of cells derived from any of the foregoing sources. Plasma cells isolated from the blood, sometimes called early plasma cells or lymphoblasts. In the present invention, these cells are also referred to as plasma cells, although they are CD19-positive cells in contrast to plasma cells residing in the bone marrow. To highlight related the x pairs of sequences, encoding immunoglobulins, it is preferable to use plasma cells, as a higher frequency of occurrence of these cells produce antigen-specific antibodies, which reflect the acquired immunity to the target antigen, the majority of these cells have undergone somatic spermatazoa and therefore encodes a high-affinity antibodies. In addition, plasma cells increased the mRNA levels compared with the rest of the population of b-lymphocytes, allowing reverse transcription is more efficient with the use of a single plasma cells. Alternatively, the allocation of plasma cells from lymphocytopenia fraction of cells can be distinguished In-memory cells using the cell surface marker, such as CD22.

Alternative distinctive feature of the present invention is the selection enriched In lymphocytes against antigenic specificity to the distribution of cells in several vessels. Antigen-specific b-lymphocytes are selected, by contacting the enriched b cells with the desired antigen or antigens, resulting in the binding of the antigen with surface immunoglobulin and the subsequent allocation of related cells. The above selection can be made by drawing on magnitnye granules of the desired antigen or antigens and by sorting cells by the method of magnetic granules, FACS, the introduction of antigens into the column and perform affinity chromatography, screening filter or other methods known in this field. If desired, the selection for antigenic specificity can be subjected to plasma cells and b-lymphocytes, unenriched mononuclear cells, white blood cells, whole blood, bone marrow or tissue preparations.

Another distinguishing feature of the present invention is the sort of enriched T-lymphocytes (e.g., CD3-positive cells) using surface markers CD45R0 and/or CD27 to obtain fractions of T-cell memory. T-lymphocytes can also be selected to reflect MHC-antigenic specificity, using complexes of MHC-peptide (see, for example, publications Callan, M.F et al. 1998, J. Exp. Med. 187, 1395-1402; Novak, E.J. et al. 1999, J. Clin. Invest. 104, R63-R67).

Another distinguishing feature of the present invention is immortality any of the above selected fractions of cells (for example, b-lymphocytes, plasma cells, memory cells or T-lymphocytes). Immortality may be, for example, performed using the Epstein - Barr (Traggiai, E. et al., 2004, Nat. Med. 10, 871-875) before distribution of cells in test tubes. Alternatively, separate cells can be immortality and reproduced to perform reverse transcription. (Traggiai et al., Nat. Med. 2004, Aug.; 10(8):871-5).

Another difference is inim characteristic of the present invention is the distribution of the population of the desired cells (e.g., cells hybridoma, cell lines of b-lymphocytes or T-lymphocytes, cells, whole blood, bone marrow cells, mononuclear cells, leukocytes, In-limfotsitov, plasma cells, antigen-specific b-lymphocytes, b-cells memory T-lymphocytes, antigen/MHC-specific T-lymphocytes or T-cell memory in several vessels to obtain separate populations of cells. The selection of individual cells refers to the physical separation of the cells from the cell population so that one vessel was one cell, or causing cells to micrometric, chip or gel matrix with individual cells. Cells can be divided directly into several adjacent vessels by the method of limited cultivation. The vessels used in the present invention, preferably, similar to vessels used to perform PCR (for example, tubes for CR, 96-well or 384-well plates to CR or larger arrays of vessels). However, you can also use other vessels. When the distribution of individual cells in a large number of individual vessels (e.g., 384-well tablets) get a population of individual cells. The distribution can be produced by metered injection of a certain amount in a separate vessel, in which the average concentration of cells is equal to one of 0.5 ili,3 cells, in the result that receive vessels, on average containing one cell or less. Because the distribution of cells by the method of limited cultivation is a statistical method, the vessel is empty, the majority of vessels will contain one cell and a small part of the vessels will contain two or more cells. When placed in a vessel of two or more cells may occur some permutation sequences coding for variable regions of cells present in the vessel. However, since this result is not significant, it will not affect the General applicability of the present invention. In addition, the combination of sequences encoding variable regions that do not have the required affinity and binding specificity, apparently, will not be selected and therefore will be excluded in the screening process. Therefore, minor cases of permutation sequences are not expected to significantly affect the final library of the present invention.

There are alternatives to distribution of cells by the method of limited cultivation, such as cellular artery, such as FACS or robots that can be programmed to the exact distribution of individual cells in separate vessels. Such alternative methods are more preferable as they are less cumbersome and more efficient to achieve a homogeneous distribution of individual cells in separate vessels.

The above methods of beneficiation, sorting, and selection of cells perform so that most of the cells remained intact. The destruction of cells during enrichment or sorting can lead to permutation sequences coding for variable regions. However, this problem should not have serious consequences, as it is assumed that the frequency of cell disruption is low. Due to leaching and possible treatment of the cells with RNase prior to their distribution in separate vessels will remove any RNA released from cells.

In addition, when reading the above description of the distribution of the cells to obtain a population of individual cells in several individual vessels this requirement cannot be interpreted as absolutely essential distinguishing characteristic, pursuant to which each vessel must be one cell. The above symptom rather suggests that in most vessels must be individual cells, such as the number of vessels with two or more cells is less than 25% of the total number of distributed cells or even less than 10%.

Another distinguishing feature of the present invention is to perform reverse transcription using the matrix obtained from cells distributed one by one in several what about the vessels.

In accordance with the purposes of reverse transcription (RT) of the present invention the nucleic acid in a separate cage, which should serve as a source matrix for RT, must be obtained from a single cell, although they need not, must be separated from the rest of the contents of this individual cells.

After the final distribution of individual cells for individual vessels of individual cells can be multiplied to obtain a population of isogenic cells to perform reverse transcription. This increases the output of the mRNA used as a matrix, which can be important when amplification and binding of rare targets. However, the cells must remain genetically identical in respect of the target genes during reproduction. Isolated cells or a population of isogenic cells may be intact or lysed, if it does not degenerate matrix for reverse transcription. The cells preferably are lysed to facilitate subsequent reverse transcription and amplification by PCR.

In another embodiment, the present invention describes the method of multiple RT-PCR c elongation of the chain by overlapping or multiple RT-PCR with subsequent linkage by ligation or recombination can also be performed on the matrix obtained from genetices the different populations of cells, which were not allocated to individual vessels and remain together in the form of a pool of cells. The method can be used to create combinatorial libraries. This method does not require the distribution of individual cells. However, cells that can be used in the implementation of this method should be similar to the cells used in the method using separate cells, and represent, for example, the population (pool) assorted b-lymphocytes or T-lymphocytes. When performing single-stage multiple RT-PCR with lengthening the chain by overlapping one or multiple RT-PCR with subsequent linkage by ligation or recombination in such a population of cells, it is desirable to lyse the cells prior to the reaction, if desired, from the lysate can be allocated total RNA or mRNA.

The sensitivity of the single-stage multiple RT-PCR with lengthening the chain by overlapping the present invention allows to use a very small amount of matrix. As shown in examples 2 and 3, one-step multiple RT-PCR with lengthening the chain by overlapping can be performed on the matrix, the number of which corresponds to a lysate of a single cell.

A mixture of primers and their creation

A mixture of primers of the present invention include at least even the re primer, forming sets of primers containing two primers each, which are able to amplify at least two different interest specified sequence. A mixture of two or more such sets of primers to form a mixture of multiple primers. The mixture of multiple primers, preferably, contains at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150 sets of primers (primer pairs). In particular, amplification of sequences encoding variable regions, separate sets of primers in the mixture of multiple primers contain more than two primers. A separate set of primers, preferably, contains at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280 or 300 primers. The total number of primers in the mixture of multiple primers, preferably, is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 45, 50, 60, 70, 80, 90, 100, 125, 150 or 200 and at most 225, 250, 275, 300, 325, 350, 375 or 400 primers.

All the primers of the present invention contain a gene-specific region, and, preferably, all of the primers optionally have a terminal segment at the 5'-end primer, 5'end non-coding sequence that is fused with the 3'-end of the gene-specific part of the primer. This concavo the segment of the primer contains from about 6 to 50 nucleotides, but if desired, may be longer. In the process of amplification of the end segments of the primer attached to a given sequence.

The end segments of the primer of the present invention are, for example, cloning and connecting terminal segments, the end segments adapted to associate legirovaniem, terminal segments, adapted to bind recombination, or terminal segments of chain elongation by overlapping.

Cloning of the end segments may contain 6-20 or more nucleotides and contain restriction sites and/or recombination sites, which can be used to insert the linked product in an appropriate vector.

To link legirovaniem sets of primers in the mixture of multiple primers create so that one part (the principal or the reverse primer of the first primer set was connecting terminal segment containing the restriction site, which is the splitting must be compatible with the restriction site located at the connecting end segment of one of the second set of primers. To link more than two given sequences of the second part of the second set of primers contains a restriction site, which is the splitting must be compatible with the restriction site, located in one the first part of the third set of primers. The second restriction site located in the second set of primers should be compatible with the above restriction site of the first set of primers. These create sets of primers can bind a significant number of given sequences. In predetermined sequences should be selected rare or even missing restriction sites. In addition, it is desirable that the compatible restriction sites were not identical, to the site of ligation was resistant to cleavage of certain used restriction enzymes. Due to this response should be directed to the binding of the first sequence with the second sequence, since the relationship between identical to the given sequence will be split restriction enzymes. Acceptable pairs of restriction enzymes cut sites are, for example, SpeI and XbaI (alternative NheI or AvrII can replace one or both of these enzyme), NcoI and BspHI, EcoRI and MfeI or > PST and NsiI. To implement binding SpeI can be, for example, in the first sequence, XbaI may be in the second sequence, NcoI may be located at another end of the second sequence, BsHI can be in the third sequence and so on. To further what about facilitate it is desirable to use the restriction enzymes in a single buffer.

To link recombination sets of primers in the mixture of multiple primers can be, for example, created in accordance with the description given in the article Chapala (Chapal, 1997, Bio Techniques 23, 518-524), which is incorporated in this description by reference.

For binding interest nucleotide sequences on the same stage with amplification method multiple PCR at least one primer in each primer set mixture of multiple primers add end segments adapted for PCR with lengthening the chain by overlapping, resulting receive a mixture of multiple primers for elongation of the chain by overlapping.

Leaf segments of chain elongation by overlapping are usually longer, including from 8 to 75 nucleotides, and may contain restriction sites or the sites of recombination, which provide subsequent insertion of regulatory elements such as promoters, binding sites of the ribosome, the termination sequence or linker sequences, such as, for example, scFv. Terminal segment of chain elongation by overlapping may also optionally contain a termination codon. Usually there are three types of end segments of chain elongation by overlapping, as shown in figure 1. Leaf segments of chain elongation by perekryvaniya I in the two sets of primers overlap each other. All the nucleotides of the two end segments of chain elongation by overlapping are not necessarily complementary to each other. In accordance with one object of the present invention are complementary to the nucleotides are 60-85% of the end segment of chain elongation by overlapping. In the end segments of chain elongation by overlapping type II 4-6 5'-terminal nucleotides are complementary to the gene-specific region adjacent sequence. In the end segments of the chain-extending overlapping type III all overlapping nucleotides are complementary to the adjacent sequence. Leaf segments of chain elongation by overlapping type I and II are preferred in subsequent introduction of regulatory and similar elements between the associated predetermined sequences. Leaf segments of chain elongation by overlapping type II are preferred, if the specified sequence must be bound to a specific linker, as in the case of scFv. Leaf segments of chain elongation by overlapping type III are preferred, if the specified sequence must be connected to each other in a frame are read.

The creation of the end segments of chain elongation by overlapping depends on the distinctive characteristics serial is ness, such as length, relative GC content (GC%), the presence of restriction sites, palindromes, melting point, gene-specific part with which they are associated, and so the length of the end segments of chain elongation by overlapping must be equal 8-75 nucleotides, preferably 15-40 nucleotides. The length of such segments, more preferably equal 22-28 nucleotides. The use of very long terminal segments of chain elongation by overlapping (50-75 nucleotides) may contribute to the binding of the products produced by each primer set. However, when using very long terminal segments of chain elongation by overlapping it is necessary to adjust the ratio between the length of the end segment of chain elongation by overlapping and gene-specific region. Select GC% depends on the length of the end segment of chain elongation by overlapping. As the shorter end segments have a smaller area, in cases where they are complementary, you have a higher GC% for increased engagement than using the longer end of the segments. You must comply with the other principles of the creation of the primers, for example, should mininterval dimerization of primers and education “studs”. Primers should not cause a false initiation. In addition, the known, that Taq DNA polymerase often adds adenosine (A) to 3'-end of the newly synthesized DNA chain, and this should be taken into account when creating an end segment of chain elongation by overlapping by adapting end segments of chain elongation by overlapping to amatriciana the addition of adenosine to the 3'-end.

The choice of primers, bearing connecting end segment, for example, the end segment of chain elongation by overlapping, the end segment adapted to associate legirovaniem, or end segment adapted to associate recombination determines the order and direction of the binding defined sequence. For the present invention whether the primers having a connecting end segment, the main or reverse primers in the primer set or perhaps both upper and lower primers. However, this issue requires attention, as the order and direction given sequences in the final product may have a certain value, for example, to insert regulatory elements such as promoters and termination sequences, or to associate a separate set of sequences within the reading frame.

To link two places nucleotide sequences connecting end segment can the be added to reverse or basic primers in each primer set, used for amplification by PCR of each sequence. The present invention describes the addition of end segments of chain elongation by overlapping and end segments adapted to associate legirovaniem, the main primers for VNand VLin each set (see respectively figure 1 and example 9). In this case, linking products occurs in the direction from 5'-end to the 5'-end (head segment with a head segment and a bidirectional link). However, the connecting end segments can also be added to the reverse primers in each set (for example, primers for Ctoand/or Cλin the first set and the primers for CHor JHin the second set). In this case, linking products occurs in the direction from the 3'-end to 3'-end (limit segment end segment and a bidirectional link). The third option is to add a connecting end segments to the reverse primer in the first primer set (for example, primers for Ctoand/or Cλand to basic primer in the second primer set (for example, primers for VN) or Vice versa. Thus, receive orientation in the direction from the 3'end to the 5'-end (head segment end segment and a one-way binding). Figure 3 shows a possible healthy lifestyles the tion, which can be obtained depending on which of the primers in each primer set are connecting end segment.

When linking more than two nucleotide sequences of interest in some sets of primers connecting end segments should be as basic and reverse primers, with one end segment is complementary terminal segment preceding set of primers and the other end segment is complementary to one of the primers in the following set of primers. This principle should be followed in respect of all sets of primers used for amplification of the specified sequences, designed to link between two other specified sequences.

When creating a gene-specific part of the primer is usually required to observe the rules of creation of primers, such as to minimize dimerization of primers education “studs” and non-specific hybridization. In addition, it is necessary to avoid several of the nucleotides G and C as 3'-end. The melting temperature (TM) gene-specific regions in the set of primers preferably should be the same plus/minus 5°C. In the present invention the desired values of TM in the range from 45°C to 75°C, while for most applications the deposits are optimal values TM of about 60°C. Primer may be initially created using computer programs designed to perform this task. However, the generated primers usually require laboratory validation and optimization. This check can be performed by analyzing the size and length polymorphism fragments (RFLP) and Sequeira amplification products obtained using the generated sets of primers. You can successfully use degenerate positions in the primers for the amplification of sequences from the variable regions or to search for new members of the family belonging to the specified class of proteins. The number of degenerate positions may also require optimization.

The present invention relates to improved sets of primers that can be used together in very complex mixtures. As a basis we used the primer set described in the publication de Haard (de Haard, H.J. et al., 1999, J. Biol. Chem. 274, 18218-18230), which was modified by trimming the 3'ends of the primers to reduce nonspecific interactions and add a leaf segments of chain elongation by overlapping or end segments adapted to associate legirovaniem.

One of the distinctive features of the present invention is a mixture of primers comprising at least two sets of p is amerov, able to initiate amplification and to stimulate the binding of at least two nucleotide sequences of interest. A mixture of primers of the present invention can initiate the amplification of at least two subunits or domains heteromeric proteins, for example belonging to the class of enzymes, inhibitors, structural proteins, toxins, canalobre proteins, G-proteins, receptor proteins, proteins of the superfamily of immunoglobulins, transport proteins, etc.

Another distinguishing feature of the present invention is a mixture of multiple primers for elongation of the chain by overlapping, including sets of primers, in which at least one primer in each primer set has an end segment of chain elongation by overlapping capable of hybreed end segment of chain elongation by overlapping one primer in a different primer set.

Leaf segments of chain elongation by overlapping makes it possible to immediately interested in linking nucleotides during amplification method multiple PCR elongation of the chain by overlapping due to the fact that each product produced using sets of primers is added to the end segment, complementary to the attached product. From the foregoing, however, Nasledie, that binding will occur during the first amplification by PCR. Depending on the nature of the reaction much of the actual binding may occur during the additional amplification using external primers used in the first amplification by PCR (amplification method multiple PCR).

Another distinguishing feature of the present invention is a set of primers designed for amplification of a family of nucleotide sequences containing the sequences encoding the variable regions. Examples of such families are Kappa light-chain (e.g., VKI-VI in humans), lambda light-chain (e.g., VL1-10 in humans) and variable regions of the heavy chains (for example, VH1-7 in humans and VH1-15 in mice) of immunoglobulins, as well as varibale α-, β-, γ - or δ-chains R. A set of primers for amplification of a family of nucleotide sequences comprising sequences encoding variable regions, often includes several primers, some of which may be degenerate primers. Amplification of sequences encoding the variable region of the light chain families of immunoglobulins, for example, performed using a primer set containing multiple primers complementary to the 5'-end of the variable region of Kappa-chain(primer for V LK)or leader sequence Kappa-chain (primer for VLL) and/or lambda chain (primer for V)or leader sequence of the lambda chain (primer for VLλL) (basic primers), along with several primers for the constant region of Kappa-chain (primer for Cto) and/or lambda chain (primer for Cλ) (reverse primers). Alternative primers for connecting region of the light chain primers for JLKand/or Jcan be used as reverse primers instead of the primers for the constant region. Alternative basic primers hybridizing area UTR, the previous leader sequence of the variable region of the light chain. Sequence encoding the variable region of the heavy chain families immunoglobulins can also be amplified using a single primer set using different combinations of primers. For example, several primers complementary to the 5'-end of the variable region of the heavy chain (primer for VN) or leader sequence of this region (primer for VHL) (basic primers)can be used together with multiple primers for connecting region of the heavy chain (primer for JN) or primers for the constant region of the heavy chain (reverse primers). Primer for the Nmay be the isotype-specific, and in principle you can use any primer for CN(for example, CH1WithH2WithH3orH4), and primer, which will allow you to get reprezentirovannoe heavy chain. Alternatively, the basic primers hybridizing area UTR, the previous leader sequence of the variable region of the heavy chain.

Using basic primers hybridizers with leader sequence instead of the 5'-end of the variable regions, is particularly useful for the detection of cross-hybridization of the primers for the variable region, as mutations that arise due to cross-hybridization will be removed from the target protein due to the cleavage of the leader sequence during processing of the protein inside the cell. In example 9 describes creating primers for leader sequences of the variable regions of the heavy chain and Kappa light-chain antibodies. That the site of initiation is in the 3'-end sequence that encodes a leader sequence (C-terminal)is an advantage compared to previously known primers for the leader sequence of the antibody, since it allows you to transfer amplificatoare sequences between bacterial and eukaryotic expressing vecto the AMI with obtaining functional leader sequences in both systems. The system described in example 9, can be easily applied to a light lambda chain antibodies, as well as α-, β-, γ - or δ-chains R.

One of the distinctive features of the present invention are primers, hybridizers c 3'-end sequence that encodes a leader sequence that is preceded by a sequence that encodes a variable region, and their use for amplification of sequences encoding variable regions.

Preferred hallmark of the present invention is the use of primers, characterized by at least 90% sequence identity (preferably at least 95% identity) with gene-specific region of SEQ ID NO:86-92, which correspond to primers, hybridisation with the end of the sequence encoding the leader sequence of the heavy chain (primer for VHL). Gene-specific sequence listed SEQ ID NO corresponds to the 18-th base in the direction of the 3'-end of these sequences (see also table 11).

Other preferred hallmark of the present invention is the use of primers, characterized by at least 90% sequence identity (preferably at least 95% identity) with gene-specific region of SEQ IDNO:93-98, which correspond to primers, hybridisation with the end of the sequence encoding the leader sequence of the Kappa light-chain (primer for VLL). Gene-specific sequence listed SEQ ID NO corresponds to the 25-th base in the direction of the 3'-end of these sequences (see also table 11).

In one embodiment of the present invention a mixture of multiple primers for elongation of the chain by overlapping used to perform multiple PCR elongation of the chain by overlapping and possibly for the implementation stage of reverse transcription, also includes (a) at least one primer for CLor JLcomplementary semantic chain sequences, the coding region of the light chain of the immunoglobulin; b) at least one 5'-terminal primer for VLor primer for the leader sequence of the VLcomplementary antisense chain sequence that encodes a variable region of the light chain of the immunoglobulin, and capable of forming a primer set with the primer under paragraph (a); (C) at least one primer for CHor JHcomplementary semantic chain sequence encoding the constant domain of the heavy chain of the immunoglobulin or the connecting region of the heavy chain; and (d) at least one 5'-to zeway primer for V Hor primer for the leader sequence of the VHcomplementary antisense chain sequence that encodes a variable region of the heavy chain of the immunoglobulin, and capable of forming a primer set with the primer under paragraph (C).

Sets of primers according to the present invention, for example, can be represented as VLK+ CtoV+ CλVLK+ JLKV+ JVLL+ CKVLλL+ CλVLL+ JLKVLλL+ JVH+ JHVH+ CHVHL+ JNVHL+ CNor combinations thereof, capable of amplifying the target specified sequence encoding a variable region.

In another embodiment of the invention used primers for CL(JL) and the primers for VL(VLL)adapted to amplify a sequence comprising the variable region of the light Kappa-chain or variable region of the light lambda chain.

In a preferred embodiment of the present invention used primers for CL(JL) and the primers for VL(VLL)adapted to amplify sequences encoding the variable regions as Kappa light chain and lambda light chains.

In an even more preferred embodiment, Khujand is the implementation of the present invention used basic primers for amplification of light chain V LLcharacterized by at least 90% sequence identity (preferably at least 95% identity) with gene-specific region of SEQ ID NO:93-98, and basic primers for amplification of heavy chain VHLcharacterized by at least 90% identity (preferably at least 95% identity) with gene-specific region of SEQ ID NO:86-92.

In another embodiment of the present invention, the primers for VL/VLLand VH/VHLimmunoglobulin have connecting end segments, preferably in the form of complementary end segments of chain elongation by overlapping. These primers allow to obtain sequences encoding the variable regions, which are connected in the direction of the head segment, the parent segment. For binding sequences encoding variable regions, in the direction of the head segment, the end segment primers for CL/JLand VH/VHLcontain connecting end segments or primers for VL/VLLand CH/JHcontain connecting end segments preferably in the form of complementary end segments of chain elongation by overlapping. For binding sequences encoding variable regions, in the direction of “limit segment end segment primers for C L/JLand CH/JHhave a connecting end segments preferably in the form of complementary end segments of chain elongation by overlapping (figure 3).

Mixture of multiple primers, including a mixture of multiple primers for elongation of the chain by the overlapping of the present invention, include two sets of primers. Thus, a mixture of multiple primers includes at least four different primers. In accordance with another object of the present invention a mixture of multiple primers includes more than four different primers. The mixture of multiple primers of the present invention is used to amplify the set of sequences in a single vessel. For example, in one vessel, it is possible to amplify all variable region of Kappa-, lambda-chains and heavy chains. One mixture of multiple primers of the present invention contained 16 different degenerate primers, distributed as follows: eight primers for VHone primer for CH1six primers for VLKand one primer for Cto(figure 2). Another set of primers consisted of 19 degenerate primers, distributed as follows: eight primers for VHfour primer for JHsix primers for VLKand one primer for Cto. The third set of primer is included in 22 of degenerate primers, distributed as follows: eight primers for VHone primer for CH1eleven primers for Vand two primers for Cλ. The fourth set of primers consisted of 27 degenerate primers, distributed as follows: eight primers for VHone primer for CH1six primers for VLKone primer for Ctoeleven primers for Vand two primers for Cλ.

The present invention also relates to primers for additional amplification method CR related products, obtained using multiple RT-PCR with subsequent linkage by ligation or recombination or by multiple RT-PCR with lengthening the chain by overlapping. Additional amplification by PCR can be performed using a mixture of primers adapted to amplify corresponding set of sequences. This mixture of primers may contain external primers mixture of multiple primers or a mixture of multiple primers for elongation of the chain by overlapping, which are primers, hybridizers with the extreme 5'-end and 3'-end of the sense circuit related nucleotide sequences, making it possible to amplify all of the associated product. One example of primers that can be used in ka is este external primers in the present invention, are the primers for Cto/Jtoand/or Cλ/Jλforming a primer set with the primer for JNorN. Additional amplification is usually to increase the number of linked product obtained by multiple RT-PCR with subsequent linkage by ligation or recombination or multiple RT-PCR with lengthening the chain by overlapping.

Alternatively, for further amplification of related nucleotide sequences can be used a set of primers, which is nesting in comparison with the external primers used for the execution of the primary reaction of multiple RT-PCR or multiple RT-PCR with lengthening the chain by overlapping. In the present invention, this primer set is called nested set of primers. Nested primers is usually created in accordance with the same rules as previously described gene-specific primers, except that they initiate the 3'end in the position of hybridization of the external primers used in multiple RT-PCR or multiple RT-PCR with lengthening the chain by overlapping. Therefore, the product resulting from the execution of the nested PCR, is shorter than the linked product obtained by multiple RT-PCR with subsequent binding of PU is eat ligation or recombination or multiple RT-PCR with lengthening the chain by overlapping. In addition to increasing the number of the associated product nested PCR is also used to increase the overall specificity, especially the method of multiple RT-PCR with lengthening the chain by overlapping. However, it should be noted that not all of the above mixture of multiple primers/mix multiple primers for elongation of the chain by overlapping suitable for use in combination with the nested primer set with the additional amplification. In such cases, additional amplification is possible to use an external primers mixture of multiple primers/mix multiple primers for elongation of the chain by overlapping or perform polygnostou PCR, which is described below.

In one of the embodiments of the present invention as nested primers for additional amplification of related sequences coding for variable regions of immunoglobulin, using primers for JLand JH.

Nested sets of primers according to the present invention may also include reverse (or main) external primers from the first mix of multiple primers/mix multiple primers for elongation of the chain by overlapping and second nesting mixture of primers that initiate the 3'end in the position of hybridization of the main (or the reverse) external p is amerov first mixture of multiple primers/mix multiple primers to increase the chain by overlapping. The use of such a primer set for further amplification by PCR is known as palugaswewa PCR. Palugaswewa PCR may be performed, for example, if it is difficult to create a nested primer in one specific area, for example, sequences encoding variable regions (primers for V and J), as this primer should hybreed with hypervariable sites (CDR). In addition, polygnostou PCR can be used in cases where it is desirable to keep intact one end of related sequences, for example, to clone.

In accordance with one of the distinguishing features of the present invention, the sequence encoding the constant region of light chain, remains intact in the process additional amplification. (Reverse) primers for CLused for additional amplification, only slightly modified in comparison with the external primers used for the primary reaction (multiplex RT-PCR or multiple RT-PCR with lengthening the chain by overlapping). The modification involves adding a few bases to the 3'-end primers for CLused for the primary amplification. In addition, to brood primers for CLcan be added another clone end segment. Main Prime the market, used for additional amplification, are fully nested in comparison with the external primers specific for the constant region of the heavy chain used in the primary reaction. The combined use of external primers in the primary reaction and slightly modified nested primers for CLtogether with a fully nesting basic primers in the reaction, additional amplification increases specificity, comparable to that achievable with the implementation of nested PCR using the fully nested primer set.

In a preferred embodiment of the present invention nested PCR performed using primers for JNand modified primers for CLto 3'-end which add from 2 to 10 gene-specific base pairs compared to the first primers for CLin a mixture of multiple primers/mix multiple primers for elongation of the chain by overlapping.

Optimization of multiple PCR elongation of the chain by overlapping

The parameters of multiple PCR elongation of the chain by overlapping as in the two-stage method and one-step method can be optimized in several ways (see, for example, publish, Henegariu, O. et al. 1997, BioTechniques 23, 504-511; Markoulatos, P. et al. 2002, J. Clin. Lab. Anal. 16, 4-51). Usually in multiple RT-PCR using the same optimized parameters, although the ratio between the outer and inner primers is less important for this reaction.

A. The concentration of primers

The concentration of primers having a terminal segment of chain elongation by overlapping (for example, primers for VNand VL), is preferably lower than the concentration of the external primers that do not have an end segment of chain elongation by overlapping (for example, primers for JHand Kappa-chain).

If one of the specified sequences amplificates less effective than the other sequences, for example as a result of higher values of GC%, it is possible to balance the efficiency of amplification. This result can be obtained by increasing the concentration of the primer set, which is less efficiently mediates amplification, or reducing the concentration of the other set of primers. For example, the sequence encoding the variable region of the heavy chain are of higher value GC% and therefore lower efficiency of amplification compared to the variable regions of the light chain. From the above it follows that the primer for VLshould be used in lower concentrations than primer for VH.

In addition, when using the a large number of primers may be a problem with determining the total concentration of the primers. The upper limit is determined experimentally by titration. For PCR system “AmpliTaq Gold” company Applied Biosystems upper limit of the concentration of all oligonucleotides is set equal to 1.1 μm, while for other systems, the upper limit can reach 2.4 μm. This upper limit of the concentration of all oligonucleotides affect the maximum concentrations of individual primers. Too low concentration of the individual primer causes poor sensitivity of PCR.

It was also found that the quality of the oligonucleotide primers is essential for multiple PCR elongation of the chain by overlapping. The best results were obtained using oligonucleotides, HPLC purified.

b. The conditions of the cyclization PCR

The cyclization conditions are preferably the following values:

Denaturation10-30 sec94°C
Hybridization30-60 sec50-70°CAbout 5°C below TM of primers
Lengthening chain1 min x EPL65-72°CEPL refers to the expected length about the ukta in KBP
The number of cycles30-80
Final lengthening chain10 min65-72°C

For one-step multiple RT-PCR with lengthening the chain by overlapping the program cyclization were introduced following the stage before the above cyclization amplification:

Reverse transcription30 min42-60°CThese terms are also used when performing a separate reverse transcription
Activation of the polymerase10-15 min95°CPolymerase, a heat-activated, are preferred in one-step RT-PCR. Activation is performed in accordance with the manufacturer's instructions

All of the above parameters can be optimized. Especially important is the temperature of hybridization. Thus, all of the individual sets of primers that should form the final mixture of primers must be tested separately to install the Optima is inuu temperature and time of hybridization, as well as the time of elongation and denaturation. Because of this, you will define a range within which these parameters can be optimized for a mixture of multiple primers for elongation of the chain by overlapping.

Problems associated with poor sensitivity of PCR, for example, due to the low concentration of primers or matrix can be overcome by using a large number of thermal cycles. A large number of thermal cycles includes 35-80 cycles, preferably about 40 cycles.

In addition, longer extension chain can improve the effectiveness of multiple PCR elongation of the chain by overlapping. Long chain elongation is 1.5-4 minutes x EPL compared to the normal time of chain elongation equal to 1 minute.

C. the Use of adjuvants

The reaction efficiency of multiple PCR can be significantly improved by using a Supplement for PCR, such as DMSO, glycerol, formamide or betaine, which relaxes DNA and thereby facilitate denaturation of the matrix.

d. dNTP and MgCl2

The quality and concentration of deoxynucleotides (dNTP) are important for multiple CR with lengthening the chain by overlapping. The best concentration of dNTP is 200 to 400 μm each dNTP (dATP, dCTP, dGTP and dTTP), above which there is a rapid inhibition amplif the requirements. Lower concentrations of dNTP (100 μm each dNTP) are sufficient for amplification method CR. Stocks dNTP sensitive to the cycles of thawing/freezing. After three to five cycles of multiple PCR is often ineffective. To avoid such problems, you can get a small aliquots dNTP and keep them frozen at -20°C.

Optimization of the concentration of Mg2+is important, as most of the DNA polymerase is magnetovolume enzymes. In addition to DNA polymerase, Mg2+bind the primers for matrix DNA and dNTP. Therefore, the optimal concentration of Mg2+will depend on the concentration of dNTP, DNA templates and composition of buffer for sample. If the primers and/or buffers for DNA templates contain chelators, such as EDTA or EGTA, the optimal concentration of Mg2+it can be changed. Excessive concentration of Mg2+stabilizes the double chain DNA and prevents complete denaturation of the DNA, resulting in reduced product yield. Excessive concentration of Mg2+can also stabilize false hybridization of the primer with the wrong sites of the matrix, which reduces the specificity. On the other hand, insufficient concentration of Mg2+reduces the amount of product.

A good balance between dNTP and MgCl2approximately 200-400 μm dNTP (each) 1.5-3 mm MgCl .

that is, the concentration of the buffer for CR

The buffers on the basis of KCl usually satisfy the requirements of multiple CR with lengthening the chain by overlapping; however, the buffers on the basis of other components, such as (NH4)2SO4, MgSO4, Tris-HCl, or combinations thereof can also be optimized for use in multiple PCR extension chain closing. Pairs of primers that are involved in the amplification of longer products that operate better at lower salt concentrations (e.g., 20-50 mm KCl), while pairs of primers involved in the amplification of short products seem to work better at higher salt concentrations (e.g., 80-100 mm KCl). A twofold increase in the concentration of the buffer instead of a one-time increase can improve the effectiveness of multiple responses.

f. DNA polymerase

The present invention is described on the example of the use of Taq polymerase. Alternatively, you can use other types of heat-resistant DNA polymerase, such as Pfu, Phusion, Pwo, Tgo, Tth, Vent, Deep-vent. Polymerase lacking or possessing activity 3'-5'-end ectonucleoside, can be used alone or in combination with each other.

Vectors and libraries

As a result of binding interest nucleotide sequences of the present invention the image is tsya nucleotide segment, including interest associated nucleotide sequence. In addition, the methods of the present invention has libraries such interest related sequences of nucleic acids, in particular the library of sequences encoding variable regions.

One of the distinctive features of the present invention is the introduction of acceptable vectors of the segment of interest related nucleotide sequences, or libraries of interest related nucleotide sequences obtained by the method according to the present invention. These libraries can be combinatorial libraries or libraries of related pairs of sequences coding for variable regions. The sites of the restriction formed by the outer primers, nested primers or palugasdamana primers should preferably be compatible with the corresponding restriction sites of the selected vector. Interest related nucleic acid sequences can also be entered into the vectors by recombination, if one polugruppovykh, breeding or external primers is acceptable recombination site and the selected vector contains the same site.

Basically there is no restriction on the vectors that can be used as the media products received one of the ways to perform multiple RT-PCR and binding according to the present invention. The selected vectors can be used for amplification and expression in cells, including, for example, bacterial cells, yeast cells, the cells of other fungi, insect cells, plant cells or mammalian cells. Such vectors can be used to facilitate subsequent stages of cloning, migration between vector systems, display product, introduced into the vector, expression of the introduced product and/or integrate into the genome of the host cell.

Cloning vectors and Shuttle vectors, preferably, are bacterial vectors. However, in the process of cloning and transferring you can also use vectors of other types.

Vector displays can be, for example, fagbemi vectors or fakedname vectors derived from filamentous bacteriophages class fd, M13 or f1. Such vectors can facilitate the display of proteins, including, for example, binding protein or its fragment, on the surface of filamentous bacteriophage. In this area also known vector displays, which can be used for display on ribosomes, DNA, yeast cells or mammalian cells. These vectors include, for example, viral vectors, or vectors encoding chimeric proteins.

Expressing vectors exist for all of these types, and the choice of vector depends entirely on expressed protein. Some expressing vectors are additionally able to integrate into the genome of the host cell as a result of any integration or site-specific integration using the appropriate recombination sites. Expressing the vectors may have additional coding sequences, which are associated with the introduction of the product in the specified sequence in reading frame can Express the longer protein, for example reprezentirovannoe monoclonal antibody, in the appropriate cell host. This introduction to the reading frame can also facilitate the expression of chimeric proteins, which in turn facilitates the display on the surface of filamentous bacteriophage or cells. In the display system based on bacteriophage interest related nucleotide sequences can be introduced into the frame read in sequence, encoding a protein shell, such as pIII or pVIII (Barbas, C.F et al. 1991, Proc. Natl. Acad. Sci. USA 88, 7978-7982; Kang, A.S. et al. 1991, Proc. Natl. Acad. Sci. USA 88, 4363-4366).

In one of the embodiments of the present invention, the individual segments of interest related nucleotide sequences include a sequence encoding a variant is below region of the heavy chain of the immunoglobulin, which is associated with a sequence that encodes a variable region light chain. These related sequences is preferably introduced into a vector containing a sequence encoding one or more constant domains of immunoglobulin. Insert carried out so that the associated sequence encoding the variable region of the heavy chain and/or variable region of light chain, was reading frame sequence encoding the constant region. As a result of such inserts may be created, for example, the vector expressive Fab fragment, an expression vector reprezentirovannoe antibodies or expressing vector encoding a fragment reprezentirovannoe antibodies. This vector is preferably expressing vector, suitable for screening (for example, vectors based on E.coli, phagemid or vector mammal)with the sequence encoding the constant region of the heavy chain, selected from a human immunoglobulin class IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, or IgE, resulting in the expression of the Fab fragment or reprezentirovannoe recombinant antibodies. In addition to sequences encoding the constant region of the heavy chain, the specified vector may also contain a sequence encoding the constant region is a light chain, you choose from a lambda or Kappa-chains of human rights. This approach is justified in cases where associated nucleotide sequences encode only the sequence encoding the variable region of the immunoglobulin (Fv-fragments).

In another embodiment of the present invention, the individual segments corresponding nucleotide sequences include a sequence encoding a variable region α-chain TcR, which is associated with a sequence that encodes a variable region of a β chain, or a sequence encoding a variable region of the γ chain, which is associated with a sequence that encodes a variable region of δ-chain. These related sequences is preferably introduced into a vector that contains sequences encoding one or more constant domains of the TcR. Insert carried out so that the entered associated sequence encoding the variable region, was in the reading frame of the respective sequence encoding the constant region of TcR. In another embodiment of the invention, a vector is a chimeric expressing a vector comprising a sequence encoding Lazenby zipper in the frame read constant regions of the TcR. It is established that such design the AI to increase the stability of the soluble TcR (Willcox, B.E. et al. 1999, Protein Sci. 8, 2418-2423).

Library of cognate pairs of the present invention can be introduced into vectors in two different ways. In accordance with the first method acceptable vector impose separate sibling pairs. Such a library of vectors can be fragmented or aggregated form. In accordance with the second method all related pairs combine to introduction into the vector and then all together enter into an acceptable vectors with the formation of a joint library vectors (illustration on Fig). Such a library of vectors contains a large variety of pairs of sequences encoding variable regions.

One object of the present invention is a library of cognate pairs of related sequences coding for variable regions. Separate sibling pairs libraries preferably include a sequence encoding a variable region light chain of immunoglobulin-related sequence that encodes a variable region of the heavy chain.

Another preferred library related pairs contains related sequence encoding region of TcR, in which each individual sequence, the coding region of the TcR includes the sequence encoding the variable region of the alpha chain is associated with the sequence, teruya variable region of the beta chain, and/or a sequence encoding a variable region of the gamma chain of the TcR-related sequence that encodes a variable region of the Delta chain.

One way of implementing the present invention relates to medbibliotekoy related pairs of related sequences coding for variable regions that define the binding specificity for a particular target. These sibling pairs preferably includes related sequence encoding the variable region of the light chain and the variable region of the heavy chain immunoglobulin sequence encoding the variable region of the alpha chain and the variable region of the beta chain of the TcR, and/or the sequence encoding the variable region of the gamma chain and the variable region of the Delta chain of the TcR.

Another variant embodiment of the invention relates to medbibliotekoy selected from the original library related pairs of sequences encoding variable regions, according to the present invention.

The preferred implementation of the present invention relates to a library or medbibliotekoy that encodes a cognate pair reprezentirovanii immunoglobulins selected from immunoglobulin classes IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4 or IgM.

Other preferred hallmark is the first characteristic of the present invention is a library or medbibliotekoy, encoding a soluble and stable sibling pairs TcR.

The hallmark of the present invention is the diversity of these libraries, which include at least 5, 10, 20, 50, 100, 1000, 104, 105or 106different sibling pairs.

In another embodiment, the present invention specified library related pairs of related sequences coding for variable regions, receiving method, comprising the stages outlined above. This library is also known as the original library.

Screening and selection

It can be assumed that the original library of pairs of related sequences coding for variable regions, which were obtained from a donor by one of the methods of the present invention, should be a variety of binding proteins, some of which will be rendered unusable, then there will not be contact with the desired target, which is especially true for combinatorial libraries. Therefore, the scope of the present invention includes enrichment and screening to obtain medbibliotekoy that encodes a subset of specificdate linking against a specific target.

As for libraries related pairs, the diversity of the library presumably corresponds to the diversity of the material of the donor in the presence of a lowly is sustained fashion number of arbitrarily related variable regions. Thus, in the library, consisting of related pairs, stage of enrichment may be required to screening target-specific affinity binding.

In another embodiment of the present invention a method of creating a library of pairs of related sequences coding for variable regions, further includes creating medbibliotekoy by selecting subsets of pairs of related sequences of variable regions that encode binding proteins with desired specificity to the target. Such a selection of related sequences coding for variable regions, also referred to as a library of target-specific sibling pairs.

The preferred implementation of the present invention relates to a library of target-specific related pairs of sequences encoding variable regions, which are introduced in expressing vector mammal.

The selection of the sequences encoding the variable regions of the target-specific immunoglobulins, usually produced by using immunological assays. Such analyses are well known in this field and include, for example, ELISPOTS, ELISA, membrane tests (e.g., Western blotting), fabric filters or FACS. These tests can be performed directly using polypep the Dov, derived from sequences encoding the variable regions of immunoglobulin. Alternative immunoassays can be performed in combination or after enrichment by methods such as the display on the phage, ribosome, bacterial surface, yeast, eukaryotic viruses and RNA or covalent display (see FitzGerald, K., 2000, Drug Discov. Today 5, 253-258). As shown in figure 10, the screening may be subjected as libraries expressed related Fab-fragments and libraries expressed related reprezentirovanii antibodies, which created medbibliotekoy positive clones. Such screening methods and enrichment suitable for Fv or scFv fragments or combinatorial libraries associated variable regions.

In a preferred embodiment of the present invention the selection of medbibliotekoy target-specific sibling pairs or combinatorial pairs of sequences encoding variable regions, carry out a highly effective method of screening. High-throughput methods include, but are not limited to, ELISA assays performed using semi-automatic and automatic equipment. Can also be used in membrane assays, in which the bacteria is automatically collected and placed on the corresponding m is mbrane on top of the agar plates with the formation of arrays of colonies, expressing antigennegative molecules. These molecules permeate through the membrane to the second button below the membrane is sensitized with the antigen, which can be revealed and used to identify clones secreting antigennegative molecules to the desired target (de Wildt, R., et al. 2000, Nat. iotechnol. 18, 989-994).

After selecting the appropriate method of medbibliotekoy related pairs or combinatorial pairs antigenspecific clones can be performed additional analyses by DNA sequencing of related sequences encoding the variable region of the light chain and the variable region of the heavy chain of immunoglobulin. Firstly, such DNA sequencing allows to obtain information about the diversity libraries, such as the origin of the germ line, distribution, collection and maturation on hypervariable sites. This analysis makes it possible to select clones characterized by a wide diversity, and to remove the duplicate clones. Secondly, DNA sequencing allows to identify mutations that arose in the process of selection.

In the analysis of sequences encoding variable regions, it is necessary to consider three types of mutations, before making a decision on admissibility mutations: (i) mutations are the most common type of result as the spas binding within the family, when the primers for V-gene associated with the wrong subset in one particular family of V-genes. The changes are mainly natural replacement of codons in one particular position. Because of the high degree of homology of sequences in the family of V-genes such replacement can be considered as conservative and acceptable replacement; (ii) less frequent mutations arise as a result of cross-linking between families (e.g., primer for the VH3 family initiates the sequence encoding the VH1 family) and give rise to more significant structural changes, sometimes with no natural option. Such changes can potentially affect the immunogenicity of variable regions in the creation of new epitopes. Such changes can be easily identified and then eliminated by standard methods of molecular biology or eliminate the detected clones from the library; (iii) errors caused by Taq DNA polymerase, it is easier to identify the sequences encoding the constant region, after which they can be eliminated easily. However, mutations induced by Taq polymerase, will also be present in the sequences coding for variable regions, where they cannot be distinguished from natural somatic mutations, so that the e are the result of random mutations in the sequences, encoding variable regions. Given that these mutations are not systemic and differently affect only certain pairs, it seems reasonable not to take into account such changes.

In addition, sequence analysis can be used to identify the degree of permutation sequences in the library of cognate pairs, as shown in table 20 for the VH group H4.

As described in example 9, mutations discussed in paragraphs i) and ii)can be solved in the library of expressed sequences using primers hybridizers with leader peptide sequences coding for variable regions, instead of primers, hybridizers with the 5'-end of the variable regions.

In another embodiment of the present invention medbibliotekoy target-specific and possibly subjected to analysis of pairs of related sequences encoding the variable region of the light chain and the variable region of the heavy chain of immunoglobulin transfer in expressing vector mammal. Such a transfer can be made in any of the vectors described in the previous section, which allow to Express reprezentirovannoe recombinant antibody. If the screening is performed in relation to the library of cognate pairs expressed nephrocarcinogenicity, such a transfer may not be necessary.

In another embodiment, the present invention create a native library from lymphocytopenia fraction of cells enriched T-lymphocytes. Pairs of related sequences coding for variable regions, which form the source library can be selected to reflect the encoding of a subset of pairs of related sequences of the variable regions consisting of alpha - and beta-chains and/or gamma and Delta chains that encode binding proteins with desired specificity to the target, which will result created medbibliotekoy related pairs or combinatorial pairs. Antigen-specific T-cell receptors can then be identified in a pool of transfected cells by standard methods, such as staining tetramer complexes of MHC-peptide (see, for example, publications Callan, M.F. et al. 1998, J. Exp. Med. 187, 1395-1402; Novak, E.J. et al. 1999, J. Clin. Invest. 104, R63-R67), measuring cellular responses in the form of release of IL-2, or more complex methods, such as methods of displaying yeast or retroviruses.

Cell host and expression

Library of the present invention can be carried into vectors suitable for the expression and production of proteins encoded by interest related sequences of nucleic acids, in chastnostyami proteins, containing variable regions, or fragments. Such vectors are described in the section “Vectors and libraries and are used for expression, for example, reprezentirovanii antibodies, Fab fragments, Fv fragments, scFv fragments, membrane-bound or soluble TcR or TcR fragments of the selected type.

One of the distinctive features of the present invention is the introduction into the cell of the master library or medbibliotekoy vectors containing the related pairs of related sequences coding for variable regions, or a single clone, including the related pair of related sequences coding for variable regions, amplification and/or expression. Cell host may be selected from bacterial cells, yeast cells, other fungi, insect cells, plant cells or mammalian cells. For expression preferred are mammalian cells, such as cells of the Chinese hamster ovary (Cho)cells, COS cells, KSS, myeloma cells (e.g., cells, Sp2/0, NS0), NIH 3T3, fibroblasts or immortalized human cells such as HeLa cells, cells of SOME 293 or PERC6.

Introduction of vectors into cells-owners perform using a number of methods of transformation or transfection, well-known experts in this field, which include the deposition of phosphate is m calcium electroporation, microinjection, fusion with liposomes, the merger with gomolateralnyj red blood cells, and fusion with protoplasts, viral infection, and the like. Well known methods of producing monoclonal reprezentirovanii antibodies, Fab fragments, Fv fragments and scFv fragments.

Production of recombinant polyclonal antibodies for use in therapeutic purposes, is a new area. A method of obtaining a recombinant polyclonal antibodies are described in PCT application WO 2004/061104. This method involves creating a collection of cells, suitable for use as line producing cells. The following description of this method refers to the library of cognate pairs, although it is applicable also to a combinatorial library. Individual cells in the collection of cells can Express one member of the recombinant polyclonal svyazyvalo protein, for example, from a library of cognate pairs. To ensure the expression of individual cells one sibling pairs, and not several related pairs polyclonal binding protein, nucleic acid sequences encoding a cognate pair, give one specific site of the genome of each individual cell. This is an important feature of the collection of cells, as it prevents the rearrangement of the heavy and light chains, the former is resereach each cell, and also allows you to obtain cells are essentially identical to each other except for small differences in the variable regions separate sibling pairs. This feature makes it possible unbiased growing collection of cells during the period of time required for production. To guarantee a single site-specific integration, you must use a commercially available cell line host that has only one site integration, for example cells CHO Flp-In the company Invitrogen, containing one FRT site. Vectors suitable for this cell line contains the corresponding FRT site and integrated into the genome using Flp-recombinase. There are several other known recombinases, such as Cre, beta recombinase, Gin, Pin, PinB, PinD, R/RS, lambda integrase or phage integrase FS, which can be used in combination with the corresponding recombination sites. In addition, acceptable vectors contain breeding marker that allows selection of site-specific integrants.

Creating line polyclonal producing cells and production of recombinant polyclonal protein of such a cell line can be produced by several different methods transfection and production.

One method is to use a library of vectors, mixed with the formation of the od of the second composition, designed for transfection of cell line-hosts, with one cell per site integration. This method is called mass transfection. The previously described structure of the vector and the host cell ensures that the appropriate selection must be received line polyclonal cells, characterized by an unbiased growth. You need to create a frozen supply line polyclonal cells to start producing recombinant polyclonal protein.

Another method is the use for transfection library of vectors, divided into parts, containing in the composition of about 5-50 individual vectors of the library. One part of the library preferably contains 10-20 separate vectors. Each composition is then transferout one aliquot of master cells. This method is called polubesova by transfection. The number of transfected aliquot depends on the size of the library and the number of individual vectors in each part. If the library includes, for example, 100 individual sibling pairs, divided into parts containing composition 20 individual members, it is necessary to transferout 5 aliquot of the cells of the host composition library, component separate part of the original library. Aliquots of master cells selected based on site-specific integration. Different aliquots of predpochtitel is but taken separately. However, they can also be combined to breeding. These aliquots can be analyzed in terms of their clonal diversity, and to create a stock library polyclonal sibling pairs only use aliquots, characterized by sufficient diversity. To obtain the required line polyclonal cell aliquots can be mixed to create a frozen stock immediately after receiving them from stock or after a short period of proliferation and adaptation. Aliquots of cells are found separately in the process of production, and the polyclonal protein get, combining the products of all the aliquot, and not aliquots of the cells prior to production.

The third method is a highly effective method, in which cells of the host transferout separately, using separate vectors comprising a library of cognate pairs. This method is referred to as individual transfection. Individually transfected cells masters preferably selected separately, taking into account site-specific integration. Individual cell clones obtained by screening can be analyzed to determine the time of proliferation, and to create a stock library polyclonal related pairs preferably using cells, characterized by the same speeds the OST. Individual clones of cells can be mixed to obtain the required line polyclonal cells to create a stock immediately after receiving them from stock or after a brief proliferation and adaptation. This approach allows to eliminate any possible bias sequence of residues during transfection, integration and selection. Alternative separately transfected cells masters mixed to perform a selection that allows you to control the alignment of sequences due to transfection.

A common hallmark of the above methods is that each individual sibling pairs, forming a recombinant polyclonal protein can be obtained in one or a limited number of bioreactors. The only difference is the stage at which selected a collection of cells, which forms a line polyclonal producing cells.

One of the embodiments of the present invention refers to a population of host cells, forming a library of cognate pairs or medbibliotekoy related pairs of sequences encoding variable regions.

Another variant of implementation of the present invention refers to a population of host cells, forming a library obtained from a separate populations of cells, including lymphocytes, using the-W to bind cognate pairs method multiple RT-PCR with subsequent linkage by ligation or recombination or multiple RT-PCR with the elongation of the chain by the overlapping of the present invention.

Another variant of implementation of the present invention refers to a population of host cells, forming a combinatorial library or medbibliotekoy related pairs of sequences encoding variable regions.

The population of host cells according to the present invention includes a population of different cells, corresponding to the diversity of the library, used for transformation and transfection of cells. Each cell in a population of cells preferably forms only one sibling pair from an entire library of cognate pairs, and no member of the library of cognate pairs does not exceed more than 50%, more preferably 25% or most preferably 10% of the total number of individual members, the downregulation of the cell population of hosts.

In a preferred embodiment of the present invention population of host cells include mammalian cells.

The above population of host cells can be used for expression of recombinant polyclonal binding protein, as a separate cell populations comprise different sequences encoding variable regions.

One of the embodiments of the present invention relates to a recombinant polyclonal protein expressed by a population of host cells comprising a library of vectors containing different is e related pairs of related sequences, encoding variable regions, which was created by the method according to the present invention. Recombinant polyclonal protein of the present invention typically includes 2, 5, 10, 20, 50, 100, 1000, 104, 105or 106proteins consisting of different sibling pairs.

The preferred implementation of the present invention relates to recombinant polyclonal immunoglobulin expressed by a population of host cells comprising a library of vectors containing different related pairs of sequences encoding the variable region of the heavy chain and the variable region of the light chain.

Another preferred implementation of the present invention relates to recombinant polyclonal TcR downregulation population of host cells comprising a library of vectors containing different related pairs of sequences encoding the variable region of the alpha chain of the TcR associated with the variable region of the beta chain, and/or sequences encoding the variable region of the gamma chain associated with the variable region of the Delta chain.

Another variant of implementation of the present invention relates to a cell-master, suitable for production of monoclonal protein. In particular, monoclonal antibodies, containing a cognate pair of variable the Oh region of the light chain and the variable region of the heavy chain, or monoclonal TcR containing a cognate pair of variable region of the alpha chain and the variable region of the beta chain or variable region of the Delta chain and the variable region of the gamma chain. This cell line producing monoclonal protein, preferably not a line of cells hybridoma.

This monoclonal antibody or TcR can be obtained by adding the following stages of the method of linking several interesting non-contiguous nucleotide sequences: (a) introducing the vector of these related sequences, nucleic acid; (b) the introduction of this vector into the cell host; (C) culturing the above host cells under conditions suitable for expression; and d) obtaining the protein product expressed by the vector entered in the specified cell host. The vector introduced into the cell host, preferably contains a separate related pair of sequences encoding variable regions.

The application of the invention

The primary application of the present invention is the linking of related pairs of sequences encoding variable regions, in particular the sequences encoding the variable regions of the heavy and light chain immunoglobulin, or sequences encoding the variable regions of alpha-and beta-chain or gamma - and Delta-chain TcR, using a highly effective way to create libraries of related pairs. In addition to the libraries of related pairs multiple RT-PCR with subsequent linkage by ligation or recombination or multiple RT-PCR with the elongation of the chain by the overlap of the present invention can be used to create combinatorial libraries for population genetic different cells, cell lyst from such a population of cells or RNA extracted from a cell population. Library, medbibliotekoy or single clones from one of these libraries facilitate the expression of polyclonal or monoclonal proteins. From the libraries of the present invention can be obtained, in particular, monoclonal or polyclonal antibodies.

A well known application of recombinant monoclonal antibodies for diagnosis, treatment and prevention of diseases. Recombinant monoclonal and polyclonal antibodies obtained by the method according to the present invention, have the same application that antibodies obtained using existing methods. In particular, the method according to the present invention can be obtained pharmaceutical composition comprising as an active ingredient recombinant polyclonal immunoglobulin combined with at least one pharmaceutically acceptable fill the eat. More preferred are pharmaceutical compositions, in which the recombinant polyclonal immunoglobulin contains related pairs of sequences coding for variable regions. Pharmaceutical compositions based on recombinant polyclonal immunoglobulins can be used as medicines. Polyclonal recombinant immunoglobulin, which is part of the composition, may be specific to a predetermined condition, so this composition can be used to treat, reduce or prevent diseases such as cancer, infectious diseases, inflammatory diseases, allergies, asthma and other respiratory diseases, autoimmune diseases, dysfunction of the immune system, cardiovascular diseases, diseases of the Central nervous system, metabolic diseases and endocrine diseases, graft rejection or unwanted pregnancy in mlekovita, such as people, Pets or animals.

Further application of the present invention is unique among modern methods based on monoclonal chimeric antibodies. When the protective antigens are poorly understood or completely unknown, as is the case with the emergence of new and the infectious diseases, it is impossible to find a monoclonal antibody that protects against this disease.

However, the present invention allows to obtain antibody-expressing cells directly from donors developed a humoral immune response, such as recovering individuals, and use source material obtained from these individuals, to create a library of cognate pairs of sequences coding for variable regions of the heavy and light chains of immunoglobulin.

In cases when, for example, the virus is known, but not known protective antigens, you can create medbibliotekoy pairs of genes related antibodies with broad reactivity against antigenic structures of the virus. Recombinant polyclonal antibody obtained from such medbibliotekoy, apparently, will contain protective antibodies.

In cases when the antigens are unknown, recombinant polyclonal antibody obtained from a library of cognate pairs, created on the basis of the source material recovering individuals, you can use the same as currently used hyperimmune immunoglobulins. The basis for this application is related mating, which ensures a close match is obtained recombinant polyclonal antibodies gumo the individual immune response of recovering individual.

Methods of binding a cognate pairs of variable regions described in the present invention find use in diagnostic and analytical methods. With the introduction of the individual drugs, there is always the likelihood of immune response against such drugs. Immunogenicity can be determined using existing methods, such as specific medicines analyses of binding to serum or plasma obtained from the individual receiving this drug. Alternative methods of the present invention can be used to display the immune response of individuals immediately after the introduction of drugs through the allocation of related pairs of sequences coding for variable regions of the heavy and light chains. Antibodies expressed from a library, you can explore the reactivity with respect to this drug or its components. This method is particularly useful in those cases where the presence of drugs in plasma or serum prevents the application of an existing method. Such drugs include, for example, antibodies. Immune response against drugs (for example, antiidiotypic immune response, immunoreaction on the frame read or Fc-fragment), induced antibodies cannot be authenticated with known methods as long as the antibody used for treatment, will not be completely removed from the blood. In accordance with the present invention from being treated individual can distinguish sequences encoding such antibodies against this drug, and explore within two weeks. Thus, the present invention is an alternative method to investigate the immunogenicity of medicines in General and drugs based on antibodies, in particular.

Another application of the present invention is a review and comparison of vaccines and vaccination programmes. This is particularly useful in the process of creating a vaccine, as it allows to evaluate and compare the diversity of sequences that are involved in humoral immune responses that occur in response to the impact of new vaccine candidates, in addition to the currently executing comparisons affinity binding antibodies and serum titer. In addition, the present invention can be used for analysis, control and comparison of humoral immune responses in overseeing the effectiveness of the vaccine in the population.

The present invention also finds application beyond the field of binding proteins containing variable regions. The person skilled in the art can easily adapt the method described in the present invention, to connect two or more transcribed nucleotide sequences encoding heteromeric protein, which is not binding protein. Such linking sequences encoding domains or subunits heteromera protein, can be very useful for separation of protein coding sequences, as it will allow to significantly reduce the number of stages. In addition, you can select, for example, splanirowannya variants, mutations or new members of the family of such proteins, using only one mixture of multiple primers/mix multiple primers for elongation of the chain by overlapping.

In addition, it is possible binding sequences encoding the remote domains in the same protein. This method should facilitate the study of the significance of certain domains in a multidomain protein, as it simplifies the deletion of the intermediate domain.

The creation of chimeric or related proteins is also an area that can be used in the present invention. Even if subject to binding proteins have different origins, for example, represent a chimeric protein generated from protein between human and mouse, the present invention can be used, mixing of the cells to the imp is in reverse transcription. This mixture of cells can include a population of cells of each species or individual cell of each type.

Examples

Example 1. Two-stage multiple RT-PCR with lengthening the chain by overlapping

In this example, considered the implementation of the reverse transcription (RT) using the matrix obtained from separate cells, while the produced cDNA is used as a matrix for performing multiple multiple PCR elongation of the chain by overlapping.

A. Cells

The cell line of Chinese hamster ovary (Cho)expressing the Kappa-chain IgG1 was obtained by the method of Flp-In (Invitrogen, Carlsbad, CA, USA).

Plasmid vector pLL113 expressing Kappa-chain IgG (figure 4), was created on the basis of expressing the vector Flp-In, pcDNA5/FRT. Cells Cho-Flp-In was cotranslationally vector pLL113 containing the genes for antibodies and pOG44, causing a temporary expression of Flp-recombinase using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA)according to the manufacturer's instructions. Transformants were selected and tested in relation to the production of Kappa-chain IgG using immunoassays. The selected cell line, called Cho Flp-In pLL113, were placed in a medium F-12 ham, containing 2 mm L-glutamine, 10% FCS and 900 hygromycin In (supportive environment).

Cells Cho Flp-In pLL113 collected using trypsin and washed three times in the maintenance environment. After the last wash the cells again suspended in the original volume supportive environment. The cell concentration was determined using the system Casy-1 (Scharfe System GmbH, Reutlingen, Germany) and diluted in maintenance medium up to a concentration of 1 cell/5 ál.

b. Reverse transcription

Suspension cells Cho Flp-In pLL113 containing on average one cell was divided into individual wells of 96-hole tablet for PCR (Thermo-Fast 96, skirted AB-0800, ABgene, Epsom, Surrey, UK).

cDNA was synthesized from distributed cells at the stage of reverse transcription using reverse transcriptase (RT) in accordance with the one-step method RT-PCR Qiagen (set to perform one-step RT-PCR Qiagen, catalog No. 210210 Hilden, Germany).

Each hole contained the following reagents in a total volume of 20 ál:

a single buffer for one-step RT-PCR,

dNTP at a final concentration of 1 mm each reagent

5 pmol of the oligonucleotide poly-dT (18),

26 units of RNase inhibitor (RNasin, Promega, Madison USA, catalog No. N2111),

2 μl of a mixture of enzymes for one-step RT-PCR,

5 µl of suspended cells Cho Flp-In pLL113.

The reaction of reverse transcription using RT was performed, incubare the reaction mixture at 55°C for 30 minutes. Then reverse transcriptase iactiveaware, incubare the reaction mixture at 94°C for 10 minutes.

C. Multiple PCR with UD is inanam chain by overlapping

Part of the cDNA products obtained in stage b), was used as a matrix for multiple PCR elongation of the chain by overlapping. The reaction was carried out in 96-well plates.

Each hole contained the following reagents in a total volume of 40 μl:

a single buffer for one-step RT-PCR,

dNTP at a final concentration of 500 μm of each reagent

the mixture of multiple primers for elongation of the chain by the overlap in the concentrations indicated in table 1,

26 units of RNase inhibitor (RNasin, Promega, Madison USA, catalog No. N2111),

2 μl of a mixture of enzymes for one-step RT-PCR,

1 µl of the matrix cDNA (isolated from single cells (stage b)).

Used a mixture of multiple primers for elongation of the chain by overlapping contained the primers shown in table 1.

CLK
Table 1
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
VH20 nm each1
2
3
4
5
6
7
8
CH100 nm9
VL20 nm each10
11
12
13
14
15
100 nm16

W=A/T, S=G/C, R=A/G. the Sequence designated by the capital letters correspond to the gene-specific region.

Reactions were performed in 96-well fuser Primus HT MWG (MWG Biotech AG, Ebersberg, Germany) under the following conditions cyclization:

Denaturation30 sec95°C50 cycles
Hybridization30 sec50°C
Lengthening chain5 min72°C
Final lengthening chain10 min72°C

d. Nested PCR

Nested PCR was performed, using as matrix products multiple CR with lengthening the chain by overlapping. Reactions were carried out in 96-well plates.

Each hole contained the following reagents in a total volume of 50 µl:

a single buffer for Bio Taq,

dNTP at a final concentration equal to 400 μm of each reagent

2 mm MgCl2,

a mixture of primers for nested PCR,

1,25 is D. DNA polymerase BIOTAQ (catalog No. BIO-21040, Bioline, UK),

1 μl of the product of multiple PCR elongation of the chain by overlapping (stage C).

The used primers are shown in table 2.

Table 2
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
JH100 nm of each17
18
19
20
CLK100 nm21

The sequence designated by the capital letters correspond to the gene-specific region.

Reactions were performed in 96-well fuser Primus HT MWG (MWG Biotech AG, Ebersberg, Germany) in the following cyclization conditions:

Denaturation30 sec95°C25 cyclesHybridization30 sec50°CLengthening chain90 sec72°CFinal lengthening chain10 min72°C

The products of the breeding CR were analyzed by electrophoresis in 1% agarose gel using to detect the ethidium bromide (figure 5). The expected size of the product obtained by lengthening the chain by the overlap was equal 1076 BP This product is shown in lanes 1, 5, 6, 7, 8, and 12, as indicated by the arrows (figa). In the considered experiment, the negative control sample is contaminated, and similar pollution is also typical samples. On FIGU shows the fragments depicted in figa that relate to this experiment.

In this experiment illustrates one of the ways to perform the two-stage multiple PCR elongation of the chain by overlapping with the use of matrix isolated from single cells. In addition, it was shown that it is possible to complete in about twenty multiple the CR by lengthening the chain by overlapping, using cDNA obtained from separate cells.

Example 2. Single-stage multiple RT-PCR with lengthening the chain by overlapping

In this example, considered the implementation of reverse transcription and multiple PCR elongation of the chain by overlapping in a single stage using a matrix derived from lysed cells, at concentrations corresponding to 100, 10 or 1 cell.

A. Cells

The cell line of hybridoma human HB-8501, producing tetanus antibody with a Kappa-chain IgG1, which was obtained from the American type culture collection, were cultured in the medium of Dulbecco modified by the method of Claims (Vitacell, Kiev, Ukrain, catalog No. 30-2005)containing 10% fetal calf serum. To run multiple RT-PCR with lengthening the chain by overlapping cells were collected, counted and frozen at -80°C in culture medium at a concentration of 200 cells/µl.

b. Single-stage multiple RT-PCR with lengthening the chain by overlapping

To perform multiple RT-PCR with lengthening the chain by overlapping used the set for one-step RT-PCR Qiagen (Qiagen, catalog No. 210212, Hilden, Germany) according to the manufacturer's recommendations. Before adding in tubes for PCR cell lysates were thawed and diluted in N2About to the concentration of lysate corresponding to 100, 10 and 1 cell per 5 ál.

Each swab for PCR contained nigelegashie reagents in a total volume of 50 µl:

a single buffer for one-step RT-PCR,

dNTP at a final concentration equal to 400 μm of each reagent

the mixture of multiple primers for elongation of the chain by the overlap in the concentrations shown in table 3,

2 μl of a mixture of enzymes for one-step RT-PCR,

50 units of RNase inhibitor (RNasin, Promega, Madison USA, catalog No. N2515),

5 μl of the diluted cell lysate.

Used a mixture of multiple primers for elongation of the chain by overlapping contained the primers shown in table 3.

Table 3
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
VH40 nm each22
23
24
25
26
27
28
29
30
JH200 nm of each31
32
33
34
VL40 nm each35
36
37
38
39
40
CLK200 nm16
W=A/T, S=G/C, R=A/G. the Sequence designated by the capital letters correspond to the gene-specific region.

Reactions were performed in the following conditions cyclization:

Reverse transcription30 min55°C
Activation of the polymerase15 min95°Cinactivation of the reverse transcriptase and activation aq polymerase

The PCR reaction:

Denaturation30 sec94°C50 cycles
Hybridization30 sec44°C
Lengthening chain3 min72°C
Final lengthening chain10 min72°C

Ten Microlitre reaction products were analyzed by electrophoresis in 1.5% agarose gel, using for detection of ethidium bromide (figa).

The expected fragment size (the exact size depends on the length of variable fields):

VN: 410 BP

LC: 680 BP

A fragment of chain elongation by overlapping: 1070 BP

Separate the DNA fragments with a mobility corresponding to the length of the variable region of the heavy chain (VHand the length of the variable and constant regions of the light chain (LC), are present at all dilutions of cell lysate. Less intense fragment with a mobility corresponding to an alleged fragment of chain elongation by overlapping present in lysates from 100 to 10 cells. A fragment of chain elongation by overlapping the sample lysate of a single cell is detected with difficulty, although it is present in the original gel (see arrow in photo shown on figa, and the image shown in figv).

C. Identification of the fragment of chain elongation by overlapping

As a result of performing the above experiment was confirmed by the presence of bands corresponding to fragments is the elongation of the chain by overlapping. The field agarose gel in position 1070 BP band corresponding to 1 cell, and bands corresponding to 100 cells, cut out, and DNA was purified using the kit Qiaex II (Qiagen, catalog No. 20051, Hilden, Germany) and dissolved in 20 μl of water.

One μl of the eluate was subjected to PCR (set Biotaq, Bioline, UK catalog No. BIO-21040) according to the manufacturer's instructions using primers flanking the expected fragment of chain elongation by overlapping (primers for JHcorresponding to SEQ ID NO:32-35, and primer for CLKcorresponding to SEQ ID NO:17, when using each primer at a concentration of 0.5 µm). Reactions were performed in neucleus cyclization conditions:

Denaturation30 sec95°C30 cycles
Hybridization30 sec55°C
Lengthening chain1 min72°C

Ten microlitres each reaction product was analyzed by electrophoresis in 1% agarose gel, using for detection of ethidium bromide. It was discovered several pieces, including mobility of the expected fragment of chain elongation put the m overlap in the samples from 1 to 100 cells (arrow in figs). The fragment length of 1 KBP was cut out of the lanes of the gel, corresponding to a single cell, and was purified using the above kit Qiaex II. The purified fragment hydrolyzed restriction enzymes NheI and NcoI (separately) and the reaction products were analyzed by electrophoresis in 1% agarose gel, using for detection of ethidium bromide (fig.6D). These restriction sites are present overlapping VH and LC, and the expected size of the circuit after the hydrolysis is approximately 410 and 680 BP (figure 2). Hydrolysis NheI was incomplete, because a large fraction still has the original size.

Example 3. The combined response of single-stage multiple RT-PCR with lengthening the chain by overlapping and nested PCR

In this example the reaction of reverse transcription and multiple PCR elongation of the chain by overlapping performed in a single stage, followed by amplification using palugaswewa PCR using the matrix from the lysed cells at concentrations corresponding to 100, 10 or 1 cell.

A. Single-stage multiple RT-PCR with lengthening the chain by overlapping

Multiple RT-PCR with lengthening the chain by overlapping performed using cell lysate HB-8501, in accordance with the description given in example 2, using a mixture of multiple primers for chain elongation by blocking the tion, including primers, shown in table 4.

Table 4
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
VH40 nm each41
42
43
44
45
46
47
48
CH1-5200 nm of one of these primers49
50
51
52
53
VL20 nm each54
55
56
57
58
59
CLK200 nm60
W=A/T, S=G/C, R=A/G. the Sequence designated by the capital letters correspond to the gene-specific region.

However, it should be noted that for each mixture of multiple primers for elongation of the chain by overlapping only used one of the primers for CN1-5, resulting in five different mixtures of multiple primers for extension chain closing.

The other parameters are the same as specified in example 2 for multiple RT-PCR with lengthening the chain by overlapping except for changing the temperature of hybridization, which was equal to 50°C. Reactions were performed using each of the reverse primers for the constant region of the heavy chain (CH1WithH2WithH3WithH4WithH5both SEQ ID NO:49-53) and lysates corresponding to 100, 10, 1 and 0 cells.

b. Palugaswewa PCR

One microliter of the reaction product of multiple RT-PCR with lengthening the chain by overlapping subjected to palugaswewa CR (set Biotaq, Bioline, UK, catalog No. BIO-21040) in accordance with the manufacturer's recommendations. The total volume of the reaction mixtures was 50 µl. The used primers are shown in table 5.

Table 5
Name of primerConcentrationSEQ ID NOThe sequence of primer in n the Board from the 5'-end to 3'-end
JH200 nm of each61
62
63
64
CLK200 nm21
The sequence designated by the capital letters correspond to the gene-specific region.

The reaction was performed in the following conditions cyclization:

Denaturation30 sec95°C25 cycles
Hybridization30 sec50°C
Lengthening chain1.5 min72°C
Final lengthening chain5 min 72°C

Ten microlitres each reaction mixture was analyzed by electrophoresis in 1.5% agarose gel, using for detection of ethidium bromide (Fig.7).

The expected fragment of chain elongation by overlapping, resulting from the execution of palugaswewa PCR using primers for CH4in the first reaction and corresponding to one cell lysate (see arrow 7), cut out from agarose gel, purified using the kit Qiaex II (Qiagen, catalog No. 20051, Hilden, Germany) and introduced into pCR2.1-TOPO using the kit to clone the TORO company Invitrogen (Invitrogen, catalog No. 45-0641, Carlsbad, CA, USA). Insertion of the eight clones sequenced, as a result it was found that seven of these inserts consisted of variable regions of the heavy chain associated with variable and constant region of light chain, in the intended area of overlap.

It can be noted that the sensitivity of the combined response of multiple RT-PCR with lengthening the chain by overlapping and palugaswewa PCR was quite satisfactory, with 4 out of 5 primers for the constant region amplified significant number of products of chain elongation by overlapping of the lysate, the corresponding single cell.

Example 4. The combined response of single-stage multiple RT-PCR with the elongation of the chain by passing the hryvnia and nested PCR using as the source matrix enriched In-impositon person

In this example the reaction of reverse transcription and multiple CR with lengthening the chain by overlapping performed in a single stage, followed by amplification using palugaswewa CR using as the source matrix is a separate In-human lymphocytes.

A. The selection of b-cells

Male donor were immunized tetanus toxin. After 6 days after immunization from the donor took the blood sample is equal to 120 ml, and were isolated mononuclear cells of peripheral blood (RVMS) device Lymphoprep (Axis-Shield, Oslo, Norway, production No. 1001967) according to the manufacturer's instructions. The population of CD19-positive cells were enriched by a method of sorting cells using magnetic beads. RVMS were stained with FITC-conjugated antibody against CD19-year-old horses (Becton Dickinson, NJ, USA, catalog No. 345776). Magnetic sorting of cells using magnetic micro granules, conjugated with anti-FITC-antibody, and purified in a column made in accordance with the manufacturer's instructions (Miltenyi Biotec, Gladbach, Germany, catalog No. 130-042-401). Cells were diluted to a concentration equal to 200 cells per 1 ml in PBS containing 2 nm EDTA and 0.5% BSA. Five microliters diluted cells was distributed to PCR tubes containing approximately one cell in a single vial. The tubes were kept before applying the por is -80°C.

b. Multiple RT-PCR with lengthening the chain by overlapping and palugaswewa PCR

Conditions for execution of multiple RT-PCR with lengthening the chain by overlapping and palugaswewa CR were similar to those described in example 3. However, these reactions were performed only with the use of a mixture of multiple primers for elongation of the chain by overlapping, including primer for CH3corresponding to SEQ ID NO:51. Sixteen samples, the resulting aggregate reactions multiple RT-PCR with lengthening the chain by overlapping and palugaswewa CR analyzed by electrophoresis in 1% agarose gel, using 10 µl of the reaction product of each palugaswewa PCR and producing a detection by ethidium bromide (Fig).

As shown in Fig, 2 out of 16 bands (bands 5 and 6) contained fragments with the expected mobility (about 1 KBP). In addition, lane 2 contained less intense fragment at the expected mobility. Fragments of length 1 KBP present in the bands 5 and 6, cut out from agarose gel, purified using the kit Qiaex II (Qiagen, catalog No. 20051) and introduced into pCR2.1-TOPO using the set for cloning TOPO TA company Invitrogen (Invitrogen, catalog No. 45-0641 Carlsbad, CA, USA). Two clones from each selection had inserts of the correct size. As a result of hydrolysis with restriction enzymes (separate NoI and NheI) were found fragments of the expected sizes (410 and 680 BP), that indicates the correct binding sequences encoding the variable region of the heavy chain and the variable and constant region of the light chain.

Two clones derived from a fragment that is present in the band 5, sequenced, revealing their identity, indicating that the associated VNand LC were related pairs.

Example 5. The combined response of single-stage multiple RT-PCR with lengthening the chain by overlapping and nested PCR using Vλ-specific primers

In this example the reaction of reverse transcription and multiple PCR extension chain, made in a single stage, using the Vλ-specific primers and subsequent implementation of palugaswewa PCR. As the matrices used total RNA extracted from two different cell lines expressing the gene family of lambda chain 1b and 1E in combination with the same variable region of the heavy chain.

A. Cells

Two cell lines of Chinese hamster ovary (Cho)expressing the lambda chain IgG1 were obtained by the method of Flp-In (Invitrogen, Carlsbad, CA, USA).

Vectors pEm465/01P581 and pEm465/01P582 expressing lambda chain IgG1 mammal (figa) and representing two families of genes lambda-chain IgG, were created on the basis of expressing the vector pcDNA5/FRT, is received by the method of Flp-In. Cells Cho-Flp-In was cotranslationally the above plasmids containing the genes for antibodies and pOG44, causing a temporary expression of Flp recombinase, using fugene 6 (Roche, Mannheim, Germany)according to the manufacturer's instructions. Then made the selection of transformants in respect of the inserts. The selected cell line, called Cho Flp-In/Em464/01P581 and CHO Flp-In/Em464/01P582, were placed in a medium F-12 ham, containing 2 mm L-glutamine, 10% FCS and 900 μg/ml of hygromycin In (supportive environment).

Line cells were collected using trypsin and washed three times in a supportive environment. About 107cells were used for purification of total RNA using a set of Nucleo Spin L (Macherey-Nagel, Duren, Germany) according to the manufacturer's instructions. The final concentration of RNA was determined by measurement methods of optical density OD260.

b. Single-stage multiple RT-PCR with lengthening the chain by overlapping

Multiple RT-PCR with lengthening the chain by overlapping performed analogously to example 3, using 50 PG, 5 PG, or 0.5 PG of total RNA as template and the mixture of multiple primers for elongation of the chain by overlapping containing the primers shown in table 6, the following conditions cyclization.

Reverse transcription30 mi the 55°C
Activation of the polymerase15 min95°Cinactivation of the reverse transcriptase and activation aq polymerase

The PCR reaction:

Denaturation30 sec95°C35 cycles
Hybridization30 sec50°C
Lengthening chain5 min72°C
Final lengthening chain10 min72°C

Table 6
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
VH40 nm each1
2
3
4
5
6
7
8
CH100 nm9
Vλ100 nm of each65
66
67
68
69

70
71
72
73
74
75
Cλ2/Cλ7100 nm76
77
Y=C/T, W=A/T, S=G/C, R=A/G. the Sequence designated by the capital letters correspond to the gene-specific region.

C. Palugaswewa PCR

One microliter of the reaction product of multiple RT-PCR with lengthening the chain by overlapping subjected to palugaswewa PCR (set Biotaq, Bioline, UK, catalog No. BIO-21040) according to the manufacturer's instructions. The total volume of the reaction mixtures were equal to 20 ál. COI is Lituanie the primers shown in table 7.

Table 7
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
JH200 nm of each61
62
63
64
C200 nm78
79
The sequence designated by the capital letters correspond to the gene-specific region.

The reaction was performed in the following conditions cyclization:

Denaturation 30 sec95°C25 cycles
Hybridization30 sec50°C
Lengthening chain1.5 min72°C
Final lengthening chain5 min72°C

Ten Microlitre reaction products nested PCR were analyzed by electrophoresis in 1.5% agarose gel, using for detection of ethidium bromide (figv and 9C). The arrows show the products of chain elongation by overlapping with the expected properties of the migration length of about 1 KBP

This experiment shows that a mixture of multiple primers to extend the lambda-chain by overlapping presented in table 6, can be used in single-stage multiple RT-PCR with lengthening the chain by overlapping regardless of the matrix. In addition, specific PCR reaction products with lengthening the chain by overlapping were obtained using a 0.5 PG of total RNA. Found sensitivity suggests that related associated sequence encoding the variable region of the heavy chain and the variable region of light chain, can be ampli is economony of individual cells.

Example 6. Create medbibliotekoy related pairs of sequences encoding anti-tetanus antibody

In this example the stage depicted in the block diagram shown in figure 10, using tetanus toxin (TT) as the target antigen.

A. Donors

Donor previously immunized tetanus vaccine, were subjected to booster immunization with tetanus vaccine (Statens Serum Institut, Denmark). Six days after the booster immunization with tetanus toxoid (TT) vaccine in donors took a blood sample of approximately 200 ml, which was introduced into a test tube with anticoagulant.

Donors must be healthy and not have a dormant or chronic infections. They should not suffer autoimmune diseases or taking any immunosuppressive tools and should not be subject to any vaccinations in the last 3 months. In addition, during the booster immunization with TT vaccine donors should not have any serious infections during the last month.

b. Obtaining mononuclear cells of peripheral blood (RVMS)

RVMS extracted from blood samples using the device Lymphoprep (Axis-Shield PoC AS, Norway, production No. 1001967) in accordance with manufacturers ' recommendations. The blood was diluted in the ratio of 1:1 in BS and received a suspension imposed in Lymphoprep in respect of 2:1. The tubes centrifuged with an acceleration of 800 g for 20 minutes at 25°C and collect the band corresponding to the interphase lymphocytes. Cells are washed in PBS containing 2 mm EDTA.

C. Enrichment In cells

Line b-cells (CD19+ cells) in PBMC enriched by a method of sorting cells using magnetic granules in accordance with the following description.

Selected RUMS paint anti-CD19-FIC (fluoresceinisothiocyanate) (Becton Dickenson, NJ, USA, catalog No. 345776). All stages performed in a dark room at 4°C. Staining produce 10 ál of anti-CD19-FITC to 1x106cells in a volume of 100 µl per 1x106cells using M-buffer (PBS, pH of 7.2, with 0.5% BSA, 2 mm EDTA). In the above conditions occurs staining line b-cells RVMS. Cells are incubated for 20 minutes and then washed twice M-buffer. Cells, stained with anti-CD19-FITC, subjected to magnetic tagging with the help of microgranules, conjugated with anti-FITC-antibody, using 10 µl of magnetic granules sensitized with anti-FITC-antibody (Miltenyi Biotec, Gladbach, Germany, catalog No. 130-042-401), 1x106cells in a volume of 100 μl of M buffer to 1x106cells. Cells are incubated for 15 minutes and then washed with M-buffer. Cells are again suspended in degassed M-buffer.

Column ACS LS (Miltenyi Biotec, Gladbach, Germany, catalog No. 130-042-401) pre-process the degassed M-buffer in accordance with the manufacturers instructions. A suspension of cells stained with anti-CD19-FITC and labeled magnetic grains sensitized with anti-FITC-antibody injected into the column by passing through it. Painted and labeled cells (CD19+) remain in the magnetic field surrounding the column, while the unpainted cells (CD19-) pass through the column. The column was washed with degassed M-buffer. The magnetic field off and collect CD19+ cells.

d. Sort of plasma cells

The eluate from the column MACS centrifuged and re-suspended in FACS buffer (PBS, pH of 7.2, 2% BSA) at a concentration equal to 1x106cells/60 μl of buffer for FACS. Add anti-CD19-FITC (Becton Dickenson, NJ, USA, catalog No. 345776) (10 μl/106cells), anti-CD38-PE (Becton Dickenson, NJ, USA, catalog No. 555460) (10 μl/106cells) and anti-CD45-PerCP (Becton Dickenson, NJ, USA, catalog No. 345809) (20 μl/106cells). Cells incubated in the dark at 4°C for 20 minutes, then washed twice and re-suspended in FACS buffer.

Cell sorting method for sorting cells with excitation fluorescence (FACS), using the following sorting options:

1. Forward and side scattering to save lymphocytes and monocytes, including plasma blasts and plasma cells, and removal of dead cells and cells with very high lateral scattering, which can be units or gra is wliicli.

2. Cells are CD19-positive and Express elevated levels of CD38 (CD38hi). Similarly capture occurs mainly CD38 cells, as RVMS were enriched in column (MACS CD19 cells, but this method allows to detect any contamination.

3. CD45-positive cells. All cells Express CD45. However, plasma cells have lower expression of CD45 in comparison with earlier stages of differentiation of lymphocytes. Therefore, when the capture CD45 you can get a discrete population of cells corresponding to plasma cells.

Cells sorted by FACS method, collected in the form of individual cells and immediately placed in individual wells of 96-well plates containing 5 μl of buffer BS with 5 units of RNase inhibitor (RNasin, Promega, Madison USA, catalog No. N2515) in each well. At this stage, cells can be frozen for later execution RT-PCR or immediately used to perform RT-PCR.

that is, the Linking of related pairs of sequences coding for variable regions of immunoglobulin

Method of multiple RT-PCR with lengthening the chain by overlapping applicable to individual cells, providing related binding transcribed sequences encoding the variable region of the heavy chain and the variable region of the light CE and antibodies against tetanus toxin.

e-1. Single-stage multiple RT-PCR with lengthening the chain by overlapping

Set for one-step RT-PCR of the company Qiagen (Qiagen, catalog No. 210212, Hilden, Germany) used to perform multiple RT-PCR with lengthening the chain by overlapping in accordance with the manufacturer's recommendations. Frozen 96-well plates, containing one cell in each well, remove from the refrigerator and, when the wells are no ice crystals to each sample (a single cell) immediately add 15 ál of the reaction mixture for RT-PCR.

The reaction mixture for RT-PCR contains in total volume of 20 μl, the following reagents:

a single buffer for one-step RT-PCR,

dNTP at a final concentration equal to 400 μm of each reagent

the mixture of multiple primers for elongation of the chain by the overlap in the concentrations indicated in table 8,

0,8 µl of a mixture of enzymes for one-step RT-PCR,

20 units of RNase inhibitor (RNasin, Promega, Madison, USA, catalog No. N2515).

The composition of the mixture of multiple primers for elongation of the chain by overlapping shown in table 8.

Table 8
Name of primerConcentrationSEQ ID NOThe follower is the outer coat of the primer from the 5'-end to 3'-end
VH40 nm each41
42
43
44
45
46
47
48
CH(IgG)200nm9
VL40 nm each54
55
56
57
58
59
CLK200 nm60
W=A/T, S=G/C, R=A/G. the Sequence designated by the capital letters correspond to the gene-specific region.

The reaction is performed in the following conditions cyclization:

Reverse transcription30 min55°C
Activation of the polymerase15 min95°Cinactivation of the reverse transcriptase and activation aq polymerase

The PCR reaction:

Denaturation30 sec94°C35 cycles
Hybridization30 sec 52°C
Lengthening chain5 min72°C
Final lengthening chain10 min72°C

e-2. Additional amplification

One microliter of the reaction product of multiple RT-PCR with the elongation of the chain by the overlapping of each sample subjected to palugaswewa CR (set Biotaq, Bioline, UK, catalog No. BIO-1040) in accordance with the manufacturer's recommendations set using 96-well plates. Each reaction mixture has a total volume of 50 μl, and contains a single buffer Buiotaq, 200 μm dNTP (each reagent), 2 mm MgCl2, 1,25% Bio Taq polymerase in a final concentration and the primers shown in table 9.

The reaction is performed in the following conditions cyclization:

5 min
Denaturation30 sec95°C30 cycles
Hybridization30 sec55°C
Lengthening chain1.5 min72°C
Final lengthening chain72°C

Table 9
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
JH200 nm of each61
62
63
64
CLK200 nm21

The sequence designated by the capital letters correspond to the gene-specific region.

Ten microlitres limited series of samples analyzed by electrophoresis in 1.5% agarose gel, using visualization of ethidium bromide to verify successful you is filling up multiple RT-PCR with lengthening the chain by overlapping.

The expected fragment size (the exact size depends on the length of variable fields):

VN: ~410 BP

LC: ~680 BP

A fragment of chain elongation by overlapping: ~1070 BP

Two microliters of all samples obtained from the same donor were cultured on 96-well tablets are pooled in one tube. Collected samples hydrolyzing XhoI and NotI. Hydrolyzed fragments of chain elongation by overlapping purified by preparative electrophoresis in 1% agarose gel, fragments of chain elongation by overlapping cut out from agarose gel and purified using the kit Qiaex II (Qiagen, catalog No. 20051, Hilden, Germany). At this stage do not want to merge sibling pairs, if not required. In this case, each individual reaction mixture is digested with restriction enzymes and the resulting products clone separately in the following vector.

f. Library expressed related Fab-fragments

The library of expression vectors Fab fragments generated by the introduction of a pool of fragments of chain elongation by overlapping, hydrolyzed XhoI/NotI, vector JSK301 E. coli (11), by means of ligation. E. coli (TOP10) transform method of electroporation library of expression vectors Fab-fragments and select transformants on hot agar containing 100 μg/ml of carbenicillin. Plasmid DNA gender is given from the colonies immediately after removal from agar plates. For the conservation of biodiversity plasmid preparation is obtained from the minimum number of colonies of a single donor, corresponding to three times the total number of originally separate sorted plasma cells. The library expressed related Fab fragments generated by the introduction of the cluster prokaryotic promoter and leader sequence selected from the phh3 (Den, W. et al. 1999, J. Immunol. Methods 222, 45-57), the resulting plasmid preparation method of hydrolysis AscI and NheI and subsequent ligation. The library process shown in Fig. E. coli (TG1) transform method of electroporation library expressed related Fab-fragments and select transformants on hot agar containing 100 μg/ml of carbenicillin. Donors do not contact during execution of pocerady described in the publication Den et al., J. Immunol. Methods, 1999, Jan. 1; 222(1-2):45-57. However, if desired they can be together at any stage.

g. Screening of the clones

Fab-expressing clones are examined in relation to binding TT-antigen by the method of the antigen-specific ELISA.

g-1. Creating a basic tablets and expression of Fab fragments

Selected colonies of TG1 cells, each of which contains the expression vector of the related Fab-fragments from a library created on the stage (f), placed in individual wells of 96-well plates, containing the e hut/100 μg/ml Amp/1% glucose. Colonies grown by gentle shaking, overnight at 37°C. These tablets called basic tablets, stored at -80°C after addition of glycerol to a final concentration of 15%.

To send a basic tablet for storage they are used for inoculation of one or more 384-well plates containing hot/100 μg/ml Amp/0.1% glucose, using a 96-channel Replicator. The tablets stick and shake for 2-3 hours at 37°C.

Expression of Fab fragments induce, adding an equal amount hut/100 μg/ml Amp/0.2 mm IPTG to the final concentration of IPTG 0.1 mm. The tablets stick and shaken overnight at 30°C. the next day, Fab-containing supernatant analyze in terms of binding specificity TT-antigen using ELISA method.

g-2. The ELISA

384-well plates to ELISA (Nunc, Roskilde, Denmark, catalog No. 265196) sensibiliser over night at 4°C. the antigen tetanus toxin (TT), diluted to a final concentration of 0.1 μg/ml in PBS in a volume of 25 ál per well. Excess binding sites in the wells blocked for 1 hour at room temperature, adding 2% M-PBS-T (2% skimmed milk powder in PBS, 0.05% tween-20). The wells are washed twice PBS-T (PBS, 0.05% tween-20).

Fab-containing bacterial supernatant obtained in stage g-1, diluted in the relationship is 1:2 in 2% M-PBS-T and transferred in two copies in the wells for ELISA. The culture is incubated for 1 hour at room temperature. The wells washed four times BS-t wells add antibody goat to Fab complex/HRP person (Sigma, St.Louis, MO, USA, catalog No. A)diluted 1:10,000 in 2% M-PBS-T. the Culture incubated for 1 hour at room temperature. The wells four times washed with PBS-T. Add the TMB substrate Plus (KemEnTec, Copenhagen, Denmark, catalog No. 4390L) and incubated for 5-15 minutes. The reaction is stopped by adding an equal volume of 1M solution of N2SO4. The progress of the reaction is determined in the spectrophotometer for reading tablets for ELISA at 450 nm (Multiscan Ascent, Labsystems, Franklin, USA).

Then from the base of tablets remove the source of bacterial clones corresponding to the clones that bind TP-antigen. Of the selected antigen-positive clones Fab fragments receive plasmid DNA and create medbibliotekoy expressed related Fab fragments of clones that bind TP-antigen.

These clones can be subjected to ELISA using antibodies against the light chain to establish a correlation between the number of antigen-binding clones and the number of Fab-expressing clones. In addition, this analysis allows to get information about lung Kappa - and lambda chains in these clones.

h. Library expressed related antibodies

For obleceni the expression reprezentirovanii antibodies person related variable regions of bacterial vector for expression of Fab fragments must be transferred in expressing vector mammal, containing a constant region of human immunoglobulin one of the isotypes. Such transfer can be done in the serial or mass transfer clones. Below is described a method of mass transfer.

Mass transfer is performed in two stages. First collect plasmid preparations separately antigenspecific clones Fab-fragments. The cluster containing prokaryotic promoter and leader of posledovatelnosti, replace the cluster promoter and leader sequence of a mammal, consisting of a leader sequence of alkaline phosphatase person (leader sequence AR), promoter of the elongation factor 1-alpha man (EFP), adenovirus main late promoter (AdMLP), leader sequence IgK, by hydrolysis of medbibliotekoy collected expressed Fab fragments using AscI and NheI, followed by the introduction of the cluster promoter and leader sequence of a mammal, performed by legirovaniem. E. coli (TOP10) transform method of electroporation received by the library expressed Fab fragments is replaced with the promoter and select transformants on hot agar containing 100 μg/ml of carbenicillin. Plasmid DNA obtained from colonies immediately after removal from agar plates. For the conservation of biodiversity plasmid preparation poluchaets minimum number of colonies of a single donor, corresponding to approximately three times the total number of clones in the source library.

Then, by hydrolysis of plasmid preparation using XhoI and NotI, from the vector expression of Fab fragments is replaced with the promoter allocate the related variable sequence. The selection imposed by legirovaniem in expressing vector mammal, while receiving library expressed cognate antibodies. Used vector similar to that shown figa except that IgL in this case corresponds to the sequence that encodes a Kappa light chain. Above expressing vector mammal obtained on the basis of site-specific Flp-In (Invitrogen Corporation, Carlsbad, CA, USA, catalog No. C-01). E. coli (TOP10) transform method of electroporation received by the library expressed related antibodies and select transformants on hot agar containing 100 μg/ml of carbenicillin. Plasmid DNA obtained from colonies immediately after removal from agar plates. For the conservation of biodiversity plasmid preparation is again obtained from the minimum number of colonies of a single donor, corresponding to approximately three times the total number of clones in the source library. The obtained plasmid preparation from libraries expressed related antibodies can be used for transformation the functions of the host cell of the mammal, for example, cells SNO from the system Flp-In the company Invitrogen (Invitrogen Corporation, Carlsbad, CA, USA, catalog No. K-01), with the aim of creating a stable expressing cell lines of the mammal by integration, mediated by the Flp-recombinase. Such a cell line can be used for producing recombinant polyclonal antibodies.

Example 7. Screening by a membrane analysis of high-density

Fab-expressing clones from example 6f examined by a membrane analysis of high density.

A. Creating a basic tablets

Basic tablets are created in accordance with the description given on the stage (g-1) of example 6.

b. Getting PVDF membranes

PVDF (PVDF) membrane (Amersham, Uppsala, Sweden, catalog No. RPN2020F) sensibiliser TT-antigen, diluted to a final concentration of 1 μg/ml in PBS, overnight at 4°C in accordance with the manufacturer's instructions. Excess binding sites on the membranes blocked for 1 hour in 2% M-PBS (2% skimmed milk powder in PBS). Membranes are washed three times in PBS. The membrane is soaked in hot within a few minutes.

C. Consolidation of the clones

Consolidation of clones in 384-well tablets perform by transferring clones with a basic tablet for one or more 384-hole planetgov containing 20 ál hot/well using a 96-channel R is plicator.

Using 384-channel Replicator bacteria carry two copies on one or more of nylon membranes (Amersham, Uppsala, Sweden, catalog No. RPN2020B), located on the agar plates containing hot/Carb/1% glucose. Tablets incubated for 4-6 hours at 37°C.

d. Induction of expression of Fab fragments

PVDF membranes obtained at stage b, placed on agar plates containing hot/Carb/0.1 mm IPTG. Nylon membrane with a growing bacterial colonies are placed on top of the PVDF membrane (one nylon membrane on one PVDF membrane) on IPTG-containing agar plate. IPTG-containing agar plate incubated at 30°C overnight to facilitate IPTG-induced expression of Fab fragments from the colonies. Molecules of Fab-fragments penetrate the nylon membrane on PVDF membrane, which retains Fab fragments that bind TP-antigen.

E. Detection

Nylon membranes are removed and the PVDF membrane was washed with PBS-T (PBS, 0.05% tween-20), 2 times for 5 minutes. Membranes are incubated for 30 minutes with 2% M-PBS. PVDF membrane was washed with PBS-T, 2 times for 5 minutes and incubated for 1 hour with the antibody goat to the complex IgG/HRP person (Sigma, St. Louis, MO, USA, catalog No. A) at a dilution in 2% M-PBS in a ratio of 1:10000. PVDF membrane was washed with PBS-T 3 times for 5 minutes. And finally, PVDF membrane, incubated for 5 minutes with chemiluminescent with what stratum SuperSignal West Femto (Pierce, Rockford, Il, USA, catalog No. 34095) in accordance with the manufacturers instructions. Excess substrate is removed and the PVDF membrane is placed under the camera based on charge-coupled devices (CCD) for detection of the chemiluminescent signal arising in those provisions PVDF membrane, where Fab-fragment binds TT-antigen.

Positive clones that bind TP-antigen, appear on the image as points. The original bacterial clone then removed from the base plates. Of the selected antigen-positive clones Fab fragments receive plasmid DNA, thus creating medbibliotekoy expressed related Fab fragments of clones that bind TP-antigen.

f. Correlation between antihistamine clones and Fab-expressing clones

Nylon membranes removed at the stage that is placed on the second series PVDF membranes sensitized with antibody against the light chain or an antibody against Fab-fragments, the method described in stage b. Then repeat stage d. and E.

Fab-positive clones appear on the image in the form of points, it is possible to establish a correlation between the number of clones that bind TP-antigen, and the number of Fab-expressing clones.

Example 8. An example illustrating the selection of sequences encoding heteromeric protein

This example illustrates the prob is the possibility of one-step selection of the trimeric protein, linking guanidoacetic (G protein), using multiple RT-PCR with the elongation of the chain by the overlapping of the present invention. The family of subunits of a G protein is extensive, only in humans, there are about 16 different alpha-subunits, 5 beta-subunits and 12 gamma subunits. For this example were chosen subunit GαS (no access to a Bank of genes GenBank H), Gβ1 subunit (No. of access Bank of genes GenBank AF501822) and subunit Gγ1 (no access to a Bank of genes GenBank BC029367). The method of binding is shown in Fig, where stage 1 is the stage of multiple RT-PCR with lengthening the chain by overlapping and stage 2 is a stage additional amplification of the associated product.

A. Cells

The population of cells in human liver obtained from samples destroyed after performing surgical operations. Liver cells are destroyed and are lysed, total RNA isolated from the lysate using a set of RNA L (Macherey - Nagel, Duren, Germany, catalog No. 740962.20) in accordance with the manufacturers instructions.

b. Multiple RT-PCR with lengthening the chain by overlapping

To perform multiple RT-PCR with lengthening the chain by overlapping use the set for one-step RT-PCR of the company Qiagen (Qiagen, catalog No. 210212, Hilden, Germany) according to the manufacturer's recommendations.

Each swab for PCR contains in total volume, p the ate 50 ál, the following reagents:

a single buffer for one-step RT-PCR,

dNTP at a final concentration of 400 μm of each reagent

the mixture of multiple primers for elongation of the chain by the overlap in the concentrations shown in table 10,

2 μl of a mixture of enzymes for one-step RT-PCR,

1 u/μl of RNase inhibitor (RNasin, Promega, Madison USA, catalog No. N2515),

50 ng total RNA.

Used a mixture of multiple primers for elongation of the chain by the overlap contains the primers shown in table 10.

Table 10
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
α1400 nm80
α280 nm81
β180 nm82
β2 80 nm83
γ180 nm84
γ2400 nm85
The sequence designated by the capital letters correspond to the gene-specific region.

The reaction is performed in the following conditions cyclization:

Reverse transcription30 min42°C
Activation of the polymerase15 min95°Cinactivation of the reverse transcriptase and activation aq polymerase

The PCR reaction:

td align="left"> Lengthening chain
Denaturation30 sec94°C45 cycles
Hybridization30 sec49°C
3 min72°C
Final lengthening chain10 min72°C

C. Amplification by PCR

One microliter of the reaction product of multiple RT-PCR with lengthening the chain by overlapping subjected to further amplification by PCR (set Biotaq, Bioline, UK, catalog No. BIO-21040) in accordance with the manufacturer's recommendations. Use primers α1 and γ2, as shown in table 10, which correspond to SEQ ID NO:80 and 85. The total reaction mixture of 50 µl.

The reaction is performed in the following conditions cyclization:

Denaturation30 sec95°C25 cycles
Hybridization30 sec53°C
Lengthening chain3 min72°C
Final lengthening chain10 min72°C

Five microlitres the reaction product is analyzed by electrophoresis in % agarose gel, using for detection of ethidium bromide. The expected product size 2215 BP, However, can be additional unrelated fragments of these subunits. The expected sizes of these fragments is equal to: Gα - 1228 BP, Gβ - 1064 BP and Gγ - 262 BP

d. Cloning

The rest of the reaction product is subjected to electrophoresis in 1% agarose gel, using for detection of ethidium bromide, a fragment of chain elongation by overlapping length 2215 BP cut out from agarose gel, purified using the kit Qiaex II (Qiagen, Hilden, Germany, catalog No. 20051) and injected into pCR2.1-TOPO using the kit to clone the TORO company Invitrogen (Invitrogen, catalog No. 45-0641, Carlsbad, CA, USA).

In addition, at the top of the sequence encoding each subunit can be inserted promoter sequence or binding sites of the ribosome, to facilitate their expression from the vector. For such insert can be used restriction sites present in the sequences of chain elongation by overlapping.

E. General considerations

The above binding sequences encoding subunits, forming heteromeric protein can be performed for most heteromeric proteins with known sequence of the individual subunits. In addition, when using a mixture of multiple pry the development for chain elongation by overlapping, able to amplify several members of a certain family, for example, all α-, β - and γ-subunit of the G protein, you can identify and associate any combination of subunits from any cells without prior analysis, to determine the cell type which family members are expressed. For example, the method according to the above example can be performed using the matrix obtained from a separate liver cells using a mixture of multiple primers for elongation of the chain by overlapping able to amplify and link all of 16 subunits Gα 5 Gβ subunits and 12 Gγ subunits, allowing you to determine which combination of subunits expressed in each cell, and simultaneously highlight coding sequences that define this combination of subunits. In addition, degenerate primers can even be used to identify new members of a specific family.

When linking subunits heteromera protein with multiple RT-PCR with the elongation of the chain by the overlapping of the present invention it is necessary to consider the overall size of the associated product, as there are limits to the number of base pairs, amplificatoare DNA polymerase. Polymerase, Deep Vent company New England Biolabs, MA, USA, is a DNA polymerase capable of image is the close co very long primer extension, containing up to 14000 BP Theoretically 14000 BP can encode a protein with an average weight 510 kDa. Thus, the method according to the present invention can distinguish coding sequences for very large heteromeric proteins. Elongation of the chain can be further increased by using a mixture of DNA polymerases.

Example 9. Creating primers for leader sequences

In this example, we create multiple sets of primers in which the site of initiation is a sequence that encodes a leader region of the families of the heavy chain and Kappa light-chains of human antibodies.

When using primers hybridizers with N-terminal coding sequences of a family of variable regions may be some degree of cross-hybridization. The primers for the sequence of a particular gene family can hybreed with cDNA of another gene family, which in many cases causes the formation of new sequences. Proteins are formed from such sequences are potentially immunogenic when used for medicinal purposes. These new sequences can usually be corrected by using PCR or delete from library.

An alternative solution is the introduction site of initiation in the sequence, coding for the expansion of its leader peptide variable regions of antibodies. Hybrid sequence resulting from cross-hybridization will be removed during intracellular processing antibodies, which resulted in the leader peptide containing potential immunogenic sequence will be split and, therefore, will not be present in the secreted antibody. Known sets of primers for leader peptides designed for cloning antibodies, were located at the 5'-end sequence that encodes a leader peptide, making possible a direct expression of the eukaryotic cell (Campbell M.J. et al. 1992, Mol. Immunol. 29, 193-203). Unfortunately, the leader peptides of eukaryotic cells is poorly suitable for processing in a prokaryotic cell.

Easy manipulation of sequences of nucleic acids in bacteria makes an attractive building systems clone, in which you can transfer sequences between bacterial vectors and vectors for other organisms-owners. Therefore, in this example we have created multiple primer sets in which the site of initiation is in the position of the sequence, the coding region of the leader peptide, which makes possible the functional expression of the antibodies or fragments of antibodies in eukaryotic and prokaryotic expressing systems.

Requirements the project, requirements for cleavage of signal sequences peptidases in the C-terminal region of any leader peptide, apparently, very similar to prokaryotic and eukaryotic systems (Nielsen H et al., 1997, Protein Eng. 10, 1-6). In addition, from the above it follows that mutations in the C-terminal region of the leader peptide, is likely to have little impact on the conformation of the N-terminal region and Vice versa. Thus, it can be expected that C-terminal sequences can be transferred from one form to another without loss of functional activity.

The basic principle of creating primers in the present example was the location of the site of initiation in the last six codons of the C-terminal region of the leader peptide. The rest of the sequence that encodes a leader peptide at the top of the site of initiation (about 50 nucleotides) must be entered acceptable expressing vector corresponding to the biological species to the owner. For example, vectors suitable for expression in gram-negative bacteria, can be created using protestirovanny or reprezentirovannoe leader sequence PelB. For the expression of antibodies in eukaryotic suitable vector with protestirovanny sequence that encodes a leader peptide of the heavy chain of native antibodies, and protestirovanny sequence is, encodes a leader peptide of variable region Kappa-chain. Regardless expressing system last six amino acids of the leader peptide are formed from a sequence that encodes a leader peptide endogenous antibodies, which is a segment of nucleic acid that is inserted in the vector.

For use in multiple RT-PCR with lengthening the chain by overlapping were created following primers (table 11). However, the end segments of chain elongation by overlapping (lowercase letters) can be easily changed to use when linking by ligation or recombination.

Table 11
Name of primerSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
VHL86
87
88
89
90
91
92
CH(IgG)9
VLKL93
94
95
96
97
98
CLK99
M=A/T, R=A/G, Y=C/T, S=G/C Sequences are indicated by capital letters correspond to the gene-specific region.

It should be noted that the restriction sites in the conformation of primers were somewhat modified by sravnenie is with primers described in the previous examples. So, overlying sequence, located between the sequences encoding the variable regions of the heavy and light chains, contains the restriction site NotI and NheI, and the seed for the constant region of Kappa-chain (CLKpreviously existing NotI site was replaced by an AscI site. Last modification must be made when creating primers for additional amplification by PCR. In addition, the NotI site in the cloning vector, as shown figure 11, must be replaced by the website AscI and AscI site in the promoter must be replaced by a NotI site.

Functional properties related to the cleavage of the leader peptide were tested in silico using the program SignalP provided by CBS Danish technical University.

Chimeric leader peptides tested for the presence of variable regions of the heavy chain, were coded sequences of the nucleic acids consisting of protestirovanny the PelB sequence, C-terminal NotI site (SEQ ID NO 100: ATG AAA TAT CTT CTA CCA ACA GCG GCA GCT GGA TTA TTG GCG GCC GCC), and are associated with the site NotI gene-specific part of one of SEQ ID NO 86-92, encoding six C-terminal amino acids of the native members of the family VHL. Using the program SignalP it was found that all seven sequences are characterized by splitting signaling the peptides in gram-negative bacteria.

Chimeric leader peptides tested for the presence of variable region of the light chain, were coded sequences of the nucleic acids consisting of protestirovanny the PelB sequence, C-terminal NheI site (SEQ ID NO 101: ATG AAA TAT TTG CTA CCA ACA GCG GCA GCT GGA TTA TTG TTA CTA GCG), and are associated with the NheI site of the gene-specific part of one of SEQ ID NO 93-98, encoding six C-terminal amino acids of the native members of the family VLL. Using the program SignalP it was found that all six sequences are characterized by cleavage of the signal peptides in gram-negative bacteria.

Sequence SEQ ID NO 100 and 101 is suitable for a bacterial expressing vector, shown in figure 11, as the AscI site, shown at 11, replaced by SEQ ID NO 100 and the NheI site replaced with SEQ ID NO 101. In addition, the site NotI shown figure 11, must be replaced by the AscI site.

Expressing the vector mammal (Fig.9) similarly can be changed with the possibility of expression in mammalian cells after transfer of segments encoding the variable region of the newly described bacterial vector.

Example 10. Performing multiple RT-PCR and binding legirovaniem in one test tube

In the present example describes how to obtain related pairs, including associated follower of the spine, encoding the variable region of the heavy chain and the variable region of light chain, in one test tube when performing binding legirovaniem instead PCR elongation of the chain by overlapping.

A. Multiple RT-PCR

Obtained in our own laboratory cell line expressing the molecules of Fab fragments with specificity against tetanus toxin, distribute method limited cultivation of obtaining a single cell in one test tube for PCR.

Apart from one cell each swab for PCR contains the following reagents in a total volume of 20 ál:

once the buffer Phusion HF,

dNTP at a final concentration of 200 μm of each reagent

the mixture of multiple primers at concentrations shown in table 12,

of 0.8 units Taq polymerase Phusion (FinnZymes, catalog No. F-530-L),

1 μl Sensiscript reverse transcriptase (Qiagen, catalog No. 205213),

20 units of RNase inhibitor.

Table 12
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
VH200 nm of each102
103
104
105
106
107
108
109
JH200 nm of each61
62
63
64
VL200 nm of each110
111
112
113
114
115
CLK200 nm16
W=A/T, R=A/G, S=G/C Sequences are indicated by capital letters correspond to the gene-specific region.

The reaction is performed in the following conditions cyclization:

Reverse transcription30 min37°C
Denaturation30 sec98°C40 cycles
Denaturation10 sec98°C
Hybridization/td> 30 sec55°C
Lengthening chain30 sec72°C
Final lengthening chain5 min72°C

b. Linking legirovaniem

To perform the binding legirovaniem restriction enzymes and ligase are added directly to the reaction products of multiple RT-PCR. Alternative reaction product of multiple RT-PCR may be cleared to the above add for the maximum release of the mixture from the polymerase.

To each tube add the following reagents in a total volume of 40 μl:

once the buffer NEBII,

1 mm ATP,

50 units of XbaI (New England Biolabs, catalog No. R0145L),

25 units of SpeI (New England Biolabs, catalog No. R0133S),

100 µg/ml BSA,

400 units of DNA T4 ligase (New England Biolabs, catalog No. 0202S).

The reaction mixture was incubated at 16°C during the night.

Associated sequences encoding the variable regions of the heavy and light chains purified from the reaction mixture by gel electrophoresis, and cut out the band of approximately 1000 BP

Alternatively, this method multiple RT-PCR performed using primers for CNinstead p is amerov for J Nin multiple primer sets. The specified primer can have a clone terminal segment, which makes possible the introduction in the frame of the read variable regions of the heavy chain in expressing vector, or may be performed palugaswewa PCR using the primers shown in table 5.

Example 11. The development of recombinant polyclonal immunoglobulins with specificity against tetanus toxin

In this example, the results of immunization of one donor (TD) tetanus toxin (TT) with the description of the stages shown in the block diagram depicted in figure 10.

A. Donors

Eight donors, which previously were immunized tetanus vaccine, were subjected to booster immunization with tetanus vaccine (Statens Serum Institut, Denmark). Donors were given numbers TT - TT. Six days after the booster immunization with tetanus toxoid (TT) vaccine in donors took a blood sample of approximately 200 ml, which was introduced into a test tube with anticoagulant.

The donors were healthy, had no chronic infections and autoimmune diseases, did not take immunosuppressive funds and are not subjected to any vaccinations in the last 3 months.

a-1. Quality of blood samples obtained from donors

During immunization donors took prewar the positive blood samples. Fourteen days from donors took additional blood samples for determination of serum titer. All donors increased titer tetanus toxin (TT). In addition, he performed an analysis of the ELISPOT to measure the frequency of TT-specific plasma cells. For analysis ELISPOT you can use different fractions of cells, such as whole blood obtained on day 6, the fraction RVMS, the fraction obtained by magnetic sorting, or a fraction obtained by sorting by FACS method. The ELISPOT analysis can be used to assess donor material and identify the best cell-responders, which can then be used at the stage of sorting and multiple RT-PCR with lengthening the chain by overlapping. The ELISPOT analysis was performed for donor T using a fraction of CD19+ cells (see section C). The ELISPOT analysis was performed in accordance with the description given in the publication Lakew, M. et al., 1997, J. Immunol. Methods 203, 193-198, making minor changes. The frequency of TT-specific plasma cells in the faction RVMS were calculated equal 0,021%.

b. Obtaining mononuclear cells of peripheral blood (RVMS)

Cells RWMS was isolated from blood samples in the device Lymphoprep (Axis-Shield Grew up AS, Norway, production No. 1001967) in accordance with the recommendations of the manufacturer is of Italy. The blood was diluted in PBS in a ratio of 1:1 and the resulting suspension was introduced into the device Lymphoprep in the ratio 2:1. The tubes were centrifuged with an acceleration of 800 g for 20 minutes at 25°C and collected a band of interphase cells. Cells were washed in PBS containing 2 mm EDTA.

From 200 ml of whole blood taken from a donor TT was obtained approximately 2x108RUMS.

C. Enrichment In cells

Line b-cells (CD19+ cells) from RVMS enriched by sorting cells using magnetic granules in the following way.

Highlighted cells RVMS were stained with anti-CD19-FITC (Becton Dickenson, NJ, USA, catalog No. 345776). All stages were performed in a dark room at 4°C. Staining was producing 10 ál of anti-CD19-FITC to 1x106cells in a volume of 100 µl per 1x106cells using M-buffer (BS, pH of 7.2, with 0.5% BSA, 2 mm EDTA). The specified dye stains the line b-cells RVMS. Cells were incubated for 20 minutes and then washed twice M-buffer. Cells, stained with anti-CD19-FITC, were subjected to magnetic tagging with the help of microgranules, conjugated with anti-FITC-antibody, using 10 µl of magnetic granules sensitized with anti-FITC-antibody (Miltenyi Biotec, Gladbach, Germany, catalog No. 130-042-401), 1x106cells in a volume of 100 μl of M buffer to 1x106cells. Cells were incubated for 15 minutes and then once washed M-buffer. Cells secondary suspend is ovale in degassed M-buffer.

Column MACS LS (Miltenyi Biotec, Gladbach, Germany, catalog No. 130-042-401) was pre-treated with degassed M-buffer in accordance with the manufacturers instructions. A suspension of cells stained with anti-CD19-FITC and labeled with a magnetic bead, sencibilizirovannam anti-FITC-antibody was injected into the column by passing through it. Painted and labeled cells (CD19+) remained in the magnetic field surrounding the column, while the unpainted cells (CD19+) was passed through the column. The column was washed degassed M-buffer. The magnetic field was switched off and collected CD19+ cells.

Analytical staining of the source material (RVMS), unlabeled fraction and CD19 labeled fraction of the donor T produced using anti-CD19-FITC, anti-CD38-PE and anti-CD45-PerCP (Fig). The data obtained show that in the magnetic sorting of cells formed two different fractions compared with the fraction RVMS. CD19-negative cells, shown in block b, and CD19-positive cells, as shown in block C. Fraction RVMS contained 11% of CD19+ cells, and the degree of purification of CD19-positive cells was equal to 99.5% of the R1 (scatterplot, shown in figs) for T.

As shown in figs, scatterplot anti-CD38/CD45 helped to identify separate populations CD38hi, CD45in cells (R2)corresponding to 1.1% of R1. This population contained plasma cells and was with the bran at a later stage sorting. From the above it follows that in the faction RVMS 0.12% of cells corresponded to plasma cells.

The fraction of CD19-positive cells were frozen in FCS (Invitrogen, catalog No. 16000-044), containing 10% DMSO (Sigma, catalog No. D2650), for subsequent sorting. Analysis similar to that shown Fig, performed in the cells, purified in column (MACS that were frozen to ensure the integrity of cells (Fig). Painting staining, shown in Fig were similar to those shown in figs, although there was somewhat greater intensity of staining. Cells collected in the sort, represent a subpopulation of R1 and R2. This subpopulation represents approximately 1.1% of cells treated in the MACS column.

d. Sort of plasma cells

Frozen eluate obtained from the column MACS, thawed, centrifuged and re-suspended in FACS buffer (PBS, pH of 7.2, 2% BSA) at a concentration of 1x106cells/60 μl of buffer for FACS. Added anti-CD19-FITC (Becton Dickenson, NJ, USA, catalog No. 345776) (10 μl/106cells), anti-CD38-PE (Becton Dickenson, NJ, USA, catalog No. 555460) (10 μl/106cells) and anti-CD45-PerCP (Becton Dickenson, NJ, USA, catalog No. 345809) (20 μl/106cells), and the mixture incubated in the dark at 4°C for 20 minutes, then washed twice and re-suspended in FACS buffer.

Cells which were ortonovo method of sorting cells with excitation fluorescence (FACS), using the following sorting options:

1. Forward and side scattering to save lymphocytes and monocytes, including plasma blasts and plasma cells, and removal of dead cells and cells with very high lateral scattering, which can be units or granulocytes.

2. Cells are CD19-positive and Express elevated levels of CD38 (CD38hi). Similarly capture occurs mainly CD38 cells, as RVMS were enriched in column (MACS CD19 cells, but this method allows to detect any contamination.

3. CD45-intermediate positive cells. All cells Express CD45. However, plasma cells have lower expression of CD45 in comparison with earlier stages of differentiation of lymphocytes. Therefore, when the capture CD45 you can get a discrete population of cells corresponding to plasma cells.

FACS-sorted cells derived from the donor TT, collected in the form of a subpopulation, the resulting two sorts P2 and P1 (figa and 16B). These cells represented CD38hi (FL2-A), CD45in (FL3-A) and CD19+, the latter cells were obtained from a purification column MACS. Cells were collected in the total mass, counted and diluted in RPMI (Invitrogen, catalog No. 21875-034)containing 10% FCS (Invitrogen, catalog No. 16000-044), 100 edit the CI/ml penicillin-streptomycin (Invitrogen, catalog No. 15140-122), 2 mm L-glutamine (catalog No. 25030-024). Then the cells were distributed in fifty 96-well plates for PCR (ABgene, catalog No. AB-0800) in the amount of one cell per well in 5 µl of the environment. The tablets were sealed immediately frozen and kept for later analysis RT-PCR.

that is, the Linking of related pairs of sequences coding for variable regions of immunoglobulin

Multiple RT-PCR with lengthening the chain by overlapping performed in respect of individual cells obtained from a donor T, the result of which was produced cognate binding transcribed sequences encoding the variable region of the heavy chain and the variable region of the light chain of antibodies against tetanus toxin.

e-1. Single-stage multiple RT-PCR with lengthening the chain by overlapping

To perform multiple RT-PCR with lengthening the chain by overlapping used the set for one-step RT-PCR of the company Qiagen (Qiagen, catalog No. 210212, Hilden, Germany) according to the manufacturer's recommendations. Fifty frozen 96-well plates for PCR containing approximately one cell in each well were removed from the refrigerator and, when the hole had no ice crystals in each well was immediately added to 15 μl of the reaction mixture for RT-PCR.

The reaction mixture is for RT-PCR included in the total, equal to 20 ml, the following reagents:

a single buffer for one-step RT-PCR,

dNTP at a final concentration equal to 400 μm of each reagent

the mixture of multiple primers for elongation of the chain by the overlap in the concentrations shown in table 13,

0,8 µl of a mixture of enzymes for one-step RT-PCR,

20 units of RNase inhibitor (RNasin, Promega, Madison, USA, catalog No. N2515).

The composition of the mixture of multiple primers for elongation of the chain by overlapping shown in table 13.

Table 13
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
VH40 nm each116
117
118
119
120
121
122
123
CH(IgG)200 nm9
VL40 nm each124
125
126
127
128
129
CLK200 nm130
W=A/T, S=G/C, R=A/g Sequence, indicated by capital letters according to the indicated gene-specific region.

The reaction was performed in the following conditions cyclization:

Reverse transcription30 min55°C
Activation of the polymerase15 min95°Cinactivation of the reverse transcriptase and activation aq polymerase

The PCR reaction:

Denaturation30 sec94°C35 cycles
Hybridization30 sec52°C
Lengthening chain5 min72°C
Final lengthening chain10 min72°C

e-2. Additional amplification

One microliter of the reaction product of multiple RT-PCR with the elongation of the chain by the overlapping of each sample was subjected to palugaswewa PCR (set Biotaq, Bioline, catalog No. BIO-21040) in accordance with the manufacturer's recommendations, use the Zuya 96-well plates to PCR (ABgene, catalog No. AB-0800). Each reaction mixture, which volume was 50 µl, contained a single Biotaq buffer, 200 μm dNTP (each reagent), 2 mm MgCl2, 1,25% Bio Taq polymerase and the primers shown in table 14.

Table 14
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
JH200 nm of each61
62
63
64
CLK200 nm21

The sequence designated by the capital letters correspond to the gene-specific region.

The reaction was performed in the following conditions cyclization:

Denaturation30 sec95°C30 cycles
Hybridization30 sec55°C
Lengthening chain1.5 min72°C
Final lengthening chain5 min72°C

Ten Microlitre samples from row a, wells 1-12 each tablet, was analyzed by electrophoresis in 1.5% agarose gel using to visualize ethidium bromide, to verify the successful execution of multiple RT-PCR with lengthening the chain by overlapping. The expected fragment length of chain elongation by overlap was equal to about 1070 BP (the exact size depends on the length variable regions). On Fig shows the samples taken from eight 96-well plates. As a result of successful implementation of RT-PCR with lengthening the chain by overlapping with fifty 96-well plates were obtained an average of eight fragments of the same tablet. Thus, the total number of fragments received as a result of successful implementation of RT-PCR with lengthening the chain by overlapping, were equal to approximately 400.

f. Library expressed related Fab-fragments

Library expressed Fab fragments was established by the method of two-stage ligation. Pool above the hydrolyzed fragments of chain elongation by overlapping ligated with the vector JSK301 E.coli, hydrolyzed XhoI/NotI (11). Legirovannye the product is then transferred in electrocompetent cells of E. coli (competent for electroporation XL1-Blue, Stratagen, catalog No. 200228, La Jolla, USA) according to the manufacturer's instructions. The transformed E.coli cells were cultured in 2xYT agar containing 100 μg/ml of carbenicillin. Biomass, equivalent to about 1010-1011cells obtained from independent colonies, which in the end is th least 5 times greater than the total number of PCR products with lengthening the chain by overlapping, used as starting material to obtain plasmid preparation using the set to obtain the plasmid Maxi company Qiagen (Qiagen, catalog No. 12163, Hilden, Germany). For the expression of Fab fragments cloned related and linked VH - and VL-coding sequences in the second stage ligation into the vector was introduced cluster prokaryotic promoter and leader sequence. Used a fragment of the bi-directional promoter (SEQ ID NO:321) were extracted from the original vector JSK301 hydrolysis AscI/NheI. Purified pool of plasmids similarly hydrolyzed restriction endonucleases AseI/NheI and was purified from the gel as described above. Purified fragments are then ligated and transferred in electrocompetent cells of E. coli (TG1, Stratagene, catalog No. 200123, La Jolla, USA) and were cultured on hot agar containing 100 μg/ml carbenicillin and 1% glucose. The process of creating a library of expressed Fab fragments shown in Fig.

g. Screening of the clones

Fab-expressing clones investigated in relation to binding TT-antigen using antigen specific ELISA assays.

g-1. Creating a basic tablets and expression of Fab fragments

Selected colonies of TG1 cells, each of which contain the expression vector related Fab-fragments from a library created in section (f), introduced in individual p the e the wells of 96-well plates, containing hot/100 μg/ml arb/1% glucose. The plates were incubated, with gentle shaking, overnight at 37°C. Four 96-hole tablet combined in the wells of one 384-tablet containing hot/100 μg/ml Carb/1% glucose, using a 96-channel replicators. 384-well plates were incubated for days at 37°C. These tablets called the base of the tablets were stored at -80°C after addition of glycerol to a final concentration of 15%.

The base plates were used for incubation 384 deep well plates containing hot/100 μg/ml Carb/0.1% glucose, using a 96-channel Replicator. The tablets were sealed and incubated, with shaking, for 2-3 hours at 37°C.

Expression of Fab fragments was induced by adding equal volume hut/100 μg/ml Carb/0.2 mm IPTG to the final concentration of IPTG 0.1 mm. The tablets were sealed and incubated, with shaking, overnight at 30°C. the next day supernatant containing Fab fragments were analyzed by the method of ELISA for binding specificity TT-antigens.

g-2. The ELISA

384-well plates to ELISA (Corning Inc., Corning, NY, USA, catalog No. 3700) was senzibilizirani over night at 4°C. the antigen tetanus toxin (TT), diluted to a final concentration of 1 μg/ml in PBS in a volume of 25 ál per well. Excess binding sites in lunch the x blocked for 1 hour at room temperature (RT), adding 2% M-PBS-T (2% skimmed milk powder in PBS, 0.05% tween-20). The wells twice washed with PBS-T (PBS, 0.05% tween-20).

Fab-containing bacterial supernatant obtained in stage g-1, diluted in ratio 1:2 in 2% M-PBS-T and transferred in two copies in the wells for ELISA. The culture were incubated for 1 hour at room temperature. The wells four times washed BS-t, the wells were added to the antibody goat to Fab complex/HRP person (Sigma, St.Louis, MO, USA, catalog No. A)diluted 1:10,000 in 2% M-PBS-T. Culture were incubated for 1 hour at room temperature. The wells four times washed with PBS-t was Added to the substrate TMB Plus (KemEnTec, Copenhagen, Denmark, catalog No. 4390L) and incubated for 5-15 minutes. Reactions were stopped by adding equal volume of 1M solution of N2SO4and the reaction product was analyzed in a spectrophotometer at 450 nm (Multiscan Ascent, Labsystems, Franklin, USA).

Primary bacterial clones corresponding to the clones that bind TP-antigen can then be removed from the base plates. Of the selected anthopological clones Fab fragments can be obtained plasmid DNA with the creation of medbibliotekoy expressed related Fab fragments of clones that bind TP-antigen.

A subpopulation of clones was further analyzed using ELISA method using antibodies against Kappa-chain to establish a correlation between the number of antigenspecific clones and the number of Fab-expressing clones. Analysis using antibodies against Kappa-chain was usually performed in the form of analysis using TT-antigen except in those cases where the wells were senzibilizirani antibody goat against Kappa-chain man, diluted in ratio 1:1000 (Caltag, California, USA, catalog No. N)using carbonate buffer, pH 9,6.

g-3. The screening results

Clones from four 384-well plates were examined for reactivity against antibodies against Kappa-chain and TT-antigen using ELISA assays as described in section g-2. The results obtained are summarized in tables 15-19. The results of ELISA analysis using antibodies against Kappa-chain indicate the expression of Fab fragments in this clone, and the results of ELISA analysis using TT-antigen indicate the functional activity of the Fab-fragments.

Table 15
Screening using ELISA method with sensitizing antibody against Kappa-chain (a total of 1440 clones)
No. tablet2-fold background reactivity3-fold background reactivity4-fold the background reactivity
G050 1057973
G051937968
G0521209673
G053164141125
Amount482395339
% Fab-positive clones34%27%24%

From 1440 individual clones analysed, 482 clone or 34% had reactivity against antibodies against Kappa-chain level greater than 2 times background reactivity. 395 clones or 27% had a reactivity greater than 3-fold background reactivity, etc.

The same clones were analyzed by the method of ELISA for reactivity against TT-antigen; the results are shown in the following table 16.

Table 16
Screening using ELISA method with sensitization TT-antig the nom (a total of 1440 clones)
No. tablet2-fold background reactivity3-fold background reactivity4-fold the background reactivity
G050261917
G051241815
G052343124
G053463630
Amount13010486
% TT-positive clones9,0%to 7.2%6,1%

From the above table it is seen that 9.0% of the clones have reactivity against TT-antigen at the level of 2-fold background reactivity (defined as the signal obtained on the basis of reactivity of Fab-fragment with irrelevant specificity). 104 clone interacted at the level of 3-fold background p the activity (7,2%), etc.

From Fab-positive clones (total of 482 clone) approximately 27% of the clones (130/482) had reactivity against TT-antigen at the level of 2-fold background reactivity. This level does not change substantially when other levels of background reactivity.

Six 384-well plates was investigated to detect clones with reactivity against TT antigen. The number of clones with reactivity against this antigen are shown in table 17. These tablets are not performed ELISA analysis using antibodies against Kappa-chain.

Table 17
Screening using ELISA method with sensitization TT-antigen (just 2160 clones)
No. tablet2-fold background reactivity3-fold background reactivity4-fold the background reactivity
G054826552
G0555302421
G0562523 21
G057302826
G058242119
G059181413
Amount209175151
% TT-positive clones9,7%8,1%7,0%

The percentage of TP-positive clones on tablets G054-G059 was comparable with the value found for tablets G050-G053 (table 16).

The results obtained for all clones examined in relation to TT antigen (tables 16 and 17), are summarized in table 18.

Table 18
All investigated clones, TT-reactive clones
Tablets2-fold background reactivity3-fold background reactivity4-fold the background of reaction is Yunosti
G050-G05313010486
G054-G059209175151
Amount339279237
% of the total number of clones (3600)9,4%7,8%6,6%

A total of 339 clones had reactivity against TT-antigen by at least 2-fold background reactivity (table 18). The obtained result corresponds to 9.4% of all investigated clones.

All positive clones with reactivity against TT-antigen at the level of 2-fold background reactivity was inoculable basic tablet on the above 96-well plates. The next day, bacteria were collected by centrifugation speeds of 4000 rpm for 15 minutes, the precipitate again suspended in 0.8 mm EDTA, 0.4 x PBS, 0.8 M NaCl, and incubated on ice for 15 minutes. Periplasmatic the extract was collected by centrifugation and analyzed the reactivity of the clones. Below are the results of reactivity to one tablet (G060) in respect of antic the La against Kappa-chain (Fig), of ovalbumin (unrelated antigen) (Fig), TT-antigen (Fig) and the results of single-stage competitive analysis using TT-antigen at a concentration of 10-7M in solution (Fig). The above ELISA assays performed on the same periplasmatic extract at the same dilution.

Most of these clones expressed Fab fragments (90/96) (Fig), while none of the clones do not interact with ovalbumin (Fig). Reactivity against immobilized TT-antigen was lower or completely suppressed TT-antigen in solution (Fig), indicating that the clones specifically interact with TT antigen. The reactivity indices clones on the tablet G060 summarized in table 19.

Table 19
The tabulation for the tablet G060 (a total of 96 clones)
The background levelClones with positive reactivity to the antibody against the Kappa-chainTT-positive clones
2-fold94% (90/96)74% (71/96)
3-fold91% (87/96)72% (69/96)
4-fold84% (81/96)69% (66/96)

h. The analysis of diversity and confirmation of the clones

The plasmids isolated from 47 clones (with tablet G060) medbibliotekoy expressed related Fab fragments that bind TP-antigen were subjected to sequence analysis. Sequence encoding the variable region of the heavy chain, sequenced using primer LSH-HCP: AGGAAACAGGAGATATACAT (SEQ ID NO:131) and hybridisable with R tac promoter; sequence encoding the light chain, sequenced using primer LSN-LCP: TCGCCAAGGAGACAGTCATA (SEQ ID NO:132) and hybridisable with P lac promoter. Data sequencing sequences were analyzed using the software Vector NTI (Informax, Frederick, MD, USA). The data obtained for the sequence of the heavy chain, cut to one base pair at the 5'-end upstream of the AscI restriction site and the 3'-end at the bottom from the restriction site XhoI. The data obtained for the sequence of light chain, cut to second base pair at the 5'-end upstream of the restriction site NheI and 3'-end of the last codon of “AAA”encoding C-terminal lysine variable chain. The cut was made to facilitate further analysis, such as the translation of each DNA sequence.

The sequence encoding the variant is belinya region of the heavy and light chains, analyzed regarding the use of the gene in the germ line by comparing these sequences with the database sequences encoding the variable region germline-based V-gene (MRC Centre for Protein Engineering, Cambridge, UK). Thus was determined the closest related germline allele for each sequence containing a set of V-genes from 12 different alleles germline variable region of the heavy chain-related VH-family VH1-VH5, and from 8 different alleles germline variable region Kappa light-chain-related VK1, VKIII and VKIV (table 20).

In addition, the sequence of variable region gene was aired in protein sequences that were subjected to comparative analysis using AlignX software (Informax, Frederick, MD, USA), as shown in figures 22 and 23. On the basis of comparative analysis of protein sequences sequences of variable regions of a circuit can be distributed in groups in accordance with rearrangeable V(D)J, is marked with the letter N for the sequence of variable region of the heavy chain and the letter L for the sequence of variable region of Kappa-chain, followed by the identification number. In each group rearrangement sequence distributed according to g is notion maturation (M-type in table 20) hypervariable sites CDR1, 2 and 3, denoted by a lowercase letter in alphabetical order. Seven clones contained immature termination codons, of which 6 clones had an amber mutation (TAG) (identification number of clones g060:b12, d08, f06, c12, f03, c04) and 1 clone had opal-mutation (TGA) (identification number of the clone g060:h12). These codons were most likely suppressed E. coli with the formation of functional Fab fragments. Four of these clones were members of groups containing a similar clones, making them redundant. It was necessary to make the analysis of additional clones to replace the remaining 3 clone with immature termination codons, as they were the only members of their groups. Alternative these sequences could be corrected by standard methods of molecular biology such as PCR, replacement termination codon acceptable codon.

47 analyzed sequences of the V-region can be divided into 20 groups with clear rearrangeable V(D)J (denoted by “groups” in table 20) depending on the gene variable regions of the heavy chain and the variable region of the Kappa chain. Four of these groups rearrangement was further divided into 1-4 type maturation (a-d), resulting in 27 unambiguous antitelomerase sequences (table 12). Specific groups of rearange ovci heavy chains are usually combined with specific groups of light chain rearrangement (for example, H1 to L1, H12 with L24 and so on). In addition, the type of maturation is consistent in pairs of sequences encoding the variable region of the heavy chain and the variable region of light chain (e.g NS consistent with L13c). This strictness is pairing up in groups rearrangement types and maturation indicates the sibling mating sequences encoding variable regions.

However, the group rearrangement of the heavy chain H4 is the exception. N4 is coupled with two different light chains L28 and L13. L13 was the only chain H4, including the types of maturing a, b and C, which are consistent with the types of maturation L13. On the other hand, it was also discovered that L28 mates with one of the members in the group heavy chain H2. Two of the seven sequences of the heavy chain Na mate with a heavy chain L13a, and five of the seven sequences of the heavy chain Na mate with L28a. These observations suggest that when performing multiple RT-PCR with lengthening the chain by overlapping in each well were two plasma cells, producing TT-specific antibody, with combinations of genotypes H2-L28 and Na-L13a. Rare permutation sequences mating genes light and heavy chains, such as H2 and Na with L28, was expected, as the experiment was performed by the method of limited razvedeni the plasma cells.

The identities of the sequences in a separate related pairs of sequences encoding the variable region of heavy and variable region light chain belonging to the same group and type of maturation equal to at least 90% and preferably at least 95%. When considering, for example, g060g03 and g060a01 from the group H1 with the type of maturation and it turns out that the clone g060g03 corresponds to a pair of nucleotide sequences SEQ ID NO 168:215, where the sequence encoding the variable region of the heavy chain corresponds to SEQ ID NO 168 and a sequence encoding a variable region light chain corresponds to SEQ ID NO 215. Clone g060a01 corresponds to a pair of nucleotide sequences SEQ ID NO 133:180. When comparing SEQ ID NO 168 to SEQ ID NO 133 (variable regions of the heavy chains) 4 369 bases are not identical and variable regions of light chains (SEQ ID NO 215 and 180) 8 of 327 bases are not identical, which corresponds to 98,3% identity to the sequences of two related pairs (g060g03 and g060a01). However, when considering the identity of the sequences in different groups cannot expect high-identity sequences, as this library is polyclonal medbibliotekoy, in which it is desirable variety. In this example, the lowest identity in related pairs is equal to PR is about 40% (e.g., g060b11 and g060h11 characterized by the identity of sequences equal to 39.5%).

One way of implementing the present invention relates to medbibliotekoy related pairs of sequences encoding the variable region of the heavy chain and the variable region of the light chain of the immunoglobulin, the immunoglobulin derived from the specified library can interact or communicate with tetanus toxin.

Another variant of implementation of the present invention refers to medbibliotekoy related pairs of sequences encoding the variable region of the heavy chain and the variable region of the light chain of the immunoglobulin, which has a separate sibling pairs with sequence identity equal to at least 90%, selected from the group comprising SEQ ID nos pair 135:182, 168:215, 146:193, 151:198, 173:220, 152:199, 164:211, 148:195, 137:184, 169:216, 138:185, 143:190, 161:208, 166:213, 157:204, 139:186, 134:181, 150:197, 156:203, 158:205, 170:217, 178:225, 141:188 or 144:191.

Table 20

The asterisk indicates the sequences encoding the variable regions that are subjected to permutation. In the column “protein sequence” (Seq.prot.) show the numbers SEQ ID from the list of sequences corresponding to protein sequences, and in the column “nucleotide consequently is here” (Seq nucl.) show the numbers SEQ ID corresponding to the sequences of nucleic acids in the list of sequences.

i. The apparent affinity

Competitive analysis was performed to determine the apparent affinity or IC50selected clones from the tablet G060.

Fab fragments expressed in 50 ml cultures as follows: to 50 ml hot/100 μg/ml Carb/0.1% glucose was added 0.5 ml of culture, which is done during the night, and was shaken for 2 hours at 37°C. Then was added IPTG to a final concentration of 0.1 mm, and continued to shake overnight at 30°C. the next day, bacteria were collected by centrifugation speeds of 4000 rpm for 15 minutes, the precipitate again suspended in 1 ml of 0.8 mm EDTA, 0.4 x PBS, 0.8 M NaCl and incubated on ice for 15 minutes. Periplasmatic the extract was collected by centrifugation and stored at -20°C.

Competitive analysis was performed as follows: periplasmatic extracts with an appropriate dilution, determined by titration, was introduced in several tubes. As a positive control sample used Fag-fragment mp584 received by the display on the phage that was isolated from the cell line of hybridoma person NV expressing antibody against TT antigen. Soluble TT was added to the first tube at a concentration of 100 nm, and for four hundred who s consistently bred in other tubes, in resulting in a total of seven dilutions TT (from 100 nm to 25 PM). The reaction mixtures were incubated for 45 minutes at room temperature. Samples transferred to the plates for ELISA, sensitised TT in the amount of 1 μg/ml and blocked as described above. The plates were incubated for 1 hour at room temperature, then four times washed with PBS-T, was added to the antibody goat to Fab complex/HRP person in the ratio of 1:10,000 and incubated for 1 hour. Added substrate TMB Plus (KemEnTech, Denmark, catalog No. A), cultures were incubated for about 10 minutes and stopped the reaction by adding 1 M solution of N2SO4. The tablets were read at 450 nm. A graph of the data shown in Fig.

The magnitude of the apparent affinity of the analyzed clones are shown in table 21.

Table 21
CloneThe apparent affinity
g060a100,50 nm
g060b06of 0.60 nm
g060b121.2 nm
g060c040,55 nm
g060d04 1,1 nm
g060f011.2 nm
g060g040,9 nm
g060g070,35 nm
g060h113,0 nm
mp584 (positive control)6,0 nm

As shown in table 21, Fab-fragments have an apparent affinity in the lower Nanomolecular or higher economicaland range. In addition, all related paired Fab-fragments are characterized by a higher apparent affinity compared to the Fab-fragment, obtained as displayed on the phage.

j. A brief overview

The frequency of TT-specific plasma cells in the fraction of monocytes peripheral blood from a donor TT was calculated equal to 0.022%. The blood donor TT was created about 400 sibling pairs. 3600 clones from cells transformed with the library of cognate pairs, were examined by the ELISA method, it was found that 339 of these clones was characterized by reactivity against TT when performing screening using ELISA method. 47 of these clones were analyzed to determine their clonal diversity. 47 these clones 27 clones was similar to unambiguous not subjected to permutation sequences, encoding the variable regions. Three of these clones contained immature termination codon, which requires correction before being transferred to the expressing vector mammal. Transfer expressing vectors mammal described in example 1, section h. The apparent affinity measured in the selected clones ranged from lower Nanomolecular to a higher ecomonitoring range.

k. Prospects

Tetanus toxin is one of the most well-known toxic substances, lethal dose which is equal to a few nanograms. The indicated toxin produced by Clostridium tetani, soil bacteria present in the digestive tract in 25% of people. The program of vaccination against tetanus has enabled us to effectively fight this disease in the Western world, although in Western countries still identified annually 100-200 cases, and the relationship between morbidity and mortality is 50%. In developing countries, the incidence of tetanus is much higher. The growth of bacteria in contaminated penetrating wounds triggers the release of the toxin, which ultimately leads to rigidity, spasms, respiratory failure and death.

Products hyperimmune immunoglobulins isolated from the blood of people with high titer humoral IMM is the TES reaction against tetanus toxin, can be used for prevention or treatment of tetanus at an early stage, as well as in combination with active vaccination. However, because of lack of human product in developing countries using hyperimmune antibody horses against tetanus toxin. Recombinant monoclonal or polyclonal antibodies against tetanus toxin can replace products hyperimmune globulin in therapeutic and/or prophylactic purposes. In the scientific literature described the successful application against TT recombinant monoclonal antibodies obtained by a known method on the basis of cells hybridoma (Chim, J. et al. 2003, Biolgicals 31, 45-53). It is interesting to note the presence of synergistic effects when mixing two monoclonal antibodies. Thus, recombinant polyclonal antibody against tetanus toxin, able to interact or communicate with tetanus toxin, could potentially be very effective for the treatment or prophylaxis of individuals with an increased risk of tetanus.

One way of implementing the present invention relates to recombinant polyclonal immunoglobulin or its fragments can interact or communicate with tetanus toxin.

The preferred implementation of the present invention relates to p is combinantion polyclonal immunoglobulin, able to interact or communicate with tetanus toxin, which consists of cognate pairs of variable region of the heavy chain and the variable region of the light chain of the immunoglobulin.

Another variant of implementation of the present invention relates to recombinant polyclonal immunoglobulin able to interact or communicate with tetanus toxin, which is produced by the method according to the present invention.

Another variant of implementation of the present invention relates to recombinant polyclonal immunoglobulin able to interact or communicate with tetanus toxin, which contains a separate cognate pairs of variable region of the heavy chain and the variable region of the light chain immunoglobulin having at least 90% sequence identity with one individual pair of SEQ ID selected from the pairs of SEQ ID 229:276, 262:309, 240:287, 245:292, 267:314, 246:293, 258:305, 242:289, 231:278, 263:310, 232:279, 237:284, 255:302, 260:307, 251:298, 233:280, 228:275, 244:291, 250:297, 252:299, 264:311, 272:319, 235:282 or 238:285.

Another variant embodiment of the invention relates to pharmaceutical compositions containing as active ingredient a recombinant polyclonal antibody is able to interact or communicate with tetanus toxin, which is intended for the treatment or prevention of the table is NACA. Recombinant polyclonal antibody is preferably combined with pharmaceutically acceptable filler.

Another variant of implementation of the present invention relates to the use of recombinant polyclonal immunoglobulin able to interact or communicate with tetanus toxin, as a drug for treatment or preventive protection of the individual with an increased risk of tetanus.

An additional variant embodiment of the invention relates to a method for prevention or treatment of an individual with an increased risk of tetanus by introducing a needy individual compositions containing recombinant polyclonal antibody is able to interact or communicate with tetanus toxin.

Example 12. Comparison of results obtained from two donors

In the following example, the results obtained from the donor T, are compared with the results obtained from the donor T in example 11. The results are summarized in table 22.

Table 22
TTTT
TT-specific plasma cells in the faction RVMS (ELISPOT 0,021%0,011%
CD19+ cells in the faction RVMS (FACS)11%5%
Plasma cells in the faction RVMS (FACS CD38gi, CD45in)0,12%0,08%
Set the number of connected VNand VLsequences400400
The number of clones examined in relation to the expression of Fab fragments14002000
The number of Fab-positive clones (2 times the background level)482558
The number of clones examined in relation to TT-specificity36003400
The number of TT-specific clones (2 times the background level)339188
The number of sequences subjected to analysis of TT-specific clones47102
Alleles germline VH 12(VH1-5)NA
Alleles germline VL8(VKI,III,IV)NA
The number of unambiguous related pairs2740
The range of apparent affinity0,35-3,0 nmNA
NA = analysis not performed

This example clearly shows that the two different donors immunized with TT, can be obtained from libraries of equal quality.

Having a greater number of unequivocal of related pairs in the library, obtained from donor T, likely due to the large number of analyzed sequences.

Example 13. Comparison of the library of cognate pairs in example 11 with the display on the combinatorial phage library obtained from the same donor

In this example, displayed on a combinatorial phage library was obtained from the donor, the blood which has been previously used to obtain a library of cognate pairs, in order to compare diversity, affinity and specificity of libraries of related pairs and combinatorial libraries.

A. The creation of combinatorial libraries on phage

Displayed nupage library was created from a fraction of CD19 +cells derived from the donor TT (identical to the fraction of cells obtained in example 11C).

Total RNA was obtained from about 5×106CD19+cells using a kit NucleoSpin RNA L (Machery-Nagel, catalog No. 740962.20). Then synthesized cDNA by performing the reaction initiated by oligo(dT)-priming, using ThermoScript reverse transcriptase (Invitrogen, catalog No. 11146-016).

VN- and Kappa-chain amplified by PCR using Taq DNA polymerase HotMaster (Eppendorf, catalog No. 0032002.692) and the primers is essentially the same as described in the publication de Haard et al., J. Biol. Chem. 274, 18218-18230; 1999), which were modified only sequence recognition restriction enzymes at the 5'-end.

Displayed on the phage combinatorial library was generated by sequential PCR products introduction Kappa and VN-chain phage display vector Em351 (modified from the vector phh3 described in the publication Den, W. et al. 1999, J. Immunol. Methods 222, 45-57).

The final library was electroporative in strain TG1 E. coli (Stratagene). Combinatorial library contained 3x106independent clones with a high frequency of insertions.

b. Panning combinatorial libraries

Phage particles displaying Fab fragments were obtained by standard methods (e.g., Antibody Engineering, A Practical Approach, 1996, ed. McCafferty, Hoogenbom and Chiswell).

Panning issue is lnai against tetanus toxin (TT; SSI, no party 89-2)diluted to 1 μg/ml in PBS and immobilized in the test tubes for immunoassay MaxiSorp (Nunc, catalog No. 444202). The cultures were incubated for one hour and washed several times associated phage particles were suirable using 100 mm tea (triethylamine).

The eluate of phage particles neutralized and used to infect exponentially growing TG1 cells, which were obtained phage particles displaying Fab fragments with high specificity to TT antigen. The second cycle of panning using buervenich phages was performed above the standard way.

In parallel performed three cycles of panning in relation To fragment molecules tetanus toxin (Sigma, catalog No. T) after the above-described method.

Individual colonies were tested bound to tetanus toxin and C-fragment coming from the library and after each cycle of panning in both series of the above penninga.

C. comparison of the specificity and affinity of combinatorial clones of phage particles and clones related pairs

Individual colonies were obtained from coming to the library and after each cycle of panning (in respect intact tetanus toxin (TT) and C-fragment of tetanus toxin). Phage particles displaying Fab fragments were analyzed on a PE is aktivnosti using ELISA assays. The number of Fab-positive clones with reactivity to TT and/or slice equal to at least 2-fold background reactivity and at least 4-fold background reactivity, listed in the following tables 23-25. All results are expressed as the ratio of the number of specific clones among the Fab-positive clones.

Table 23
Clones selected against TT and subjected to TT-specific ELISA
Enrichment2-fold background reactivity4-fold the background reactivity
Coming clones-13/approximately 5000
After 1 cycle of panning61/9959/93
After 2 cycles of panning165/169163/166

Table 24
Clones selected against TPS and subjected to ELISA analysis specific to the C-fragment
Enrichment2-fold background reactivity4-fold the background reactivity
Coming clones0/130/13
After 1 cycle of panning0/850/85
After 2 cycles of panning0/850/85

Table 25
Clones selected in relation to the C-fragment and subjected to ELISA analysis specific to the C-fragment
Enrichment2-fold background reactivity4-fold the background reactivity
After 1 cycle of panning1/350/35
After 2 cycles of panning12/479/47
After 3 cycles of panning64/12626/126

Panning displayed on the phage library against TT was possible to identify an increasing number T is-specific clones with increasing number of cycles of panning, in coming to the library was identified only a few clones. In coming to the library or after two cycles of panning library against TT was not detected clones with reactivity to the C-fragment of tetanus toxin. To obtain Fab fragments with specificity for the C-fragment displayed on the phage combinatorial library named library it was necessary to expose panning specifically against the C-fragment.

For comparison thirteen TT-specific clones from seven clones with reactivity higher than 2-fold background reactivity in example 11 was subjected to ELISA analysis specific to the C-fragment. Thus, Fab fragments with specificity for the C-fragment of tetanus toxin can be Express from the library of cognate pairs, obtained from the blood of the TT-immunized individual.

This example clearly shows the disadvantage of using panning to identify clones with specificity to a specific antigen. Unknown important fragments or epitopes of the antigen can be skipped during panning, which received a less efficient product.

In addition, the method described in the analysis for example 11i, measured the apparent affinity of combinatorial clones. Analyzed ten combinatorial clones obtained after two cycles of panning in which the compared TP, thus were obtained the values of the apparent affinity of the binding in the range from 1 to 15 nm.

When comparing four of the nine clones analyzed from the library of cognate pairs (table 21), we obtained the values of affinity in economicaland range.

The results show that the pairing of the variable regions, originally selected by the immune system of the donor, in combination with somatic hypermutation, which were subjected pairs, potentially increases the apparent affinity of binding compared with arbitrary combinations of these variable regions.

d. Comparison of sequences of TT-specific combinatorial clones of phage particles and clones related pairs

A large amount of sequence data obtained from the two libraries, prevents direct comparison of raw sequences. To visualize the differences between pairs of VNand VLsequences in the display on the phage library and in the library of cognate pairs were reconstructed phylogenetic tree for VNand VLsequences, and a couple were illustrated in the form of a dot matrix. Pairwise comparison of phylogenetic information in a scatter matrix (Fig) has revealed a very different distribution profiles of pairs of VNand VL-sequences in the two libraries. Diffuse image pairs VNand VLsequences in the display on the phage library (figa) testified small phylogenetic relationship between the VNand VLgenes, which is consistent with random mating V-genes in the library. In contrast, a pair of VNand VLsequences from a library of cognate pairs (pigv) are clustered image, indicating co-evolution V-genes expected for related pairs. In addition, genetic diversity is much greater for V-gene library related pairs compared to the V-genes of combinatorial libraries, indicating that the allocation of related paired V-genes is less erroneous.

Example 14. The combined response of single-stage multiple RT-PCR with lengthening the chain by overlapping and nested PCR using T cells as the source matrix

This example describes how to perform one-stage multiple RT-PCR with lengthening the chain by overlapping with the use of T-lymphocytes person.

A. Getting lymphocytopenia fraction of cells

A sample of blood obtained from the donor, is subjected to the desired antigen, for example, immunization, natural infection, neoplasia, autoimmune reactions Il the other diseases. Mononuclear cells from peripheral blood (RVMS) allocate the device Lymphoprep (Axis-Shield, Oslo, Norway, production No. 1001967) according to the manufacturer's instructions.

In this example, the antigen-specific T cells were obtained by further stimulation faction RVMS. However, multiple RT-PCR with lengthening the chain by overlapping can also be done using separate cells from the faction RVMS or fractions of cells enriched T-cells (for example, by sorting by FACS method for CD3-positive cells).

b. The establishment of antigen-specific T cells

The fraction of cells RVMS again suspended in an appropriate culture medium containing the necessary sitecity, such as IL2. Then add to the culture to a desired antigen, where the antigen-presenting cells (APC)present in a fraction RVMS, represent it to the T-cells. Alternative to faction RWMS can be added ARS-supply cells pre-treated with presentation of the desired antigen. Such ARS-supply cells can be ARS subjected to a desired antigen, for example, in the form of a peptide, protein or other molecules, ARS infected with microbes, cells, transfected for the expression and presentation of antigen, or ARS, coculture with other EN igennem cells, for example, cancer cells in the form of primary tissue or cell lines. In the literature many different types of ARS-feeder cells, including lines of transformed cell lines of b-cells, dendritic cells, etc.

Fraction RVMS cultured for approximately 3-5 weeks, during which adds fresh antigen-presenting cells with cytokines, for example, once a week. This results in the proliferation, activation and maturation of T-lymphocytes. At the end of cultivation in cell culture dominated by antigen-specific T cells. Whether these cells are CD4+ or CD8+ cells, depends on the disease, antigen, cell ARS and mixtures of cytokines used during stimulation.

Antigenic specificity can be checked, for example, by analyzing CTL assays proliferation and MHC tetramers, sensitised desired antigen (Altman, J.D. et al., 1996, Science 274, 94-96).

Antigen-specific T cells was dispensed into test tubes for PCR by the method of limited cultivation or FACS, while receiving one cell in a single vessel. The vessel can be stored at -80°C until use.

b. Single-stage multiple RT-PCR with lengthening the chain by overlapping

To perform multiple RT-PCR with lengthening the chain by overlapping use the set for one-step RT-CR company Qiagen (Qiagen, catalog No. 210212, Hilden, Germany) according to the manufacturer's recommendations. Before adding the reaction mixture PCR tubes PCR cells thawed.

The reaction mixture CR and conditions of the cyclization of the initially determined in accordance with the description given in example 11 e-1. However, when using a new set of primers may require some optimization conditions.

Used a mixture of multiple primers for elongation of the chain by overlapping includes primers, shown in table 26.

Table 26
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
10 nm of each322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
200 nm351
10 nm of each352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
200 nm375

C. Palugaswewa PCR

Palugaswewa PCR can be performed in accordance with the description given in example 11 e-2, this may require some optimization conditions.

Table 27
Name of primerConcentrationSEQ ID NOThe sequence of the primer from the 5'-end to 3'-end
200 nm376
200 nm377
The sequence designated by the capital letters correspond to the gene-specific region.

To verify the successful execution of multiple RT-PCR with lengthening the chain by overlapping a part of the samples from the reaction mixtures palugaswewa CR analyze, subjecting 10 μl of each reaction mixture palugaswewa PCR electrophoresis in 1% agarose gel using for detection of ethidium bromide. The expected fragment size of chain elongation by overlapping of approximately 850 BP (the exact size depends on the length variable regions).

About ten microlitres from all reaction mixtures obtained from a single donor, combined into one test tube. An aliquot of pooled PCR products are then cleaned using the cleaning kit QIAquick PCR according to the manufacturer's instructions (Qiagen, catalog No. 28106, Hilden, Germany). Purified pooled PCR products with lengthening the chain by overlapping can be hydrolyzed with appropriate restriction enzymes, purified and put into an acceptable vector.

In this experiment, the primers for the constant region (SEQ ID NO 376 and 377)used in the step is lunesdale PCR, create for sublimirovanny product palugaswewa PCR acceptable vector. When creating a primer for β-chain residue SER is replaced by a Met residue at position 21 of the peptide constant region, β-chain, resulting in the sequence of the nucleic acid can enter the NsiI site:

This transition should be relatively safe, as SER 21 is located in the constant region of the β-chain in the loop at the proximal end of the membrane domain. So the above relatively conservative replacement, apparently, will not disturb the overall structure of the domain.

When creating a primer for α-chain substituted nucleotides corresponding to positions 15-17 in peptide constant region α-chain, resulting in a sequence of nucleic acids it is possible to introduce a SacI site:

Therefore, acceptable vectors contain the remaining parts of the constant regions of α - and β-chains of the TcR and include the appropriate modification of the restriction sites. These substitutions can be made by standard methods CR and sublimirovanny.

E. Additional considerations

Many of the primers for the variable regions can potentially interact with each other with providing inhibitory effect during amplification method multiple CR with lengthening the chain by perekryvaniya order to avoid this, the primers for the variable regions can be divided into subsets and used separately in respective combinations.

Other embodiments of the invention

All publications and patent applications cited in this description of the invention included in this application by reference as if each individual publication or patent application were put in as a reference. Although the present invention has been described in detail on the example of various illustrative embodiments for ease of understanding, professionals in this field must be understood in light of the above description that this invention can be made certain changes or modifications not beyond the extent and nature of the attached claims.

1. Method of bonding a variety of interesting non-contiguous nucleotide sequences, which provides:
a) amplification of nucleotide sequences of interest using multiple molecular amplification using matrix obtained from separate cells; and
b) binding of nucleotide sequences of interest, amplified in stage a);
in which the interest of the nucleotide sequence containing the sequence encoding the variable region, and the binding is formed of a related pair of sequences encoding variable regions.

2. With whom persons according to claim 1, in which the interest of the nucleotide sequence containing the sequence encoding the variable region of the immunoglobulin, and the binding is formed sibling pair, consisting of a sequence that encodes a variable region light chain, and the associated sequence that encodes a variable region of the heavy chain.

3. The method according to claim 1, in which the interest of the nucleotide sequence containing the sequence encoding the variable region of the T-cell receptor, and the binding is formed sibling pair, consisting of a sequence that encodes a variable region of the alpha chain, and the associated sequence that encodes a variable region of the beta chain, or sequence that encodes a variable region of the gamma chain, and the associated sequence that encodes a variable region of the Delta chain.

4. The method according to claim 1, in which the family of the nucleotide sequence containing the sequence encoding the variable region amplified using the set of primers.

5. The method according to claim 1, in which the specified multiple molecular amplification is an amplification method multiple RT-PCR.

6. The method according to claim 5, in which the specified amplification method multiple RT-PCR assessedusing process providing a separate stage of reverse transcription (RT)pre-amplification method multiple PCR.

7. The method according to claim 5, in which the specified amplification method multiple RT-PCR is performed in a single stage, providing an initial introduction to one vessel all components necessary to perform as reverse transcription (RT)and amplification by a method of multiple PCR.

8. The method according to claim 1, in which a single cell or a population of genetically different cells obtained from the fraction of cells containing lymphocytes.

9. The method according to claim 8, in which the fraction of cells containing lymphocytes, part of the whole blood, bone marrow, mononuclear cells, or leukocytes.

10. The method according to claim 9, in which the fraction of cells containing lymphocytes enriched in cells b-lymphocytes.

11. The method according to claim 10, in which the fraction of cells containing lymphocytes, or the line b-lymphocytes enriched plasma cells.

12. The method according to claim 8, in which the cells of the fraction of cells containing lymphocytes, line b-lymphocytes or plasma cells have a high antigenic specificity.

13. The method according to claim 8, in which the fraction of cells containing lymphocytes enriched cells T-lymphocytes.

14. The method according to claim 8, in which antigen-specific T cells produced by stimulation of the fraction of cells that contains Asa lymphocytes.

15. The method according to claim 8, which additionally provides an introduction to vector corresponding nucleotide sequences or related a couple from the library.

16. The method according to claim 8, in which before the execution stage of reverse transcription and multiple molecular amplification due to the intensive division of each separate cells are isogenic population of cells.

17. The method according to claim 1, in which the indicated binding of nucleotide sequences of interest is performed in the same vessel that multiple molecular amplification.

18. The method according to any of pp.5-17, in which the indicated binding of nucleotide sequences of interest perform together with the amplification method of multiple PCR using a mixture of multiple primers for elongation of the chain by overlapping.

19. The method according to any of pp.5-17, in which the indicated binding of nucleotide sequences of interest is performed by ligating.

20. The method according to claim 1, in which perform additional molecular amplification using a mixture of primers adapted to amplify interest related sequences of nucleic acids.

21. The method according to p, in which a mixture of multiple primers for elongation of the chain by overlapping contains sets of primers, in which at m is re one of the primer set contains end sequence for chain elongation due to overlapping, can hybridisierung with end sequence for chain elongation due to overlapping primer of the second primer set.

22. The method according to p, in which a mixture of multiple primers for elongation of the chain by overlapping includes:
a) at least one primer for CLor JLcomplementary sense sequence that encodes a variable region light chain immunoglobulin;
b) at least one 5'-terminal primer for VLor primer for VLLcomplementary antisense sequence that encodes a variable region of the light chain of the immunoglobulin, or a leader sequence of the variable region of the light chain, and capable of forming a primer set with the primer(s) for paragraph (a);
c) at least one primer for CHor JHcomplementary sense sequence encoding the constant domain of the heavy chain of the immunoglobulin, or a sequence that encodes a connecting region of the heavy chain; and
d) at least one 5'-terminal primer for VHor primer for VHLcomplementary antisense chain sequence that encodes a variable region of the heavy chain of the immunoglobulin, or a leader sequence of the variable region of the heavy chain, and capable of forming a primer set with what Rimera(AMI) in paragraph (C).

23. The method according to item 22, in which the primers in paragraph (b) are primers for VLL, wherein the sequence is at least 90% identical to the sequence of the gene-specific region selected from SEQ ID NO: 93-98, and primers according to paragraph (d) are primers for VHL, wherein the sequence is at least 90% identical to the sequence of the gene-specific region selected from SEQ ID NO: 86-92.

24. A method of creating a library of cognate pairs that contain related sequences encoding the variable regions, and these sequences encoding the variable regions are sequences of the immunoglobulin superfamily, and the method includes:
a) obtaining from a donor fraction of cells containing lymphocytes;
b) optional enrichment of specific populations of lymphocytes specified fraction of cells;
c) obtaining a population of separate cells, providing for the distribution of one cell from a specified fraction of cells in several vessels; and
d) amplification and binding sequences encoding variable regions located at the specified separate populations of cells, the method according to any one of claims 1 to 24.

25. The method according to paragraph 24, in which prior to performing the amplification and binding (stage d) C is the intensive division of each separate cells are isogenic population of cells.

26. The method according to paragraph 24, in which the fraction of cells containing lymphocytes, part of the whole blood, bone marrow, mononuclear cells, or leukocytes.

27. The method according to p, in which the fraction of cells containing lymphocytes enriched in cells b-lymphocytes.

28. The method according to item 27, in which the fraction of cells containing lymphocytes, or the line b-lymphocytes enriched plasma cells.

29. The method according to paragraph 24, in which the cells of the fraction of cells containing lymphocytes, line b-lymphocytes or plasma cells have a high antigenic specificity.

30. The method according to paragraph 24, in which the fraction of cells containing lymphocytes enriched cells T-lymphocytes.

31. The method according to paragraph 24, in which antigen-specific T cells produced by stimulation of the fraction of cells containing lymphocytes.

32. The method according to paragraph 24, which additionally provides an introduction to vector corresponding nucleotide sequences or related a couple from the library.

33. The method according to p, wherein said vector is selected from the cloning vectors, Shuttle vectors, vector display or expression vectors.

34. The method according to p where related nucleotide sequences or individual members of the library of cognate pairs are sequences encoding the variable region of the heavy chain immunoglobulin is, associated with the sequences encoding the variable region of light chain, and the above sequence is injected with the preservation of the reading frame in the vector already containing sequences encoding one or more constant domains of immunoglobulins or their fragments.

35. The method according to p where related nucleotide sequences or individual members of the library of cognate pairs are sequences encoding the variable region α-chain T-cell receptor, related sequence encoding the variable region of the β-chain, and the above sequence is injected with the preservation of the reading frame in the vector already containing sequences encoding one or more constant domains of T-cell receptor or its fragments.

36. The method according to paragraph 24, which additionally provides for the creation of medbibliotekoy by selecting subsets of related pairs of related sequences of the variable regions encoding binding proteins with specificity for a desired target, with the formation of a library of target-specific related pairs of sequences encoding variable regions.

37. The method according to any of PP-36, which additionally provides for the transfer of the specified sibling pairs or library mi is the tier-specific related pairs of sequences, encoding the variable region in the expression vector mammal.

38. The method according to clause 37, in which the expression vector mammalian encodes one or more domains of the constant region selected from a human immunoglobulin classes, IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4, IgM, Kappa light chain or lambda light-chain or from alpha-, beta-, Delta - and/or gamma-chain T-cell receptor of a person.

39. The method according to p, which additionally provides the stage:
a) introducing a vector encoding the segment corresponding nucleotide sequence in the cell-host;
b) culturing the above host cells under conditions adapted for expression; and
c) obtaining the protein product expressed by the vector entered in the specified cell of the host.

40. The method according to § 39, wherein said protein is a monoclonal antibody containing a cognate pair of variable region of the light chain and the variable region of the heavy chain.

41. The method according to § 39, wherein said polypeptide product is a monoclonal T-cell receptor containing a cognate pair of variable region of the alpha chain and the variable region of the beta chain.

42. The library of cognate pairs consisting of corresponding sequences encoding variable regions, in which the specified sequence, to droushia variable regions, are the sequences of the immunoglobulin superfamily, where each sibling pair is embedded in a vector that can Express the specified sibling pair.

43. Library § 42, in which these related pairs of sequences encoding variable regions, get the method according to paragraph 24.

44. Library § 42 or 43, in which the individual representative of these sibling pairs contains the sequence encoding the variable region of the light chain of the immunoglobulin, and an associated sequence encoding the variable region of the heavy chain.

45. Library item 44, in which the specified individual representative encodes a full-sized antibody selected from a human immunoglobulins of class IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4 or IgM.

46. The library of cognate pairs of § 42 or 43, in which the individual representative of these sibling pairs contains the sequence encoding the variable region of the alpha chain of the TcR and its associated sequence encoding the variable region of the beta chain, or a sequence encoding a variable region of the gamma chain, and an associated sequence encoding the variable region of the Delta chain.

47. Library § 46, in which the specified individual representative encodes full-TcR.

48. Library related the s pairs of related sequences, encoding variable regions, according to any one of p-47, in which each individual representative selected based on its ability to encode a protein having a desired binding specificity for a particular target.

49. The library of cognate pairs of item 44, in which the antibodies expressed from a specified library, able to interact or communicate with tetanus toxin.

50. The population of host cells containing the library or abilitec on any of PP-49, where the population of host cells is designed for the expression of recombinant polyclonal binding protein.

51. The population of host cells according to item 50, in which the cells are mammalian cells.



 

Same patents:

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, specifically obtaining hemopoietic cells from blood, and may be used in medicine. The homopoietic cell CD34+ is extracted from peripheral blood of cancer patients undergone a growth factor treatment course. The obtained cell is transduced by a ligand which induces apoptosis with participation of the tumour necrosis factor, and is used to treat tumours.

EFFECT: invention enables to obtain a hemopoietic cell CD34+ which has anti-tumuor activity.

6 cl, 3 dwg, 8 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, particularly to a method of treating ophthalmopathies. The method of treating an ophthalmopathy in a mammal by recovery from mammal's bone marrow of a population of haematopoietic stem cells of a negative lineage which includes precursor endotheliocytes, transfection of the prepared population with a gene which functionally codes a fragment of antiangiogenic protein T2 of human tryptophanyl-tRNA-synthetase, and the following introduction in a vitreous body of the population of transfected cells in amount sufficient for symptomatic relief. The method of transgene delivery in a retinal vasculature of the mammal by introducing in the mammal's vitreous body of the population of haematopoietic stem cells of the negative lineage including precursor endotheliocytes where the cells are transfected with the antiangiogenic fragment of protein T2 of human tryptophanyl-tRNA-synthetase.

EFFECT: method of treating the ophthalmopathy is novel and highly effective.

2 cl, 27 dwg, 2 tbl, 10 ex

FIELD: agriculture.

SUBSTANCE: invention includes compositions, methods and cell lines related to insect control. Substance of invention includes compositions that contains vegetable essences purposely acting at least at one receptor of insects selected from the following - tyramine receptor , olfactory receptor Or83b or olfactory receptor Or43a, as a result of which intracellular levels cAMP, Ca+2 or both vary in insects. Also invention includes method of insect control, line of insects cells including sequence of nucleic acid of above mentioned receptors and methods for selection of composition by activity in respect to insects with application of specified line of insect cells.

EFFECT: development of softer sparing compositions that are not toxic for mammals and other types.

20 cl, 34 dwg, 1 tbl, 33 ex

FIELD: food industry.

SUBSTANCE: strain Streptococcus thermophilus which produces lactic acid is described. Sequence of nucleic acids made of the strain producing polysaccharides are also described as well as food or pharmaceutical composition and milk product containing such strain.

EFFECT: strain has strong structural properties.

16 cl, 4 dwg, 6 tbl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: this invention is related to the field of biotechnology and may be used in production of various protein products with the help of recombinant DNA technology. New sequences of DNA are defined and generated, which are related to matrix attachment region, which are characterised by ability to improve producing of protein in eukaryotic cells.

EFFECT: methods are suggested for transfection of eukaryotic master cells, including new method of multiple transfection, based on use of active sequenes of DNA MAR according to invention and providing for substantial increase of recombinant protein expression level compared to similar cells transfected by traditional methods.

11 cl, 21 dwg, 9 tbl, 17 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of genetic engineering and medicine. Described is animal, non-human, having sequence of nucleic acid encoding presenilin 1, carrying mutations, corresponding to M233T and L235P mutations in PS1 protein of mouse. Animal also contains sequence of nucleic acid, encoding whole gene or part of gene, encoding APP. APP protein represents APP751, originates from human and carries mutations Swedish and London. Animal is intended for application in fight against Alzheimer's disease. Also described are PS1 protein and encoding it nucleic acid.

EFFECT: invention can be used in medicine for discovering compounds intended for Alzheimer's disease treatment.

20 cl, 50 dwg, 1 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: vitamin K dependent protein is made by separating a cultivated eukaryotic cell that contains an expressing vector that contains a nucleic acid molecule coding vitamin K dependent protein and associated sequences regulating expression. The associated sequences contain the first promoter and the nucleic acid molecule coding gamma-glutamylcarboxylase, and the second promoter. The first promoter represents a pre-early promoter of human cytomegalovirus (hCMV), and the second promoter is a pre-early promoter SV40. Herewith the expressing relation of vitamin K dependent protein and gamma-glutamylcarboxylase is 10:1 to 250:1.

EFFECT: invention allows for making gamma-carboxylated vitamin K dependent protein in production quantities.

29 cl, 5 dwg, 6 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention claims synthetic DNS molecule encoding L1 HPV58 protein, where codons are optimised for high expression level in yeast cell. Also invention claims expression vector, yeast host cell, HPV58 virus-like particle and method of its obtainment, and pharmaceutical composition including such VLP.

EFFECT: invention can be applied in medicine for efficient immune prevention of papillomavirus infection by neutralising antibodies and cell-mediated immunity, and for treatment of developed HPV infections.

10 cl, 10 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: dendritic cells presenting hepatitis B antigen are separated from peripheral blood of patients suffering from chronic hepatitis B virus and cultivated nonadherent fraction of mononuclear cells with proinflammatory cytokine "рчИЛ"-18 added.

EFFECT: invention allows generating cells with high cytotoxic potential with respect to the hepatitis B infected cells.

3 tbl

FIELD: biotechnologies.

SUBSTANCE: invention relates to field of biotechnology, namely, to obtaining genetically modified cell lines and can be applied in medicine for immunotherapy and immuno-prophylaxis in patients with malignant neoplasms. By means of recombinant method line of cells of human melanoma KG is obtained, which secretes recombinant granulocytic-macrofagal colony-stimulating human factor. Obtained line is deposited with Specialised cell culture collection of vertebrates of Russian cell culture collection under number RCCC ("П") 699"Д".

EFFECT: line of human melanoma cells KG possesses stable cultural, morphological and immunological characteristics and possesses ability to secrete recombinant human GM-CSF, remaining after cell inactivation with ionising irradiation.

FIELD: medicine.

SUBSTANCE: there are offered versions of human IL-13 antibodies, including based on CDR antibody BAK278D6. There is described a based composition, and also isolated nucleic acid, a host cell for preparing antibodies and versions of the method for preparing antibodies. There is disclosed application of antibodies for preparing a drug and a composition for treating various diseases mediated by IL-13 activity. Application of the invention provides antibodies neutralising IL-13.

EFFECT: applicable in medicine for preparing a vaccine.

52 cl, 32 dwg, 7 tbl, 29 ex

FIELD: chemistry.

SUBSTANCE: invention relates to immunology and biotechnology. Described are versions of the humanised antibody CD45RO/RB which carry a light and a heavy strand. Versions of the following are disclosed: isolated polynucleotide, coding antibody, expression vector containing a polynucleotide and host cells containing the expression vector. Described also is use of the antibody to treat and/or prevent various diseases, including as a component of a pharmaceutical composition.

EFFECT: invention provides antibodies identified as CD45RO and CD45RB, which can find use in medicine.

9 cl, 14 dwg, 2 tbl, 13 ex

FIELD: chemistry.

SUBSTANCE: invention relates to humanised anti-TGF-beta-antibody which is linked to TGF-beta. The humanised antibody has a variable domain VH which contains residues of the hypervariable region (non-human), which are contained in the human domain VH which includes a modified framework region (FR) (amino acid and nucleotide sequences are given in the list of sequences). The humanised antibody can contain residues of the complementarity determining region (CDR) of the variable domain of the light strand VL. The invention also relates to a composition for treating TGF-beta mediated disorders, e.g. malignant tumours, nucleic acid, coding monoclonal antibody, and a method of obtaining the latter using host cells. The invention provides a method of treating and detecting TGF-beta in a sample from the body using the disclosed antibody, as well as to a product which contains the humanised antibody and directions for use for treating TGF-beta mediated disorders.

EFFECT: invention enables control of TGF-beta molecules, which can prevent possible changes in antibodies, enables preparation of high-affinity humanised antibodies which act as TGF-beta antagonists.

57 cl, 45 dwg, 4 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: there is offered a monoclonal antibody specific to human interleukine-4 (hIL-4) containing two domains with the related CDR1-3 region. There are described versions thereof that contain specified CDR, polynucleotide coding said antibody. There are described an expression vector and a host-cell for preparing the antibody to human interleukine-4 (hIL-4). There are opened: application of the antibody for preparing a pharmaceutical agent for treating the diseases mediated by interleukine-4 and/or IgE. There is discovered the pharmaceutical composition for treating the diseases mediated by interleukine-4 and/or IgE is opened.

EFFECT: application of the invention ensured the high-affinity neutralised monoclonal antibodies to human interleukine-4.

14 cl, 1 tbl, 6 ex

FIELD: pharmacology.

SUBSTANCE: present invention refers to immunology and biotechnology. There are antibody-antagonist to CD40 with their variable areas derived from an antibody produced of hybridoma 4D11 (FERM BP-7758). The constant areas of antibodies are derived from human IgG4 with mutations S228P and L235E. There are described related coding polynucleotides and the based expression vector. There is disclosed host-cell containing said vector. There is described method for preparing monoclonal antibody and application thereof in the pharmaceutical composition.

EFFECT: application of the invention provides reduced ADCC and CDC activity that can find application in therapy of autoimmune diseases and graft rejection.

10 cl, 26 dwg, 2 tbl, 22 ex

FIELD: pharmacology.

SUBSTANCE: invention concerns immunology and biotechnology. There is offered human monoclonal antibody specific to TNF-alpha containing light and heavy chain with appropriate CDR3 sites. There are described versions thereof including those based on heavy and light chains and coded by human genes VH3-33 and A30VK1 or VH3-53 and L2VK3 respectively. There are disclosed: the method for estimating the TNF-alpha content in the patient's sample with using specified antibodies, and application of antibodies for preparing a medical product. There are described: compositions for diagnostics and treatment of the conditions associated with TNF-alpha activity on the basis of antibodies. There is disclosed coding nucleic acid, a cell for making said antibodies and the method for making said antibodies.

EFFECT: application of the invention ensured high-affinity neutralizing monoclonal antibodies with improved Kd and IC50 in comparison with Infliximab, Adalimumab or Etanercept that can find application in medicine for treatment and diagnostics of the diseases associated with TNF-alpha hyperactivity.

35 cl, 13 dwg, 36 tbl, 14 ex

FIELD: medicine.

SUBSTANCE: human antibodies or their antigen-binding fragments are fully described, which specifically bind to human 4-1BB, and which provide for binding of human 4-1BB to human 4-1BB ligand. Antibody includes variable areas of light and heavy chains with amino-acid sequence, given in formula, and may in one of aspects represent IgG4 antibody. Invention presents polynucleotides, which code amino-acid sequences of heavy chain and light chain of monoclonal antibody. Pharmaceutical compositions are described for cancer treatment on the basis of monoclonal antibody or its fragment and method for treatment of disease in subject, which consists in introduction of therapeutically efficient amount of antibody to this subject.

EFFECT: antibodies of invention have agonistic activity and may be used for treatment or prevention of human diseases, such as cancer, infectious and autoimmune diseases.

10 cl, 24 dwg, 1 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: proposed is a recombinant single-strand trispecific antibody for treating tumours which express CEA. The said antibody consists of a series of three antibody fragments: anti-CEA-scFv, anti-CD3-scFv and VH CD28-antibody, linked by two intermediate linkers (intermediate linker Fc and intermediate linker HSA). If necessary, a c-myc-mark or (His)6-mark can be added at the C-end. Described is DNA, which codes the antibody, expression vector based on it and E.coli cell, containing the vector.

EFFECT: use of the invention is more beneficial in clinical use compared to bispecific antibodies and known trispecific antibodies, makes easier clearing and expression of an antibody, which can further be used in treating CEA-mediated tumours.

10 cl, 21 dwg, 11 ex

FIELD: chemistry, medicine.

SUBSTANCE: novel antibodies and fragments of human antibodies are bound with GDF-8 in a specific way and inhibit its activity in vitro and/or in vivo. On the basis of said invention pharmaceutical composition is created, which can be used for diagnostics, prevention or treatment of degenerative dysfunctions of muscle or bone or disorders of insulin metabolism.

EFFECT: extending range of arsenal of technical means used in treatment of diseases related to muscular, bone tissue or insulin metabolism.

FIELD: medicine.

SUBSTANCE: polypeptides include single-domain antibody against vWF, A1 domain of vWF, A1 domain of activated vWF, A3 domain of vWF, gp1b and/or collagen. Invention claims methods of obtaining indicated polypeptides, methods of coating devices applied in medical practice (e.g. in X-ray structural analysis, endoprosthetics) with indicated polypeptides.

EFFECT: obtainment of polypeptides for treatment of diseases requiring modulation of thrombocyte-mediated aggregation.

40 cl, 69 ex, 30 dwg, 32 tbl

FIELD: agriculture.

SUBSTANCE: at stage of vegetable samples' homogenisation hydroxy derived from benzoic acid is added to a lytic buffer in amount of 20-30 mg for a sample. The lytic buffer contains 4 mg guanidine hydrochloride, 0.2 M sodium acetate, 25 mM EDTA , 2.5% kollidon, 20% sarcosyl.

EFFECT: efficiency upgrading RNA's educing, more successful PCR's process and revealing of viruses in vegetable sphere.

2 dwg, 2 tbl, 2 ex

Up!